rna levels  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Thermo Fisher rna levels
    Validation of other SRSF3-responsive <t>RNA</t> splicing events identified by ANOVA analysis. Following transfection of U2OS or HeLa cells with Dharmacon si-NS or si-SRSF3 twice in an interval of 48 h, total RNA from the cells was analyzed by <t>RT-PCR</t> for exon skipping of CHK1 exon 3 ( A ), SMC2 exon 3–4 ( B ), CKLF exon 3 ( C ), MAP4 exon 10 ( D ), MBNL1 exon 4 ( E ), MELK exon 11 ( F ), DDX5 exon 12 ( G ) and PABPC1 exon 10–11 ( H ). See other details in Figure 3 .
    Rna Levels, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna levels/product/Thermo Fisher
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rna levels - by Bioz Stars, 2020-01
    89/100 stars

    Images

    1) Product Images from "A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells"

    Article Title: A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv1500

    Validation of other SRSF3-responsive RNA splicing events identified by ANOVA analysis. Following transfection of U2OS or HeLa cells with Dharmacon si-NS or si-SRSF3 twice in an interval of 48 h, total RNA from the cells was analyzed by RT-PCR for exon skipping of CHK1 exon 3 ( A ), SMC2 exon 3–4 ( B ), CKLF exon 3 ( C ), MAP4 exon 10 ( D ), MBNL1 exon 4 ( E ), MELK exon 11 ( F ), DDX5 exon 12 ( G ) and PABPC1 exon 10–11 ( H ). See other details in Figure 3 .
    Figure Legend Snippet: Validation of other SRSF3-responsive RNA splicing events identified by ANOVA analysis. Following transfection of U2OS or HeLa cells with Dharmacon si-NS or si-SRSF3 twice in an interval of 48 h, total RNA from the cells was analyzed by RT-PCR for exon skipping of CHK1 exon 3 ( A ), SMC2 exon 3–4 ( B ), CKLF exon 3 ( C ), MAP4 exon 10 ( D ), MBNL1 exon 4 ( E ), MELK exon 11 ( F ), DDX5 exon 12 ( G ) and PABPC1 exon 10–11 ( H ). See other details in Figure 3 .

    Techniques Used: Transfection, Reverse Transcription Polymerase Chain Reaction

    Validation of the SRSF3-responsive events identified by B/E ratio analysis. U2OS and HeLa cells were transfected with Dharmacon si-NS or si-SRSF3 twice in an interval of 48 h. Total RNA from the cells were analyzed by RT-PCR to validate transcript level change of ERRFI1 ( A ), ANXA1 ( B ) and TGFB2 ( C ), splicing alteration of PUS3 alternative 5′ ss usage in the exon 3 ( D ), and exon skipping of the PKP4 exon 7 ( E ), KIF23 exon 18 ( F ), EP300 exon 14 ( G ) and CLINT1 exon 11 ( H ). The primers used in RT-PCR are shown as bars above (forward primers) and below (reverse primers) each RNA splicing diagram. GAPDH served as a loading control. RT+, reaction with reverse transcriptase; RT−, reaction without reverse transcriptase; si-SRSF3 Amb , si-SRSF3 from Ambion; FC, fold-change; PSI, percent spliced-in of the alternative exon(s) or splice site (% inclusion = inclusion/sum of inclusion + exclusion).
    Figure Legend Snippet: Validation of the SRSF3-responsive events identified by B/E ratio analysis. U2OS and HeLa cells were transfected with Dharmacon si-NS or si-SRSF3 twice in an interval of 48 h. Total RNA from the cells were analyzed by RT-PCR to validate transcript level change of ERRFI1 ( A ), ANXA1 ( B ) and TGFB2 ( C ), splicing alteration of PUS3 alternative 5′ ss usage in the exon 3 ( D ), and exon skipping of the PKP4 exon 7 ( E ), KIF23 exon 18 ( F ), EP300 exon 14 ( G ) and CLINT1 exon 11 ( H ). The primers used in RT-PCR are shown as bars above (forward primers) and below (reverse primers) each RNA splicing diagram. GAPDH served as a loading control. RT+, reaction with reverse transcriptase; RT−, reaction without reverse transcriptase; si-SRSF3 Amb , si-SRSF3 from Ambion; FC, fold-change; PSI, percent spliced-in of the alternative exon(s) or splice site (% inclusion = inclusion/sum of inclusion + exclusion).

    Techniques Used: Transfection, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry

    SRSF3 and SRSF1 are mutually regulated in cells. ( A ) SRSF3 knockdown in HeLa cells activates the usage of a cryptic intron in the SRSF1 exon 4. HeLa cells were transfected with Dharmacon si-NS or si-SRSF3 as described in Figure 4 and total RNA from the cells was analyzed by RT-PCR for activation of a cryptic intron (dark box) in the SRSF1 3′ UTR. ( B ) Knocking down SRSF1 expression in HeLa cells affects SRSF3 transcript level, but not inclusion or skipping of the SRSF3 exon 4. Knockdown of SRSF1 expression in HeLa cells was performed as described in Figure 4 . See other details in Figure 3 . ( C ) Knocking down SRSF1 expression in HeLa cells does not affect SRSF3 RNA stability in a pause-chase RNA decay assay. Following 10 μg/ml actinomycin D treatment for 0, 1, 2, 4 and 8 h, HeLa cells with Dharmacon si-NS or si-SRSF1 knockdown as described in Figure 4 were examined for the quantitative levels of the exon 4-skipped SRSF3 RNA and GAPDH RNA at each time point by quantitative RT-qPCR. After normalizing to GAPDH RNA, the exon 4-skipped SRSF3 RNA decay rate was calculated by setting the RNA levels at 0 h as 100% for both si-NS and si-SRSF1 groups. Exponential fitting curves over each time point are determined as y = e −0.185x , R 2 = 0.8739 for si-NS group and y = e −0.201x , R 2 = 0.9819 for si-SRSF1 group. Half-life (t 1/2 ) of the exon 4-skipped SRSF3 RNA was calculated as 3.8 h for si-NS transfected cells, and 3.5 h for si-SRSF1 transfected cells. ( D ) Expression of SRSF3 and SRSF1 is mutually regulated each other. HeLa or U2OS cells were transfected with Dharmacon si-NS, si-SRSF1, or si-SRSF3 twice with an interval of 48 h, and analyzed by Western blot for the corresponding protein expression by using an anti-SRSF1 or anti-SRSF3 antibody. ( E ) Overexpression of T7-SRSF3 increases the expression of SRSF1 in MEF3T3 cells revealed by Western blot.
    Figure Legend Snippet: SRSF3 and SRSF1 are mutually regulated in cells. ( A ) SRSF3 knockdown in HeLa cells activates the usage of a cryptic intron in the SRSF1 exon 4. HeLa cells were transfected with Dharmacon si-NS or si-SRSF3 as described in Figure 4 and total RNA from the cells was analyzed by RT-PCR for activation of a cryptic intron (dark box) in the SRSF1 3′ UTR. ( B ) Knocking down SRSF1 expression in HeLa cells affects SRSF3 transcript level, but not inclusion or skipping of the SRSF3 exon 4. Knockdown of SRSF1 expression in HeLa cells was performed as described in Figure 4 . See other details in Figure 3 . ( C ) Knocking down SRSF1 expression in HeLa cells does not affect SRSF3 RNA stability in a pause-chase RNA decay assay. Following 10 μg/ml actinomycin D treatment for 0, 1, 2, 4 and 8 h, HeLa cells with Dharmacon si-NS or si-SRSF1 knockdown as described in Figure 4 were examined for the quantitative levels of the exon 4-skipped SRSF3 RNA and GAPDH RNA at each time point by quantitative RT-qPCR. After normalizing to GAPDH RNA, the exon 4-skipped SRSF3 RNA decay rate was calculated by setting the RNA levels at 0 h as 100% for both si-NS and si-SRSF1 groups. Exponential fitting curves over each time point are determined as y = e −0.185x , R 2 = 0.8739 for si-NS group and y = e −0.201x , R 2 = 0.9819 for si-SRSF1 group. Half-life (t 1/2 ) of the exon 4-skipped SRSF3 RNA was calculated as 3.8 h for si-NS transfected cells, and 3.5 h for si-SRSF1 transfected cells. ( D ) Expression of SRSF3 and SRSF1 is mutually regulated each other. HeLa or U2OS cells were transfected with Dharmacon si-NS, si-SRSF1, or si-SRSF3 twice with an interval of 48 h, and analyzed by Western blot for the corresponding protein expression by using an anti-SRSF1 or anti-SRSF3 antibody. ( E ) Overexpression of T7-SRSF3 increases the expression of SRSF1 in MEF3T3 cells revealed by Western blot.

    Techniques Used: Transfection, Reverse Transcription Polymerase Chain Reaction, Activation Assay, Expressing, Quantitative RT-PCR, Western Blot, Over Expression

    SRSF3 promotes inclusion of the EP300 exon 14 through an exonic SRSF3-binding site. ( A ) Diagram of EP300 minigene structure and exon 14 mutants containing detection (Δ1, Δ2, Δ3 and Δ4) of a 6-nt, putative SRSF3-binding motif. Red boxes a, b, c and d indicate individual putative SRSF3-binding motif. The EP300 minigene has a 623-bp deletion in the intron 14 indicated by a vertical line. P CMV IE , cytomegalovirus immediate early promoter; pA SV40 , SV40 polyadenylation signal. ( B and C ) Deletion of a putative SRSF3-binding motif increases skipping of the EP300 exon 14. HeLa cells were transfected with individual EP300 minigenes or a parental vector pEGFP-N1 for 24 h, and skipping of the minigene exon 14 was determined by RT-PCR with a primer set for EP300 exon 13 (F 13 , forward primer) and vector sequence (R vec , reverse primer, diagrammed on the right). GAPDH RNA served as a loading control. RT-PCR products were resolved by gel electrophoresis, the band intensity was measured, and after normalizing to GAPDH RNA, a skipping rate (%) of the EP300 exon 14 was calculated. Shown in bar graphs (C) are means ± SD from two separate experiments. * P
    Figure Legend Snippet: SRSF3 promotes inclusion of the EP300 exon 14 through an exonic SRSF3-binding site. ( A ) Diagram of EP300 minigene structure and exon 14 mutants containing detection (Δ1, Δ2, Δ3 and Δ4) of a 6-nt, putative SRSF3-binding motif. Red boxes a, b, c and d indicate individual putative SRSF3-binding motif. The EP300 minigene has a 623-bp deletion in the intron 14 indicated by a vertical line. P CMV IE , cytomegalovirus immediate early promoter; pA SV40 , SV40 polyadenylation signal. ( B and C ) Deletion of a putative SRSF3-binding motif increases skipping of the EP300 exon 14. HeLa cells were transfected with individual EP300 minigenes or a parental vector pEGFP-N1 for 24 h, and skipping of the minigene exon 14 was determined by RT-PCR with a primer set for EP300 exon 13 (F 13 , forward primer) and vector sequence (R vec , reverse primer, diagrammed on the right). GAPDH RNA served as a loading control. RT-PCR products were resolved by gel electrophoresis, the band intensity was measured, and after normalizing to GAPDH RNA, a skipping rate (%) of the EP300 exon 14 was calculated. Shown in bar graphs (C) are means ± SD from two separate experiments. * P

    Techniques Used: Binding Assay, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Sequencing, Nucleic Acid Electrophoresis

    2) Product Images from "High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing"

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-38458-7

    Nucleotide biases seen at ligation sites and varies between individual miRNAs. ( A ) SeqLogo representation of the base composition of the degenerate Ns over all miRNAs and select miRs representing high (miR-21) mid (Let-7i, miR-96) and low (miR-151) expression. The height of the letter representing the base is proportional to its probability. Bases 1–4 are at the 3′ end of 5′ adapter. Bases 5–8 are at the 5′ end of 3′ adapter. Bases 9–12 follow barcode in 3′ adapter. ( B ) Cumulative divergence from expected probability of nucleotide composition at each base across all miRNAs, and the same select miRs as ( A ). Data shown is from a 500 ng cellular RNA input sample.
    Figure Legend Snippet: Nucleotide biases seen at ligation sites and varies between individual miRNAs. ( A ) SeqLogo representation of the base composition of the degenerate Ns over all miRNAs and select miRs representing high (miR-21) mid (Let-7i, miR-96) and low (miR-151) expression. The height of the letter representing the base is proportional to its probability. Bases 1–4 are at the 3′ end of 5′ adapter. Bases 5–8 are at the 5′ end of 3′ adapter. Bases 9–12 follow barcode in 3′ adapter. ( B ) Cumulative divergence from expected probability of nucleotide composition at each base across all miRNAs, and the same select miRs as ( A ). Data shown is from a 500 ng cellular RNA input sample.

    Techniques Used: Ligation, Expressing

    Unique molecular identifiers (UMIs) collapse duplicate reads and reveal linear relationship at low PCR cycles between total and collapsed counts, but drop out at high PCR cycles. ( A-C ) Effect of increasing length of UMI on number of miRNA counts following collapsing of miRNA + UMI, compared to total “raw” count. Number to left of + sign represents Ns on the 5′ adapter while numbers to right represent 3′ adapter. Insert represent collapse on miRNAs alone (i.e. without and UMI). Raw represents uncollapsed read count. Analysis shown for all miRNAs (A), a highly expressed miRNA (miR-21, B) and intermediately expressed miRNA (miR-96, C ). ( D ) Correlation plot of log10 counts per million for each miRNA comparing collapsed versus uncollapsed (total) reads for a library amplified for 14 cycles. All 12 random nucleotides were used for collapsing. ( E ) Same as D, but amplified for 24 cycles showing reduction in correlation for low expressed miRNAs. ( F ) Same as D, but comparing only collapsed reads between library amplified for 14 versus 24 cycles, showing much poorer correlation for low to intermediate expressed miRNAs. ( G-I ) Direct comparison of read counts for each miRNA from libraries differing in the number of PCR amplification cycles. miRNAs are ordered from high to low expression in 14 cycle library. ( G ) Uncollapsed (total) counts per million. ( H ) Collapsed counts per million. ( I ) Percent unique reads (i.e. collapsed counts/total counts *100). Note noise created by high PCR cycle number on the lowly to intermediately expressed miRNAs. All libraries were made from one cellular input RNA.
    Figure Legend Snippet: Unique molecular identifiers (UMIs) collapse duplicate reads and reveal linear relationship at low PCR cycles between total and collapsed counts, but drop out at high PCR cycles. ( A-C ) Effect of increasing length of UMI on number of miRNA counts following collapsing of miRNA + UMI, compared to total “raw” count. Number to left of + sign represents Ns on the 5′ adapter while numbers to right represent 3′ adapter. Insert represent collapse on miRNAs alone (i.e. without and UMI). Raw represents uncollapsed read count. Analysis shown for all miRNAs (A), a highly expressed miRNA (miR-21, B) and intermediately expressed miRNA (miR-96, C ). ( D ) Correlation plot of log10 counts per million for each miRNA comparing collapsed versus uncollapsed (total) reads for a library amplified for 14 cycles. All 12 random nucleotides were used for collapsing. ( E ) Same as D, but amplified for 24 cycles showing reduction in correlation for low expressed miRNAs. ( F ) Same as D, but comparing only collapsed reads between library amplified for 14 versus 24 cycles, showing much poorer correlation for low to intermediate expressed miRNAs. ( G-I ) Direct comparison of read counts for each miRNA from libraries differing in the number of PCR amplification cycles. miRNAs are ordered from high to low expression in 14 cycle library. ( G ) Uncollapsed (total) counts per million. ( H ) Collapsed counts per million. ( I ) Percent unique reads (i.e. collapsed counts/total counts *100). Note noise created by high PCR cycle number on the lowly to intermediately expressed miRNAs. All libraries were made from one cellular input RNA.

    Techniques Used: Polymerase Chain Reaction, Amplification, Expressing

    Modifications to high-throughput sequencing method improves capture of miRNAs. ( A ) Schematic of protocol to prepare miRNA libraries for sequencing. Modifications from original protocol noted in bold. ( B ) Percentage of different classes of RNAs captured from a plasma sample using the original conditions (0.85 μM 3′ adapter, 3.3 μM unmodified 5′ adapter). Ligations were performed in triplicate from the same RNA. Each replicate is shown as an individual bar. Note the low percentage of reads mapping to miRNAs (red). ( C ) Percentage of mature miRNAs captured using the optimized conditions (0.05 μΜ 3′ adapter, 0.33 μΜ amino-modified 5′ adapter) were compared to original conditions in three independent biological samples. The ligation reactions were performed in triplicate for each sample and protocol. Each replicate is shown as a black dot. Red dot represents average. ( D ) The average percentage of reads mapping to different classes of RNA for each sample and condition shown in C.
    Figure Legend Snippet: Modifications to high-throughput sequencing method improves capture of miRNAs. ( A ) Schematic of protocol to prepare miRNA libraries for sequencing. Modifications from original protocol noted in bold. ( B ) Percentage of different classes of RNAs captured from a plasma sample using the original conditions (0.85 μM 3′ adapter, 3.3 μM unmodified 5′ adapter). Ligations were performed in triplicate from the same RNA. Each replicate is shown as an individual bar. Note the low percentage of reads mapping to miRNAs (red). ( C ) Percentage of mature miRNAs captured using the optimized conditions (0.05 μΜ 3′ adapter, 0.33 μΜ amino-modified 5′ adapter) were compared to original conditions in three independent biological samples. The ligation reactions were performed in triplicate for each sample and protocol. Each replicate is shown as a black dot. Red dot represents average. ( D ) The average percentage of reads mapping to different classes of RNA for each sample and condition shown in C.

    Techniques Used: Next-Generation Sequencing, Sequencing, Modification, Ligation

    Improved miRNA capture also seen at low concentrations of input RNA. ( A ) The percentage of reads mapping to miRNAs at the indicated input following either the optimized (0.05 μΜ 3′ adapter, 0.33 μΜ amino-modified 5′adapter) or the original (0.85 μM 3′ adapter, 3.3 μM unmodified 5′ adapter) protocol. Black dots represent the three replicates from each input RNA for each sample, protocol, and concentration. Red dots represent average. ( B ) The average percentage of reads mapping to different RNA classes for each sample, protocol, and concentration.
    Figure Legend Snippet: Improved miRNA capture also seen at low concentrations of input RNA. ( A ) The percentage of reads mapping to miRNAs at the indicated input following either the optimized (0.05 μΜ 3′ adapter, 0.33 μΜ amino-modified 5′adapter) or the original (0.85 μM 3′ adapter, 3.3 μM unmodified 5′ adapter) protocol. Black dots represent the three replicates from each input RNA for each sample, protocol, and concentration. Red dots represent average. ( B ) The average percentage of reads mapping to different RNA classes for each sample, protocol, and concentration.

    Techniques Used: Modification, Concentration Assay

    Related Articles

    Centrifugation:

    Article Title: Differences in airway inflammation according to atopic status in patients with chronic rhinitis
    Article Snippet: Cells were isolated by brief centrifugation and then stored in 1 mL Trizol (Gibco, Carlsbad, CA, USA) at -80℃ until required. .. RNA levels were determined spectrophotometrically (Nanodrop ND-1000, Wilmington, DE, USA) and 2 µg of RNA from each sample was reverse transcribed into cDNA using a single-strand cDNA synthesis kit (Promega Co., Madison, WI, USA).

    Amplification:

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: Paragraph title: Laser-Capture Microdissection and Amplification ... RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Methylated DNA Immunoprecipitation Sequencing:

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ). .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Blocking Assay:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL). .. The 5′ and the 3′ adapters included four degenerate bases at the ligation site of each.

    Real-time Polymerase Chain Reaction:

    Article Title: A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells
    Article Snippet: Total RNA was extracted at each time point and treated by DNase TURBO (Life Technologies). .. The DNase-treated total RNA at 1 μg was reverse-transcribed and quantified by TaqMan real-time PCR for the remaining RNA levels of SRSF3 and GAPDH (Applied Biosystems, Life Technologies). .. Relative SRSF3 RNA expression levels at individual time points were determined by ΔΔCT method ( ).

    Microarray:

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: While these results do not rule out cytosine methylation in sperm as the relevant carrier of epigenetic information about paternal diet, the high correlation between samples, coupled with the absence of cytosine methylation changes at the Ppara enhancer in sperm, lead us to consider alternative epigenetic information carriers including RNA ( ; ) and chromatin ( ; ; ; ). .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ). .. Curiously, low protein and caloric restriction samples consistently exhibited more “sperm-like” RNA populations (as opposed to epididymis RNA) than did control samples ( ).

    Incubation:

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop). .. RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Expressing:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: This many-to-one sample approach was further optimized to obtain miRNA expression data from human plasma samples. .. With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL).

    Article Title: A genomics approach identifies senescence-specific gene expression regulation
    Article Snippet: This work represents a resource for the field of senescence and aging research. .. To describe global senescence-associated expression patterns, we grew IMR90 cells at physiological oxygen levels from low population doublings (PD) onward until they reached replicative senescence and analyzed RNA levels with Affymetrix arrays. .. Genes were regulated as a function of replicative age, as the number of regulated genes at each time point increased (Fig. ), with 1603 genes regulated in senescent cells (Table ).

    Article Title: Sequencing newly replicated DNA reveals widespread plasticity in human replication timing
    Article Snippet: Affymetrix Human Exon 1.0 ST arrays were used to examine RNA levels in all cultures (Affymetrix, Santa Clara, CA) and the data are available as released from the ENCODE Project through the UCSC Genome Browser at (see ). .. Affymetrix Human Exon 1.0 ST arrays were used to examine RNA levels in all cultures (Affymetrix, Santa Clara, CA) and the data are available as released from the ENCODE Project through the UCSC Genome Browser at (see ).

    Modification:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL). .. The 5′ and the 3′ adapters included four degenerate bases at the ligation site of each.

    Transformation Assay:

    Article Title: A genomics approach identifies senescence-specific gene expression regulation
    Article Snippet: To describe global senescence-associated expression patterns, we grew IMR90 cells at physiological oxygen levels from low population doublings (PD) onward until they reached replicative senescence and analyzed RNA levels with Affymetrix arrays. .. To describe global senescence-associated expression patterns, we grew IMR90 cells at physiological oxygen levels from low population doublings (PD) onward until they reached replicative senescence and analyzed RNA levels with Affymetrix arrays.

    Derivative Assay:

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: All tissue was collected from sections proceeding (in an apical-to-basal direction) from the first appearance of the or P1 to their junction. and P1 tissue was collected from the same vegetative apices, such that most replicates have a sister P1 replicate, derived from the same apices. .. RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Transfection:

    Article Title: A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells
    Article Snippet: HeLa cells were transfected with Dharmacon si-NS or si-SRSF3 twice with an interval of 48 h. The cells at 48 h after the second transfection were treated with 10 μg/ml of actinomycin D for 0, 1, 2, 4 and 8 h ( , ). .. The DNase-treated total RNA at 1 μg was reverse-transcribed and quantified by TaqMan real-time PCR for the remaining RNA levels of SRSF3 and GAPDH (Applied Biosystems, Life Technologies).

    Ligation:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: The method we present incorporates each of these improvements while using barcodes to allow sample pooling after the first ligation . .. With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL).

    Cell Culture:

    Article Title: Sequencing newly replicated DNA reveals widespread plasticity in human replication timing
    Article Snippet: Paragraph title: Cell Culture and RNA Analysis, and the Repli-Seq Procedure. ... Affymetrix Human Exon 1.0 ST arrays were used to examine RNA levels in all cultures (Affymetrix, Santa Clara, CA) and the data are available as released from the ENCODE Project through the UCSC Genome Browser at (see ).

    Mrna Decay Assay:

    Article Title: A genome landscape of SRSF3-regulated splicing events and gene expression in human osteosarcoma U2OS cells
    Article Snippet: Paragraph title: mRNA decay assay ... The DNase-treated total RNA at 1 μg was reverse-transcribed and quantified by TaqMan real-time PCR for the remaining RNA levels of SRSF3 and GAPDH (Applied Biosystems, Life Technologies).

    Sequencing:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: There are few commercially available miRNA sequencing kits optimized for low-input RNA samples. .. With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL).

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ). .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Article Title: Sequencing newly replicated DNA reveals widespread plasticity in human replication timing
    Article Snippet: Affymetrix Human Exon 1.0 ST arrays were used to examine RNA levels in all cultures (Affymetrix, Santa Clara, CA) and the data are available as released from the ENCODE Project through the UCSC Genome Browser at (see ). .. Affymetrix Human Exon 1.0 ST arrays were used to examine RNA levels in all cultures (Affymetrix, Santa Clara, CA) and the data are available as released from the ENCODE Project through the UCSC Genome Browser at (see ).

    Methylation:

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: Paragraph title: Cytosine methylation, RNA, and chromatin in sperm ... We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Isolation:

    Article Title: Differences in airway inflammation according to atopic status in patients with chronic rhinitis
    Article Snippet: Cells were isolated by brief centrifugation and then stored in 1 mL Trizol (Gibco, Carlsbad, CA, USA) at -80℃ until required. .. RNA levels were determined spectrophotometrically (Nanodrop ND-1000, Wilmington, DE, USA) and 2 µg of RNA from each sample was reverse transcribed into cDNA using a single-strand cDNA synthesis kit (Promega Co., Madison, WI, USA).

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: RNA was isolated following the manufacturer’s instructions with an additional treatment of the samples on the RNA purification column with RNase-free DNase (1:4 dilution of DNase I in RDD buffer; Qiagen). .. RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: To globally investigate effects of paternal diet on sperm cytosine methylation, we isolated sperm from four males – two consuming control diet, one consuming low protein diet, and one subjected to a caloric restriction regimen. .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Microscopy:

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ). .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Purification:

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: RNA was isolated following the manufacturer’s instructions with an additional treatment of the samples on the RNA purification column with RNase-free DNase (1:4 dilution of DNase I in RDD buffer; Qiagen). .. RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Concentration Assay:

    Article Title: High-throughput, Efficient, and Unbiased Capture of Small RNAs from Low-input Samples for Sequencing
    Article Snippet: With the optimized method presented here, miRNA libraries were successfully prepared from plasma samples with RNA levels undetectable by the Thermo Scientific Nanodrop One ( < 1.6 ng/μL) or Agilent Bioanalyzer RNA 6000 Pico kit ( < 50 pg/μL). .. In addition to the blocking modification already present on the 3′ adapter , a blocking amino modification was added to the 5′ end of the 5′ adapter.

    RNA Extraction:

    Article Title: Differences in airway inflammation according to atopic status in patients with chronic rhinitis
    Article Snippet: Paragraph title: RNA extraction and reverse transcription-PCR ... RNA levels were determined spectrophotometrically (Nanodrop ND-1000, Wilmington, DE, USA) and 2 µg of RNA from each sample was reverse transcribed into cDNA using a single-strand cDNA synthesis kit (Promega Co., Madison, WI, USA).

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: Microdissected tissue was harvested into RNA extraction buffer (RNAqueous-Micro; Ambion) and stored at −80°C until further use. .. RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Ethanol Precipitation:

    Article Title: Differences in airway inflammation according to atopic status in patients with chronic rhinitis
    Article Snippet: RNA was extracted by phenol/chloroform extraction and ethanol precipitation according to the manufacturer's instructions. .. RNA levels were determined spectrophotometrically (Nanodrop ND-1000, Wilmington, DE, USA) and 2 µg of RNA from each sample was reverse transcribed into cDNA using a single-strand cDNA synthesis kit (Promega Co., Madison, WI, USA).

    Laser Capture Microdissection:

    Article Title: Light-Induced Indeterminacy Alters Shade-Avoiding Tomato Leaf Morphology
    Article Snippet: Paragraph title: Laser-Capture Microdissection and Amplification ... RNA levels were quantified (Quant-iT RiboGreen RNA Assay Kit; Invitrogen) using an ND-3330 Fluorospectrometer (Nano-Drop).

    Immunoprecipitation:

    Article Title: Paternally-induced transgenerational environmental reprogramming of metabolic gene expression in mammals
    Article Snippet: We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ). .. We analyzed RNA levels for three pairs of males and for two matched epididymis samples by Affymetrix microarray ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Thermo Fisher mirna levels
    EBV miR-BHRF1-2-5p, miR-BART2-5p, and cellular miR-17 regulate the latent to lytic switch. A and C-G. MutuI cells were transduced with pLCE control vector or sponge inhibitors to indicated EBV or cellular miRNAs, then treated for 24 or 42 hrs with 5 ug/mL anti-IgM. Total RNA was harvested and assayed by <t>qRT-PCR</t> for EBV gene expression as indicated. Reported are the averages of two independent experiments with qPCR performed in duplicate; expression levels are normalized to GAPDH and shown relative to mock treated cells (harvested at 42 hrs) for each <t>miRNA</t> sponge inhibitor. B. miRNA levels in anti-IgM treated, sponged MutuI cells assayed by qRT-PCR. Values are normalized to miR-16 and shown relative to pLCE control cells for each respective sponge inhibitor. Reported are the averages of two independent experiments with qPCR performed in duplicate. *By Student’s t test, p
    Mirna Levels, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirna levels/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mirna levels - by Bioz Stars, 2020-01
    86/100 stars
      Buy from Supplier

    89
    Thermo Fisher gene exp scn1a hs00374696 m1
    Secondary structure of SCN1ANAT. Blue triangles — low-activity, red triangles — high-activity AntagoNAT clusters. AntagoNATs inducing highest upregulation of <t>SCN1A</t> were located around positions 540 and 1018 (representative AntagoNATs CUR-1740 and CUR-1916 respectively). Color scale represents probability of occurrence of the secondary structure (blue — low, red — high). Generated using Vienna RNAfold software.
    Gene Exp Scn1a Hs00374696 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp scn1a hs00374696 m1/product/Thermo Fisher
    Average 89 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp scn1a hs00374696 m1 - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    95
    Thermo Fisher gene exp lrig1 hs00394267 m1
    Loss of <t>LRIG1</t> in HMLE-Twist-ER cells increases mammosphere formation and the population of cells bearing stem cell markers (A) Quantification of mammospheres formed by HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 or after induction of Twist for 12 and 15 days. (B) FACS detection of stem cell markers (CD44, CD24) in HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 and Day 15. (C) Quantification of HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells bearing the CD44 hi /CD24 lo/− configuration at Day 15 of Twist induction. All data are representative of at least 3 independent experiments. Data are presented as mean ± SEM, collected from 3 independent experiments. (* = p
    Gene Exp Lrig1 Hs00394267 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp lrig1 hs00394267 m1/product/Thermo Fisher
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    gene exp lrig1 hs00394267 m1 - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    92
    Thermo Fisher gene exp runx1 mm01213404 m1
    Loss of <t>Runx1</t> in mdx mice resulted in reduced muscle regeneration. (A and B) Determination of myofibers numbers in mdx muscle. Soleus muscles from 8 weeks old mdx and mdx/Runx1 f/f mice were sectioned, subjected to H E staining, and number of total and regenerating myofibers was determined. (A) Representative images of mdx and mdx/Runx1 f/f sections showing regenerating myofibers with central nuclei, the hallmark of regenerating myofibers, shown at x100 (top) or x200 (bottom). Scale bars, 200μm and 100μm for the x100 and x200 magnification, respectively. (B) Stacked column histograms showing the average number of regenerating myofibers (red) and normal myofibers (blue) in mdx and mdx/Runx1 f/f soleus muscle sections. The number of regenerating (fibers with round and central nuclei) and normal myofibers was counted in 3 H E-stained sections per muscle and their average number calculated. Values are mean±SE (n = 9–13, *** P
    Gene Exp Runx1 Mm01213404 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp runx1 mm01213404 m1/product/Thermo Fisher
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp runx1 mm01213404 m1 - by Bioz Stars, 2020-01
    92/100 stars
      Buy from Supplier

    Image Search Results


    EBV miR-BHRF1-2-5p, miR-BART2-5p, and cellular miR-17 regulate the latent to lytic switch. A and C-G. MutuI cells were transduced with pLCE control vector or sponge inhibitors to indicated EBV or cellular miRNAs, then treated for 24 or 42 hrs with 5 ug/mL anti-IgM. Total RNA was harvested and assayed by qRT-PCR for EBV gene expression as indicated. Reported are the averages of two independent experiments with qPCR performed in duplicate; expression levels are normalized to GAPDH and shown relative to mock treated cells (harvested at 42 hrs) for each miRNA sponge inhibitor. B. miRNA levels in anti-IgM treated, sponged MutuI cells assayed by qRT-PCR. Values are normalized to miR-16 and shown relative to pLCE control cells for each respective sponge inhibitor. Reported are the averages of two independent experiments with qPCR performed in duplicate. *By Student’s t test, p

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: EBV miR-BHRF1-2-5p, miR-BART2-5p, and cellular miR-17 regulate the latent to lytic switch. A and C-G. MutuI cells were transduced with pLCE control vector or sponge inhibitors to indicated EBV or cellular miRNAs, then treated for 24 or 42 hrs with 5 ug/mL anti-IgM. Total RNA was harvested and assayed by qRT-PCR for EBV gene expression as indicated. Reported are the averages of two independent experiments with qPCR performed in duplicate; expression levels are normalized to GAPDH and shown relative to mock treated cells (harvested at 42 hrs) for each miRNA sponge inhibitor. B. miRNA levels in anti-IgM treated, sponged MutuI cells assayed by qRT-PCR. Values are normalized to miR-16 and shown relative to pLCE control cells for each respective sponge inhibitor. Reported are the averages of two independent experiments with qPCR performed in duplicate. *By Student’s t test, p

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Transduction, Plasmid Preparation, Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction

    Regulation of GRB2 by EBV miR-BHRF1-2-5p contributes to the growth of latently infected LCLs. A. Ectopic expression of the BHRF1-2 miRNAs enhances the growth of mutant LCLs. BHRF1-2 miRNA mutant LCLs stably transduced with pLCE or pLCE-BHRF1-2 (Donor 1 = LCLBACD2; Donor 2 = LCL-D2) were plated in triplicate or quadruplicate at 2.5 x 10^6 cells per mL in media containing 10% FBS or 20% FBS (see also S3 Fig ). Viable cell counts were determined at times indicated in S3 Fig . Cell growth rates were calculated between 2 and 5 days post-plating using the equation: ln(N1/N1) = k(t1-t2), where k = growth rate, t = time, and N = cell number. *By Student’s t-test, p

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: Regulation of GRB2 by EBV miR-BHRF1-2-5p contributes to the growth of latently infected LCLs. A. Ectopic expression of the BHRF1-2 miRNAs enhances the growth of mutant LCLs. BHRF1-2 miRNA mutant LCLs stably transduced with pLCE or pLCE-BHRF1-2 (Donor 1 = LCLBACD2; Donor 2 = LCL-D2) were plated in triplicate or quadruplicate at 2.5 x 10^6 cells per mL in media containing 10% FBS or 20% FBS (see also S3 Fig ). Viable cell counts were determined at times indicated in S3 Fig . Cell growth rates were calculated between 2 and 5 days post-plating using the equation: ln(N1/N1) = k(t1-t2), where k = growth rate, t = time, and N = cell number. *By Student’s t-test, p

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Infection, Expressing, Mutagenesis, Stable Transfection, Transduction

    shRNAs to RAC1, GRB2, or SOS1 phenocopy EBV BHRF1-2 miRNA activity. A. BJAB cells were transduced with pL-mCherry or shRNAs to GRB2, PLCG1, or SOS1 as indicated. Lysates were analyzed by Western blot. Gapdh levels are shown as loading controls. Lysate from BJAB cells transduced with pLCE-BHRF1-2 was included in the Grb2 Western blot. B. Knockdown of individual target genes in BJAB-NFkB-GL4.32 cells was assayed by qRT-PCR analysis. Expression levels are normalized to GAPDH and reported relative to control (mCherry) cells. qPCR was performed in duplicate. C. Individual shRNAs were stably expressed in BJAB-NFkB-GL4.32 cells. Cells were stimulated for 18 hr with 5 ug/ml anti-IgM, then lysed and assayed for NF-kappaB responsive luciferase activity. NF-kappaB activity levels are normalized to mock treated cells. Averages and standard deviations (S.D.) are from two independent experiments performed in quadruplicate. By Student’s t-test, *p

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: shRNAs to RAC1, GRB2, or SOS1 phenocopy EBV BHRF1-2 miRNA activity. A. BJAB cells were transduced with pL-mCherry or shRNAs to GRB2, PLCG1, or SOS1 as indicated. Lysates were analyzed by Western blot. Gapdh levels are shown as loading controls. Lysate from BJAB cells transduced with pLCE-BHRF1-2 was included in the Grb2 Western blot. B. Knockdown of individual target genes in BJAB-NFkB-GL4.32 cells was assayed by qRT-PCR analysis. Expression levels are normalized to GAPDH and reported relative to control (mCherry) cells. qPCR was performed in duplicate. C. Individual shRNAs were stably expressed in BJAB-NFkB-GL4.32 cells. Cells were stimulated for 18 hr with 5 ug/ml anti-IgM, then lysed and assayed for NF-kappaB responsive luciferase activity. NF-kappaB activity levels are normalized to mock treated cells. Averages and standard deviations (S.D.) are from two independent experiments performed in quadruplicate. By Student’s t-test, *p

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Activity Assay, Transduction, Western Blot, Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction, Stable Transfection, Luciferase

    EBV miR-BHRF1-2-5p contributes to the growth of EBV+ DLBCL cells. A. Taqman qRT-PCR analysis of miR-BHRF1-2-5p (5p) and miR-BHRF1-2-3p (3p) expression in miR-BHRF1-2-5p sponged DLBCLs (IBL1 and BCKN1). Values are normalized to U6 and reported relative to the BHRF1-2 miRNA levels in each respective DLBCL transduced with pLCE-CXCR4 control vector. B. Proliferation of DLBCLs as determined by MTT assay following stable transduction with pLCE-CXCR4 control vector or the miR-BHRF1-2-5p sponge. FAC-sorted, GFP+ DLBCLs were maintained in media containing 15% FBS and split one day prior to MTT assays. Values at Tn are normalized to the absorbance values at 0 hr (A-T0). Error bars represent S.D. of measurements from six or eight wells. *By Student’s t test, p

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: EBV miR-BHRF1-2-5p contributes to the growth of EBV+ DLBCL cells. A. Taqman qRT-PCR analysis of miR-BHRF1-2-5p (5p) and miR-BHRF1-2-3p (3p) expression in miR-BHRF1-2-5p sponged DLBCLs (IBL1 and BCKN1). Values are normalized to U6 and reported relative to the BHRF1-2 miRNA levels in each respective DLBCL transduced with pLCE-CXCR4 control vector. B. Proliferation of DLBCLs as determined by MTT assay following stable transduction with pLCE-CXCR4 control vector or the miR-BHRF1-2-5p sponge. FAC-sorted, GFP+ DLBCLs were maintained in media containing 15% FBS and split one day prior to MTT assays. Values at Tn are normalized to the absorbance values at 0 hr (A-T0). Error bars represent S.D. of measurements from six or eight wells. *By Student’s t test, p

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Quantitative RT-PCR, Expressing, Transduction, Plasmid Preparation, MTT Assay

    EBV miRNAs disrupt BCR-mediated signaling events. A. BJAB-NFkB-GL4.32, stably transfected with a NF-kappaB-responsive firefly luciferase reporter, were transduced with pLCE empty vector or individual EBV miRNA vectors. Cells were plated in 96-well black-well plates, treated with 10 ug/mL anti-IgM for 18 hrs, and analyzed for luciferase activity. Values are normalized to mock treated cells and reported relative to pLCE control. Shown are the averages of three independent experiments performed in quadruplicate. B. BJAB-NFkBLuc cells, expressing a NF-kappaB-responsive firefly luciferase reporter and a renilla luciferase reporter for internal control, were transduced with pLCE empty vector or individual EBV miRNA vectors. Cells were treated with 5 ug/mL anti-IgM for 18 hr, and then lysed in 1X passive lysis buffer. Luciferase activity was measured using the dual luciferase reporter kit. Values are reported relative to mock-treated control (pLCE) cells. Shown are the averages of four independent experiments performed in triplicate. C. BJAB-NFkBLuc cells transduced with pLCE or pLCE-BHRF1-2 were stimulated with 100 ng/mL LPS for 6 hrs, then analyzed for luciferase activity as in (A.). Shown are the averages of three independent experiments performed in triplicate. D. and E. BJAB-AP1-GL4.44 cells, expressing an AP1-responsive firefly luciferase reporter, were transduced with pLCE-based EBV miRNA expression vectors, treated with 10 ug/mL anti-IgM for 6 hrs (D.) or 18 hrs (E.), then analyzed for luciferase activity. Values are normalized to mock treated cells. Shown are the averages of three independent experiments performed in quadruplicate. F. EBV miRNA expression. RNA was harvested from BJAB cells transduced with control vector (pLCE) or individual EBV miRNA expression vectors (pLCE-miR) and Mutu I cells treated with 5 ug/mL anti-IgM for 48 hrs. miRNAs were detected by qRT-PCR. Values are normalized to cellular miR-16 and reported relative to levels in Mutu I cells. By Student’s t-test, *p

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: EBV miRNAs disrupt BCR-mediated signaling events. A. BJAB-NFkB-GL4.32, stably transfected with a NF-kappaB-responsive firefly luciferase reporter, were transduced with pLCE empty vector or individual EBV miRNA vectors. Cells were plated in 96-well black-well plates, treated with 10 ug/mL anti-IgM for 18 hrs, and analyzed for luciferase activity. Values are normalized to mock treated cells and reported relative to pLCE control. Shown are the averages of three independent experiments performed in quadruplicate. B. BJAB-NFkBLuc cells, expressing a NF-kappaB-responsive firefly luciferase reporter and a renilla luciferase reporter for internal control, were transduced with pLCE empty vector or individual EBV miRNA vectors. Cells were treated with 5 ug/mL anti-IgM for 18 hr, and then lysed in 1X passive lysis buffer. Luciferase activity was measured using the dual luciferase reporter kit. Values are reported relative to mock-treated control (pLCE) cells. Shown are the averages of four independent experiments performed in triplicate. C. BJAB-NFkBLuc cells transduced with pLCE or pLCE-BHRF1-2 were stimulated with 100 ng/mL LPS for 6 hrs, then analyzed for luciferase activity as in (A.). Shown are the averages of three independent experiments performed in triplicate. D. and E. BJAB-AP1-GL4.44 cells, expressing an AP1-responsive firefly luciferase reporter, were transduced with pLCE-based EBV miRNA expression vectors, treated with 10 ug/mL anti-IgM for 6 hrs (D.) or 18 hrs (E.), then analyzed for luciferase activity. Values are normalized to mock treated cells. Shown are the averages of three independent experiments performed in quadruplicate. F. EBV miRNA expression. RNA was harvested from BJAB cells transduced with control vector (pLCE) or individual EBV miRNA expression vectors (pLCE-miR) and Mutu I cells treated with 5 ug/mL anti-IgM for 48 hrs. miRNAs were detected by qRT-PCR. Values are normalized to cellular miR-16 and reported relative to levels in Mutu I cells. By Student’s t-test, *p

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Stable Transfection, Transfection, Luciferase, Transduction, Plasmid Preparation, Activity Assay, Expressing, Lysis, Quantitative RT-PCR

    Hypothetical model by which EBV miRNAs, such as miR-BHRF1-2-5p, regulate signal transduction components downstream of BCR and modulate the latent/lytic switch. A. EBV miR-BHRF1-2-5p regulates Grb2 protein levels in multiple EBV-infected B cell types which contributes to B cell proliferation (irrespective of an intact BCR). B. Multiple EBV miRNAs, including miR-BHRF1-2-5p, attenuate signaling through the BCR. Disruption of EBV miR-BHRF1-2-5p and miR-BART2-5p activities, in particular, impact the amplitude of virus reactivation when triggered by antigen cross-linking.

    Journal: PLoS Pathogens

    Article Title: Epstein-Barr virus microRNAs regulate B cell receptor signal transduction and lytic reactivation

    doi: 10.1371/journal.ppat.1007535

    Figure Lengend Snippet: Hypothetical model by which EBV miRNAs, such as miR-BHRF1-2-5p, regulate signal transduction components downstream of BCR and modulate the latent/lytic switch. A. EBV miR-BHRF1-2-5p regulates Grb2 protein levels in multiple EBV-infected B cell types which contributes to B cell proliferation (irrespective of an intact BCR). B. Multiple EBV miRNAs, including miR-BHRF1-2-5p, attenuate signaling through the BCR. Disruption of EBV miR-BHRF1-2-5p and miR-BART2-5p activities, in particular, impact the amplitude of virus reactivation when triggered by antigen cross-linking.

    Article Snippet: Oligonucleotides are listed in Table S1. miRNAs were detected using commercial Taqman assays or miRNA stem-loop qRT-PCR assays as previously described [ , ]. miRNA levels are reported relative to miR-16 (assay #000391, Thermofisher) or U6 (assay #001973, Thermofisher) as indicated.

    Techniques: Transduction, Infection

    Secondary structure of SCN1ANAT. Blue triangles — low-activity, red triangles — high-activity AntagoNAT clusters. AntagoNATs inducing highest upregulation of SCN1A were located around positions 540 and 1018 (representative AntagoNATs CUR-1740 and CUR-1916 respectively). Color scale represents probability of occurrence of the secondary structure (blue — low, red — high). Generated using Vienna RNAfold software.

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Secondary structure of SCN1ANAT. Blue triangles — low-activity, red triangles — high-activity AntagoNAT clusters. AntagoNATs inducing highest upregulation of SCN1A were located around positions 540 and 1018 (representative AntagoNATs CUR-1740 and CUR-1916 respectively). Color scale represents probability of occurrence of the secondary structure (blue — low, red — high). Generated using Vienna RNAfold software.

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Activity Assay, Generated, Software

    Normalization of neuronal activity in Dravet mice after CUR-1901 treatment. WT and Scn1a E1099X/+ mice were treated with a single IT injection of 5 μg of CUR-1901 or saline. (a) Representative traces of current clamp experiments in hippocampal parvalbumin-positive interneuron in WT and control Scn1a E1099X/+ mice (Het), compared to Scn1a E1099X/+ treated (Het_1901) mice. (b) Input/output function for (a). (c–i) Characteristics of hippocampal parvalbumin-positive neurons ( n = 6.5.8 respectively): (c) half-width of action potential (AP); (d) rise slope of AP; (e) decay slope of AP; (f) amplitude of AP; (g) afterhyperpolarization (AHP) amplitude of AP; (h) input resistance; (i) resting potential ( t -test with correction, p > 0.05). Mean ± S.E.M., * — p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Normalization of neuronal activity in Dravet mice after CUR-1901 treatment. WT and Scn1a E1099X/+ mice were treated with a single IT injection of 5 μg of CUR-1901 or saline. (a) Representative traces of current clamp experiments in hippocampal parvalbumin-positive interneuron in WT and control Scn1a E1099X/+ mice (Het), compared to Scn1a E1099X/+ treated (Het_1901) mice. (b) Input/output function for (a). (c–i) Characteristics of hippocampal parvalbumin-positive neurons ( n = 6.5.8 respectively): (c) half-width of action potential (AP); (d) rise slope of AP; (e) decay slope of AP; (f) amplitude of AP; (g) afterhyperpolarization (AHP) amplitude of AP; (h) input resistance; (i) resting potential ( t -test with correction, p > 0.05). Mean ± S.E.M., * — p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Activity Assay, Mouse Assay, Injection

    Mouse model of Dravet syndrome. (a) Localization of the E1099X mutation in the Scn1a protein structure. (b) Scn1a mRNA expression in Scn1a E1099X/+ mice compared to WT, real time PCR data, n = 3. (c) Example of a 12-hour long EEG recording showing typical seizure (square bracket), post-seizure depression (slim arrow) and inter-ictal activity (block arrows); representative of the 28-day continuous observation of > 30 mice (video in Supplementary File 3 ). Mean ± S.E.M. Mouse model of Dravet syndrome. (a) Localization of the E1099X mutation in the Scn1a protein structure. (b) Scn1a mRNA expression in Scn1a E1099X/+ mice compared to WT, real time PCR data, n = 3. (c) Example of a 12-hour long EEG recording showing typical seizure (square bracket), post-seizure depression (slim arrow) and inter-ictal activity (block arrows); representative of the 28-day continuous observation of > 30 mice (video in Supplementary File 3). Mean ± S.E.M.

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Mouse model of Dravet syndrome. (a) Localization of the E1099X mutation in the Scn1a protein structure. (b) Scn1a mRNA expression in Scn1a E1099X/+ mice compared to WT, real time PCR data, n = 3. (c) Example of a 12-hour long EEG recording showing typical seizure (square bracket), post-seizure depression (slim arrow) and inter-ictal activity (block arrows); representative of the 28-day continuous observation of > 30 mice (video in Supplementary File 3 ). Mean ± S.E.M. Mouse model of Dravet syndrome. (a) Localization of the E1099X mutation in the Scn1a protein structure. (b) Scn1a mRNA expression in Scn1a E1099X/+ mice compared to WT, real time PCR data, n = 3. (c) Example of a 12-hour long EEG recording showing typical seizure (square bracket), post-seizure depression (slim arrow) and inter-ictal activity (block arrows); representative of the 28-day continuous observation of > 30 mice (video in Supplementary File 3). Mean ± S.E.M.

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Mutagenesis, Expressing, Mouse Assay, Real-time Polymerase Chain Reaction, Activity Assay, Blocking Assay

    SCN1A and SCN1ANAT coding regions are localized on opposite chromosomal strands in human and mouse genomes. (a) Human chromosome 2. (b) Mouse chromosome 2. In the insets: empty boxes — SCN1ANAT exons; filled boxes — SCN1A exons; grey lines — complementary chromosomal strands; angled arrows — direction of transcription; CUR-1916, CUR-1901 — positions of sequences complementary to respective AntagoNATs.

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: SCN1A and SCN1ANAT coding regions are localized on opposite chromosomal strands in human and mouse genomes. (a) Human chromosome 2. (b) Mouse chromosome 2. In the insets: empty boxes — SCN1ANAT exons; filled boxes — SCN1A exons; grey lines — complementary chromosomal strands; angled arrows — direction of transcription; CUR-1916, CUR-1901 — positions of sequences complementary to respective AntagoNATs.

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques:

    SCN1A and SCN1ANAT expression in human, monkey and mouse tissues. (a) Expression of SCN1ANAT in a human tissue panel, normalized to arbitrary RNA standard. (b) Correlation of expression levels of Scn1a and Scn1aNAT in African green monkey tissues ( n = 4, df = 20, F = 29.5; tissues as listed in (e), dark circles — peripheral organs, lighter circles — spinal cord, light circles — brain regions). (c) Ratio of Scn1a to Scn1aNAT expression in mouse tissues, n = 4. (d) Ratio of Scn1a to Scn1aNAT expression in mouse cell lines. (e–g) Expression levels of Scn1a and Scn1aNAT in African green monkey tissues, n = 4: (e) — Scn1a mRNA. (f) — Scn1aNAT RNA. (g) — Ratios of Scn1a to Scn1aNAT copy numbers. (h–j) — Enlarged portions of e, f, g respectively showing data for peripheral organs. Real time PCR data. Mean ± S.E.M.

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: SCN1A and SCN1ANAT expression in human, monkey and mouse tissues. (a) Expression of SCN1ANAT in a human tissue panel, normalized to arbitrary RNA standard. (b) Correlation of expression levels of Scn1a and Scn1aNAT in African green monkey tissues ( n = 4, df = 20, F = 29.5; tissues as listed in (e), dark circles — peripheral organs, lighter circles — spinal cord, light circles — brain regions). (c) Ratio of Scn1a to Scn1aNAT expression in mouse tissues, n = 4. (d) Ratio of Scn1a to Scn1aNAT expression in mouse cell lines. (e–g) Expression levels of Scn1a and Scn1aNAT in African green monkey tissues, n = 4: (e) — Scn1a mRNA. (f) — Scn1aNAT RNA. (g) — Ratios of Scn1a to Scn1aNAT copy numbers. (h–j) — Enlarged portions of e, f, g respectively showing data for peripheral organs. Real time PCR data. Mean ± S.E.M.

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Summary of AntagoNAT screening data. Bars show fold difference in the SCN1A mRNA expression levels between mock-transfected controls and cells treated with 20 nM of AntagoNATs of different chemistry and sequence. Boxes point to AntagoNATs selected for in-depth studies based on their high SCN1A upregulation and effect consistency in different cell lines. For mouse, homology to human AntagoNATs was also taken into account. Each bar represents an average of 2 or more experiments in 2 different cell lines (HepG2 and SK-N-AS cells for human, 3T3 and Neuro2a cells for mouse-specific AntagoNATs, n = 10 or higher). Real time PCR data. Mean ± S.E.M. * — p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Summary of AntagoNAT screening data. Bars show fold difference in the SCN1A mRNA expression levels between mock-transfected controls and cells treated with 20 nM of AntagoNATs of different chemistry and sequence. Boxes point to AntagoNATs selected for in-depth studies based on their high SCN1A upregulation and effect consistency in different cell lines. For mouse, homology to human AntagoNATs was also taken into account. Each bar represents an average of 2 or more experiments in 2 different cell lines (HepG2 and SK-N-AS cells for human, 3T3 and Neuro2a cells for mouse-specific AntagoNATs, n = 10 or higher). Real time PCR data. Mean ± S.E.M. * — p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Expressing, Transfection, Sequencing, Real-time Polymerase Chain Reaction

    AntagoNAT distribution and Scn1a upregulation in vivo in African green monkeys. Animals were injected IT with different doses of CUR-1916. (a) Tissue concentration of CUR-1916 in monkey brain 7 days after injection (hybridization assay data). (b) CUR-1916 concentrations in different monkey brain regions after treatment with 0.04 mg/kg of CUR-1916 (hybridization assay data, n = 9). (c–f) Upregulation of Scn1a mRNA in brain regions ( n = 6 for 0.008 mg/kg, n = 9 for 0 and 0.04 mg/kg of CUR-1916; real time PCR data, ANOVA p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: AntagoNAT distribution and Scn1a upregulation in vivo in African green monkeys. Animals were injected IT with different doses of CUR-1916. (a) Tissue concentration of CUR-1916 in monkey brain 7 days after injection (hybridization assay data). (b) CUR-1916 concentrations in different monkey brain regions after treatment with 0.04 mg/kg of CUR-1916 (hybridization assay data, n = 9). (c–f) Upregulation of Scn1a mRNA in brain regions ( n = 6 for 0.008 mg/kg, n = 9 for 0 and 0.04 mg/kg of CUR-1916; real time PCR data, ANOVA p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: In Vivo, Injection, Concentration Assay, Hybridization, Real-time Polymerase Chain Reaction

    Upregulation of SCN1A expression after AntagoNAT treatment of different Dravet mutations. (a) SCN1A mRNA levels in 5 Dravet patient fibroblast lines treated with 20 nM of CUR-1916; normalized to inactive oligonucleotide control, real time PCR data, t -test with Bonferroni correction, n = 18/group. (b) Copy numbers of WT and mutant (X) SCN1A mRNAs in fibroblast lines D-00 and D-02. Mutant mRNA was undetectable in both cell lines (allele-specific real time PCR with synthetic copy number standards, n = 3 wells/group). Mean ± S.E.M., ** — p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Upregulation of SCN1A expression after AntagoNAT treatment of different Dravet mutations. (a) SCN1A mRNA levels in 5 Dravet patient fibroblast lines treated with 20 nM of CUR-1916; normalized to inactive oligonucleotide control, real time PCR data, t -test with Bonferroni correction, n = 18/group. (b) Copy numbers of WT and mutant (X) SCN1A mRNAs in fibroblast lines D-00 and D-02. Mutant mRNA was undetectable in both cell lines (allele-specific real time PCR with synthetic copy number standards, n = 3 wells/group). Mean ± S.E.M., ** — p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Mutagenesis

    Target specificity of NAT-mediated SCN1A upregulation. (a) SCN1A mRNA in SK-N-AS cells treated with a mixture of active AntagoNAT (CUR-1837) and a control oligonucleotide (CUR-1462); ANOVA p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Target specificity of NAT-mediated SCN1A upregulation. (a) SCN1A mRNA in SK-N-AS cells treated with a mixture of active AntagoNAT (CUR-1837) and a control oligonucleotide (CUR-1462); ANOVA p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques:

    Increase in seizure threshold temperature after CUR-1901 treatment. Scn1a E1099X/+ (a) or WT (b) mice were treated with 4 weekly injections of CUR-1901 at 20 μg/injection or saline. ( n = 4.6, representative of 3 experiments, t -test p = 0.01). (c) Cumulative seizure probability vs core body temperature for WT and Scn1aE1099X/+ transgenic mice treated with CUR-1901 or vehicle ( n = 3.3,6,5 respectively, representative of 3 experiments). (d) Power spectra of normal EEG (red trace), inter-ictal EEG (green trace), ictal EEG (blue trace) and post-ictal suppression EEG (black trace) in Scn1aE1099X/+ transgenic mice ( n = 6).Mean ± S.E.M. ** — p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: Increase in seizure threshold temperature after CUR-1901 treatment. Scn1a E1099X/+ (a) or WT (b) mice were treated with 4 weekly injections of CUR-1901 at 20 μg/injection or saline. ( n = 4.6, representative of 3 experiments, t -test p = 0.01). (c) Cumulative seizure probability vs core body temperature for WT and Scn1aE1099X/+ transgenic mice treated with CUR-1901 or vehicle ( n = 3.3,6,5 respectively, representative of 3 experiments). (d) Power spectra of normal EEG (red trace), inter-ictal EEG (green trace), ictal EEG (blue trace) and post-ictal suppression EEG (black trace) in Scn1aE1099X/+ transgenic mice ( n = 6).Mean ± S.E.M. ** — p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: Mouse Assay, Injection, Transgenic Assay

    SCN1A upregulation and seizure phenotype improvement in a mouse model of Dravet syndrome after AntagoNAT treatment in vivo. Mice were treated with 4 weekly injections of CUR-1901 at 20 μg/injection or saline. (a, b) Dose-dependent increase in Scn1a mRNA levels in brain regions of Scn1a E1099X/+ (a) or WT (b) mice (real time PCR data, normalized to vehicle control, ANOVA p

    Journal: EBioMedicine

    Article Title: Upregulation of Haploinsufficient Gene Expression in the Brain by Targeting a Long Non-coding RNA Improves Seizure Phenotype in a Model of Dravet Syndrome

    doi: 10.1016/j.ebiom.2016.05.011

    Figure Lengend Snippet: SCN1A upregulation and seizure phenotype improvement in a mouse model of Dravet syndrome after AntagoNAT treatment in vivo. Mice were treated with 4 weekly injections of CUR-1901 at 20 μg/injection or saline. (a, b) Dose-dependent increase in Scn1a mRNA levels in brain regions of Scn1a E1099X/+ (a) or WT (b) mice (real time PCR data, normalized to vehicle control, ANOVA p

    Article Snippet: 2.4.3 cDNA was PCR amplified using TaqMan Fast Advance Master Mix and TaqMan® Gene Expression Assays labeled with FAM (Hs00374696_m1 specific for human or Mm00450580_m1 assay specific for mouse Scn1a RNA; assays for human SCN2A — Hs00221379_m1, SCN3A — Hs00366902_m1, SCN5A — Hs00165693_m1, SCN7A — Hs00161546_m1, SCN8A — Hs00274075_m1, SCN9A — Hs00161567_m1, mouse SCN9A — Mm00405762_S1, custom assay for human SCN1ANAT — context sequence GGAAACACCACAGCATAGTGATTAG, assay for mouse Scn1aNAT Mm01329045_mH) in a StepOne Plus analyzer (all from Applied Biosystems, USA).

    Techniques: In Vivo, Mouse Assay, Injection, Real-time Polymerase Chain Reaction

    Loss of LRIG1 in HMLE-Twist-ER cells increases mammosphere formation and the population of cells bearing stem cell markers (A) Quantification of mammospheres formed by HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 or after induction of Twist for 12 and 15 days. (B) FACS detection of stem cell markers (CD44, CD24) in HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 and Day 15. (C) Quantification of HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells bearing the CD44 hi /CD24 lo/− configuration at Day 15 of Twist induction. All data are representative of at least 3 independent experiments. Data are presented as mean ± SEM, collected from 3 independent experiments. (* = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: Loss of LRIG1 in HMLE-Twist-ER cells increases mammosphere formation and the population of cells bearing stem cell markers (A) Quantification of mammospheres formed by HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 or after induction of Twist for 12 and 15 days. (B) FACS detection of stem cell markers (CD44, CD24) in HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells at Day 0 and Day 15. (C) Quantification of HMLE-Twist-ER-shCon cells and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells bearing the CD44 hi /CD24 lo/− configuration at Day 15 of Twist induction. All data are representative of at least 3 independent experiments. Data are presented as mean ± SEM, collected from 3 independent experiments. (* = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: FACS

    LRIG1 suppresses invasive 3D morphology of MDA-MB-231 breast cancer cells (A) Phase-contrast images (4x and 10x objectives, as indicated) of MDA-MB-231-pMX control (left) and MDA-MB-231-pMX-LRIG1 (right) cells grown in 3D Matrigel culture for 7 days. (B) Left panel: Proliferation of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells was measured by manually counting cells recovered from 3D Matrigel culture after 7 days. Right panel: The area of structures observed in (A) were quantified (n ≥ 80 structures). (C) Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells recovered after growing in 3D Matrigel culture for 7 days. (D) Quantification of tumorspheres formed by MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells. Data are presented as mean ± SEM, collected from at least 3 independent experiments. (** = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 suppresses invasive 3D morphology of MDA-MB-231 breast cancer cells (A) Phase-contrast images (4x and 10x objectives, as indicated) of MDA-MB-231-pMX control (left) and MDA-MB-231-pMX-LRIG1 (right) cells grown in 3D Matrigel culture for 7 days. (B) Left panel: Proliferation of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells was measured by manually counting cells recovered from 3D Matrigel culture after 7 days. Right panel: The area of structures observed in (A) were quantified (n ≥ 80 structures). (C) Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells recovered after growing in 3D Matrigel culture for 7 days. (D) Quantification of tumorspheres formed by MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells. Data are presented as mean ± SEM, collected from at least 3 independent experiments. (** = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Multiple Displacement Amplification, Western Blot

    LRIG1 expression in Met receptor positive Basal B breast cancer cells is as effective as Met inhibition (A) Left panel: Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells, treated with and without 0.5 uM ARQ197 for 24 hours, as indicated. Right panel: Western blot analysis of total cell lysates from MDA-MB-157-pMX control and –LRIG1 cells, treated with and without 0.5 uM ARQ197 for 24 hours, as indicated. (B) Migration of pMX control and LRIG1-expressing MDA-MB-231 (top panel) and MDA-MB-157 (bottom panel) cells with and without 0.5 μM ARQ197 was measured after 12 hrs by Boyden chamber transwell migration assay. Data are presented as mean ± SEM, collected from at least 3 independent experiments (** = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 expression in Met receptor positive Basal B breast cancer cells is as effective as Met inhibition (A) Left panel: Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells, treated with and without 0.5 uM ARQ197 for 24 hours, as indicated. Right panel: Western blot analysis of total cell lysates from MDA-MB-157-pMX control and –LRIG1 cells, treated with and without 0.5 uM ARQ197 for 24 hours, as indicated. (B) Migration of pMX control and LRIG1-expressing MDA-MB-231 (top panel) and MDA-MB-157 (bottom panel) cells with and without 0.5 μM ARQ197 was measured after 12 hrs by Boyden chamber transwell migration assay. Data are presented as mean ± SEM, collected from at least 3 independent experiments (** = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing, Inhibition, Western Blot, Multiple Displacement Amplification, Migration, Transwell Migration Assay

    LRIG1 suppresses proliferation and migration of MDA-MB-231 breast cancer cells (A) Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells. Cells are stable, pooled clones. Cells were blotted as indicated. (B) Activity of secreted matrix metalloproteinase-9 (MMP-9) from MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells, measured by gelatin-substrate zymography. (C) Proliferation of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells, measured by manual cell counting at the indicated time points. (D) Migration of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells after 12 hrs (before cell division), measured by Boyden chamber transwell migration assay. Data are presented as mean ± SEM, collected from at least 3 independent experiments. (* = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 suppresses proliferation and migration of MDA-MB-231 breast cancer cells (A) Western blot analysis of total cell lysates from MDA-MB-231-pMX control and –LRIG1 cells. Cells are stable, pooled clones. Cells were blotted as indicated. (B) Activity of secreted matrix metalloproteinase-9 (MMP-9) from MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells, measured by gelatin-substrate zymography. (C) Proliferation of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells, measured by manual cell counting at the indicated time points. (D) Migration of MDA-MB-231-pMX control and MDA-MB-231-pMX-LRIG1 cells after 12 hrs (before cell division), measured by Boyden chamber transwell migration assay. Data are presented as mean ± SEM, collected from at least 3 independent experiments. (* = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Migration, Multiple Displacement Amplification, Western Blot, Clone Assay, Activity Assay, Zymography, Cell Counting, Transwell Migration Assay

    Lrig1 suppresses migration and invasion of MDA-MB-157 breast cancer cells (A) Western blot analysis of whole cell lysates from MDA-MB-157-pMX control and –LRIG1 cells. Cells were blotted as indicated. (B) Phase-contrast images (4x and 10x objectives, as indicated) of MDA-MB-157-pMX control (left) and MDA-MB-157-pMX-LRIG1 (right) cells grown in 3D Matrigel culture for 7 days. The area of structures observed were quantified (n ≥ 60 structures, as shown in far right panel). (C) Migration of MDA-MB-157-pMX control and MDA-MB-157-pMX-LRIG1 cells after 12 hrs, measured by Boyden chamber transwell migration assay. (D) Invasion of MDA-MB-157-pMX control and MDA-MB-157-pMX-LRIG1 cells after 24 hrs, measured by invasion through Collagen I-coated Boyden chambers. Data are presented as mean ± SEM, collected from at least 3 independent experiments (** = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: Lrig1 suppresses migration and invasion of MDA-MB-157 breast cancer cells (A) Western blot analysis of whole cell lysates from MDA-MB-157-pMX control and –LRIG1 cells. Cells were blotted as indicated. (B) Phase-contrast images (4x and 10x objectives, as indicated) of MDA-MB-157-pMX control (left) and MDA-MB-157-pMX-LRIG1 (right) cells grown in 3D Matrigel culture for 7 days. The area of structures observed were quantified (n ≥ 60 structures, as shown in far right panel). (C) Migration of MDA-MB-157-pMX control and MDA-MB-157-pMX-LRIG1 cells after 12 hrs, measured by Boyden chamber transwell migration assay. (D) Invasion of MDA-MB-157-pMX control and MDA-MB-157-pMX-LRIG1 cells after 24 hrs, measured by invasion through Collagen I-coated Boyden chambers. Data are presented as mean ± SEM, collected from at least 3 independent experiments (** = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Migration, Multiple Displacement Amplification, Western Blot, Transwell Migration Assay

    LRIG1 inhibits growth of MDA-MB-231 breast cancer cells in vivo (A) MDA-MB-231-pMX and MDA-MB-231-pMX-LRIG1 cells were xenografted into the mammary fat pad of NOD.SCID female mice and tumor volume was followed over time with caliper measurement. Data are presented as mean ± SEM, * = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 inhibits growth of MDA-MB-231 breast cancer cells in vivo (A) MDA-MB-231-pMX and MDA-MB-231-pMX-LRIG1 cells were xenografted into the mammary fat pad of NOD.SCID female mice and tumor volume was followed over time with caliper measurement. Data are presented as mean ± SEM, * = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Multiple Displacement Amplification, In Vivo, Mouse Assay

    LRIG1 expression is lowest in Basal B breast cancer cells (A) The publicly available database Oncomine was used to assess LRIG1 mRNA expression in the Neve dataset of 51 breast cancer cell lines. Cell lines are categorized into Basal A, Basal B and Luminal. (B) LRIG1 protein expression was assessed by western blotting of total cell lysates from primary human mammary epithelial cells (HMEC), immortalized human mammary epithelial cells (HMLE), luminal breast cancer cells (T47D, MDA-MB-361) Basal-B breast cancer cells (BT549, MDA-MB-157, MDA-MB-231) and derivatives of MDA-MB-231 and MDA-MB-157 cells, as noted. Actin was used as a loading control. All data are representative of at least 3 independent experiments.

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 expression is lowest in Basal B breast cancer cells (A) The publicly available database Oncomine was used to assess LRIG1 mRNA expression in the Neve dataset of 51 breast cancer cell lines. Cell lines are categorized into Basal A, Basal B and Luminal. (B) LRIG1 protein expression was assessed by western blotting of total cell lysates from primary human mammary epithelial cells (HMEC), immortalized human mammary epithelial cells (HMLE), luminal breast cancer cells (T47D, MDA-MB-361) Basal-B breast cancer cells (BT549, MDA-MB-157, MDA-MB-231) and derivatives of MDA-MB-231 and MDA-MB-157 cells, as noted. Actin was used as a loading control. All data are representative of at least 3 independent experiments.

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing, Western Blot, Multiple Displacement Amplification

    LRIG1 knockdown accelerates EMT of human mammary epithelial cells (A) Western blot analysis of total cell lysates collected from stable pooled clones of HMLE-Twist-ER cells expressing control shRNA (shCon) or LRIG1-targeted shRNAs (shLRIG1# 1 and shLRIG1#2). Cell lysates were prepared pre-Twist induction (Day 0) and post-Twist induction (Days 3, 6, 9, 13, 16). Lysates were blotted as indicated with Actin as a loading control. (B) Images (10x objective) of HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells pre-Twist induction (Day 0) and post-Twist induction (Days 3, 6, 9, 13, 16). Scale bar = 20 μm. (C) Confocal immunofluorescence analysis of HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells pre-Twist induction (Day 0) and post-Twist induction (Days 7 and 13). Staining for Vimentin and E-cadherin, as shown. All data are representative of at least 3 independent experiments. Scale bar = 20 μm.

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 knockdown accelerates EMT of human mammary epithelial cells (A) Western blot analysis of total cell lysates collected from stable pooled clones of HMLE-Twist-ER cells expressing control shRNA (shCon) or LRIG1-targeted shRNAs (shLRIG1# 1 and shLRIG1#2). Cell lysates were prepared pre-Twist induction (Day 0) and post-Twist induction (Days 3, 6, 9, 13, 16). Lysates were blotted as indicated with Actin as a loading control. (B) Images (10x objective) of HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells pre-Twist induction (Day 0) and post-Twist induction (Days 3, 6, 9, 13, 16). Scale bar = 20 μm. (C) Confocal immunofluorescence analysis of HMLE-Twist-ER-shCon and HMLE-Twist-ER-shLRIG1#1 and shLRIG1#2 cells pre-Twist induction (Day 0) and post-Twist induction (Days 7 and 13). Staining for Vimentin and E-cadherin, as shown. All data are representative of at least 3 independent experiments. Scale bar = 20 μm.

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Western Blot, Clone Assay, Expressing, shRNA, Immunofluorescence, Staining

    LRIG1 protein expression is increased by lysosomal inhibition in HMLE-Twist-ER cells (A) LRIG1 transcript expression was measured by quantitative real time PCR in HMLE-Twist-ER-shCon cells at Day 0, Day 6 or Day 12 post-Twist induction. (B) HMLE-Twist-ER-shCon cells at Day 0 or Day 12 post-Twist induction were treated with DMSO (Vehicle), 100 nM Concanamycin A (ConA) or 10 μM MG132 for 6hrs. Lysates were then probed for LRIG1, Vimentin and Actin. Samples pre- and post-Twist induction were run on the same blot and are directly comparable. (C) Quantification of data shown in (B) with LRIG1 on the left and Vimentin on the right. Data are presented as mean ± SEM, collected from 3 independent experiments. (* = p

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 protein expression is increased by lysosomal inhibition in HMLE-Twist-ER cells (A) LRIG1 transcript expression was measured by quantitative real time PCR in HMLE-Twist-ER-shCon cells at Day 0, Day 6 or Day 12 post-Twist induction. (B) HMLE-Twist-ER-shCon cells at Day 0 or Day 12 post-Twist induction were treated with DMSO (Vehicle), 100 nM Concanamycin A (ConA) or 10 μM MG132 for 6hrs. Lysates were then probed for LRIG1, Vimentin and Actin. Samples pre- and post-Twist induction were run on the same blot and are directly comparable. (C) Quantification of data shown in (B) with LRIG1 on the left and Vimentin on the right. Data are presented as mean ± SEM, collected from 3 independent experiments. (* = p

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing, Inhibition, Real-time Polymerase Chain Reaction

    LRIG1 induction in HMLE-Twist-ER cells limits expression of EMT markers (A) Western blot analysis of HMLE-Twist-ER-pInducer-LRIG1 cells. “Days Tamoxifen” indicates days of Twist induction. “Dox” indicates when LRIG1 expression was induced with Doxycycline. Total cell lysates were blotted as indicated. (B) Images (4x and 10x objective) of HMLE-Twist-ER-pInducer-LRIG1 cells treated with Tamoxifen to induce Twist (left) or with Tamoxifen and Doxycycline on the indicated day (Day 3, right). All data are representative of at least 3 independent experiments. Scale bar = 200 μm for 4x images, 20 μm for 10x images.

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 induction in HMLE-Twist-ER cells limits expression of EMT markers (A) Western blot analysis of HMLE-Twist-ER-pInducer-LRIG1 cells. “Days Tamoxifen” indicates days of Twist induction. “Dox” indicates when LRIG1 expression was induced with Doxycycline. Total cell lysates were blotted as indicated. (B) Images (4x and 10x objective) of HMLE-Twist-ER-pInducer-LRIG1 cells treated with Tamoxifen to induce Twist (left) or with Tamoxifen and Doxycycline on the indicated day (Day 3, right). All data are representative of at least 3 independent experiments. Scale bar = 200 μm for 4x images, 20 μm for 10x images.

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing, Western Blot

    LRIG1 mRNA expression is lowest in Basal-like breast cancer The publicly available Breast Cancer Gene-Expression Miner v3.0 was used to assess LRIG1 mRNA expression in breast cancer. The prognostic gene expression analysis tool was used with analysis by molecular subtype and RSSPC robust classification. Tumors were segregated into Basal, Her2-positive, Luminal A, Luminal B and Normal and relative mRNA expression plotted.

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: LRIG1 mRNA expression is lowest in Basal-like breast cancer The publicly available Breast Cancer Gene-Expression Miner v3.0 was used to assess LRIG1 mRNA expression in breast cancer. The prognostic gene expression analysis tool was used with analysis by molecular subtype and RSSPC robust classification. Tumors were segregated into Basal, Her2-positive, Luminal A, Luminal B and Normal and relative mRNA expression plotted.

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing

    Inducible expression of LRIG1 decreases expression of mesenchymal markers in MDA-MB-231 and MDA-MB-157 breast cancer cells MDA-MB-231-pInducer-LRIG1 (A) and MDA-MB-157-pInducer-LRIG1 (B) Cells were untreated or treated with Doxycycline to induce LRIG1 expression and blotted for various markers as indicated. All data are representative of at least 3 independent experiments.

    Journal: Oncogene

    Article Title: LRIG1 opposes epithelial to mesenchymal transition and inhibits invasion of basal-like breast cancer cells

    doi: 10.1038/onc.2015.345

    Figure Lengend Snippet: Inducible expression of LRIG1 decreases expression of mesenchymal markers in MDA-MB-231 and MDA-MB-157 breast cancer cells MDA-MB-231-pInducer-LRIG1 (A) and MDA-MB-157-pInducer-LRIG1 (B) Cells were untreated or treated with Doxycycline to induce LRIG1 expression and blotted for various markers as indicated. All data are representative of at least 3 independent experiments.

    Article Snippet: Relative LRIG1 mRNA levels (probe: Hs00394267_m1) were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels for each sample.

    Techniques: Expressing, Multiple Displacement Amplification

    Loss of Runx1 in mdx mice resulted in reduced muscle regeneration. (A and B) Determination of myofibers numbers in mdx muscle. Soleus muscles from 8 weeks old mdx and mdx/Runx1 f/f mice were sectioned, subjected to H E staining, and number of total and regenerating myofibers was determined. (A) Representative images of mdx and mdx/Runx1 f/f sections showing regenerating myofibers with central nuclei, the hallmark of regenerating myofibers, shown at x100 (top) or x200 (bottom). Scale bars, 200μm and 100μm for the x100 and x200 magnification, respectively. (B) Stacked column histograms showing the average number of regenerating myofibers (red) and normal myofibers (blue) in mdx and mdx/Runx1 f/f soleus muscle sections. The number of regenerating (fibers with round and central nuclei) and normal myofibers was counted in 3 H E-stained sections per muscle and their average number calculated. Values are mean±SE (n = 9–13, *** P

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Loss of Runx1 in mdx mice resulted in reduced muscle regeneration. (A and B) Determination of myofibers numbers in mdx muscle. Soleus muscles from 8 weeks old mdx and mdx/Runx1 f/f mice were sectioned, subjected to H E staining, and number of total and regenerating myofibers was determined. (A) Representative images of mdx and mdx/Runx1 f/f sections showing regenerating myofibers with central nuclei, the hallmark of regenerating myofibers, shown at x100 (top) or x200 (bottom). Scale bars, 200μm and 100μm for the x100 and x200 magnification, respectively. (B) Stacked column histograms showing the average number of regenerating myofibers (red) and normal myofibers (blue) in mdx and mdx/Runx1 f/f soleus muscle sections. The number of regenerating (fibers with round and central nuclei) and normal myofibers was counted in 3 H E-stained sections per muscle and their average number calculated. Values are mean±SE (n = 9–13, *** P

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Mouse Assay, Staining

    Analysis of PM high confidence Runx1-regulated genes. (A) Schematic representation of the selection procedures used to identify high-confidence Runx1-regulated genes. Each cylinder represents a gene subset, with the gene number given in brackets. I- Runx1-responsive genes were derived from Runx1 L/L vs. Runx1 f/f PM microarray expression data. II- Runx1-regulated genes were derived by cross analysis of the Runx1-responsive genes dataset and Runx1 ChIP-seq data. This gene subset represents Runx1-responsive genes that are also occupied by Runx1. III- RMJ-regulated genes are Runx1-responsive genes that are co-occupied by Runx1, MyoD and c-Jun. IV- High-confidence Runx1-regulated gene subset are RMJ-regulated genes that were also marked as having adjacent active regulatory elements by both anti histone modifications (H3K4me1 H3K27ac) ChIP-seq and ATAC-seq. (B) Scatter plot of differentially expressed genes in WT vs. Runx1 f/f- PM. Gene expression level (log2 scale) in Runx1 f/f vs. WT PM is plotted. Significant increased or decreased genes are indicated in red or green, respectively. Filled circles indicate Runx1-responsive genes that are known to participate in myoblast proliferation or differentiation. (C) Pie chart depicting Runx1 binding sites distribution in relation to the nearest annotated TSS. Numbers represent % of bound regions. (D) Venn diagram summarizing the overlap between Runx1-ChIP-seq bound genes (ChIP) and Runx1-responsive genes, differentially expressed in Runx1 f/f vs. Runx1 L/L . Runx1-regulated genes are defined as Runx1-bound genes that were also Runx1-responsive. (E) Enriched TF motifs among Runx1-bound regions from PM ChIP-seq data. (F) Overrepresented TF modules in Runx1-bound regions from PM. Runx1 ChIP-seq data was analyzed using the module overrepresentation tool in Genomatix package (RegionMiner). The table presents the most highly enriched modules. (G) Venn diagram showing the overlap of regions bound by Runx1, MyoD and c-Jun and the common fraction of 11629 regions. (H) Cross analysis of all ChIP seq and ATAC-seq common loci with Runx1-responsive gene list (Fig 5B). Prominent genes are presented.

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Analysis of PM high confidence Runx1-regulated genes. (A) Schematic representation of the selection procedures used to identify high-confidence Runx1-regulated genes. Each cylinder represents a gene subset, with the gene number given in brackets. I- Runx1-responsive genes were derived from Runx1 L/L vs. Runx1 f/f PM microarray expression data. II- Runx1-regulated genes were derived by cross analysis of the Runx1-responsive genes dataset and Runx1 ChIP-seq data. This gene subset represents Runx1-responsive genes that are also occupied by Runx1. III- RMJ-regulated genes are Runx1-responsive genes that are co-occupied by Runx1, MyoD and c-Jun. IV- High-confidence Runx1-regulated gene subset are RMJ-regulated genes that were also marked as having adjacent active regulatory elements by both anti histone modifications (H3K4me1 H3K27ac) ChIP-seq and ATAC-seq. (B) Scatter plot of differentially expressed genes in WT vs. Runx1 f/f- PM. Gene expression level (log2 scale) in Runx1 f/f vs. WT PM is plotted. Significant increased or decreased genes are indicated in red or green, respectively. Filled circles indicate Runx1-responsive genes that are known to participate in myoblast proliferation or differentiation. (C) Pie chart depicting Runx1 binding sites distribution in relation to the nearest annotated TSS. Numbers represent % of bound regions. (D) Venn diagram summarizing the overlap between Runx1-ChIP-seq bound genes (ChIP) and Runx1-responsive genes, differentially expressed in Runx1 f/f vs. Runx1 L/L . Runx1-regulated genes are defined as Runx1-bound genes that were also Runx1-responsive. (E) Enriched TF motifs among Runx1-bound regions from PM ChIP-seq data. (F) Overrepresented TF modules in Runx1-bound regions from PM. Runx1 ChIP-seq data was analyzed using the module overrepresentation tool in Genomatix package (RegionMiner). The table presents the most highly enriched modules. (G) Venn diagram showing the overlap of regions bound by Runx1, MyoD and c-Jun and the common fraction of 11629 regions. (H) Cross analysis of all ChIP seq and ATAC-seq common loci with Runx1-responsive gene list (Fig 5B). Prominent genes are presented.

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Selection, Derivative Assay, Microarray, Expressing, Chromatin Immunoprecipitation, Binding Assay

    Runx1 is required for myoblast proliferation during muscle regeneration. Schematic diagram summarizing the scenario of Runx1-regulated myoblast proliferation during muscle regeneration: (A) Following myonecrosis of WT muscle, SC are activated, Runx1 is induced and promote proliferation and prevents premature differentiation. Once the critical mass of myoblasts is reached Runx1 is destined to degradation, myoblasts differentiate to produce normal size myofibers. (B) In Runx f/f muscles, myoblasts lack Runx1 expression and therefore undergo premature differentiation. This leads to insufficient myoblast pool size, resulting in reduced number and size of myofibers and impaired muscle regeneration.

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Runx1 is required for myoblast proliferation during muscle regeneration. Schematic diagram summarizing the scenario of Runx1-regulated myoblast proliferation during muscle regeneration: (A) Following myonecrosis of WT muscle, SC are activated, Runx1 is induced and promote proliferation and prevents premature differentiation. Once the critical mass of myoblasts is reached Runx1 is destined to degradation, myoblasts differentiate to produce normal size myofibers. (B) In Runx f/f muscles, myoblasts lack Runx1 expression and therefore undergo premature differentiation. This leads to insufficient myoblast pool size, resulting in reduced number and size of myofibers and impaired muscle regeneration.

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Expressing

    Loss of Runx1 in mdx mice decreases muscle mass, muscle strength and lifespan. (A) Scatter plot showing weight of Runx1 L/L (WT), Runx1 f/f , mdx and mdx/Runx1 f/f mice between 2–9 months of age (average ±SD, n = 9–28, ** P

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Loss of Runx1 in mdx mice decreases muscle mass, muscle strength and lifespan. (A) Scatter plot showing weight of Runx1 L/L (WT), Runx1 f/f , mdx and mdx/Runx1 f/f mice between 2–9 months of age (average ±SD, n = 9–28, ** P

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Mouse Assay

    Validation of in vivo high confidence Runx1-regulated genes. (A) Volcano plot of differentially expressed genes in soleus muscle of 8 weeks old mdx/Runx1 f/f vs. mdx mice. Fold expression change against p value is plotted. Significant increased or decreased genes are indicated in red or blue, respectively. Filled triangles indicate Runx1-responsive genes that are known to participate in myoblast proliferation or differentiation. (B) Venn diagram summarizing the overlap between mdx Runx1- responsive (RNA-seq) and PM RMJ- regulated gene. These genes are defined as high confidence Runx1- regulated genes in mdx myoblasts. (C to E) UCSC genome browser screenshots showing ChIP-Seq performed in PM and mdx/Runx1 f/f vs. mdx mice RNA- seq tracing examples of high-confidence Runx1-regulated genes. Expression of these genes was quantified by RT-qPCR of cultured Runx1-deficient or-over expressing PM, and in vivo in mdx/Runx1 f/f vs. mdx muscles. Values are mean±SD (n = 3). (C) Myog , encoding Myogenin (** p

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Validation of in vivo high confidence Runx1-regulated genes. (A) Volcano plot of differentially expressed genes in soleus muscle of 8 weeks old mdx/Runx1 f/f vs. mdx mice. Fold expression change against p value is plotted. Significant increased or decreased genes are indicated in red or blue, respectively. Filled triangles indicate Runx1-responsive genes that are known to participate in myoblast proliferation or differentiation. (B) Venn diagram summarizing the overlap between mdx Runx1- responsive (RNA-seq) and PM RMJ- regulated gene. These genes are defined as high confidence Runx1- regulated genes in mdx myoblasts. (C to E) UCSC genome browser screenshots showing ChIP-Seq performed in PM and mdx/Runx1 f/f vs. mdx mice RNA- seq tracing examples of high-confidence Runx1-regulated genes. Expression of these genes was quantified by RT-qPCR of cultured Runx1-deficient or-over expressing PM, and in vivo in mdx/Runx1 f/f vs. mdx muscles. Values are mean±SD (n = 3). (C) Myog , encoding Myogenin (** p

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: In Vivo, Mouse Assay, Expressing, RNA Sequencing Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Cell Culture

    Runx1 expression in response to muscle damage. (A to D). IHC using anti- Runx1 Ab of gastrocnemius muscle from mice subjected to muscle stress. Runx1-positive cells show brown nuclear staining, scale bars, 50 μm. (A) Untreated WT mice. (B) 120 days-old tg-mSOD1 mice. (C) CTX treated WT mice. (D) 2 month old mdx mice. (E) Runx1 and Pax7 IF analysis of CTX-treated WT muscle, scale bars, 50 μm. White arrowheads indicate Runx1 + /Pax7 + cells. (F) IF analysis of cultured proliferating PM using anti- Runx1 and MyoD Abs. DAPI staining was used as a nuclear marker, and myoblasts were visualized by differential interface contrast (DIC) microscopy, scale bars, 50 μm. Results from one of four different experiments with similar findings are shown.

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Runx1 expression in response to muscle damage. (A to D). IHC using anti- Runx1 Ab of gastrocnemius muscle from mice subjected to muscle stress. Runx1-positive cells show brown nuclear staining, scale bars, 50 μm. (A) Untreated WT mice. (B) 120 days-old tg-mSOD1 mice. (C) CTX treated WT mice. (D) 2 month old mdx mice. (E) Runx1 and Pax7 IF analysis of CTX-treated WT muscle, scale bars, 50 μm. White arrowheads indicate Runx1 + /Pax7 + cells. (F) IF analysis of cultured proliferating PM using anti- Runx1 and MyoD Abs. DAPI staining was used as a nuclear marker, and myoblasts were visualized by differential interface contrast (DIC) microscopy, scale bars, 50 μm. Results from one of four different experiments with similar findings are shown.

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Expressing, Immunohistochemistry, Mouse Assay, Staining, Cell Culture, Marker, Microscopy

    Runx1 attenuates PM proliferation. (A to F) Runx1 L/L and Runx1 f/f PM were purified and their proliferation properties were compared. (A) Average doubling time of Runx1 L/L and Runx1 f/f PM cultures. Values are mean±SD (n = 4, ** p

    Journal: PLoS Genetics

    Article Title: Runx1 Transcription Factor Is Required for Myoblasts Proliferation during Muscle Regeneration

    doi: 10.1371/journal.pgen.1005457

    Figure Lengend Snippet: Runx1 attenuates PM proliferation. (A to F) Runx1 L/L and Runx1 f/f PM were purified and their proliferation properties were compared. (A) Average doubling time of Runx1 L/L and Runx1 f/f PM cultures. Values are mean±SD (n = 4, ** p

    Article Snippet: The following Taqman gene expression assays (Applied Biosystems, USA) were used to quantify RNA level: Mm01213404_m1 and Mm0123405_for Runx1 , Mm0044614_m1 for Myog , Mm01340842_m1 for Mef2c , Mm00500665_m1 for Myom2 , Mm00449089_m1 for Tnnt1 , Mm01332564_m1 for Myh2 , Mm01329494_m1 for Myh8 and Mm00446973_m1 for Tbp1 , used as an internal calibrator.

    Techniques: Purification