rlt lysis buffer  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen rlt lysis buffer
    Rlt Lysis Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlt lysis buffer/product/Qiagen
    Average 99 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    rlt lysis buffer - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Irradiation:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA). .. RNA concentrations were normalized across all samples, and 3 mice per time point and treatment group were pooled for subsequent sequencing, generating a total of 10 samples (5 irradiated, 5 sham) for comparison.

    Centrifugation:

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: .. Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RNA from serum was extracted using a Viral RNA mini kit (Qiagen).

    Amplification:

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RT-PCR stages consisted of reverse transcription (50 °C for 30 min), Taq activation (95 °C for 15 min), and amplification (40 cycles at 94 °C for 15 s and 60 °C for 60 s).

    RNA Sequencing Assay:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA isolation and analysis by qPCR and low input RNA sequencing ... Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA).

    Modification:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Briefly, lung digests for qPCR and low input RNA sequencing were obtained via instillation of 1.8 units/ml dispase (Gibco® Life Technologies, Grand Island, NY) in Dulbecco’s modified Eagle medium (DMEM; Gibco Life Technologies) and incubated at room temperature for 45 min. .. Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA).

    Concentration Assay:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: .. Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA). .. RNA concentrations were normalized across all samples, and 3 mice per time point and treatment group were pooled for subsequent sequencing, generating a total of 10 samples (5 irradiated, 5 sham) for comparison.

    Isolation:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA isolation and analysis by qPCR and low input RNA sequencing ... Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA).

    RNA Extraction:

    Article Title: Inhibition of NF-κB activity by the porcine epidemic diarrhea virus nonstructural protein 1 for innate immune evasion.
    Article Snippet: .. RNA extraction and quantitative real-time RT-PCR Cells were washed with PBS and lysed with RLT lysis buffer (QIAGEN). .. Total cellular RNA was extracted using RNeasy mini kit according to the manufacturer's instructions (QIAGEN).

    Quantitative RT-PCR:

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RT-qPCR detection of ANDV and SNV S segment RNA was performed on a StepOne Plus instrument (Applied Biosystems, Foster City, CA, USA) using a one-step protocol with a QuantiTect Probe RT-PCR (Qiagen) kit and SNV and ANDV-specific primers and probes (SNVforw—GCAGACGGGCAGCTGTG; SNVrev—AGATCAGCCAGTTCCCGCT; SNVProbe—5′FAM-TGCATTGGAGACCAAACTCGGAGAACTC-TAMRA; ANDVforw—AAGGCAGTGGAGGTGGAC; ANDVrev—CCCTGTTGGATCAACTGGTT; ANDVProbe—FAM-ACGGGCAGCTGTGTCTACATTGGA-TAMRA) according to manufacturer’s instructions.

    Article Title: Inhibition of NF-κB activity by the porcine epidemic diarrhea virus nonstructural protein 1 for innate immune evasion.
    Article Snippet: .. RNA extraction and quantitative real-time RT-PCR Cells were washed with PBS and lysed with RLT lysis buffer (QIAGEN). .. Total cellular RNA was extracted using RNeasy mini kit according to the manufacturer's instructions (QIAGEN).

    Mouse Assay:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA). .. RNA concentrations were normalized across all samples, and 3 mice per time point and treatment group were pooled for subsequent sequencing, generating a total of 10 samples (5 irradiated, 5 sham) for comparison.

    Real-time Polymerase Chain Reaction:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Paragraph title: RNA isolation and analysis by qPCR and low input RNA sequencing ... Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA).

    Activation Assay:

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RT-PCR stages consisted of reverse transcription (50 °C for 30 min), Taq activation (95 °C for 15 min), and amplification (40 cycles at 94 °C for 15 s and 60 °C for 60 s).

    Incubation:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Briefly, lung digests for qPCR and low input RNA sequencing were obtained via instillation of 1.8 units/ml dispase (Gibco® Life Technologies, Grand Island, NY) in Dulbecco’s modified Eagle medium (DMEM; Gibco Life Technologies) and incubated at room temperature for 45 min. .. Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA).

    Sequencing:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA). .. RNA concentrations were normalized across all samples, and 3 mice per time point and treatment group were pooled for subsequent sequencing, generating a total of 10 samples (5 irradiated, 5 sham) for comparison.

    Lysis:

    Article Title: Recurrent DNA Damage is Associated with Persistent Injury in Progressive Radiation-induced Pulmonary Fibrosis
    Article Snippet: .. Following collection of cells in RLT Lysis buffer, total RNA was obtained utilizing the Qiagen RNeasy Mini Kit (Qaigen, Hilde, Germany) and RNA quality and concentration per sample was determined through the use of the Agilent 2100 bioanalyzer (Agilent technologies, Santa Clara, CA). .. RNA concentrations were normalized across all samples, and 3 mice per time point and treatment group were pooled for subsequent sequencing, generating a total of 10 samples (5 irradiated, 5 sham) for comparison.

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: .. Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RNA from serum was extracted using a Viral RNA mini kit (Qiagen).

    Article Title: Inhibition of NF-κB activity by the porcine epidemic diarrhea virus nonstructural protein 1 for innate immune evasion.
    Article Snippet: .. RNA extraction and quantitative real-time RT-PCR Cells were washed with PBS and lysed with RLT lysis buffer (QIAGEN). .. Total cellular RNA was extracted using RNeasy mini kit according to the manufacturer's instructions (QIAGEN).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Vesicular Stomatitis Virus-Based Vaccines Provide Cross-Protection against Andes and Sin Nombre Viruses
    Article Snippet: Detection of ANDV and SNV RNA At days 4 and 7 post-infection, hamster tissues were collected and homogenized in 600 µL RLT lysis buffer (Qiagen, Hilden, Germany), clarified by centrifugation, diluted to 30 mg equivalents in RLT lysis buffer, and extracted using an RNeasy mini kit (Qiagen). .. RT-qPCR detection of ANDV and SNV S segment RNA was performed on a StepOne Plus instrument (Applied Biosystems, Foster City, CA, USA) using a one-step protocol with a QuantiTect Probe RT-PCR (Qiagen) kit and SNV and ANDV-specific primers and probes (SNVforw—GCAGACGGGCAGCTGTG; SNVrev—AGATCAGCCAGTTCCCGCT; SNVProbe—5′FAM-TGCATTGGAGACCAAACTCGGAGAACTC-TAMRA; ANDVforw—AAGGCAGTGGAGGTGGAC; ANDVrev—CCCTGTTGGATCAACTGGTT; ANDVProbe—FAM-ACGGGCAGCTGTGTCTACATTGGA-TAMRA) according to manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rlt buffer
    Depleting the microbiota limits infant Ccl2 expression and accelerates pneumococcal clearance. (A) Breeding pairs were placed on sterile filtered tap water or water containing 5 antibiotics (Abx) for at least 5 days prior to giving birth, and continued until the infant mice were 10d old. Mice were sacrificed, and nasal lavages obtained with PBS. DNA was isolated from lavage fluid, and qPCR used to measure the number of copies of 16S bacterial ribosomal DNA. (B-C) Adult mice were maintained on sterile filtered tap water or water containing 5 antibiotics for at least 2 weeks. Breeding pairs were provided water as above. Mice were sacrificed, and nasal lavages obtained with <t>RLT</t> lysis buffer. RNA was isolated and reverse-transcribed into cDNA, and <t>qRT-PCR</t> used to measure relative expression of Ccl2 (B) and Ccl7 (C) in the nasopharynx. (D) Infant mice were exposed to tap water or antibiotics as in the previously described protocol. Treatments were continued until infant mice were 6d old, then all mice were given tap water to drink. 24 hrs later, mice were inoculated with pneumococci. At 7 dpi, mice were sacrificed and nasal lavages fixed and stained for flow cytometry to measure the number of macrophages present in the airway lumen. (E-F) Infant mice were treated as in (D). At 14d (E) and 7d (F) post-inoculation, mice were sacrificed. Nasal lavages were obtained and plated on media containing neomycin and catalase to measure pneumococcal density in the URT. (G) Ccl2 expression was measured in the nasopharynx of tap- or antibiotic-water exposed conventionally-reared (Conv), or germ-free infant mice. Data are represented as mean +/- SEM. Horizontal lines indicate median values. n.s., not significant. * = p
    Rlt Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1553 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rlt buffer/product/Qiagen
    Average 99 stars, based on 1553 article reviews
    Price from $9.99 to $1999.99
    rlt buffer - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Depleting the microbiota limits infant Ccl2 expression and accelerates pneumococcal clearance. (A) Breeding pairs were placed on sterile filtered tap water or water containing 5 antibiotics (Abx) for at least 5 days prior to giving birth, and continued until the infant mice were 10d old. Mice were sacrificed, and nasal lavages obtained with PBS. DNA was isolated from lavage fluid, and qPCR used to measure the number of copies of 16S bacterial ribosomal DNA. (B-C) Adult mice were maintained on sterile filtered tap water or water containing 5 antibiotics for at least 2 weeks. Breeding pairs were provided water as above. Mice were sacrificed, and nasal lavages obtained with RLT lysis buffer. RNA was isolated and reverse-transcribed into cDNA, and qRT-PCR used to measure relative expression of Ccl2 (B) and Ccl7 (C) in the nasopharynx. (D) Infant mice were exposed to tap water or antibiotics as in the previously described protocol. Treatments were continued until infant mice were 6d old, then all mice were given tap water to drink. 24 hrs later, mice were inoculated with pneumococci. At 7 dpi, mice were sacrificed and nasal lavages fixed and stained for flow cytometry to measure the number of macrophages present in the airway lumen. (E-F) Infant mice were treated as in (D). At 14d (E) and 7d (F) post-inoculation, mice were sacrificed. Nasal lavages were obtained and plated on media containing neomycin and catalase to measure pneumococcal density in the URT. (G) Ccl2 expression was measured in the nasopharynx of tap- or antibiotic-water exposed conventionally-reared (Conv), or germ-free infant mice. Data are represented as mean +/- SEM. Horizontal lines indicate median values. n.s., not significant. * = p

    Journal: PLoS Pathogens

    Article Title: Clearance of Pneumococcal Colonization in Infants Is Delayed through Altered Macrophage Trafficking

    doi: 10.1371/journal.ppat.1005004

    Figure Lengend Snippet: Depleting the microbiota limits infant Ccl2 expression and accelerates pneumococcal clearance. (A) Breeding pairs were placed on sterile filtered tap water or water containing 5 antibiotics (Abx) for at least 5 days prior to giving birth, and continued until the infant mice were 10d old. Mice were sacrificed, and nasal lavages obtained with PBS. DNA was isolated from lavage fluid, and qPCR used to measure the number of copies of 16S bacterial ribosomal DNA. (B-C) Adult mice were maintained on sterile filtered tap water or water containing 5 antibiotics for at least 2 weeks. Breeding pairs were provided water as above. Mice were sacrificed, and nasal lavages obtained with RLT lysis buffer. RNA was isolated and reverse-transcribed into cDNA, and qRT-PCR used to measure relative expression of Ccl2 (B) and Ccl7 (C) in the nasopharynx. (D) Infant mice were exposed to tap water or antibiotics as in the previously described protocol. Treatments were continued until infant mice were 6d old, then all mice were given tap water to drink. 24 hrs later, mice were inoculated with pneumococci. At 7 dpi, mice were sacrificed and nasal lavages fixed and stained for flow cytometry to measure the number of macrophages present in the airway lumen. (E-F) Infant mice were treated as in (D). At 14d (E) and 7d (F) post-inoculation, mice were sacrificed. Nasal lavages were obtained and plated on media containing neomycin and catalase to measure pneumococcal density in the URT. (G) Ccl2 expression was measured in the nasopharynx of tap- or antibiotic-water exposed conventionally-reared (Conv), or germ-free infant mice. Data are represented as mean +/- SEM. Horizontal lines indicate median values. n.s., not significant. * = p

    Article Snippet: qRT-PCR RNA was obtained from URT epithelium by lavage with RLT buffer (Qiagen) with 1% β-mercaptoethanol, or from cultured peritoneal macrophages by lysing cells in RLT buffer with 1% β-mercaptoethanol and frozen at -80°C until used.

    Techniques: Expressing, Mouse Assay, Isolation, Real-time Polymerase Chain Reaction, Lysis, Quantitative RT-PCR, Staining, Flow Cytometry, Cytometry

    Infant mice do not form a gradient of CCL2 expression during colonization. (A) Adult (42d old) and infant (7d old) mice were inoculated with PBS (mock) or pneumococci. At 3d post-inoculation, nasal lavages were obtained with RLT lysis buffer, and RNA was isolated and reverse transcribed to cDNA. qRT-PCR was performed to measure relative expression of Ccl2 . (B) Serum was obtained from adult and infant mice, and ELISA used to measure CCL2 levels. (C-D) Peritoneal macrophages from adult and infant mice were lysed with RLT buffer and RNA isolated. qRT-PCR was used to measure relative expression of Ccl2 (C) and Ccr2 (D). In (C), cultured macrophages were incubated overnight with PBS (Mock) or heat-killed bacterial lysates (Stim) prior to lysis. (E-H) Uncolonized adult and infant mice were sacrificed, and nasal lavages obtained with RLT lysis buffer. RNA was isolated and reverse-transcribed into cDNA. qRT-PCR was used to measure relative expression of Ccl7 , (E) Il6 , (F) Cxcl1 , (G) and Cxcl2 (H). Data are represented as mean +/- SEM. n.s., not significant. * = p

    Journal: PLoS Pathogens

    Article Title: Clearance of Pneumococcal Colonization in Infants Is Delayed through Altered Macrophage Trafficking

    doi: 10.1371/journal.ppat.1005004

    Figure Lengend Snippet: Infant mice do not form a gradient of CCL2 expression during colonization. (A) Adult (42d old) and infant (7d old) mice were inoculated with PBS (mock) or pneumococci. At 3d post-inoculation, nasal lavages were obtained with RLT lysis buffer, and RNA was isolated and reverse transcribed to cDNA. qRT-PCR was performed to measure relative expression of Ccl2 . (B) Serum was obtained from adult and infant mice, and ELISA used to measure CCL2 levels. (C-D) Peritoneal macrophages from adult and infant mice were lysed with RLT buffer and RNA isolated. qRT-PCR was used to measure relative expression of Ccl2 (C) and Ccr2 (D). In (C), cultured macrophages were incubated overnight with PBS (Mock) or heat-killed bacterial lysates (Stim) prior to lysis. (E-H) Uncolonized adult and infant mice were sacrificed, and nasal lavages obtained with RLT lysis buffer. RNA was isolated and reverse-transcribed into cDNA. qRT-PCR was used to measure relative expression of Ccl7 , (E) Il6 , (F) Cxcl1 , (G) and Cxcl2 (H). Data are represented as mean +/- SEM. n.s., not significant. * = p

    Article Snippet: qRT-PCR RNA was obtained from URT epithelium by lavage with RLT buffer (Qiagen) with 1% β-mercaptoethanol, or from cultured peritoneal macrophages by lysing cells in RLT buffer with 1% β-mercaptoethanol and frozen at -80°C until used.

    Techniques: Mouse Assay, Expressing, Lysis, Isolation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Cell Culture, Incubation

    CCL2 overexpression increases macrophage recruitment and pneumococcal clearance. (A-C) Mice were inoculated with a control (GFP-expressing) or a CCL2-expressing AAV5 vector at 4d of age, followed by pneumococcal colonization at 7d old. Seven and 21 days later, mice were sacrificed and nasal lavages were obtained with RLT lysis buffer. (A) RNA was isolated and cDNA reverse-transcribed, followed by qRT-PCR to measure the relative expression of Ccl2 in the upper respiratory tract, using primers Ccl2 ORF-F and Ccl2 ORF-R. ELISA was used to measure CCL2 protein levels in nasal lavage (B) and serum (C) at 7 and 21 dpi. (D) Mice were inoculated with a control (GFP-expressing) or a CCL2-expressing AAV5 vector at 4d of age, followed by pneumococcal colonization at 7d of age. Seven days later, mice were sacrificed, nasal lavages obtained and flow cytometry used to measure macrophage recruitment. (E) At 21d post-inoculation, nasal lavages were obtained and plated to measure the pneumococcal load in the nasopharynx. Data are represented as mean +/- SEM. n.s., not significant. * = p

    Journal: PLoS Pathogens

    Article Title: Clearance of Pneumococcal Colonization in Infants Is Delayed through Altered Macrophage Trafficking

    doi: 10.1371/journal.ppat.1005004

    Figure Lengend Snippet: CCL2 overexpression increases macrophage recruitment and pneumococcal clearance. (A-C) Mice were inoculated with a control (GFP-expressing) or a CCL2-expressing AAV5 vector at 4d of age, followed by pneumococcal colonization at 7d old. Seven and 21 days later, mice were sacrificed and nasal lavages were obtained with RLT lysis buffer. (A) RNA was isolated and cDNA reverse-transcribed, followed by qRT-PCR to measure the relative expression of Ccl2 in the upper respiratory tract, using primers Ccl2 ORF-F and Ccl2 ORF-R. ELISA was used to measure CCL2 protein levels in nasal lavage (B) and serum (C) at 7 and 21 dpi. (D) Mice were inoculated with a control (GFP-expressing) or a CCL2-expressing AAV5 vector at 4d of age, followed by pneumococcal colonization at 7d of age. Seven days later, mice were sacrificed, nasal lavages obtained and flow cytometry used to measure macrophage recruitment. (E) At 21d post-inoculation, nasal lavages were obtained and plated to measure the pneumococcal load in the nasopharynx. Data are represented as mean +/- SEM. n.s., not significant. * = p

    Article Snippet: qRT-PCR RNA was obtained from URT epithelium by lavage with RLT buffer (Qiagen) with 1% β-mercaptoethanol, or from cultured peritoneal macrophages by lysing cells in RLT buffer with 1% β-mercaptoethanol and frozen at -80°C until used.

    Techniques: Over Expression, Mouse Assay, Expressing, Plasmid Preparation, Lysis, Isolation, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Flow Cytometry, Cytometry

    Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with RLT lysis buffer were obtained to isolate host RNA. Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p

    Journal: Nature microbiology

    Article Title: Pneumococcal quorum sensing drives an asymmetric owner-intruder competitive strategy during carriage via the competence regulon

    doi: 10.1038/s41564-018-0314-4

    Figure Lengend Snippet: Asymmetric competition is dependent on direct interactions between resident and challenger pneumococci. a, Day 4–5 old pups were inoculated with a heat-killed serotype 23F resident strain (10 5 CFU) for 6h before introduction of the live isogenic challenger strain with increasing CFU (10 1 -10 3 ). Nasal lavages were cultured 3 days later to determine challenger colonization densities, n=3–4. Median values are shown. b, Pups were inoculated with live (10 3 CFU) or heat-killed (10 5 CFU) resident strain for 6h and nasal lavages with RLT lysis buffer were obtained to isolate host RNA. Early inflammatory cytokine expression levels were assessed by SYBR green real-time quantitative RT-PCR. Cytokine expression induced by heat-killed S. pneumoniae were shown as fold change relative to that elicited by live bacteria, n=5–6. Data are shown as mean ± SEM. c-d, Pups were inoculated with either a streptomycin sensitive ( c ) or resistant ( d ) resident strain for 3 days before intranasal administration of streptomycin. An isogenic streptomycin resistant challenger was inoculated 6h later and its colonization density determined after 3 days. Median values are shown. Colonization levels by 10 1 CFU challenger alone, and in resident-colonized pups treated with either phosphate buffered saline (PBS) or streptomycin, were compared by Kruskal–Wallis one-way analysis of variance in ( d ), n=4–8, * p

    Article Snippet: To obtain host RNA, nasal lavages with RLT lysis buffer (Qiagen) were performed and RNA isolated with the RNeasy minikit (Qiagen) as previously described . cDNA was reverse transcribed using a high-capacity cDNA kit (Applied Biosystems) following the manufacturer’s instructions.

    Techniques: Cell Culture, Lysis, Expressing, SYBR Green Assay, Quantitative RT-PCR

    RNA integrity of some RNA samples after enrichment with buffer RLT, Triton X-100 and bead beating. Electropherogram profiles were determined with a Fragment Analyzer. Quality for Fragment Analyzer is shown as the RQN value. Reported on a scale of 1 to 10, with higher values indicating a better quality of total RNA. Values above 7 are considered to represent high quality and non-degraded RNA.

    Journal: Scientific Reports

    Article Title: Nucleic acids enrichment of fungal pathogens to study host-pathogen interactions

    doi: 10.1038/s41598-019-54608-x

    Figure Lengend Snippet: RNA integrity of some RNA samples after enrichment with buffer RLT, Triton X-100 and bead beating. Electropherogram profiles were determined with a Fragment Analyzer. Quality for Fragment Analyzer is shown as the RQN value. Reported on a scale of 1 to 10, with higher values indicating a better quality of total RNA. Values above 7 are considered to represent high quality and non-degraded RNA.

    Article Snippet: In addition, using qPCR and RT-qPCR, we demonstrated that after cell lysis with Buffer RLT, both fungal DNA and RNA can be further enriched by means of a centrifugation step that effectively reduced human nucleic acids.

    Techniques:

    Fhl2 upregulation induced by BG-enriched compounds is under the control of Dectin-1. (A) Wild-type WT or Clec7a −/− bone marrow-derived macrophages (BMDM) were pre-treated as described in Figure 4 A. Fhl2 expression was determined by RT-qPCR as described for Csf2 . (B) WT or Clec7a −/− BMDM were stimulated with BG-containing compounds for 8 h. At the end of the incubation, BMDM were lysed in RLT lysis buffer. After RNA extraction, cDNA synthesis and RT-qPCR were performed. Data are expressed as the fold change (FC) related to the mock condition value and are representative of two experiments performed in triplicate. (C) WT BMDM were stimulated following the same protocol as in (A) . After incubation, BMDM were lysed in RIPA buffer supplemented with 5 mM EDTA and protease inhibitor (Pierce™). After clarification and protein quantitation, 10 mg of total lysates were separated on a polyacrylamide gel. After transfer, nitrocellulose membrane was subjected to Western blotting with anti-FHL2 (F4B2-B11) and anti-β-actin (C4) mAbs (Santa Cruz Biotechnologies). Blotting was revealed using chemiluminescence. Results are also presented as the relative quantity of FHL2 protein detected in each condition as compared to the reference corresponding to the unstimulated cells. The data are representative of three independent experiments.

    Journal: Frontiers in Immunology

    Article Title: Molecular Analysis of a Short-term Model of β-Glucans-Trained Immunity Highlights the Accessory Contribution of GM-CSF in Priming Mouse Macrophages Response

    doi: 10.3389/fimmu.2017.01089

    Figure Lengend Snippet: Fhl2 upregulation induced by BG-enriched compounds is under the control of Dectin-1. (A) Wild-type WT or Clec7a −/− bone marrow-derived macrophages (BMDM) were pre-treated as described in Figure 4 A. Fhl2 expression was determined by RT-qPCR as described for Csf2 . (B) WT or Clec7a −/− BMDM were stimulated with BG-containing compounds for 8 h. At the end of the incubation, BMDM were lysed in RLT lysis buffer. After RNA extraction, cDNA synthesis and RT-qPCR were performed. Data are expressed as the fold change (FC) related to the mock condition value and are representative of two experiments performed in triplicate. (C) WT BMDM were stimulated following the same protocol as in (A) . After incubation, BMDM were lysed in RIPA buffer supplemented with 5 mM EDTA and protease inhibitor (Pierce™). After clarification and protein quantitation, 10 mg of total lysates were separated on a polyacrylamide gel. After transfer, nitrocellulose membrane was subjected to Western blotting with anti-FHL2 (F4B2-B11) and anti-β-actin (C4) mAbs (Santa Cruz Biotechnologies). Blotting was revealed using chemiluminescence. Results are also presented as the relative quantity of FHL2 protein detected in each condition as compared to the reference corresponding to the unstimulated cells. The data are representative of three independent experiments.

    Article Snippet: Microarray Analysis After stimulation with Sc BG compounds and then with ultraPure LPS, BMDM were lysed in Buffer RLT (Qiagen, Hilden, Germany) and was subjected to RNA extraction using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

    Techniques: Derivative Assay, Expressing, Quantitative RT-PCR, Incubation, Lysis, RNA Extraction, Protease Inhibitor, Clarification Assay, Protein Quantitation, Western Blot

    Csf2 upregulation induced by BG-enriched compounds treatment and lipopolysaccharide (LPS) exposure is mainly Dectin-1-dependent. Wild-type or Clec7a −/− bone marrow-derived macrophages (BMDM) were stimulated with 100 µg/mL of the various BG-containing compounds for 8 h. After incubation, cell culture supernatants were removed and 100 ng/mL of ultraPure LPS or medium was added in each well for 8 h (A) or 48 h (B) . (A) Supernatants were discarded and BMDM were lysed in RLT lysis buffer. Total RNA was extracted as described before and retro-transcribed. Csf2 expression was determined by quantitative PCR after normalization with three housekeeping genes ( Sdha, Rpl9 , and Hprt1 ). Fold change (FC) data are expressed as the mean ± SD as compared to the mock condition in three independent experiments. Mean values not sharing the same letter are significantly different according to the Student’s t -tes t ( p

    Journal: Frontiers in Immunology

    Article Title: Molecular Analysis of a Short-term Model of β-Glucans-Trained Immunity Highlights the Accessory Contribution of GM-CSF in Priming Mouse Macrophages Response

    doi: 10.3389/fimmu.2017.01089

    Figure Lengend Snippet: Csf2 upregulation induced by BG-enriched compounds treatment and lipopolysaccharide (LPS) exposure is mainly Dectin-1-dependent. Wild-type or Clec7a −/− bone marrow-derived macrophages (BMDM) were stimulated with 100 µg/mL of the various BG-containing compounds for 8 h. After incubation, cell culture supernatants were removed and 100 ng/mL of ultraPure LPS or medium was added in each well for 8 h (A) or 48 h (B) . (A) Supernatants were discarded and BMDM were lysed in RLT lysis buffer. Total RNA was extracted as described before and retro-transcribed. Csf2 expression was determined by quantitative PCR after normalization with three housekeeping genes ( Sdha, Rpl9 , and Hprt1 ). Fold change (FC) data are expressed as the mean ± SD as compared to the mock condition in three independent experiments. Mean values not sharing the same letter are significantly different according to the Student’s t -tes t ( p

    Article Snippet: Microarray Analysis After stimulation with Sc BG compounds and then with ultraPure LPS, BMDM were lysed in Buffer RLT (Qiagen, Hilden, Germany) and was subjected to RNA extraction using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

    Techniques: Derivative Assay, Incubation, Cell Culture, Lysis, Expressing, Real-time Polymerase Chain Reaction