ribonucleic acid sirna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher ribonucleic acid sirna
    Dasatinib does not function via <t>Src</t> kinase in non-metastatic ccRCC cell lines. a Western blots and showing <t>siRNA</t> knockdown of NT or Src kinase in 769-P and 786–O. b - c Graph showing effect of 1, 10, 50 and 100 nM Dasatinib (dark bars) and saracatinib (light bars) on ( b ) proliferation and ( c ) apoptosis in the presence of NT (solid bars) and Src siRNA (checked bars) in 769-P and 786-O cells. d , e Photographs and ( f ) quantification graphs showing effects of inhibitors on migration as assessed by wound healing in 769-P and 786-O cells ( n = 3-4; * = 0.05, ** = 0.01, *** = 0.001)
    Ribonucleic Acid Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribonucleic acid sirna/product/Thermo Fisher
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ribonucleic acid sirna - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "Nuclear expression of Lyn, a Src family kinase member, is associated with poor prognosis in renal cancer patients"

    Article Title: Nuclear expression of Lyn, a Src family kinase member, is associated with poor prognosis in renal cancer patients

    Journal: BMC Cancer

    doi: 10.1186/s12885-016-2254-9

    Dasatinib does not function via Src kinase in non-metastatic ccRCC cell lines. a Western blots and showing siRNA knockdown of NT or Src kinase in 769-P and 786–O. b - c Graph showing effect of 1, 10, 50 and 100 nM Dasatinib (dark bars) and saracatinib (light bars) on ( b ) proliferation and ( c ) apoptosis in the presence of NT (solid bars) and Src siRNA (checked bars) in 769-P and 786-O cells. d , e Photographs and ( f ) quantification graphs showing effects of inhibitors on migration as assessed by wound healing in 769-P and 786-O cells ( n = 3-4; * = 0.05, ** = 0.01, *** = 0.001)
    Figure Legend Snippet: Dasatinib does not function via Src kinase in non-metastatic ccRCC cell lines. a Western blots and showing siRNA knockdown of NT or Src kinase in 769-P and 786–O. b - c Graph showing effect of 1, 10, 50 and 100 nM Dasatinib (dark bars) and saracatinib (light bars) on ( b ) proliferation and ( c ) apoptosis in the presence of NT (solid bars) and Src siRNA (checked bars) in 769-P and 786-O cells. d , e Photographs and ( f ) quantification graphs showing effects of inhibitors on migration as assessed by wound healing in 769-P and 786-O cells ( n = 3-4; * = 0.05, ** = 0.01, *** = 0.001)

    Techniques Used: Western Blot, Migration

    2) Product Images from "Highly glycosylated CD147 promotes hemorrhagic transformation after rt-PA treatment in diabetes: a novel therapeutic target?"

    Article Title: Highly glycosylated CD147 promotes hemorrhagic transformation after rt-PA treatment in diabetes: a novel therapeutic target?

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-019-1460-1

    Caveolin-1 binds to CD147 and upregulates its glycosylation. a CD147 and caveolin-1 co-localize in astrocytes and endothelium. b Caveolin-1 silencing by siRNA downregulates HG-CD147 in astrocytes and endothelial cells treated with AGEs and rt-PA. c , d Decrease of HG-CD147 reduces MMPs activities. Data expressed as mean ± SD and analyzed by one-way ANOVA test. One asterisk (*) represents P
    Figure Legend Snippet: Caveolin-1 binds to CD147 and upregulates its glycosylation. a CD147 and caveolin-1 co-localize in astrocytes and endothelium. b Caveolin-1 silencing by siRNA downregulates HG-CD147 in astrocytes and endothelial cells treated with AGEs and rt-PA. c , d Decrease of HG-CD147 reduces MMPs activities. Data expressed as mean ± SD and analyzed by one-way ANOVA test. One asterisk (*) represents P

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: A full-length human Ets-1 and dominant-negative (DN) Ets-1 constructs cloned into pCDNA3.1 (−) neovector were kind gifts from Dr. Stephen Lee (Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario, Canada). .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen).

    Immunocytochemistry:

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA. .. Co-transfection of YFP allowed visualisation of transfected neurons, and knock down was confirmed by immunocytochemistry (not shown).

    Cytometry:

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA). .. To investigate surface Ddc silencing, or haemocyte phagocytosis, cells were processed as described earlier and analysed by flow cytometry.

    Construct:

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: For transient transfection, the cells were transfected using Lipofectamine 2000 (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol with either mammalian expression constructs for Ets-1 or DN Ets-1 ( ). .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. After 72 hours of the transfection process, hTERT cells were infected with B. abortus or mutant strain Δ1520 (MOI 100) or transfected with bacterial DNA (1μg) and the supernatant was collected after 17 hours to measure human CXCL10 by ELISA.

    Incubation:

    Article Title: The Cytosolic Pattern Recognition Receptor NOD1 Induces Inflammatory Interleukin-8 during Chlamydia trachomatis Infection
    Article Snippet: Subconfluent HeLa cells in a six-well plate were transfected with small interfering RNA (siRNA) purchased from Ambion or a negative (nonspecific) siRNA (Dharmacon, Lafayette, CO) control using Oligofectamine (Invitrogen) (Silencer predesigned siRNAs 2680 CARD4 [NOD1], 455 RIPK2 [RIP2], and 242558 MYD88). .. Oligofectamine and Opti-MEM medium (Invitrogen) at a 1:8 ratio were vortexed for 1 s and incubated for 5 min at room temperature.

    Article Title:
    Article Snippet: For transfections, silencer Negative control 1 small interfering RNA (siRNA) and AAK1-specific (sense: 5′-GGUGUGCAAGAGAGAAAUCtt-3′; antisense: 5′-GAUUUCUCUCUUGCACACCtg-3′) siRNAs were obtained from Ambion (Austin, TX). tTA HeLa cells (1 × 105 ) were seeded into each well of a six-well dish containing glass coverslips. .. For transferrin recycling assays, cells were incubated overnight at 37°C in DMEM containing 10% fetal bovine calf serum.

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. Culture medium was replaced 48 hrs after transfection with DMEM supplemented with 10% heat-inactivated fetal bovine serum, pen-strep, 20% 199 media, sodium pyruvate, L-glutamine solution and the cells were incubated for additional 24 hrs.

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: To silence Ddc, isolated haemocytes (5 × 105 cells) were incubated in 100 µl of Grace's insect medium for 7 hr. .. Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA).

    Cell Culture:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: Paragraph title: Cell culture, transfection, drugs and RNA interference ... Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2.

    Article Title: Enhanced response of melanoma cells to MEK inhibitors following unbiased IGF-1R down-regulation
    Article Snippet: .. siRNA transfection Cells were transfected with small interfering RNA (siRNA) against IGF-1R (Ambion, Life Technologies, s7211, 5’ GCAUGGUAGCCGAAGAUUUtt 3’) using reverse transfection (adding suspended cells to transfection mixture in cell culture vessels) and RNAiMAX (Life Technologies) according to manufacturer’s protocol. .. SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) and western blot analysis Cell lysates were prepared and subjected to western blot (WB) analysis as described in detail elsewhere [ ].

    Expressing:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: Transgene expression was induced with 1 μg/ml doxycycline (Sigma). .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2.

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. Cell transfection with small interfering RNA (siRNA) We used siRNA to knock-down the expression of EGFR and human MIO-M1 cells plated in 6-well dishes were transfected in the absence of serum and antibiotics with non-specific target (Stealth RNAi Negative Control Duplex, Cat # 12935–300, Invitrogen, Carlsbad, CA) or EGFR-siRNA ( 5′-GGAUCCCAGAAGAAGGUGAGAAAGUUAA- 3′ , Accession no. NM_005228.3) with Lipofectamine RNAi-MAX (Cat # 13778–030, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. After 48 h of EGFR siRNA transfection, cells were treated with IRL1620 (5 μM) or vehicle and were analyzed after 10 min for effects on EGFR, phospho-EGFR (Y1173) and phospho-ERK1/2 levels.

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: For transient transfection, the cells were transfected using Lipofectamine 2000 (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol with either mammalian expression constructs for Ets-1 or DN Ets-1 ( ). .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen).

    Modification:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: We cultured Flp-In T-REx™ HEK293, SH-SY5Y and HEK293T cells in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum. .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2.

    Western Blot:

    Article Title: Immunogenic cell death due to a new photodynamic therapy (PDT) with glycoconjugated chlorin (G-chlorin)
    Article Snippet: Small interfering RNA transfections CT26 cells were transfected with small interfering RNA (siRNA) for either CRT or HMGB1 (Ambion, Beverly, MA) using Lipofectamine reagent (Invitrogen) according to manufacturer instructions. .. At 48 hours after transfection, CT26 cells were assessed for total content of each protein by western blotting.

    Transfection:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2. .. Western blot analysis Cells were lysed with RIPA buffer (25 mM Tris–HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate and 0.1% sodium dodecyl sulphate) supplemented with protease inhibitor cocktail (Sigma) and centrifuged at 12,000 ×g for 10 min at 4°C.

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. Cell transfection with small interfering RNA (siRNA) We used siRNA to knock-down the expression of EGFR and human MIO-M1 cells plated in 6-well dishes were transfected in the absence of serum and antibiotics with non-specific target (Stealth RNAi Negative Control Duplex, Cat # 12935–300, Invitrogen, Carlsbad, CA) or EGFR-siRNA ( 5′-GGAUCCCAGAAGAAGGUGAGAAAGUUAA- 3′ , Accession no. NM_005228.3) with Lipofectamine RNAi-MAX (Cat # 13778–030, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. After 48 h of EGFR siRNA transfection, cells were treated with IRL1620 (5 μM) or vehicle and were analyzed after 10 min for effects on EGFR, phospho-EGFR (Y1173) and phospho-ERK1/2 levels.

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: To do this, freshly dissociated suspensions of each kind of neuron were electroporated using the Neon Transfection System (Life Technologies, Paisley, UK) prior to being plated together in the same culture dishes at low density. .. For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA.

    Article Title: A critical role for suppressor of cytokine signalling 3 in promoting M1 macrophage activation and function in vitro and in vivo
    Article Snippet: Gene knockdown Knockdown experiments were performed using pre-designed and validated short interfering RNA (siRNA) for SOCS3 (rat 192802, human s17191, Invitrogen, Life Technologies, Paisley, UK), SOCS1 (s16469, Invitrogen) or a non-targeting siRNA sequence control (4390844, Invitrogen) containing at least four mismatches to any mouse, human or rat gene. .. BMDM or human macrophages were transfected using Lipofectamine RNAi Max (Invitrogen) in serum-free medium according to the manufacturer's instructions.

    Article Title: Immunogenic cell death due to a new photodynamic therapy (PDT) with glycoconjugated chlorin (G-chlorin)
    Article Snippet: .. Small interfering RNA transfections CT26 cells were transfected with small interfering RNA (siRNA) for either CRT or HMGB1 (Ambion, Beverly, MA) using Lipofectamine reagent (Invitrogen) according to manufacturer instructions. .. At 48 hours after transfection, CT26 cells were assessed for total content of each protein by western blotting.

    Article Title: Hypoxia-Induced Pulmonary Arterial Smooth Muscle Cell Proliferation Is Controlled by Forkhead Box M1
    Article Snippet: .. HPASMCs were plated on 60-mm dishes and transfected with small interfering RNA (siRNA) and Lipofectamine 2000 (Invitrogen, Carlsbad, CA) at approximately 60–70% confluence, following the manufacturer's protocol. ..

    Article Title: The Cytosolic Pattern Recognition Receptor NOD1 Induces Inflammatory Interleukin-8 during Chlamydia trachomatis Infection
    Article Snippet: .. Subconfluent HeLa cells in a six-well plate were transfected with small interfering RNA (siRNA) purchased from Ambion or a negative (nonspecific) siRNA (Dharmacon, Lafayette, CO) control using Oligofectamine (Invitrogen) (Silencer predesigned siRNAs 2680 CARD4 [NOD1], 455 RIPK2 [RIP2], and 242558 MYD88). .. Oligofectamine and Opti-MEM medium (Invitrogen) at a 1:8 ratio were vortexed for 1 s and incubated for 5 min at room temperature.

    Article Title:
    Article Snippet: .. For transfections, silencer Negative control 1 small interfering RNA (siRNA) and AAK1-specific (sense: 5′-GGUGUGCAAGAGAGAAAUCtt-3′; antisense: 5′-GAUUUCUCUCUUGCACACCtg-3′) siRNAs were obtained from Ambion (Austin, TX). tTA HeLa cells (1 × 105 ) were seeded into each well of a six-well dish containing glass coverslips. .. For transferrin recycling assays, cells were incubated overnight at 37°C in DMEM containing 10% fetal bovine calf serum.

    Article Title: Enhanced response of melanoma cells to MEK inhibitors following unbiased IGF-1R down-regulation
    Article Snippet: .. siRNA transfection Cells were transfected with small interfering RNA (siRNA) against IGF-1R (Ambion, Life Technologies, s7211, 5’ GCAUGGUAGCCGAAGAUUUtt 3’) using reverse transfection (adding suspended cells to transfection mixture in cell culture vessels) and RNAiMAX (Life Technologies) according to manufacturer’s protocol. .. SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) and western blot analysis Cell lysates were prepared and subjected to western blot (WB) analysis as described in detail elsewhere [ ].

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: .. Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. Culture medium was replaced 48 hrs after transfection with DMEM supplemented with 10% heat-inactivated fetal bovine serum, pen-strep, 20% 199 media, sodium pyruvate, L-glutamine solution and the cells were incubated for additional 24 hrs.

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen). .. After 24 h of transfection, the cells were stimulated with or without EGF (10 ng/ml) and used for qPCR to quantify mRNA expression of Col I (α1 ), Col III (α1 ), MMP-1, and MMP-9 and GAPDH genes using the primers previously described ( ).

    Infection:

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: .. Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. Culture medium was replaced 48 hrs after transfection with DMEM supplemented with 10% heat-inactivated fetal bovine serum, pen-strep, 20% 199 media, sodium pyruvate, L-glutamine solution and the cells were incubated for additional 24 hrs.

    Sequencing:

    Article Title: A critical role for suppressor of cytokine signalling 3 in promoting M1 macrophage activation and function in vitro and in vivo
    Article Snippet: .. Gene knockdown Knockdown experiments were performed using pre-designed and validated short interfering RNA (siRNA) for SOCS3 (rat 192802, human s17191, Invitrogen, Life Technologies, Paisley, UK), SOCS1 (s16469, Invitrogen) or a non-targeting siRNA sequence control (4390844, Invitrogen) containing at least four mismatches to any mouse, human or rat gene. .. BMDM or human macrophages were transfected using Lipofectamine RNAi Max (Invitrogen) in serum-free medium according to the manufacturer's instructions.

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA). .. The sense sequence of Ddc siRNA was GUUACAUGCCUACUUCCCCUU, which was designed and provided by Ambion according to the C. capitata Ddc mRNA nucleotide sequence (NCBI sequence viewer, accession no.: ).

    Fluorescence:

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: For every condition in each experiment, images of at least 50 neurons were digitally acquired by fluorescence microscopy and analysed to obtain total neurite length, number of branch points and Sholl profiles ( ). .. For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA.

    Mutagenesis:

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. After 72 hours of the transfection process, hTERT cells were infected with B. abortus or mutant strain Δ1520 (MOI 100) or transfected with bacterial DNA (1μg) and the supernatant was collected after 17 hours to measure human CXCL10 by ELISA.

    Isolation:

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: VSMCs isolated from both AS and S plaques were grown to 60–80% confluence without antibiotics. .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen).

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: To silence Ddc, isolated haemocytes (5 × 105 cells) were incubated in 100 µl of Grace's insect medium for 7 hr. .. Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA).

    Flow Cytometry:

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA). .. To investigate surface Ddc silencing, or haemocyte phagocytosis, cells were processed as described earlier and analysed by flow cytometry.

    Microscopy:

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: For every condition in each experiment, images of at least 50 neurons were digitally acquired by fluorescence microscopy and analysed to obtain total neurite length, number of branch points and Sholl profiles ( ). .. For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA.

    Small Interfering RNA:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2. .. Western blot analysis Cells were lysed with RIPA buffer (25 mM Tris–HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate and 0.1% sodium dodecyl sulphate) supplemented with protease inhibitor cocktail (Sigma) and centrifuged at 12,000 ×g for 10 min at 4°C.

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. Cell transfection with small interfering RNA (siRNA) We used siRNA to knock-down the expression of EGFR and human MIO-M1 cells plated in 6-well dishes were transfected in the absence of serum and antibiotics with non-specific target (Stealth RNAi Negative Control Duplex, Cat # 12935–300, Invitrogen, Carlsbad, CA) or EGFR-siRNA ( 5′-GGAUCCCAGAAGAAGGUGAGAAAGUUAA- 3′ , Accession no. NM_005228.3) with Lipofectamine RNAi-MAX (Cat # 13778–030, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. After 48 h of EGFR siRNA transfection, cells were treated with IRL1620 (5 μM) or vehicle and were analyzed after 10 min for effects on EGFR, phospho-EGFR (Y1173) and phospho-ERK1/2 levels.

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: .. For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA. .. Co-transfection of YFP allowed visualisation of transfected neurons, and knock down was confirmed by immunocytochemistry (not shown).

    Article Title: A critical role for suppressor of cytokine signalling 3 in promoting M1 macrophage activation and function in vitro and in vivo
    Article Snippet: .. Gene knockdown Knockdown experiments were performed using pre-designed and validated short interfering RNA (siRNA) for SOCS3 (rat 192802, human s17191, Invitrogen, Life Technologies, Paisley, UK), SOCS1 (s16469, Invitrogen) or a non-targeting siRNA sequence control (4390844, Invitrogen) containing at least four mismatches to any mouse, human or rat gene. .. BMDM or human macrophages were transfected using Lipofectamine RNAi Max (Invitrogen) in serum-free medium according to the manufacturer's instructions.

    Article Title: Immunogenic cell death due to a new photodynamic therapy (PDT) with glycoconjugated chlorin (G-chlorin)
    Article Snippet: .. Small interfering RNA transfections CT26 cells were transfected with small interfering RNA (siRNA) for either CRT or HMGB1 (Ambion, Beverly, MA) using Lipofectamine reagent (Invitrogen) according to manufacturer instructions. .. At 48 hours after transfection, CT26 cells were assessed for total content of each protein by western blotting.

    Article Title: Hypoxia-Induced Pulmonary Arterial Smooth Muscle Cell Proliferation Is Controlled by Forkhead Box M1
    Article Snippet: .. HPASMCs were plated on 60-mm dishes and transfected with small interfering RNA (siRNA) and Lipofectamine 2000 (Invitrogen, Carlsbad, CA) at approximately 60–70% confluence, following the manufacturer's protocol. ..

    Article Title: The Cytosolic Pattern Recognition Receptor NOD1 Induces Inflammatory Interleukin-8 during Chlamydia trachomatis Infection
    Article Snippet: .. Subconfluent HeLa cells in a six-well plate were transfected with small interfering RNA (siRNA) purchased from Ambion or a negative (nonspecific) siRNA (Dharmacon, Lafayette, CO) control using Oligofectamine (Invitrogen) (Silencer predesigned siRNAs 2680 CARD4 [NOD1], 455 RIPK2 [RIP2], and 242558 MYD88). .. Oligofectamine and Opti-MEM medium (Invitrogen) at a 1:8 ratio were vortexed for 1 s and incubated for 5 min at room temperature.

    Article Title:
    Article Snippet: .. For transfections, silencer Negative control 1 small interfering RNA (siRNA) and AAK1-specific (sense: 5′-GGUGUGCAAGAGAGAAAUCtt-3′; antisense: 5′-GAUUUCUCUCUUGCACACCtg-3′) siRNAs were obtained from Ambion (Austin, TX). tTA HeLa cells (1 × 105 ) were seeded into each well of a six-well dish containing glass coverslips. .. For transferrin recycling assays, cells were incubated overnight at 37°C in DMEM containing 10% fetal bovine calf serum.

    Article Title: Enhanced response of melanoma cells to MEK inhibitors following unbiased IGF-1R down-regulation
    Article Snippet: .. siRNA transfection Cells were transfected with small interfering RNA (siRNA) against IGF-1R (Ambion, Life Technologies, s7211, 5’ GCAUGGUAGCCGAAGAUUUtt 3’) using reverse transfection (adding suspended cells to transfection mixture in cell culture vessels) and RNAiMAX (Life Technologies) according to manufacturer’s protocol. .. SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) and western blot analysis Cell lysates were prepared and subjected to western blot (WB) analysis as described in detail elsewhere [ ].

    Article Title: Brucella abortus triggers a cGAS-independent STING pathway to induce host protection that involves guanylate-binding proteins and inflammasome activation
    Article Snippet: .. Forty-eight hrs after transfection, cells were infected with B. abortus (MOI 100:1) for 24 hrs as described above. hTERT cells were transfected with small interfering RNA (siRNA) from siGENOME smart pools siRNA STING (J-024333-20-0002), siRNA cGAS (L-015607-02-0005) or siRNA Control (D-001810-10-05) at 80μM siRNA and 1μl Lipofectamine RNAiMAX (ThermoFisher) in 100 μl of Opti-MEM media. .. Culture medium was replaced 48 hrs after transfection with DMEM supplemented with 10% heat-inactivated fetal bovine serum, pen-strep, 20% 199 media, sodium pyruvate, L-glutamine solution and the cells were incubated for additional 24 hrs.

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen). .. After 24 h of transfection, the cells were stimulated with or without EGF (10 ng/ml) and used for qPCR to quantify mRNA expression of Col I (α1 ), Col III (α1 ), MMP-1, and MMP-9 and GAPDH genes using the primers previously described ( ).

    Article Title: Innate immunity in insects: surface-associated dopa decarboxylase-dependent pathways regulate phagocytosis, nodulation and melanization in medfly haemocytes
    Article Snippet: .. Every 75 min, medium was supplemented with 50 n ì small interfering RNA (siRNA) for Ddc (Ambion, Austin, TX, USA). ..

    Cotransfection:

    Article Title: ProNGF promotes neurite growth from a subset of NGF-dependent neurons by a p75NTR-dependent mechanism
    Article Snippet: For small interfering RNA (siRNA) experiments, dissociated suspensions of SCG neurons were electroporated with Silencer Select siRNAs (Life Technologies) directed against TrkA (also known as NTRK1) or with scrambled control siRNA. .. Co-transfection of YFP allowed visualisation of transfected neurons, and knock down was confirmed by immunocytochemistry (not shown).

    Dominant Negative Mutation:

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: A full-length human Ets-1 and dominant-negative (DN) Ets-1 constructs cloned into pCDNA3.1 (−) neovector were kind gifts from Dr. Stephen Lee (Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario, Canada). .. For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells
    Article Snippet: For small interfering RNA (siRNA) experiments, cells were transfected with siRNA-targeting Ets-1 or with a scrambled control siRNA using Lipofectamine 2000 (Invitrogen). .. After 24 h of transfection, the cells were stimulated with or without EGF (10 ng/ml) and used for qPCR to quantify mRNA expression of Col I (α1 ), Col III (α1 ), MMP-1, and MMP-9 and GAPDH genes using the primers previously described ( ).

    Negative Control:

    Article Title: Endothelin B Receptors on Primary Chicken Müller Cells and the Human MIO-M1 Müller Cell Line Activate ERK Signaling via Transactivation of Epidermal Growth Factor Receptors
    Article Snippet: .. Cell transfection with small interfering RNA (siRNA) We used siRNA to knock-down the expression of EGFR and human MIO-M1 cells plated in 6-well dishes were transfected in the absence of serum and antibiotics with non-specific target (Stealth RNAi Negative Control Duplex, Cat # 12935–300, Invitrogen, Carlsbad, CA) or EGFR-siRNA ( 5′-GGAUCCCAGAAGAAGGUGAGAAAGUUAA- 3′ , Accession no. NM_005228.3) with Lipofectamine RNAi-MAX (Cat # 13778–030, Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. .. After 48 h of EGFR siRNA transfection, cells were treated with IRL1620 (5 μM) or vehicle and were analyzed after 10 min for effects on EGFR, phospho-EGFR (Y1173) and phospho-ERK1/2 levels.

    Article Title:
    Article Snippet: .. For transfections, silencer Negative control 1 small interfering RNA (siRNA) and AAK1-specific (sense: 5′-GGUGUGCAAGAGAGAAAUCtt-3′; antisense: 5′-GAUUUCUCUCUUGCACACCtg-3′) siRNAs were obtained from Ambion (Austin, TX). tTA HeLa cells (1 × 105 ) were seeded into each well of a six-well dish containing glass coverslips. .. For transferrin recycling assays, cells were incubated overnight at 37°C in DMEM containing 10% fetal bovine calf serum.

    Selection:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: For Flp-In T-REx™ HEK293 selection, Hygromycin- and blasticidin-resistant colonies were pooled and expanded. .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2.

    Concentration Assay:

    Article Title: Increased cytoplasmic TARDBP mRNA in affected spinal motor neurons in ALS caused by abnormal autoregulation of TDP-43
    Article Snippet: Cycloheximide (Sigma), actinomycin D (Sigma) and caffeine (Sigma) was used at a final concentration of 100 μg/ml, 5 μg/ml and 10 mM, respectively. .. Cells were transfected with small interfering RNA (siRNA) using Lipofectamine RNAi MAX (Invitrogen) according to the manufacturer's protocol. siRNA probes used in this study are summarized in Supplementary Table S2.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher sirna
    Cellular uptake. Cellular uptake of <t>DP-CLPs–PTX–survivin</t> <t>siRNA</t> (A1–A5), DP-CLPs–scrambled siRNA (B1–B5), CLPs–PTX–survivin siRNA (C1–C5) or CLPs–scrambled siRNA (D1–D5) particles (lipid/siRNA weight ratio of 1:0.08) by U251-CD133+ cells (A1–D1 and A2–D2), U251-CD133– cells (A3–D3 and A4–D4) or BCECs (A5–D5 and A6–D6) was examined by fluorescence microscopy after 60 min incubation. Phase contrast images were obtained before each corresponding fluorescent image. Red: rhodamine. Scale bar: 100 μm.
    Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna/product/Thermo Fisher
    Average 99 stars, based on 2186 article reviews
    Price from $9.99 to $1999.99
    sirna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher chop sirna
    Application of ATF6 <t>siRNA</t> promotes neuronal survival at 24 h after ICH. (A) Representative Western blot images. (B) Quantitative analyses of ATF6, <t>CHOP,</t> Bip, Bcl-2, Bax, cleaved caspase-3. n = 6 for each group. The bars represent the mean ± SD. ∗ p
    Chop Sirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chop sirna/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    chop sirna - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    94
    Thermo Fisher bugz sirna oligonucleotide
    Effects of <t>BuGZ</t> on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 <t>siRNA</t> (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P
    Bugz Sirna Oligonucleotide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bugz sirna oligonucleotide/product/Thermo Fisher
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bugz sirna oligonucleotide - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Cellular uptake. Cellular uptake of DP-CLPs–PTX–survivin siRNA (A1–A5), DP-CLPs–scrambled siRNA (B1–B5), CLPs–PTX–survivin siRNA (C1–C5) or CLPs–scrambled siRNA (D1–D5) particles (lipid/siRNA weight ratio of 1:0.08) by U251-CD133+ cells (A1–D1 and A2–D2), U251-CD133– cells (A3–D3 and A4–D4) or BCECs (A5–D5 and A6–D6) was examined by fluorescence microscopy after 60 min incubation. Phase contrast images were obtained before each corresponding fluorescent image. Red: rhodamine. Scale bar: 100 μm.

    Journal: Drug Delivery

    Article Title: Dual-modified cationic liposomes loaded with paclitaxel and survivin siRNA for targeted imaging and therapy of cancer stem cells in brain glioma

    doi: 10.1080/10717544.2018.1494225

    Figure Lengend Snippet: Cellular uptake. Cellular uptake of DP-CLPs–PTX–survivin siRNA (A1–A5), DP-CLPs–scrambled siRNA (B1–B5), CLPs–PTX–survivin siRNA (C1–C5) or CLPs–scrambled siRNA (D1–D5) particles (lipid/siRNA weight ratio of 1:0.08) by U251-CD133+ cells (A1–D1 and A2–D2), U251-CD133– cells (A3–D3 and A4–D4) or BCECs (A5–D5 and A6–D6) was examined by fluorescence microscopy after 60 min incubation. Phase contrast images were obtained before each corresponding fluorescent image. Red: rhodamine. Scale bar: 100 μm.

    Article Snippet: Survivin siRNA (sequence: 5′-GCAUUCGUCCGGUUGCGCUdTdT-3′) and a scrambled siRNA (sequence: 5′-AUGAACUUCAGGGUCAGCUdTdT-3′) were purchased from Thermo Scientific Dharmacon (Shanghai, China).

    Techniques: Fluorescence, Microscopy, Incubation

    Characterization of nanocomplex. (A) Agarose gel electrophoretic mobility shift assay was performed for DP-CLPs–PTX–survivin siRNA (M-e 1 ), DP-CLPs–scrambled siRNA (M-e 2 ), CLPs–PTX–survivin siRNA (M-e 3 ) and CLPs–scrambled siRNA (M-e 4 ). Control was in lane M. Lanes a, b, c, d and e corresponded to lipid/siRNA ratios of 1:0.05, 1:0.08, 1:0.1, 1:0.15 and 1:0.2 (w/w), respectively. (B) Atomic force microscopy pictures of (a) CLPs–scrambled siRNA, (b) DP-CLPs–scrambled siRNA, (c) CLPs–PTX–survivin siRNA siRNA and (d) DP-CLPs–PTX–survivin siRNA siRNA at a lipid/siRNA weight ratio of 1:0.08. (C) PTX and DiR in vitro release profiles from the above liposomes. (D) TEM of (a) CLPs–PTX–survivin siRNA siRNA and (b) DP-CLPs–PTX–survivin siRNA siRNA at a lipid/siRNA weight ratio of 1:0.08.

    Journal: Drug Delivery

    Article Title: Dual-modified cationic liposomes loaded with paclitaxel and survivin siRNA for targeted imaging and therapy of cancer stem cells in brain glioma

    doi: 10.1080/10717544.2018.1494225

    Figure Lengend Snippet: Characterization of nanocomplex. (A) Agarose gel electrophoretic mobility shift assay was performed for DP-CLPs–PTX–survivin siRNA (M-e 1 ), DP-CLPs–scrambled siRNA (M-e 2 ), CLPs–PTX–survivin siRNA (M-e 3 ) and CLPs–scrambled siRNA (M-e 4 ). Control was in lane M. Lanes a, b, c, d and e corresponded to lipid/siRNA ratios of 1:0.05, 1:0.08, 1:0.1, 1:0.15 and 1:0.2 (w/w), respectively. (B) Atomic force microscopy pictures of (a) CLPs–scrambled siRNA, (b) DP-CLPs–scrambled siRNA, (c) CLPs–PTX–survivin siRNA siRNA and (d) DP-CLPs–PTX–survivin siRNA siRNA at a lipid/siRNA weight ratio of 1:0.08. (C) PTX and DiR in vitro release profiles from the above liposomes. (D) TEM of (a) CLPs–PTX–survivin siRNA siRNA and (b) DP-CLPs–PTX–survivin siRNA siRNA at a lipid/siRNA weight ratio of 1:0.08.

    Article Snippet: Survivin siRNA (sequence: 5′-GCAUUCGUCCGGUUGCGCUdTdT-3′) and a scrambled siRNA (sequence: 5′-AUGAACUUCAGGGUCAGCUdTdT-3′) were purchased from Thermo Scientific Dharmacon (Shanghai, China).

    Techniques: Agarose Gel Electrophoresis, Electrophoretic Mobility Shift Assay, Microscopy, In Vitro, Transmission Electron Microscopy

    (A) Quantification of the viability of U251-CD133 + cells, U251-CD133 – cells and BCECs after treatment with DMEM, CLPs–scrambled siRNA, DP-CLPs–scrambled siRNA, PTX, CLPs–PTX–survivin siRNA siRNA or DP-CLPs–PTX–survivin siRNA for 48 h. * p

    Journal: Drug Delivery

    Article Title: Dual-modified cationic liposomes loaded with paclitaxel and survivin siRNA for targeted imaging and therapy of cancer stem cells in brain glioma

    doi: 10.1080/10717544.2018.1494225

    Figure Lengend Snippet: (A) Quantification of the viability of U251-CD133 + cells, U251-CD133 – cells and BCECs after treatment with DMEM, CLPs–scrambled siRNA, DP-CLPs–scrambled siRNA, PTX, CLPs–PTX–survivin siRNA siRNA or DP-CLPs–PTX–survivin siRNA for 48 h. * p

    Article Snippet: Survivin siRNA (sequence: 5′-GCAUUCGUCCGGUUGCGCUdTdT-3′) and a scrambled siRNA (sequence: 5′-AUGAACUUCAGGGUCAGCUdTdT-3′) were purchased from Thermo Scientific Dharmacon (Shanghai, China).

    Techniques:

    (A) In vivo fluorescence imaging of intracranial U251-CD133 + glioma tumor-bearing nude mice treated for 24 h with CLPs–PTX–survivin siRNA (B 1 ) or DP-CLPs–PTX–survivin siRNA (D 1 ) liposomes, as well as corresponding dissected organs (A 1 and C 1 ). (B) Lesions in nude mice implanted in situ with U251-CD133 + cells after treatment with CLPs–scrambled siRNA (A 1 ), CLPs–PTX–survivin siRNA (C 1 ), DP-CLPs–scrambled siRNA (B 1 ) or DP-CLPs–PTX–survivin siRNA (D 1 ); all lesions were characterized by MRI at 19 days post-injection. U251-CD133 + cells were intracranially implanted in nude mice after 48 h treatment with Taxol, CLPs–PTX–survivin siRNA or DP-CLPs–PTX–survivin siRNA. Tumor size was measured 19 days post-injection ( n = 5/group). ** p

    Journal: Drug Delivery

    Article Title: Dual-modified cationic liposomes loaded with paclitaxel and survivin siRNA for targeted imaging and therapy of cancer stem cells in brain glioma

    doi: 10.1080/10717544.2018.1494225

    Figure Lengend Snippet: (A) In vivo fluorescence imaging of intracranial U251-CD133 + glioma tumor-bearing nude mice treated for 24 h with CLPs–PTX–survivin siRNA (B 1 ) or DP-CLPs–PTX–survivin siRNA (D 1 ) liposomes, as well as corresponding dissected organs (A 1 and C 1 ). (B) Lesions in nude mice implanted in situ with U251-CD133 + cells after treatment with CLPs–scrambled siRNA (A 1 ), CLPs–PTX–survivin siRNA (C 1 ), DP-CLPs–scrambled siRNA (B 1 ) or DP-CLPs–PTX–survivin siRNA (D 1 ); all lesions were characterized by MRI at 19 days post-injection. U251-CD133 + cells were intracranially implanted in nude mice after 48 h treatment with Taxol, CLPs–PTX–survivin siRNA or DP-CLPs–PTX–survivin siRNA. Tumor size was measured 19 days post-injection ( n = 5/group). ** p

    Article Snippet: Survivin siRNA (sequence: 5′-GCAUUCGUCCGGUUGCGCUdTdT-3′) and a scrambled siRNA (sequence: 5′-AUGAACUUCAGGGUCAGCUdTdT-3′) were purchased from Thermo Scientific Dharmacon (Shanghai, China).

    Techniques: In Vivo, Fluorescence, Imaging, Mouse Assay, In Situ, Magnetic Resonance Imaging, Injection

    Knockdown of CacyBP facilitated viral replication and arrested apoptosis in DF-1 cells. DF-1 cells were transfected with mock and/or NC and si-CacyBP/SIP and incubated for 36 h. Mock, treated with transfection regent; NC, transfected with si-NC; si183/326/644, separately transfected with those siRNAs targets CacyBP/SIP. (A) Endogenous CacyBP/SIP was detected by western blotting. (B) DF-1 cells were co-transfected with si-CacyBP (326) and pCMV-HA-CacyBP. Thirty-six hours after transfection, protein expression of HA-CacyBP was detected by anti-HA antibody through immunofluorescence in DF-1 cells. (C) Replication kinetics of NDV RNAs from the mock, NC, and siRNA (326) groups of DF-1 cells; 1 MOI of F48E9 NDV were inoculated into the three groups of cells 24 h after transfection. Q-PCR was used to measure viral RNA replication 24 hpi. (D) Viral plaque formation tests were further used to measure the number of viruses in the supernatants. (E) Three cell cultures were prepared and transfected with mock, NC and siRNA (326), and then, the cells were washed and harvested, an annexin V assay was followed by flow cytometry to monitor for percentage of cells undergoing early apoptosis (bottom right quadrant) and late apoptosis(upper right quadrant). Y-axis is PI signal; X-asis is annexin V-FITC signal. Right graph data were the percentage of total apoptosis (bottom and upper right quadrant)and data from three independent experiments. (F–H) Q-PCR was used to analyze the expression of apoptosis-related markers and immune-associated markers 24 h after transfection with NC and si-CacyBP/SIP. (G) The transfected cell lysate was analyzed by western blotting with the indicated apoptosis-related antibody. Data shown in (C,D) are mean ± SD of four independent experiments, in (E,G,H) are mean ± SD of three independent expriments. * P

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: Newcastle Disease Virus V Protein Inhibits Cell Apoptosis and Promotes Viral Replication by Targeting CacyBP/SIP

    doi: 10.3389/fcimb.2018.00304

    Figure Lengend Snippet: Knockdown of CacyBP facilitated viral replication and arrested apoptosis in DF-1 cells. DF-1 cells were transfected with mock and/or NC and si-CacyBP/SIP and incubated for 36 h. Mock, treated with transfection regent; NC, transfected with si-NC; si183/326/644, separately transfected with those siRNAs targets CacyBP/SIP. (A) Endogenous CacyBP/SIP was detected by western blotting. (B) DF-1 cells were co-transfected with si-CacyBP (326) and pCMV-HA-CacyBP. Thirty-six hours after transfection, protein expression of HA-CacyBP was detected by anti-HA antibody through immunofluorescence in DF-1 cells. (C) Replication kinetics of NDV RNAs from the mock, NC, and siRNA (326) groups of DF-1 cells; 1 MOI of F48E9 NDV were inoculated into the three groups of cells 24 h after transfection. Q-PCR was used to measure viral RNA replication 24 hpi. (D) Viral plaque formation tests were further used to measure the number of viruses in the supernatants. (E) Three cell cultures were prepared and transfected with mock, NC and siRNA (326), and then, the cells were washed and harvested, an annexin V assay was followed by flow cytometry to monitor for percentage of cells undergoing early apoptosis (bottom right quadrant) and late apoptosis(upper right quadrant). Y-axis is PI signal; X-asis is annexin V-FITC signal. Right graph data were the percentage of total apoptosis (bottom and upper right quadrant)and data from three independent experiments. (F–H) Q-PCR was used to analyze the expression of apoptosis-related markers and immune-associated markers 24 h after transfection with NC and si-CacyBP/SIP. (G) The transfected cell lysate was analyzed by western blotting with the indicated apoptosis-related antibody. Data shown in (C,D) are mean ± SD of four independent experiments, in (E,G,H) are mean ± SD of three independent expriments. * P

    Article Snippet: Transfection and viral infection Plasmid or siRNA was transfected to DF-1 and/or Vero cells using Lipofectamine 2000 (Thermo Scientific, NH, USA) according to the manufacturer's instruction.

    Techniques: Transfection, Incubation, Western Blot, Expressing, Immunofluorescence, Polymerase Chain Reaction, Annexin V Assay, Flow Cytometry, Cytometry

    Application of ATF6 siRNA promotes neuronal survival at 24 h after ICH. (A) Representative Western blot images. (B) Quantitative analyses of ATF6, CHOP, Bip, Bcl-2, Bax, cleaved caspase-3. n = 6 for each group. The bars represent the mean ± SD. ∗ p

    Journal: Frontiers in Neuroscience

    Article Title: Melatonin Protects Against Neuronal Apoptosis via Suppression of the ATF6/CHOP Pathway in a Rat Model of Intracerebral Hemorrhage

    doi: 10.3389/fnins.2018.00638

    Figure Lengend Snippet: Application of ATF6 siRNA promotes neuronal survival at 24 h after ICH. (A) Representative Western blot images. (B) Quantitative analyses of ATF6, CHOP, Bip, Bcl-2, Bax, cleaved caspase-3. n = 6 for each group. The bars represent the mean ± SD. ∗ p

    Article Snippet: The results showed that the administration of ATF6 siRNA could significantly reduce the level of CHOP expression in both protein and mRNA levels, while CHOP siRNA had no effects on the expression of ATF6, which was elevated at 24 h after ICH (p < 0.05, vs. sham).

    Techniques: Western Blot

    Effects of BuGZ on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 siRNA (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P

    Journal: The Journal of Cell Biology

    Article Title: Aurora A activation in mitosis promoted by BuGZ

    doi: 10.1083/jcb.201706103

    Figure Lengend Snippet: Effects of BuGZ on AurA kinase activity in mitosis. (A–D) Cells were transfected with control, BuGZ, or TPX2 siRNA (si) or were treated with AurA inhibitor MLN8237 (100 nM) followed by staining with antibodies to total AurA (A) or p-AurA (B). Bars, 10 µm. The immunostaining intensity of total AurA (C) and p-AurA (D) in control siRNA–treated cells in metaphase or prometaphase (ProM, containing misaligned chromosomes or thick chromosome bars) and cells in the experimental groups containing misaligned chromosomes were quantified. 75–152 total cells from three independent experiments in each experiment were measured and quantified. Error bars indicate SEM. One-way ANOVA: *, P

    Article Snippet: For BuGZ knockdown, we used our previously published BuGZ siRNA oligonucleotide (5′-GCCUGCUACACUUACAACAACUAGU-3′; , ), control oligonucleotide (12935-300; Thermo Fisher Scientific), and a TPX2 oligonucleotide (SI02665082; QIAGEN).

    Techniques: Activity Assay, Transfection, Staining, Immunostaining