ribonucleic acid rna  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen ribonucleic acid rna
    Ribonucleic Acid Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribonucleic acid rna/product/Qiagen
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    ribonucleic acid rna - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Shedding of Hepatitis C Virus in Semen of Human Immunodeficiency Virus-Infected Men
    Article Snippet: After liquefaction at room temperature, seminal plasma and cells were separated by centrifugation at 700 x g for 12 minutes, and the seminal plasma was removed and frozen at −80℃. .. Ribonucleic acid (RNA) was isolated using the QIAmp Viral RNA Mini Kit (QIAGEN, Courtaboeuf, France), and HCV RNA was quantified using the (Abbott Molecular; m 2000 RealTim e System [LLOQ 12 IU/mL]).

    Amplification:

    Article Title: Antecedent causes of a measles resurgence in the Democratic Republic of the Congo
    Article Snippet: .. Ribonucleic acid (RNA) was extracted using the QIAamp® viral RNA mini kit (QIAGEN® ) and amplified by reverse-transcriptase polymerase chain reaction. .. Amplicons were sequenced and analyzed using Sequencher software (Gene Codes Corporation 4.1.4, Ann Arbor, MI).

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: Because all 5 of the RV5 vaccine strains possess a gene 6 derived from the bovine strain WC3 and the gene 6 from human wild-type rotavirus are distinct from RV5 at the nucleotide sequence level, the sequencing data obtained from a gene 6 RT-PCR amplicon was able to categorize the virus in the stool sample as vaccine or a human wild-type rotavirus. .. Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method.

    Synthesized:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: .. The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols. .. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with the cDNA and primers ( ) using SYBR® Green Real-Time PCR Master Mix (Applied Biosystems) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols. .. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with the cDNA and primers ( ) using SYBR® Green Real-Time PCR Master Mix (Applied Biosystems) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

    Article Title: Molecular evidence and clinical importance of β‐arrestins expression in patients with acromegaly
    Article Snippet: Quantitative PCR The expression of β‐arrestins 1 and 2 , sst2, sst5 and D2 in somatotropinomas was analysed by quantitative real‐time RT‐PCR (qPCR) using Sybergreen® method as previously described . .. The ribonucleic acid (RNA) was isolated using Allprep® Universal kit (Qiagen, Hilden, Germany) and treated with DNase (Turbo DNA‐free™ Kit, Invitrogen, CA, USA), according to the manufacturers’ protocol.

    Article Title: Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet
    Article Snippet: Paragraph title: 2.6. Quantitative RT-PCR ... Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions.

    SYBR Green Assay:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols. .. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with the cDNA and primers ( ) using SYBR® Green Real-Time PCR Master Mix (Applied Biosystems) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

    Article Title: Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet
    Article Snippet: Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. .. Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City, CA) thermal cycler and SYBR Green master mix (Applied Biosystems, Foster City, CA).

    Incubation:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: The GT1–7 cells were incubated with DW, 10 nM estradiol (Sigma-Aldrich, E2758) [ ], or noncytotoxic concentrations of each plant extract solution in SFM for 24 hours, whereas GH3 cells were incubated with DW and noncytotoxic concentrations of the plant extract solutions in SFM for 24 hours. .. The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols.

    Article Title: Two canine CD1a proteins are differentially expressed in skin
    Article Snippet: Intestine tissue (duodenum, jejunum, and colon) was washed and incubated in phosphate-buffered saline (PBS) with 0.75 mg/ml ethylenediamine tetraacetic acid, 5% fetal calf serum (FCS), and 50 μg/ml gentamicin at 37°C for 1 h to obtain intestinal cells. .. From all collected tissues, ribonucleic acid (RNA) was isolated using the RNeasy kit (Qiagen) followed by complementary deoxyribonucleic acid (cDNA) synthesis with Multiscribe reverse transcriptase (Applied Biosystems).

    Cell Culture:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: RT-PCR To assess the quantity of messenger ribonucleic acid (mRNA), the GT1–7 cells (5 × 105 cells/well) [ ] and the GH3 cells (1 × 106 cells/well) [ ] were seeded in 60 mm cell culture dishes with SFM and incubated overnight. .. The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols.

    Expressing:

    Article Title: Topical royal jelly alleviates symptoms of pruritus in a murine model of allergic contact dermatitis
    Article Snippet: Paragraph title: Expression of nerve growth factor mRNA in skin ... Each specimen was homogenized, and the total ribonucleic acid (RNA) was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany).

    Article Title: Molecular evidence and clinical importance of β‐arrestins expression in patients with acromegaly
    Article Snippet: Quantitative PCR The expression of β‐arrestins 1 and 2 , sst2, sst5 and D2 in somatotropinomas was analysed by quantitative real‐time RT‐PCR (qPCR) using Sybergreen® method as previously described . .. The ribonucleic acid (RNA) was isolated using Allprep® Universal kit (Qiagen, Hilden, Germany) and treated with DNase (Turbo DNA‐free™ Kit, Invitrogen, CA, USA), according to the manufacturers’ protocol.

    Western Blot:

    Article Title: An antiretroviral drug-na?ve human immunodeficiency virus-1 infected woman with a persistent non-reactive proviral deoxyribonucleic acid polymerase chain reaction: a case report
    Article Snippet: The molecular tests made use of the following genetic material extracted from samples: ribonucleic acid (RNA) was extracted from 200μL of plasma using QIAamp® Viral RNA mini kit (Qiagen, Courtaboeuf, France) and DNA was extracted from 200μL of buffy coat using QIAamp® DNA mini kit (Qiagen) according to the manufacturer’s recommendations. .. HIV Western blot (Bio-Rad).

    Derivative Assay:

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: Because all 5 of the RV5 vaccine strains possess a gene 6 derived from the bovine strain WC3 and the gene 6 from human wild-type rotavirus are distinct from RV5 at the nucleotide sequence level, the sequencing data obtained from a gene 6 RT-PCR amplicon was able to categorize the virus in the stool sample as vaccine or a human wild-type rotavirus. .. Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method.

    Infection:

    Article Title: Surveillance of equine respiratory viruses in Ontario
    Article Snippet: .. Ribonucleic acid (RNA) was extracted from nasal swabs and allantoic fluids infected with influenza A virus using QIAamp Viral RNA Mini Kit (Qiagen Sciences; Germantown, Maryland, USA) as described by the manufacturer. .. Primers to the nucleoprotein ( ) were used in gel-based RT-PCR to identify virus from nasopharyngeal swabs and allantoic fluids.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: Paragraph title: 2.4. RT-PCR ... The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols.

    Article Title: Surveillance of equine respiratory viruses in Ontario
    Article Snippet: Paragraph title: Reverse transcriptase-polymerase chain reaction (RT-PCR) and RT-PCR typing ... Ribonucleic acid (RNA) was extracted from nasal swabs and allantoic fluids infected with influenza A virus using QIAamp Viral RNA Mini Kit (Qiagen Sciences; Germantown, Maryland, USA) as described by the manufacturer.

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: Paragraph title: Rotavirus gene 6 RT-PCR assay ... Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method.

    Generated:

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method. .. In addition, if the extracted material using the QIAamp Viral RNA Extraction kit generated an amplicon that yielded poor sequencing data, the RNA material was extracted using the Boom’s silica extraction method.

    Polymerase Chain Reaction:

    Article Title: Topical royal jelly alleviates symptoms of pruritus in a murine model of allergic contact dermatitis
    Article Snippet: Each specimen was homogenized, and the total ribonucleic acid (RNA) was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany). .. Real-time quantitative polymerase chain reaction (PCR) was performed using a Step One TM Real Time PCR system (Applied Biosystems Inc., Carlsbad, CA) using SYBR Premix Ex Taq for mouse glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (forward 5’-AACGACCCCTTCATTGAC-3’ and reverse 5’-TCCACGACATACTCAGCAC-3’) and mouse nerve growth factor (NGF) (forward 5’-TGCCAAGGACGCAGCTTTC-3’ and reverse 5’-TGAAGTTTAGTCCAGTGGGCTTCAG-3’) in accordance with the manufacturer's instructions (Takara Bio Inc.).

    Article Title: Viral infections in patients with an acute exacerbation of idiopathic interstitial pneumonia.
    Article Snippet: The BALF samples used for PCR were stored at À70 1C until ready for processing. .. Total deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) were extracted from 200 μL of each BALF sample using the QIAamp MinElute Virus Spin kit (Qiagen, Tokyo, Japan).

    Article Title: Antecedent causes of a measles resurgence in the Democratic Republic of the Congo
    Article Snippet: .. Ribonucleic acid (RNA) was extracted using the QIAamp® viral RNA mini kit (QIAGEN® ) and amplified by reverse-transcriptase polymerase chain reaction. .. Amplicons were sequenced and analyzed using Sequencher software (Gene Codes Corporation 4.1.4, Ann Arbor, MI).

    Enzyme Immunoassay:

    Article Title: An antiretroviral drug-na?ve human immunodeficiency virus-1 infected woman with a persistent non-reactive proviral deoxyribonucleic acid polymerase chain reaction: a case report
    Article Snippet: Briefly, the initial serological analyses comprised two fourth-generation EIAs (Murex Ag-Ab combination Abbott and Genscreen ULTRA Ag-Ab Bio-Rad, Marnes-la-Coquette, France), followed by an in-house serotyping assay for HIV group discrimination [ , ]. .. The molecular tests made use of the following genetic material extracted from samples: ribonucleic acid (RNA) was extracted from 200μL of plasma using QIAamp® Viral RNA mini kit (Qiagen, Courtaboeuf, France) and DNA was extracted from 200μL of buffy coat using QIAamp® DNA mini kit (Qiagen) according to the manufacturer’s recommendations.

    Isolation:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: .. The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols. .. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with the cDNA and primers ( ) using SYBR® Green Real-Time PCR Master Mix (Applied Biosystems) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

    Article Title: Two canine CD1a proteins are differentially expressed in skin
    Article Snippet: .. From all collected tissues, ribonucleic acid (RNA) was isolated using the RNeasy kit (Qiagen) followed by complementary deoxyribonucleic acid (cDNA) synthesis with Multiscribe reverse transcriptase (Applied Biosystems). .. PCR, cloning, and sequence analysis Polymerase chain reactions (PCRs) were performed with Pfu Turbo polymerase (Stratagene) according to the protocol of the manufacturer under the following cycling conditions: an initial denaturation of 7 min at 95°C, followed by 40 cycles of 15 s at 95°C, 45 s at a primer-specific annealing temperature, 30 s at 72°C, followed by a final elongation step of 5 min at 72°C.

    Article Title: Shedding of Hepatitis C Virus in Semen of Human Immunodeficiency Virus-Infected Men
    Article Snippet: .. Ribonucleic acid (RNA) was isolated using the QIAmp Viral RNA Mini Kit (QIAGEN, Courtaboeuf, France), and HCV RNA was quantified using the (Abbott Molecular; m 2000 RealTim e System [LLOQ 12 IU/mL]). ..

    Article Title: Genomic plasticity of the MHC class I A region in rhesus macaques: extensive haplotype diversity at the population level as revealed by microsatellites
    Article Snippet: .. Ribonucleic acid (RNA) was isolated from PBMCs or B cells (Rneasy kit, Qiagen, Heiden, Germany). .. Mamu-A D6S2854 and D6S2859 genotyping The polymerase chain reaction (PCR) amplification of microsatellite D6S2854, a (TAAA)n repeat, was performed under the same conditions as previously described (Wiseman et al. ), with the exception that the 5′ primer (D6S2854-forward-VIC: TCATGAGCGTGGCACTGCAC) is VIC labeled and the 3′ primer (D6S2854-reverse: CCGTATGTTGCAACCAGGAG) is unlabeled.

    Article Title: Molecular evidence and clinical importance of β‐arrestins expression in patients with acromegaly
    Article Snippet: .. The ribonucleic acid (RNA) was isolated using Allprep® Universal kit (Qiagen, Hilden, Germany) and treated with DNase (Turbo DNA‐free™ Kit, Invitrogen, CA, USA), according to the manufacturers’ protocol. .. The quality and amount of the extracted RNA were evaluated using NanoDrop Lite Spectrophotometer (Thermo Fischer, Wilmington, DE, USA) and Qubit 3.0 Fluorometer (Life Technologies, Foster City, CA, USA), respectively.

    Article Title: Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet
    Article Snippet: .. Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. .. A DNase (Qiagen, Germantown, MD) step to digest the genomic DNA was included.

    Mouse Assay:

    Article Title: Topical royal jelly alleviates symptoms of pruritus in a murine model of allergic contact dermatitis
    Article Snippet: Expression of nerve growth factor mRNA in skin To evaluate the effect of topical royal jelly, the back skin of hairless mice was sampled after evaluation of pruritus on day 33. .. Each specimen was homogenized, and the total ribonucleic acid (RNA) was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany).

    Sequencing:

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: Because all 5 of the RV5 vaccine strains possess a gene 6 derived from the bovine strain WC3 and the gene 6 from human wild-type rotavirus are distinct from RV5 at the nucleotide sequence level, the sequencing data obtained from a gene 6 RT-PCR amplicon was able to categorize the virus in the stool sample as vaccine or a human wild-type rotavirus. .. Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method.

    Salting Out:

    Article Title: Genomic plasticity of the MHC class I A region in rhesus macaques: extensive haplotype diversity at the population level as revealed by microsatellites
    Article Snippet: The DNA was extracted from EDTA blood samples or from immortalized B-cell lines using a standard salting-out procedure. .. Ribonucleic acid (RNA) was isolated from PBMCs or B cells (Rneasy kit, Qiagen, Heiden, Germany).

    Software:

    Article Title: Antecedent causes of a measles resurgence in the Democratic Republic of the Congo
    Article Snippet: Ribonucleic acid (RNA) was extracted using the QIAamp® viral RNA mini kit (QIAGEN® ) and amplified by reverse-transcriptase polymerase chain reaction. .. Amplicons were sequenced and analyzed using Sequencher software (Gene Codes Corporation 4.1.4, Ann Arbor, MI).

    Real-time Polymerase Chain Reaction:

    Article Title: Effects of Huang Bai (Phellodendri Cortex) and Three Other Herbs on GnRH and GH Levels in GT1–7 and GH3 Cells
    Article Snippet: The total quantities of ribonucleic acid (RNA) from these two cell lines were isolated using the QIAzol® reagent (Qiagen, Venlo, Netherlands) and first-strand complementary deoxyribonucleic acid (cDNA) was synthesized using 1 μ g of RNA as a template in a SimpliAmp™ Thermal Cycler (Applied Biosystems, Waltham, Massachusetts, USA) with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocols. .. A quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis was performed with the cDNA and primers ( ) using SYBR® Green Real-Time PCR Master Mix (Applied Biosystems) on a StepOnePlus™ Real-Time PCR System (Applied Biosystems).

    Article Title: Topical royal jelly alleviates symptoms of pruritus in a murine model of allergic contact dermatitis
    Article Snippet: Each specimen was homogenized, and the total ribonucleic acid (RNA) was extracted using an RNeasy Mini Kit (Qiagen, Hilden, Germany). .. Real-time quantitative polymerase chain reaction (PCR) was performed using a Step One TM Real Time PCR system (Applied Biosystems Inc., Carlsbad, CA) using SYBR Premix Ex Taq for mouse glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) (forward 5’-AACGACCCCTTCATTGAC-3’ and reverse 5’-TCCACGACATACTCAGCAC-3’) and mouse nerve growth factor (NGF) (forward 5’-TGCCAAGGACGCAGCTTTC-3’ and reverse 5’-TGAAGTTTAGTCCAGTGGGCTTCAG-3’) in accordance with the manufacturer's instructions (Takara Bio Inc.).

    Article Title: Molecular evidence and clinical importance of β‐arrestins expression in patients with acromegaly
    Article Snippet: Paragraph title: Quantitative PCR ... The ribonucleic acid (RNA) was isolated using Allprep® Universal kit (Qiagen, Hilden, Germany) and treated with DNase (Turbo DNA‐free™ Kit, Invitrogen, CA, USA), according to the manufacturers’ protocol.

    Article Title: Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet
    Article Snippet: Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. .. Quantitative PCR was performed using the 7800HT (Applied Biosystems, Foster City, CA) thermal cycler and SYBR Green master mix (Applied Biosystems, Foster City, CA).

    RNA Extraction:

    Article Title: Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)
    Article Snippet: .. Ribonucleic acid (RNA) was extracted from stool samples using the QIAamp™ Viral RNA Extraction Kit (QIAGEN, Inc.) or Boom’s silica extraction method. .. The algorithm followed was to first extract the RNA material using the QIAamp Viral RNA Extraction kit and if RT-PCR was negative, the RNA material was extracted with the Boom’s silica extraction method.

    Random Hexamer Labeling:

    Article Title: Adaptive changes in amino acid metabolism permit normal longevity in mice consuming a low-carbohydrate ketogenic diet
    Article Snippet: Ribonucleic acid (RNA) was isolated from tissue flash-frozen in liquid nitrogen using an RNAeasy Lipid mini kit (Qiagen, Germantown, MD) according to manufacturer’s instructions. .. Complementary DNA (cDNA) was made from isolated RNA using oligo(dt) and random hexamer primers and reverse transcriptase (QuantiTech RT Kit; Qiagen, Germantown, MD).

    Spectrophotometry:

    Article Title: Molecular evidence and clinical importance of β‐arrestins expression in patients with acromegaly
    Article Snippet: The ribonucleic acid (RNA) was isolated using Allprep® Universal kit (Qiagen, Hilden, Germany) and treated with DNase (Turbo DNA‐free™ Kit, Invitrogen, CA, USA), according to the manufacturers’ protocol. .. The quality and amount of the extracted RNA were evaluated using NanoDrop Lite Spectrophotometer (Thermo Fischer, Wilmington, DE, USA) and Qubit 3.0 Fluorometer (Life Technologies, Foster City, CA, USA), respectively.

    Cell Counting:

    Article Title: Viral infections in patients with an acute exacerbation of idiopathic interstitial pneumonia.
    Article Snippet: Subsequently, the BALF was analyzed for the white blood cell count and differential and virus separation. .. Total deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) were extracted from 200 μL of each BALF sample using the QIAamp MinElute Virus Spin kit (Qiagen, Tokyo, Japan).

    Gradient Centrifugation:

    Article Title: Two canine CD1a proteins are differentially expressed in skin
    Article Snippet: Peripheral blood mononuclear cells (PBMCs) were isolated from dog blood by standard Ficoll–Hypaque gradient centrifugation. .. From all collected tissues, ribonucleic acid (RNA) was isolated using the RNeasy kit (Qiagen) followed by complementary deoxyribonucleic acid (cDNA) synthesis with Multiscribe reverse transcriptase (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Qiagen mettl14 sirna
    m 6 A reader blocks RNA demethylase activity to regulate m 6 A levels and expression of target genes. ( A ) m 6 A-contaning biotin-labeled TGFβ1 mRNA was incubated with 1 μg of FTO in the absence (−) or presence of 1 μg (+) or 2 μg (++) of YTHDF3, followed by mRNA pulldown and Western blot using antibodies against YTHDF3 or FTO. A portion of the sample collected before pulldown served as inputs. Gel photograph represents results from three independent experiments. ( B ) qRT-PCR showing m 6 A abundance (normalized to input) of target genes in MeRIP samples from MDA-MB-231 cells transfected with <t>scrambled-siRNA,</t> <t>METTL14-siRNA</t> (METTL14 KD), or METTL14 KD + YTHDF3-siRNA (YTHDF3 KD). The data shown are means ± SEM of three independent experiments. ( C and D ) qRT-PCR (C) and Western blot (D) analysis of scrambled-siRNA–, METTL14-siRNA (METTL14 KD)–, YTHDF3-siRNA (YTHDF3 KD)–, or METTL14-siRNA + YTHDF3-siRNA–transfected MDA-MB-231 cells using gene-specific primers and antibodies against the indicated proteins. The data shown in (C) are means ± SEM of four independent experiments. Gel photographs in (D) represent results from three independent experiments. Quantification of band intensities for (D) is shown in fig. S8K. ( E ) Western blot analysis of MDA-MB-231 cells exposed to normoxic and hypoxic conditions for 24 and 48 hours using antibodies against the indicated proteins. β-Actin served as a loading control. Gel photographs represent results from three independent experiments. Quantification of band intensities for (E) is shown in fig. S10A. ( F ) qRT-PCR showing TGFβ1 m 6 A abundance (normalized to input) in MeRIP samples (left) and TGFβ1 mRNA levels (right) from MDA-MB-231 cells exposed to normoxic and hypoxic conditions. The data shown are means ± SEM for two (for MeRIP) and three (for expression analysis) independent experiments. ( G ) qRT-PCR showing m 6 A abundance (normalized to input) of target gene in breast cancer patients ( n = 10) and normal controls ( n = 7) using gene-specific primers. * P
    Mettl14 Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mettl14 sirna/product/Qiagen
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mettl14 sirna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Qiagen gfp negative facs
    <t>GFP-positive</t> <t>FACS-sorted</t> cells from P7 Tie2-GFP mice represent pure populations of ECs. ( A ) Heatmap indicating pairwise Pearson correlations for RNA-seq TPMs for protein-coding genes. Total indicates sequencing performed on total dissociated tissue, GFPneg indicates sequencing performed on GFP-negative FACS-sorted cells, and GFPpos indicates sequencing performed on GFP-positive FACS-sorted cells. R1 and R2 indicate biological replicates. ( B ) Expression levels (TPMs) based on RNA-seq for the indicated genes. The top row of genes are known EC-expressed genes. EC-specific transcripts comprise ~15% of total lung transcripts. The middle row of genes are known immune or mural cell-expressed genes. The bottom row of genes are known abundant parenchymal-expressed genes. In this and subsequent figures, cell or tissue fractions are indicated by the following symbols: GFP-negative, circle; GFP-positive, triangle; Total, square. GFP-positive represents FACS-purified ECs.
    Gfp Negative Facs, supplied by Qiagen, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp negative facs/product/Qiagen
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gfp negative facs - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Qiagen qrt pcr rna
    Ro 25–6981 Mechanistic Studies Reveal UPR Modulation in Jimpy (A) <t>qRT-PCR</t> of Plp1 for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. n = 4 technical replicates per sample. (B) qRT-PCR of UPR-related panel for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. For all other probes n = 4 technical replicates per sample. Error bars represent mean ± SD. See also Figure S6 and Table S6 .
    Qrt Pcr Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 126 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr rna/product/Qiagen
    Average 99 stars, based on 126 article reviews
    Price from $9.99 to $1999.99
    qrt pcr rna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Qiagen apc sirna
    Local knockdown of <t>APC</t> accelerates functional and structural recovery following mouse sciatic nerve crush. ( A ) Knockdown of APC in DRG was confirmed by qRT-PCR. ( B ) Real-time PCR data showing APC knockdown in sciatic nerve. ( C – E ) Semi-thin transverse sections of crushed sciatic nerves distal to the zone of injury, after treatment with APC or scrambled control <t>siRNA</t> and analyzed after 28 days. ( D , E ) APC siRNA exposed nerves had a greater number of myelinated axon distal to injury indicating more robust recovery of axons, but there was no improvement in axonal caliber. ( F , G ) Histograms illustrating recovery of motor and sensory function after peripheral nerve injury [n = 6/group]. There was a rise in mechanical and thermal sensation, indicating recovery by 28 d. ( H , I ) A significant impact on the recovery of motor and sensory conduction velocities of regenerating axons at 28d using APC siRNA was noted. ( J ) Sensory nerve action potential amplitudes showed a nonsignificant trend toward higher values in APC siRNA treated when compared to those treated with scrambled siRNA. ( K ) Immunohistochemical analysis of β-catenin distribution in the crushed proximal nerve after treatment with APC or scrambled siRNA. Expression of β-catenin in regenerating axons is indicated using white arrows. Axons labeled with neurofilament (red, NF200) colocalized with β-catenin (green). ( L ) Co-expression of S100 and β-catenin in the crushed proximal nerve after treatment with APC or scramble siRNA. Expression of β-catenin in SC is indicated using white arrows. SCs labelled with s100 (red) are colocalized with β-catenin (green) ( t -test, *p
    Apc Sirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apc sirna/product/Qiagen
    Average 95 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    apc sirna - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    m 6 A reader blocks RNA demethylase activity to regulate m 6 A levels and expression of target genes. ( A ) m 6 A-contaning biotin-labeled TGFβ1 mRNA was incubated with 1 μg of FTO in the absence (−) or presence of 1 μg (+) or 2 μg (++) of YTHDF3, followed by mRNA pulldown and Western blot using antibodies against YTHDF3 or FTO. A portion of the sample collected before pulldown served as inputs. Gel photograph represents results from three independent experiments. ( B ) qRT-PCR showing m 6 A abundance (normalized to input) of target genes in MeRIP samples from MDA-MB-231 cells transfected with scrambled-siRNA, METTL14-siRNA (METTL14 KD), or METTL14 KD + YTHDF3-siRNA (YTHDF3 KD). The data shown are means ± SEM of three independent experiments. ( C and D ) qRT-PCR (C) and Western blot (D) analysis of scrambled-siRNA–, METTL14-siRNA (METTL14 KD)–, YTHDF3-siRNA (YTHDF3 KD)–, or METTL14-siRNA + YTHDF3-siRNA–transfected MDA-MB-231 cells using gene-specific primers and antibodies against the indicated proteins. The data shown in (C) are means ± SEM of four independent experiments. Gel photographs in (D) represent results from three independent experiments. Quantification of band intensities for (D) is shown in fig. S8K. ( E ) Western blot analysis of MDA-MB-231 cells exposed to normoxic and hypoxic conditions for 24 and 48 hours using antibodies against the indicated proteins. β-Actin served as a loading control. Gel photographs represent results from three independent experiments. Quantification of band intensities for (E) is shown in fig. S10A. ( F ) qRT-PCR showing TGFβ1 m 6 A abundance (normalized to input) in MeRIP samples (left) and TGFβ1 mRNA levels (right) from MDA-MB-231 cells exposed to normoxic and hypoxic conditions. The data shown are means ± SEM for two (for MeRIP) and three (for expression analysis) independent experiments. ( G ) qRT-PCR showing m 6 A abundance (normalized to input) of target gene in breast cancer patients ( n = 10) and normal controls ( n = 7) using gene-specific primers. * P

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: m 6 A reader blocks RNA demethylase activity to regulate m 6 A levels and expression of target genes. ( A ) m 6 A-contaning biotin-labeled TGFβ1 mRNA was incubated with 1 μg of FTO in the absence (−) or presence of 1 μg (+) or 2 μg (++) of YTHDF3, followed by mRNA pulldown and Western blot using antibodies against YTHDF3 or FTO. A portion of the sample collected before pulldown served as inputs. Gel photograph represents results from three independent experiments. ( B ) qRT-PCR showing m 6 A abundance (normalized to input) of target genes in MeRIP samples from MDA-MB-231 cells transfected with scrambled-siRNA, METTL14-siRNA (METTL14 KD), or METTL14 KD + YTHDF3-siRNA (YTHDF3 KD). The data shown are means ± SEM of three independent experiments. ( C and D ) qRT-PCR (C) and Western blot (D) analysis of scrambled-siRNA–, METTL14-siRNA (METTL14 KD)–, YTHDF3-siRNA (YTHDF3 KD)–, or METTL14-siRNA + YTHDF3-siRNA–transfected MDA-MB-231 cells using gene-specific primers and antibodies against the indicated proteins. The data shown in (C) are means ± SEM of four independent experiments. Gel photographs in (D) represent results from three independent experiments. Quantification of band intensities for (D) is shown in fig. S8K. ( E ) Western blot analysis of MDA-MB-231 cells exposed to normoxic and hypoxic conditions for 24 and 48 hours using antibodies against the indicated proteins. β-Actin served as a loading control. Gel photographs represent results from three independent experiments. Quantification of band intensities for (E) is shown in fig. S10A. ( F ) qRT-PCR showing TGFβ1 m 6 A abundance (normalized to input) in MeRIP samples (left) and TGFβ1 mRNA levels (right) from MDA-MB-231 cells exposed to normoxic and hypoxic conditions. The data shown are means ± SEM for two (for MeRIP) and three (for expression analysis) independent experiments. ( G ) qRT-PCR showing m 6 A abundance (normalized to input) of target gene in breast cancer patients ( n = 10) and normal controls ( n = 7) using gene-specific primers. * P

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Activity Assay, Expressing, Labeling, Incubation, Western Blot, Quantitative RT-PCR, Multiple Displacement Amplification, Transfection

    RNA methyltransferase METTL14 and demethylase ALKBH5 promote growth and invasion of breast cancer cells. Clonogenic assay on scrambled-siRNA– or METTL14-siRNA (METTL14 KD)–transfected ( A ) or ALKBH5-siRNA (ALKBH5 KD)–transfected ( C ) MDA-MB-231 cells. Bar graphs below show the number of colonies counted microscopically in 10 different fields. ( B and D ) Photomicrograph showing migrated (top) and invaded (bottom) MDA-MB-231 cells in scrambled (Scr) or METTL14 KD (B) or ALKBH5 KD (D) cells. Bar graphs show the number of migrated and invaded cells. The data shown are means ± SEM for at least three independent experiments. ** P

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: RNA methyltransferase METTL14 and demethylase ALKBH5 promote growth and invasion of breast cancer cells. Clonogenic assay on scrambled-siRNA– or METTL14-siRNA (METTL14 KD)–transfected ( A ) or ALKBH5-siRNA (ALKBH5 KD)–transfected ( C ) MDA-MB-231 cells. Bar graphs below show the number of colonies counted microscopically in 10 different fields. ( B and D ) Photomicrograph showing migrated (top) and invaded (bottom) MDA-MB-231 cells in scrambled (Scr) or METTL14 KD (B) or ALKBH5 KD (D) cells. Bar graphs show the number of migrated and invaded cells. The data shown are means ± SEM for at least three independent experiments. ** P

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Clonogenic Assay, Transfection, Multiple Displacement Amplification

    METTL14 and ALKBH5 support tumor growth and progression by targeting cell cycle– and TGFβ signaling–associated transcripts. ( A ) Western blot analysis of target genes in scrambled-siRNA–transfected, METTL14-siRNA (METTL14 KD)–transfected, and ALKBH5-siRNA (ALKBH5 KD)–transfected MDA-MB-231, MDA-MB-468, and BT-549 cells using antibodies against the indicated proteins. Membranes were reprobed with β-actin, which served as a loading control. Gel photograph is representative of at least three independent experiments. ( B ) Western blot analysis of target genes in empty vector (Control) and METTL14 expression vector (METTL14 OE)–transfected and ALKBH5 expression vector (ALKBH5 OE)–transfected MDA-MB-231 cells using antibodies against the indicated proteins. Membranes were reprobed with β-actin, which served as a loading control. Gel photograph is representative of at least three independent experiments. Quantification of band intensities for (A) and (B) is shown in fig. S4 (C and D). ( C ) Histogram showing cell cycle distribution of scrambled-siRNA (Control), METTL14 KD (top), and ALKBH5KD (bottom) MDA-MB-231 cells. The data shown are means ± SEM of three samples for each treatment and represent three independent experiments. ( D ) Western blot analysis of scrambled-siRNA–transfected, METTL14-siRNA (METTL14 KD)–transfected, or ALKBH5-siRNA (ALKBH5 KD)–transfected MDA-MB-231 cells using antibodies against the indicated proteins. Vinculin served as a loading control. Gel photograph is representative of at least three independent experiments. PARP, poly(adenosine diphosphate–ribose) polymerase. ( E ) Histogram showing the number of annexin V+ apoptotic cells in scrambled-siRNA–, METTL14-siRNA (METTL14 KD)–, or ALKBH5-siRNA (ALKBH5KD)–transfected MDA-MB-231 cells. MDA-MB-231 cells were transfected with scrambled-siRNA or METTL14-siRNA/ALKBH5-siRNA for 48 hours before they were stained with propidium iodide (PI) and incubated with annexin V antibody and analyzed by flow cytometry. The data shown are means ± SEM of three samples for each experiment and represent three independent experiments. ( F to H ) Photomicrograph showing migrated MDA-MB-231 cells in scrambled-siRNA–transfected, METTL14-siRNA–transfected (F), and ALKBH5-siRNA–transfected (H) groups, treated with TGFβ1 recombinant protein. Bar graphs show the number of migrated MDA-MB-231 cells in METTL14 KD (G) and ALKBH5 KD ( I ) groups. * P

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: METTL14 and ALKBH5 support tumor growth and progression by targeting cell cycle– and TGFβ signaling–associated transcripts. ( A ) Western blot analysis of target genes in scrambled-siRNA–transfected, METTL14-siRNA (METTL14 KD)–transfected, and ALKBH5-siRNA (ALKBH5 KD)–transfected MDA-MB-231, MDA-MB-468, and BT-549 cells using antibodies against the indicated proteins. Membranes were reprobed with β-actin, which served as a loading control. Gel photograph is representative of at least three independent experiments. ( B ) Western blot analysis of target genes in empty vector (Control) and METTL14 expression vector (METTL14 OE)–transfected and ALKBH5 expression vector (ALKBH5 OE)–transfected MDA-MB-231 cells using antibodies against the indicated proteins. Membranes were reprobed with β-actin, which served as a loading control. Gel photograph is representative of at least three independent experiments. Quantification of band intensities for (A) and (B) is shown in fig. S4 (C and D). ( C ) Histogram showing cell cycle distribution of scrambled-siRNA (Control), METTL14 KD (top), and ALKBH5KD (bottom) MDA-MB-231 cells. The data shown are means ± SEM of three samples for each treatment and represent three independent experiments. ( D ) Western blot analysis of scrambled-siRNA–transfected, METTL14-siRNA (METTL14 KD)–transfected, or ALKBH5-siRNA (ALKBH5 KD)–transfected MDA-MB-231 cells using antibodies against the indicated proteins. Vinculin served as a loading control. Gel photograph is representative of at least three independent experiments. PARP, poly(adenosine diphosphate–ribose) polymerase. ( E ) Histogram showing the number of annexin V+ apoptotic cells in scrambled-siRNA–, METTL14-siRNA (METTL14 KD)–, or ALKBH5-siRNA (ALKBH5KD)–transfected MDA-MB-231 cells. MDA-MB-231 cells were transfected with scrambled-siRNA or METTL14-siRNA/ALKBH5-siRNA for 48 hours before they were stained with propidium iodide (PI) and incubated with annexin V antibody and analyzed by flow cytometry. The data shown are means ± SEM of three samples for each experiment and represent three independent experiments. ( F to H ) Photomicrograph showing migrated MDA-MB-231 cells in scrambled-siRNA–transfected, METTL14-siRNA–transfected (F), and ALKBH5-siRNA–transfected (H) groups, treated with TGFβ1 recombinant protein. Bar graphs show the number of migrated MDA-MB-231 cells in METTL14 KD (G) and ALKBH5 KD ( I ) groups. * P

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Western Blot, Transfection, Multiple Displacement Amplification, Plasmid Preparation, Expressing, Staining, Incubation, Flow Cytometry, Cytometry, Recombinant

    METTL14 and ALKBH5 constitute a positive feedback loop with HuR to regulate the stability of target genes. ( A ) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis showing stability of target genes in scrambled-siRNA– or METTL14-siRNA–transfected MDA-MB-231 cells treated with actinomycin (5 μg) for the indicated hours. Transcript levels in scrambled-transfected cells were normalized to 100% for each time point. The data shown are means ± SEM of three independent experiments ( n = 3 biological replicates per experiment). ( B and C ) Western blot analysis of scrambled-siRNA–transfected, METTL14-siRNA–transfected (B), or ALKBH5-siRNA–transfected (C) MDA-MB-231, MDA-MB-468, BT-549, and HeLa cells using antibodies against the indicated proteins. The data shown are means ± SEM of three independent biological replicates. β-Actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as loading controls. #, *, **, and $ symbols next to β-actin in (B) and (C) indicate the same loading control as in Fig. 5C . The same loading controls were used because gels were stripped and reprobed for different proteins. Relevant proteins are shown in different figures to maintain the flow of the results. Quantification of band intensities is shown in fig. S5I. ( D ) qRT-PCR showing enrichment of HuR, METTL14, ALKBH5, and their target genes in MDA-MB-231 cells subjected to RIP using antibody against HuR. The data shown are means ± SEM of six independent experiments. ( E ) Western blot analysis of the indicated proteins in two sets of scrambled-siRNA– or HuR-siRNA (KD #1 and KD #2)–transfected MDA-MD-231 cells. β-Actin and GAPDH served as loading controls. Gel photograph is representative of at least three independent experiments. Quantification of band intensities is shown in fig. S5J. ( F and G ) qRT-PCR (F) and Western blot (G) analysis showing HuR expression in MDA-MB-231 cells treated with or without recombinant TGFβ1 (rTGFβ1; 2 ng/ml) using HuR-specific primers and antibody. Bar graph in (G) represents band intensity quantified from all experiments using ImageJ software. The data shown are means ± SEM of three independent experiments. * P

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: METTL14 and ALKBH5 constitute a positive feedback loop with HuR to regulate the stability of target genes. ( A ) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis showing stability of target genes in scrambled-siRNA– or METTL14-siRNA–transfected MDA-MB-231 cells treated with actinomycin (5 μg) for the indicated hours. Transcript levels in scrambled-transfected cells were normalized to 100% for each time point. The data shown are means ± SEM of three independent experiments ( n = 3 biological replicates per experiment). ( B and C ) Western blot analysis of scrambled-siRNA–transfected, METTL14-siRNA–transfected (B), or ALKBH5-siRNA–transfected (C) MDA-MB-231, MDA-MB-468, BT-549, and HeLa cells using antibodies against the indicated proteins. The data shown are means ± SEM of three independent biological replicates. β-Actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as loading controls. #, *, **, and $ symbols next to β-actin in (B) and (C) indicate the same loading control as in Fig. 5C . The same loading controls were used because gels were stripped and reprobed for different proteins. Relevant proteins are shown in different figures to maintain the flow of the results. Quantification of band intensities is shown in fig. S5I. ( D ) qRT-PCR showing enrichment of HuR, METTL14, ALKBH5, and their target genes in MDA-MB-231 cells subjected to RIP using antibody against HuR. The data shown are means ± SEM of six independent experiments. ( E ) Western blot analysis of the indicated proteins in two sets of scrambled-siRNA– or HuR-siRNA (KD #1 and KD #2)–transfected MDA-MD-231 cells. β-Actin and GAPDH served as loading controls. Gel photograph is representative of at least three independent experiments. Quantification of band intensities is shown in fig. S5J. ( F and G ) qRT-PCR (F) and Western blot (G) analysis showing HuR expression in MDA-MB-231 cells treated with or without recombinant TGFβ1 (rTGFβ1; 2 ng/ml) using HuR-specific primers and antibody. Bar graph in (G) represents band intensity quantified from all experiments using ImageJ software. The data shown are means ± SEM of three independent experiments. * P

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Transfection, Multiple Displacement Amplification, Western Blot, Flow Cytometry, Expressing, Recombinant, Software

    m 6 A methylation analysis of control and METTL14-silenced breast cancer cells. ( A and B ) MeRIP-seq analysis showing the number of peaks (A) and m 6 A peak–containing transcripts (B) identified in scrambled-siRNA (siCntrl)– and METTL14-siRNA (METTL14 KD)–transfected breast cancer cells. Common m 6 A-containing genes share at least one common peak, while unique m 6 A-containing genes share no peak between scrambled-siRNA and METTL14 KD breast cancer cells. ( C ) TGF β 1 , CCNE1 , and SMAD3 showing significantly enriched m 6 A peaks in METTL14 KD MDA-MB-231 cells compared to scrambled-siRNA. Top two tracks represent MeRIP and input for METTL14-siRNA–transfected MDA-MB-231 cells, while bottom two tracks represent MeRIP and input for scrambled-siRNA–transfected MDA-MB-231 cells. bp, base pairs; RefSeq, reference sequence. ( D ) Pie chart of m 6 A peak distribution showing proportion of total (top) and unique (bottom) peaks in different regions of genes in scrambled-siRNA and METTL14 KD cells. ( E ) Ingenuity Pathway Analysis (IPA) using m 6 A peak–containing genes shows TGF β as one of the top upstream regulators. ( F ) Bar graphs show enriched canonical pathways derived from IPA using m 6 A-containing genes. ( G ) qRT-PCR showing m 6 A abundance (normalized to input) of target genes in MeRIP samples from MDA-MB-231 and MCF-7 cells transfected with scrambled-siRNA or METTL14-siRNA (METTL14 KD). The data shown are means ± SEM of three independent experiments ( n = 3 biological replicates per experiment).

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: m 6 A methylation analysis of control and METTL14-silenced breast cancer cells. ( A and B ) MeRIP-seq analysis showing the number of peaks (A) and m 6 A peak–containing transcripts (B) identified in scrambled-siRNA (siCntrl)– and METTL14-siRNA (METTL14 KD)–transfected breast cancer cells. Common m 6 A-containing genes share at least one common peak, while unique m 6 A-containing genes share no peak between scrambled-siRNA and METTL14 KD breast cancer cells. ( C ) TGF β 1 , CCNE1 , and SMAD3 showing significantly enriched m 6 A peaks in METTL14 KD MDA-MB-231 cells compared to scrambled-siRNA. Top two tracks represent MeRIP and input for METTL14-siRNA–transfected MDA-MB-231 cells, while bottom two tracks represent MeRIP and input for scrambled-siRNA–transfected MDA-MB-231 cells. bp, base pairs; RefSeq, reference sequence. ( D ) Pie chart of m 6 A peak distribution showing proportion of total (top) and unique (bottom) peaks in different regions of genes in scrambled-siRNA and METTL14 KD cells. ( E ) Ingenuity Pathway Analysis (IPA) using m 6 A peak–containing genes shows TGF β as one of the top upstream regulators. ( F ) Bar graphs show enriched canonical pathways derived from IPA using m 6 A-containing genes. ( G ) qRT-PCR showing m 6 A abundance (normalized to input) of target genes in MeRIP samples from MDA-MB-231 and MCF-7 cells transfected with scrambled-siRNA or METTL14-siRNA (METTL14 KD). The data shown are means ± SEM of three independent experiments ( n = 3 biological replicates per experiment).

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Methylation, Transfection, Multiple Displacement Amplification, Sequencing, Indirect Immunoperoxidase Assay, Derivative Assay, Quantitative RT-PCR

    Cross-talk among writer, reader, and eraser determines m 6 A levels of target transcripts. ( A ) Western blot analysis of scrambled-siRNA–transfected or METTL14-siRNA–transfected (top) or ALKBH5-siRNA–transfected (bottom) MDA-MB-231, MDA-MB-468, and BT-549 cells using antibodies against the indicated protein. Gel photographs represent results from three independent experiments. Note that METTL14 levels in ALKBH5 KD MDA-MB-231, MDA-MB-468, and BT-549 cells are shown in Fig. 4C . #, *, **, and $ symbols next to β-actin indicate the same loading control as in Fig. 4C . ( B ) Western blot analysis of scrambled-siRNA–transfected or METTL14-siRNA–transfected (top) or ALKBH5-siRNA–transfected (bottom) MDA-MB-231, MDA-MB-468, BT-549, and HeLa cells using antibodies against YTHDF3. Gel photographs represent results from three independent experiments. Quantification of band intensities for (A) and (B) is shown in fig. S8.

    Journal: Science Advances

    Article Title: Cross-talk among writers, readers, and erasers of m6A regulates cancer growth and progression

    doi: 10.1126/sciadv.aar8263

    Figure Lengend Snippet: Cross-talk among writer, reader, and eraser determines m 6 A levels of target transcripts. ( A ) Western blot analysis of scrambled-siRNA–transfected or METTL14-siRNA–transfected (top) or ALKBH5-siRNA–transfected (bottom) MDA-MB-231, MDA-MB-468, and BT-549 cells using antibodies against the indicated protein. Gel photographs represent results from three independent experiments. Note that METTL14 levels in ALKBH5 KD MDA-MB-231, MDA-MB-468, and BT-549 cells are shown in Fig. 4C . #, *, **, and $ symbols next to β-actin indicate the same loading control as in Fig. 4C . ( B ) Western blot analysis of scrambled-siRNA–transfected or METTL14-siRNA–transfected (top) or ALKBH5-siRNA–transfected (bottom) MDA-MB-231, MDA-MB-468, BT-549, and HeLa cells using antibodies against YTHDF3. Gel photographs represent results from three independent experiments. Quantification of band intensities for (A) and (B) is shown in fig. S8.

    Article Snippet: m6 A MeRIP Total RNA was isolated from scrambled and METTL14-siRNA or ALKBH5-siRNA using the RNeasy Midi Kit (Qiagen), followed by polyadenylation enrichment using the GenElute mRNA Miniprep Kit (Sigma-Aldrich).

    Techniques: Western Blot, Transfection, Multiple Displacement Amplification

    GFP-positive FACS-sorted cells from P7 Tie2-GFP mice represent pure populations of ECs. ( A ) Heatmap indicating pairwise Pearson correlations for RNA-seq TPMs for protein-coding genes. Total indicates sequencing performed on total dissociated tissue, GFPneg indicates sequencing performed on GFP-negative FACS-sorted cells, and GFPpos indicates sequencing performed on GFP-positive FACS-sorted cells. R1 and R2 indicate biological replicates. ( B ) Expression levels (TPMs) based on RNA-seq for the indicated genes. The top row of genes are known EC-expressed genes. EC-specific transcripts comprise ~15% of total lung transcripts. The middle row of genes are known immune or mural cell-expressed genes. The bottom row of genes are known abundant parenchymal-expressed genes. In this and subsequent figures, cell or tissue fractions are indicated by the following symbols: GFP-negative, circle; GFP-positive, triangle; Total, square. GFP-positive represents FACS-purified ECs.

    Journal: eLife

    Article Title: Transcriptional and epigenomic landscapes of CNS and non-CNS vascular endothelial cells

    doi: 10.7554/eLife.36187

    Figure Lengend Snippet: GFP-positive FACS-sorted cells from P7 Tie2-GFP mice represent pure populations of ECs. ( A ) Heatmap indicating pairwise Pearson correlations for RNA-seq TPMs for protein-coding genes. Total indicates sequencing performed on total dissociated tissue, GFPneg indicates sequencing performed on GFP-negative FACS-sorted cells, and GFPpos indicates sequencing performed on GFP-positive FACS-sorted cells. R1 and R2 indicate biological replicates. ( B ) Expression levels (TPMs) based on RNA-seq for the indicated genes. The top row of genes are known EC-expressed genes. EC-specific transcripts comprise ~15% of total lung transcripts. The middle row of genes are known immune or mural cell-expressed genes. The bottom row of genes are known abundant parenchymal-expressed genes. In this and subsequent figures, cell or tissue fractions are indicated by the following symbols: GFP-negative, circle; GFP-positive, triangle; Total, square. GFP-positive represents FACS-purified ECs.

    Article Snippet: RNA and DNA sample preparation RNA was extracted from an aliquot of dissociated tissue prior to filtering and antibody staining and from GFP-positive and GFP-negative FACS sorted cells using the RNeasy Micro Plus kit (74034, QIAGEN, Venlo, Netherlands).

    Techniques: FACS, Mouse Assay, RNA Sequencing Assay, Sequencing, Expressing, Purification

    Ro 25–6981 Mechanistic Studies Reveal UPR Modulation in Jimpy (A) qRT-PCR of Plp1 for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. n = 4 technical replicates per sample. (B) qRT-PCR of UPR-related panel for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. For all other probes n = 4 technical replicates per sample. Error bars represent mean ± SD. See also Figure S6 and Table S6 .

    Journal: Stem Cell Reports

    Article Title: Chemical Screening Identifies Enhancers of Mutant Oligodendrocyte Survival and Unmasks a Distinct Pathological Phase in Pelizaeus-Merzbacher Disease

    doi: 10.1016/j.stemcr.2018.07.015

    Figure Lengend Snippet: Ro 25–6981 Mechanistic Studies Reveal UPR Modulation in Jimpy (A) qRT-PCR of Plp1 for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. n = 4 technical replicates per sample. (B) qRT-PCR of UPR-related panel for wild-type and jimpy at day 1 of oligodendrocyte differentiation with indicated treatment. Vehicle-treated controls same as Figure S6 D. For Atf6 n = 3 technical replicates per sample. For all other probes n = 4 technical replicates per sample. Error bars represent mean ± SD. See also Figure S6 and Table S6 .

    Article Snippet: qRT-PCR RNA was prepared with the RNeasy Mini Kit (74104, QIAGEN). qRT-PCR was performed using pre-designed TaqMan gene expression assays (Thermo Fisher Scientific) and probes values were normalized to an Actb endogenous control.

    Techniques: Quantitative RT-PCR

    Local knockdown of APC accelerates functional and structural recovery following mouse sciatic nerve crush. ( A ) Knockdown of APC in DRG was confirmed by qRT-PCR. ( B ) Real-time PCR data showing APC knockdown in sciatic nerve. ( C – E ) Semi-thin transverse sections of crushed sciatic nerves distal to the zone of injury, after treatment with APC or scrambled control siRNA and analyzed after 28 days. ( D , E ) APC siRNA exposed nerves had a greater number of myelinated axon distal to injury indicating more robust recovery of axons, but there was no improvement in axonal caliber. ( F , G ) Histograms illustrating recovery of motor and sensory function after peripheral nerve injury [n = 6/group]. There was a rise in mechanical and thermal sensation, indicating recovery by 28 d. ( H , I ) A significant impact on the recovery of motor and sensory conduction velocities of regenerating axons at 28d using APC siRNA was noted. ( J ) Sensory nerve action potential amplitudes showed a nonsignificant trend toward higher values in APC siRNA treated when compared to those treated with scrambled siRNA. ( K ) Immunohistochemical analysis of β-catenin distribution in the crushed proximal nerve after treatment with APC or scrambled siRNA. Expression of β-catenin in regenerating axons is indicated using white arrows. Axons labeled with neurofilament (red, NF200) colocalized with β-catenin (green). ( L ) Co-expression of S100 and β-catenin in the crushed proximal nerve after treatment with APC or scramble siRNA. Expression of β-catenin in SC is indicated using white arrows. SCs labelled with s100 (red) are colocalized with β-catenin (green) ( t -test, *p

    Journal: Scientific Reports

    Article Title: Expression and Manipulation of the APC-β-Catenin Pathway During Peripheral Neuron Regeneration

    doi: 10.1038/s41598-018-31167-1

    Figure Lengend Snippet: Local knockdown of APC accelerates functional and structural recovery following mouse sciatic nerve crush. ( A ) Knockdown of APC in DRG was confirmed by qRT-PCR. ( B ) Real-time PCR data showing APC knockdown in sciatic nerve. ( C – E ) Semi-thin transverse sections of crushed sciatic nerves distal to the zone of injury, after treatment with APC or scrambled control siRNA and analyzed after 28 days. ( D , E ) APC siRNA exposed nerves had a greater number of myelinated axon distal to injury indicating more robust recovery of axons, but there was no improvement in axonal caliber. ( F , G ) Histograms illustrating recovery of motor and sensory function after peripheral nerve injury [n = 6/group]. There was a rise in mechanical and thermal sensation, indicating recovery by 28 d. ( H , I ) A significant impact on the recovery of motor and sensory conduction velocities of regenerating axons at 28d using APC siRNA was noted. ( J ) Sensory nerve action potential amplitudes showed a nonsignificant trend toward higher values in APC siRNA treated when compared to those treated with scrambled siRNA. ( K ) Immunohistochemical analysis of β-catenin distribution in the crushed proximal nerve after treatment with APC or scrambled siRNA. Expression of β-catenin in regenerating axons is indicated using white arrows. Axons labeled with neurofilament (red, NF200) colocalized with β-catenin (green). ( L ) Co-expression of S100 and β-catenin in the crushed proximal nerve after treatment with APC or scramble siRNA. Expression of β-catenin in SC is indicated using white arrows. SCs labelled with s100 (red) are colocalized with β-catenin (green) ( t -test, *p

    Article Snippet: In vivo siRNA application and functional recovery The control (scramble) siRNA or APC siRNA were transfected using HiPerfect Transfection reagent (Qiagen) according to manufacturer’s protocol.

    Techniques: Functional Assay, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Immunohistochemistry, Expressing, Labeling

    Neurite extension in cultured dissociated rat DRG neurons exposed to APC knockdown in vitro . ( A ) Western blot analysis of the expression of APC protein in cultured sensory DRG neuronal cell transfected with siRNA against rat APC (siAPC). ( B – D ) The cells were visualized by immunostaining using anti-NF200 antibody of sham injured neurons with or without siRNA: ( B ) sham control, ( C ) with scrambled siRNA and ( D ) with APC siRNA. ( E – G ) Representative images of the injured neurons with or without siRNA: ( E ) injured control, ( F ) with scrambled siRNA, ( G ) with APC siRNA. ( H ) Quantification of neurite outgrowth (µm) after outgrowth analysis of cultured DRG neurons of sham and pre-conditionally injured cells. APC knockdown was associated with increased neurite outgrowth in comparison to control cultures after both sham sciatic injury and sciatic axotomy pre-conditioning injury. ( I – N ) Pharmacological-mediated knockdown of β-catenin impairs neurite outgrowth in injured cultured primary adult sensory neurons from rats. ( I ) DRG neuronal cells were treated with the carrier (control), ( J ) APC siRNA, ( K ) cells treated within ICG-001 alone, ( L ) cells treated with APC siRNA and ICG-001. ICG-001 was associated with attenuated outgrowth in control and APC siRNA conditions ( M , N ). Quantification of total neurite outgrowth of injured cultured neurons. (One-way ANOVA with Turkey post-hoc analysis, *p

    Journal: Scientific Reports

    Article Title: Expression and Manipulation of the APC-β-Catenin Pathway During Peripheral Neuron Regeneration

    doi: 10.1038/s41598-018-31167-1

    Figure Lengend Snippet: Neurite extension in cultured dissociated rat DRG neurons exposed to APC knockdown in vitro . ( A ) Western blot analysis of the expression of APC protein in cultured sensory DRG neuronal cell transfected with siRNA against rat APC (siAPC). ( B – D ) The cells were visualized by immunostaining using anti-NF200 antibody of sham injured neurons with or without siRNA: ( B ) sham control, ( C ) with scrambled siRNA and ( D ) with APC siRNA. ( E – G ) Representative images of the injured neurons with or without siRNA: ( E ) injured control, ( F ) with scrambled siRNA, ( G ) with APC siRNA. ( H ) Quantification of neurite outgrowth (µm) after outgrowth analysis of cultured DRG neurons of sham and pre-conditionally injured cells. APC knockdown was associated with increased neurite outgrowth in comparison to control cultures after both sham sciatic injury and sciatic axotomy pre-conditioning injury. ( I – N ) Pharmacological-mediated knockdown of β-catenin impairs neurite outgrowth in injured cultured primary adult sensory neurons from rats. ( I ) DRG neuronal cells were treated with the carrier (control), ( J ) APC siRNA, ( K ) cells treated within ICG-001 alone, ( L ) cells treated with APC siRNA and ICG-001. ICG-001 was associated with attenuated outgrowth in control and APC siRNA conditions ( M , N ). Quantification of total neurite outgrowth of injured cultured neurons. (One-way ANOVA with Turkey post-hoc analysis, *p

    Article Snippet: In vivo siRNA application and functional recovery The control (scramble) siRNA or APC siRNA were transfected using HiPerfect Transfection reagent (Qiagen) according to manufacturer’s protocol.

    Techniques: Cell Culture, In Vitro, Western Blot, Expressing, Transfection, Immunostaining

    APC regulates β-catenin/TCF/LEF signalling. ( A – D ) Cultured DRG neurons were transfected with control siRNA or APC siRNA and then subjected to immunoblotting; protein expression of APC, β-catenin, TCF, LEF and α-tubulin served as an internal control. ( A – D ) Quantification of western blot data showing declines in APC and rises in β-catenin, TCF and LEF relative expression. Asterisks indicate a significant difference ( t test, *p

    Journal: Scientific Reports

    Article Title: Expression and Manipulation of the APC-β-Catenin Pathway During Peripheral Neuron Regeneration

    doi: 10.1038/s41598-018-31167-1

    Figure Lengend Snippet: APC regulates β-catenin/TCF/LEF signalling. ( A – D ) Cultured DRG neurons were transfected with control siRNA or APC siRNA and then subjected to immunoblotting; protein expression of APC, β-catenin, TCF, LEF and α-tubulin served as an internal control. ( A – D ) Quantification of western blot data showing declines in APC and rises in β-catenin, TCF and LEF relative expression. Asterisks indicate a significant difference ( t test, *p

    Article Snippet: In vivo siRNA application and functional recovery The control (scramble) siRNA or APC siRNA were transfected using HiPerfect Transfection reagent (Qiagen) according to manufacturer’s protocol.

    Techniques: Cell Culture, Transfection, Expressing, Western Blot