Structured Review

Biological Industries Inc ribonucleic acid rna
Ribonucleic Acid Rna, supplied by Biological Industries Inc, used in various techniques. Bioz Stars score: 80/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ribonucleic acid rna/product/Biological Industries Inc
Average 80 stars, based on 1 article reviews
Price from $9.99 to $1999.99
ribonucleic acid rna - by Bioz Stars, 2020-04
80/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Neurally adjusted ventilatory assist mitigates ventilator-induced diaphragm injury in rabbits
Article Snippet: Paragraph title: Muscle protein degeneration: measurement of messenger ribonucleic acid (mRNA) expression by quantitative realtime polymerase chain reaction (PCR) ... Muscle tissue samples were stored in ribonucleic acid (RNA) Save (Biological Industries Ltd. Israel), homogenized with Biomasher 2 (Nippi inc. Japan), and total RNA extracted with EZ-RNA Total RNA Isolation Kit (Biological Industries Ltd. Israel).

Isolation:

Article Title: Neurally adjusted ventilatory assist mitigates ventilator-induced diaphragm injury in rabbits
Article Snippet: .. Muscle tissue samples were stored in ribonucleic acid (RNA) Save (Biological Industries Ltd. Israel), homogenized with Biomasher 2 (Nippi inc. Japan), and total RNA extracted with EZ-RNA Total RNA Isolation Kit (Biological Industries Ltd. Israel). .. RNA purity was measured with an Agilent 2100 Bioanalyzer System (Agilent Technologies, Inc. Santa Clara, Calif., USA) and complementary deoxyribonucleic acid (cDNA) was prepared using SuperScript™ IV VILO™ Master Mix with ezDNase™ (Thermo Fisher Scientific Inc., Waltham, Mass., USA).

Amplification:

Article Title: Neurally adjusted ventilatory assist mitigates ventilator-induced diaphragm injury in rabbits
Article Snippet: Muscle tissue samples were stored in ribonucleic acid (RNA) Save (Biological Industries Ltd. Israel), homogenized with Biomasher 2 (Nippi inc. Japan), and total RNA extracted with EZ-RNA Total RNA Isolation Kit (Biological Industries Ltd. Israel). .. After previously verifying amplification efficiency, expression level of Caspase-3 was measured by the ΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as endogenous control.

Expressing:

Article Title: Neurally adjusted ventilatory assist mitigates ventilator-induced diaphragm injury in rabbits
Article Snippet: Paragraph title: Muscle protein degeneration: measurement of messenger ribonucleic acid (mRNA) expression by quantitative realtime polymerase chain reaction (PCR) ... Muscle tissue samples were stored in ribonucleic acid (RNA) Save (Biological Industries Ltd. Israel), homogenized with Biomasher 2 (Nippi inc. Japan), and total RNA extracted with EZ-RNA Total RNA Isolation Kit (Biological Industries Ltd. Israel).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Biological Industries Inc cdna
    RT-PCR and quantitative RT-PCR analysis . A : PCR analysis of <t>cDNA</t> transcribed from RNA extracted by the different columns. RT-PCR, Lanes 1 and 4, cDNA template was transcribed from RNA extracted using the common RNA extraction protocol [ 4 ] without column extraction step. Lanes 2 and 5, cDNA template was transcribed from RNA produced using the plasmid <t>DNA</t> extraction column. Lanes 3 and 6, cDNA template was transcribed from RNA produced using the RNA collection column (RNeasy Plant Mini Kit). EtOH, 96% ethanol added to samples before transfer through columns. Actin 1 ( Act1 , lanes 1-3) and β-Tubulin 2 ( Tub2 , lanes 4-6) primers were used. M, DNA 1-kb ladder. B : Quantitative real-time RT-PCR on cDNA transcribed from RNA produced using LogSpin protocol, amplification plot (upper panel) and fold change of AtPR1 gene normalized to AtPTB1F on samples from inoculated versus uninoculated (control) Arabidopsis leaves. Relative AtPR1 gene expression was calculated by the 2 -ΔΔCt method (ΔRn).
    Cdna, supplied by Biological Industries Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna/product/Biological Industries Inc
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cdna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    90
    Biological Industries Inc hfk ncam cd133 cells
    SIX2 is highly expressed by NCAM1 + <t>CD133−</t> cells, while EMA and CD13 are upregulated in NCAM1 + CD133 + and NCAM1 − CD133 + at the protein level. Sorted cells were fixed on coverslips and immonostained for SIX2, WT1, EMA and CD13. ( A ) Immunofluorescent staining confirms the RNA sequencing and qRT-PCR gene expression results at the protein level showing SIX2 (green) to be highly expressed by NCAM1 + CD133 − cells while few or no cells were stained in the NCAM1 + CD133 + and NCAM1 − CD133 + subpopulations respectively. WT1 (red) was highly expressed by both NCAM1 + CD133 − and NCAM1 + CD133 + cells. ( B ) CD13 (green-marker of proximal tubular cells) showed the highest expression in the NCAM1 − CD133 + and EMA (red- marker of distal tubular cells) was highly expressed by NCAM1 + CD133 + while NCAM1 + CD133 − <t>hFK</t> cells were mostly devoid of their expression.
    Hfk Ncam Cd133 Cells, supplied by Biological Industries Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hfk ncam cd133 cells/product/Biological Industries Inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hfk ncam cd133 cells - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    94
    Biological Industries Inc sirna
    Biocompatibility of <t>APA-siRNA</t> <t>polyplex.</t> a APA alone or complexed with siRNA (50 and 200 nM) was added to freshly isolated human PBMCs that were seeded in 12-well plates. PBMCs medium and LPS (2 µg ml −1 ) were used as negative and positive controls, respectively. Culture supernatants were collected after 24 h and assayed for human IL-6 and TNF-α cytokines by ELISA. b miR (35 μM) alone or complexed with APA was incubated in FBS for several time points (0, 1, 3, 6 and 12 h) at 37 °C and was run on an electrophoresis agarose gel. c Red blood cells lysis assay following 1 h incubation with APA-miRNA polyplexes. Results are presented as percentage of hemoglobin released by 1 wt %/vol solution of Triton X-100 (100% lysis). Sodium dodecyl sulfate (SDS) and dextran were used as positive and negative controls, respectively. d H E staining of normal pancreas following 3 sequential i.v. injections of PBS or APA-miR-34a-PLK1-siRNA polyplex (2 mg kg −1 oligonucleotide dose). Scale bar, 10 μm. e Blood glucose levels of normal mice treated as in d . Blood was withdrawn at days 0, 2, 7, and 9 from treatment initiation ( n = 2/3). Data represent mean ± SD
    Sirna, supplied by Biological Industries Inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna/product/Biological Industries Inc
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    sirna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    87
    Biological Industries Inc rna
    Expression of PLEKHM2 gene in patients' cells. ( A ) RT-PCR products. <t>RNA</t> was extracted from <t>lymphoblastoid</t> cells and fibroblasts of patient II-1 and from comparable cells of control individuals. PCR was performed on the cDNA using primers in exons 10 and 15, flanking exon 12 that contains the mutation and the PCR products were separated on 2% agarose gel. The patient cells exhibited two fragments in contrast to control cells that had only one. The large PCR product of the patient (579 bp) contains the deletion of AG in exon 12 and the smaller fragment of 488 bp that appears only in patients' cells results from skipping of exon 11. ( B ) Sequence chromatogram of the 581 bp PCR product of the control cells (upper), the 579 bp PCR product of the patient (middle) and the 448 bp PCR product showing the skipping of exon 11 (exon 12 joining directly to exon 10 is marked by darker letters). ( C ). The mutant diagram presents the result of the frameshift mutation that will be created by the PLEKHM2 mRNA that produces the 579 bp RT-PCR product. The 12 amino acids marked in darker are created by the frameshift translation. The diagram of the mutant lacking exon 11 presents the amino acids flanking the deletion and in darker are the amino acids that are produced by the frameshift that is created by splicing exon 10–12 until the deletion of the AG nucleotide rescues the frameshift. ( D ) Sequence conservation of exon 11 and the first amino acids of exon 12 that are missing in the patients. The amino acids that are deleted by the mutation are shaded by gray. ( E ) PLEKHM2 protein is expressed in fibroblasts cells of patients II-1 and II-2 as demonstrated by western blot using an antibody to the C-terminal region. Control cells (C) are from fibroblasts from two control individuals as well as commercial fibroblasts. PLEKHM2 protein sample produced by expression of plasmid Pcmv-Myc-PLEKHM2 was loaded in parallel for use as size migration control (PLEKHM2). ( F ) Same as (E) with an antibody to the N-terminal region.
    Rna, supplied by Biological Industries Inc, used in various techniques. Bioz Stars score: 87/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna/product/Biological Industries Inc
    Average 87 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    Image Search Results


    RT-PCR and quantitative RT-PCR analysis . A : PCR analysis of cDNA transcribed from RNA extracted by the different columns. RT-PCR, Lanes 1 and 4, cDNA template was transcribed from RNA extracted using the common RNA extraction protocol [ 4 ] without column extraction step. Lanes 2 and 5, cDNA template was transcribed from RNA produced using the plasmid DNA extraction column. Lanes 3 and 6, cDNA template was transcribed from RNA produced using the RNA collection column (RNeasy Plant Mini Kit). EtOH, 96% ethanol added to samples before transfer through columns. Actin 1 ( Act1 , lanes 1-3) and β-Tubulin 2 ( Tub2 , lanes 4-6) primers were used. M, DNA 1-kb ladder. B : Quantitative real-time RT-PCR on cDNA transcribed from RNA produced using LogSpin protocol, amplification plot (upper panel) and fold change of AtPR1 gene normalized to AtPTB1F on samples from inoculated versus uninoculated (control) Arabidopsis leaves. Relative AtPR1 gene expression was calculated by the 2 -ΔΔCt method (ΔRn).

    Journal: BMC Research Notes

    Article Title: LogSpin: a simple, economical and fast method for RNA isolation from infected or healthy plants and other eukaryotic tissues

    doi: 10.1186/1756-0500-5-45

    Figure Lengend Snippet: RT-PCR and quantitative RT-PCR analysis . A : PCR analysis of cDNA transcribed from RNA extracted by the different columns. RT-PCR, Lanes 1 and 4, cDNA template was transcribed from RNA extracted using the common RNA extraction protocol [ 4 ] without column extraction step. Lanes 2 and 5, cDNA template was transcribed from RNA produced using the plasmid DNA extraction column. Lanes 3 and 6, cDNA template was transcribed from RNA produced using the RNA collection column (RNeasy Plant Mini Kit). EtOH, 96% ethanol added to samples before transfer through columns. Actin 1 ( Act1 , lanes 1-3) and β-Tubulin 2 ( Tub2 , lanes 4-6) primers were used. M, DNA 1-kb ladder. B : Quantitative real-time RT-PCR on cDNA transcribed from RNA produced using LogSpin protocol, amplification plot (upper panel) and fold change of AtPR1 gene normalized to AtPTB1F on samples from inoculated versus uninoculated (control) Arabidopsis leaves. Relative AtPR1 gene expression was calculated by the 2 -ΔΔCt method (ΔRn).

    Article Snippet: cDNA synthesis and RT-PCR RNA (1000 ng) was treated with DNase I (New England Biolabs, Ipswich, MA, USA) and 1000 ng of DNA-free RNA was reverse-transcribed to cDNA (EZ-First Strand cDNA Synthesis Kit for RT-PCR, Biological Industries, Beit Haemek, Israel).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Polymerase Chain Reaction, RNA Extraction, Produced, Plasmid Preparation, DNA Extraction, Amplification, Expressing

    SIX2 is highly expressed by NCAM1 + CD133− cells, while EMA and CD13 are upregulated in NCAM1 + CD133 + and NCAM1 − CD133 + at the protein level. Sorted cells were fixed on coverslips and immonostained for SIX2, WT1, EMA and CD13. ( A ) Immunofluorescent staining confirms the RNA sequencing and qRT-PCR gene expression results at the protein level showing SIX2 (green) to be highly expressed by NCAM1 + CD133 − cells while few or no cells were stained in the NCAM1 + CD133 + and NCAM1 − CD133 + subpopulations respectively. WT1 (red) was highly expressed by both NCAM1 + CD133 − and NCAM1 + CD133 + cells. ( B ) CD13 (green-marker of proximal tubular cells) showed the highest expression in the NCAM1 − CD133 + and EMA (red- marker of distal tubular cells) was highly expressed by NCAM1 + CD133 + while NCAM1 + CD133 − hFK cells were mostly devoid of their expression.

    Journal: Scientific Reports

    Article Title: Dissecting Stages of Human Kidney Development and Tumorigenesis with Surface Markers Affords Simple Prospective Purification of Nephron Stem Cells

    doi: 10.1038/srep23562

    Figure Lengend Snippet: SIX2 is highly expressed by NCAM1 + CD133− cells, while EMA and CD13 are upregulated in NCAM1 + CD133 + and NCAM1 − CD133 + at the protein level. Sorted cells were fixed on coverslips and immonostained for SIX2, WT1, EMA and CD13. ( A ) Immunofluorescent staining confirms the RNA sequencing and qRT-PCR gene expression results at the protein level showing SIX2 (green) to be highly expressed by NCAM1 + CD133 − cells while few or no cells were stained in the NCAM1 + CD133 + and NCAM1 − CD133 + subpopulations respectively. WT1 (red) was highly expressed by both NCAM1 + CD133 − and NCAM1 + CD133 + cells. ( B ) CD13 (green-marker of proximal tubular cells) showed the highest expression in the NCAM1 − CD133 + and EMA (red- marker of distal tubular cells) was highly expressed by NCAM1 + CD133 + while NCAM1 + CD133 − hFK cells were mostly devoid of their expression.

    Article Snippet: For assessment of the differentiation capacity of HFK NCAM+ CD133− cells, apart from SCM and SFM, cells were cultured in RPMI media comprised of RPMI-1640 (Biological Industries) supplemented with 10% foetal bovine serum (Invitrogen), 1% Pen–strep 100 M, 1% l-glutamine (both from Biological industries).

    Techniques: Staining, RNA Sequencing Assay, Quantitative RT-PCR, Expressing, Marker

    NCAM1 and CD133 define the MET hierarchy in hFK cells. RNA sequencing of hFK cells grown in SFM and sorted into three cell fractions: NCAM1 + CD133 − , NCAM1 + CD133 + and NCAM1 − CD133 + . ( A ) Left: Heatmap representation of differentially expressed genes between the three cell subpopulations showing cap mesenchyme (CM) and mesenchymal genes to be highly expressed by NCAM1 + CD133 − cells and gradually decline in NCAM1 + CD133 + and NCAM1 − CD133 + hFK cells. In contrast, epithelial genes are most highly expressed by NCAM1 − CD133 + , to a lesser extent in NCAM1 + CD133 + cells and are drastically downregulated in NCAM1 + CD133 − cells. Right: validation of RNA sequencing results via qRT-PCR performed on sorted cells from different hFKs showing the same hierarchical MET gene expression pattern between these cell fractions. The values for NCAM1 + CD133 − cells were used to normalize (therefore = 1) and all other values were calculated with respect to them. Experiments were performed on 2 hFK sources (n = 2). Results are presented as the mean ± S.E.M of three separate experiments; *p

    Journal: Scientific Reports

    Article Title: Dissecting Stages of Human Kidney Development and Tumorigenesis with Surface Markers Affords Simple Prospective Purification of Nephron Stem Cells

    doi: 10.1038/srep23562

    Figure Lengend Snippet: NCAM1 and CD133 define the MET hierarchy in hFK cells. RNA sequencing of hFK cells grown in SFM and sorted into three cell fractions: NCAM1 + CD133 − , NCAM1 + CD133 + and NCAM1 − CD133 + . ( A ) Left: Heatmap representation of differentially expressed genes between the three cell subpopulations showing cap mesenchyme (CM) and mesenchymal genes to be highly expressed by NCAM1 + CD133 − cells and gradually decline in NCAM1 + CD133 + and NCAM1 − CD133 + hFK cells. In contrast, epithelial genes are most highly expressed by NCAM1 − CD133 + , to a lesser extent in NCAM1 + CD133 + cells and are drastically downregulated in NCAM1 + CD133 − cells. Right: validation of RNA sequencing results via qRT-PCR performed on sorted cells from different hFKs showing the same hierarchical MET gene expression pattern between these cell fractions. The values for NCAM1 + CD133 − cells were used to normalize (therefore = 1) and all other values were calculated with respect to them. Experiments were performed on 2 hFK sources (n = 2). Results are presented as the mean ± S.E.M of three separate experiments; *p

    Article Snippet: For assessment of the differentiation capacity of HFK NCAM+ CD133− cells, apart from SCM and SFM, cells were cultured in RPMI media comprised of RPMI-1640 (Biological Industries) supplemented with 10% foetal bovine serum (Invitrogen), 1% Pen–strep 100 M, 1% l-glutamine (both from Biological industries).

    Techniques: RNA Sequencing Assay, Quantitative RT-PCR, Expressing

    Sorted NCAM1 + CD133 − hFK cells show differentiation potential towards different compartments of the mature human kidney when grown in specific conditions. Sorted NCAM1 + CD133 − hFK cells were cultured in two types of media: RPMI based serum containing medium (RPMI) or IMDM based serum containing medium (SCM), for 10 days. ( A ) qRT-PCR was performed on cultured cells comparing the expression of podocyte (Nephrin, Synaptopondin and WT1), proximal tubular (AQP1) and distal tubular (SLC1A3 and EpCAM) markers between the two culture conditions in comparison to freshly sorted NCAM1 + CD133 − cells. All markers were most highly expressed by cells cultured in SCM compared to sorted fresh cells. The values for NCAM1 + CD133 − fresh sorted cells were used to normalize (therefore = 1) and all other values were calculated with respect to them. Experiments were performed on 2 hFK sources (n = 2). Results are presented as the mean ± S.E.M of three separate experiments; *p

    Journal: Scientific Reports

    Article Title: Dissecting Stages of Human Kidney Development and Tumorigenesis with Surface Markers Affords Simple Prospective Purification of Nephron Stem Cells

    doi: 10.1038/srep23562

    Figure Lengend Snippet: Sorted NCAM1 + CD133 − hFK cells show differentiation potential towards different compartments of the mature human kidney when grown in specific conditions. Sorted NCAM1 + CD133 − hFK cells were cultured in two types of media: RPMI based serum containing medium (RPMI) or IMDM based serum containing medium (SCM), for 10 days. ( A ) qRT-PCR was performed on cultured cells comparing the expression of podocyte (Nephrin, Synaptopondin and WT1), proximal tubular (AQP1) and distal tubular (SLC1A3 and EpCAM) markers between the two culture conditions in comparison to freshly sorted NCAM1 + CD133 − cells. All markers were most highly expressed by cells cultured in SCM compared to sorted fresh cells. The values for NCAM1 + CD133 − fresh sorted cells were used to normalize (therefore = 1) and all other values were calculated with respect to them. Experiments were performed on 2 hFK sources (n = 2). Results are presented as the mean ± S.E.M of three separate experiments; *p

    Article Snippet: For assessment of the differentiation capacity of HFK NCAM+ CD133− cells, apart from SCM and SFM, cells were cultured in RPMI media comprised of RPMI-1640 (Biological Industries) supplemented with 10% foetal bovine serum (Invitrogen), 1% Pen–strep 100 M, 1% l-glutamine (both from Biological industries).

    Techniques: Cell Culture, Quantitative RT-PCR, Expressing

    NCAM1, SIX2, CD133 and FZD7 expression defines distinct cellular compartments in human fetal kidney (hFK) and primary WT (pWT) ( A ) Immunohistochemical staining (IHC) for NCAM1, SIX2, CD133 and FZD7 in representative hFK, pWT and pure blastema WT-PDX presented in serial sections. SIX2 is expressed in the cap mesenchyme (CM) and early post-MET structures (e.g. C-/S- shaped bodies) in the hFK and in WT blastema. The NCAM1 expression domain includes the SIX2 expression domain and also the hFK interstitium. In contrast, CD133 is expressed in mature tubular epithelia in both hFK and pWT as well as in early post-MET (S/C) structures in the hFK and immature tubules (IT) in pWT. FZD7 expression spans all cellular compartments except for the hFK interstitium, but in a non-uniform staining pattern. Accordingly, pure blastema WT-PDX uniformly express SIX2, NCAM1 and FZD7 but are devoid of CD133 expression. ( B ) Representative flow cytometry plots of hFK and pWT according to NCAM1 and CD133 expression, delineating the different cellular compartments in these tissues. Thus, cellular lineages along the renal developmental MET axis in hFK and pWT can be defined according to the expression of these markers. T-Tubules; B-Blastema; IT-Immature tubules; St-Stroma; CM-Condensed mesenchyme; S/C-S-shaped/Comma shaped bodies; Ist-Interstitium. (Scale bars are indicated in the images).

    Journal: Scientific Reports

    Article Title: Dissecting Stages of Human Kidney Development and Tumorigenesis with Surface Markers Affords Simple Prospective Purification of Nephron Stem Cells

    doi: 10.1038/srep23562

    Figure Lengend Snippet: NCAM1, SIX2, CD133 and FZD7 expression defines distinct cellular compartments in human fetal kidney (hFK) and primary WT (pWT) ( A ) Immunohistochemical staining (IHC) for NCAM1, SIX2, CD133 and FZD7 in representative hFK, pWT and pure blastema WT-PDX presented in serial sections. SIX2 is expressed in the cap mesenchyme (CM) and early post-MET structures (e.g. C-/S- shaped bodies) in the hFK and in WT blastema. The NCAM1 expression domain includes the SIX2 expression domain and also the hFK interstitium. In contrast, CD133 is expressed in mature tubular epithelia in both hFK and pWT as well as in early post-MET (S/C) structures in the hFK and immature tubules (IT) in pWT. FZD7 expression spans all cellular compartments except for the hFK interstitium, but in a non-uniform staining pattern. Accordingly, pure blastema WT-PDX uniformly express SIX2, NCAM1 and FZD7 but are devoid of CD133 expression. ( B ) Representative flow cytometry plots of hFK and pWT according to NCAM1 and CD133 expression, delineating the different cellular compartments in these tissues. Thus, cellular lineages along the renal developmental MET axis in hFK and pWT can be defined according to the expression of these markers. T-Tubules; B-Blastema; IT-Immature tubules; St-Stroma; CM-Condensed mesenchyme; S/C-S-shaped/Comma shaped bodies; Ist-Interstitium. (Scale bars are indicated in the images).

    Article Snippet: For assessment of the differentiation capacity of HFK NCAM+ CD133− cells, apart from SCM and SFM, cells were cultured in RPMI media comprised of RPMI-1640 (Biological Industries) supplemented with 10% foetal bovine serum (Invitrogen), 1% Pen–strep 100 M, 1% l-glutamine (both from Biological industries).

    Techniques: Expressing, Immunohistochemistry, Staining, Flow Cytometry, Cytometry

    pWT and hFK lineage hierarchy according to SIX2, NCAM1, CD133, FZD7 and ALDH1. The scheme demonstrates the cellular phenotypes along the renal mesenchymal to epithelial transition (MET) axis in both the human developing kidney (upper row) and primary human WT. Along this axis, NCAM1 expression gradually decreases, while that of CD133 increases. FZD7 is expressed throughout the renal MET process, but, not on all cell types in the different compartments. It is highly expressed by some of the hFK condensed mesenchyme (CM) and WT blastema cells. hFK CM progenitors (NCAM1 + CD133 − FZD7 + or NCAM1 + CD133 − in hFK cultured in SFM) and WT CSCs (NCAM1 + CD133 − ALDH1 + ) phenotypes are indicated. Possible isolation or targeting of these two populations, based on the markers described in this work, could facilitate kidney regeneration or WT eradication, respectively. For Figures S1–S5 and Table S1-see Supplemental Data doc.

    Journal: Scientific Reports

    Article Title: Dissecting Stages of Human Kidney Development and Tumorigenesis with Surface Markers Affords Simple Prospective Purification of Nephron Stem Cells

    doi: 10.1038/srep23562

    Figure Lengend Snippet: pWT and hFK lineage hierarchy according to SIX2, NCAM1, CD133, FZD7 and ALDH1. The scheme demonstrates the cellular phenotypes along the renal mesenchymal to epithelial transition (MET) axis in both the human developing kidney (upper row) and primary human WT. Along this axis, NCAM1 expression gradually decreases, while that of CD133 increases. FZD7 is expressed throughout the renal MET process, but, not on all cell types in the different compartments. It is highly expressed by some of the hFK condensed mesenchyme (CM) and WT blastema cells. hFK CM progenitors (NCAM1 + CD133 − FZD7 + or NCAM1 + CD133 − in hFK cultured in SFM) and WT CSCs (NCAM1 + CD133 − ALDH1 + ) phenotypes are indicated. Possible isolation or targeting of these two populations, based on the markers described in this work, could facilitate kidney regeneration or WT eradication, respectively. For Figures S1–S5 and Table S1-see Supplemental Data doc.

    Article Snippet: For assessment of the differentiation capacity of HFK NCAM+ CD133− cells, apart from SCM and SFM, cells were cultured in RPMI media comprised of RPMI-1640 (Biological Industries) supplemented with 10% foetal bovine serum (Invitrogen), 1% Pen–strep 100 M, 1% l-glutamine (both from Biological industries).

    Techniques: Expressing, Cell Culture, Isolation

    Biocompatibility of APA-siRNA polyplex. a APA alone or complexed with siRNA (50 and 200 nM) was added to freshly isolated human PBMCs that were seeded in 12-well plates. PBMCs medium and LPS (2 µg ml −1 ) were used as negative and positive controls, respectively. Culture supernatants were collected after 24 h and assayed for human IL-6 and TNF-α cytokines by ELISA. b miR (35 μM) alone or complexed with APA was incubated in FBS for several time points (0, 1, 3, 6 and 12 h) at 37 °C and was run on an electrophoresis agarose gel. c Red blood cells lysis assay following 1 h incubation with APA-miRNA polyplexes. Results are presented as percentage of hemoglobin released by 1 wt %/vol solution of Triton X-100 (100% lysis). Sodium dodecyl sulfate (SDS) and dextran were used as positive and negative controls, respectively. d H E staining of normal pancreas following 3 sequential i.v. injections of PBS or APA-miR-34a-PLK1-siRNA polyplex (2 mg kg −1 oligonucleotide dose). Scale bar, 10 μm. e Blood glucose levels of normal mice treated as in d . Blood was withdrawn at days 0, 2, 7, and 9 from treatment initiation ( n = 2/3). Data represent mean ± SD

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Biocompatibility of APA-siRNA polyplex. a APA alone or complexed with siRNA (50 and 200 nM) was added to freshly isolated human PBMCs that were seeded in 12-well plates. PBMCs medium and LPS (2 µg ml −1 ) were used as negative and positive controls, respectively. Culture supernatants were collected after 24 h and assayed for human IL-6 and TNF-α cytokines by ELISA. b miR (35 μM) alone or complexed with APA was incubated in FBS for several time points (0, 1, 3, 6 and 12 h) at 37 °C and was run on an electrophoresis agarose gel. c Red blood cells lysis assay following 1 h incubation with APA-miRNA polyplexes. Results are presented as percentage of hemoglobin released by 1 wt %/vol solution of Triton X-100 (100% lysis). Sodium dodecyl sulfate (SDS) and dextran were used as positive and negative controls, respectively. d H E staining of normal pancreas following 3 sequential i.v. injections of PBS or APA-miR-34a-PLK1-siRNA polyplex (2 mg kg −1 oligonucleotide dose). Scale bar, 10 μm. e Blood glucose levels of normal mice treated as in d . Blood was withdrawn at days 0, 2, 7, and 9 from treatment initiation ( n = 2/3). Data represent mean ± SD

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Isolation, Enzyme-linked Immunosorbent Assay, Incubation, Electrophoresis, Agarose Gel Electrophoresis, Lysis, Staining, Mouse Assay

    Synergistic anticancer effect by the combination of the restoration of miR-34a and silencing of PLK1 is via myc. a miR-34a binding site within MYC 3′-UTR. b PLK1 and MYC protein levels in MiaPaCa2 cells transfected with miRNA and siRNA monotherapies and their combination. (Representative blot out of 3 biological repeats is shown). c MYC immunostaining of tumors from the different treatments of the in vivo experiment shown in Fig. 8. d MYC immunostaining of short-term and long-term PDAC FFPE specimens. Representative images are shown. e Quantification of MYC immunostaining based on histology scores (0–3: 0- none, 1- weak, 2- moderate, 3- high). f Cell viability of cMYC overexpressed-MiaPaCa2 cells (transiently transfected with MYC ORF-containing plasmid 24 h prior to treatments) and naive cells following treatment with the combination for 48 h. Immunoblotting of MYC is depicted beneath the graph ( n = 3 biological repeats). g Proposed model of synergism via MYC as a common target for miR-34a and PLK1. STS; short-term survivors, LTS; long-term survivors. cMYC OE; cMYC overexpression. Data represent mean ± SD. (Student’s t -test, NS; not significant for P > 0.05, * P

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Synergistic anticancer effect by the combination of the restoration of miR-34a and silencing of PLK1 is via myc. a miR-34a binding site within MYC 3′-UTR. b PLK1 and MYC protein levels in MiaPaCa2 cells transfected with miRNA and siRNA monotherapies and their combination. (Representative blot out of 3 biological repeats is shown). c MYC immunostaining of tumors from the different treatments of the in vivo experiment shown in Fig. 8. d MYC immunostaining of short-term and long-term PDAC FFPE specimens. Representative images are shown. e Quantification of MYC immunostaining based on histology scores (0–3: 0- none, 1- weak, 2- moderate, 3- high). f Cell viability of cMYC overexpressed-MiaPaCa2 cells (transiently transfected with MYC ORF-containing plasmid 24 h prior to treatments) and naive cells following treatment with the combination for 48 h. Immunoblotting of MYC is depicted beneath the graph ( n = 3 biological repeats). g Proposed model of synergism via MYC as a common target for miR-34a and PLK1. STS; short-term survivors, LTS; long-term survivors. cMYC OE; cMYC overexpression. Data represent mean ± SD. (Student’s t -test, NS; not significant for P > 0.05, * P

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Binding Assay, Transfection, Immunostaining, In Vivo, Formalin-fixed Paraffin-Embedded, Plasmid Preparation, Over Expression

    Biodistribution and accumulation of APA-miRNA–siRNA polyplexes in orthotopic pancreatic tumor-bearing mice. a APA:Cy5-labeled siRNA polyplexes or Cy5-labeled siRNA alone (0.5 mg kg −1 siRNA dose) were injected i.v. to mCherry-labeled tumor-bearing (~1000 scaled counts per second) mice. At 10 min, 1, 3, and 24 h mice were imaged by non-invasive intravital fluorescent microscopy for mCherry (red) and Cy5 (light blue) fluorescent signals. Representative images of the mice are shown ( n = 3). b , c Twenty-four hours following intravenous injection of the same treatments as in a , tumor and healthy organs were resected, imaged b and quantified for their Cy5 fluorescent signal intensity c ( n = 3). d Resected tumors were embedded within OCT, cut to 10 µm sections, stained with DAPI and subjected to confocal microscopy. Normal pancreas was used as control. Scale bar, 250 µm. e Relative miR-34a levels in PDAC tumors following intravenous injections (3 consecutive, once a day) of APA-miR-34a or APA-NC-miR (2 mg kg −1 miR dose) or PBS, quantified by qRT-PCR ( n = 4). f miR-34a target genes level following injection of the same treatments as in e , quantified by qRT-PCR ( n = 4). Data represent mean ± SEM in c and mean ± SD in e and f . (Student’s t -test, * P

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Biodistribution and accumulation of APA-miRNA–siRNA polyplexes in orthotopic pancreatic tumor-bearing mice. a APA:Cy5-labeled siRNA polyplexes or Cy5-labeled siRNA alone (0.5 mg kg −1 siRNA dose) were injected i.v. to mCherry-labeled tumor-bearing (~1000 scaled counts per second) mice. At 10 min, 1, 3, and 24 h mice were imaged by non-invasive intravital fluorescent microscopy for mCherry (red) and Cy5 (light blue) fluorescent signals. Representative images of the mice are shown ( n = 3). b , c Twenty-four hours following intravenous injection of the same treatments as in a , tumor and healthy organs were resected, imaged b and quantified for their Cy5 fluorescent signal intensity c ( n = 3). d Resected tumors were embedded within OCT, cut to 10 µm sections, stained with DAPI and subjected to confocal microscopy. Normal pancreas was used as control. Scale bar, 250 µm. e Relative miR-34a levels in PDAC tumors following intravenous injections (3 consecutive, once a day) of APA-miR-34a or APA-NC-miR (2 mg kg −1 miR dose) or PBS, quantified by qRT-PCR ( n = 4). f miR-34a target genes level following injection of the same treatments as in e , quantified by qRT-PCR ( n = 4). Data represent mean ± SEM in c and mean ± SD in e and f . (Student’s t -test, * P

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Mouse Assay, Labeling, Injection, Microscopy, Staining, Confocal Microscopy, Quantitative RT-PCR

    In vivo antitumor effect of miRNA–siRNA combination. a Trial design for testing miRNA–siRNA combination efficacy in the orthotopic PDAC model. b Tumor growth curves from biweekly fluorescent measurements of tumor-bearing mice treated with APA complexed with miR-34a/PLK1-siRNA, miR-34a/NC-siRNA, PLK1-siRNA/NC-miR, NC-miR/NC-siRNA or PBS (treatments are marked with arrows). ( n = 6, 7). Data represent mean ± SEM. One way ANOVA. c In vivo toxicity via mouse body weight evaluation. Data represent mean ± SEM. d An image of a representative mouse from each treatment group 33 days post tumor inoculation showing the difference in tumor fluorescent signal. e Kaplan–Meier survival graph. Log-Rank test, P

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: In vivo antitumor effect of miRNA–siRNA combination. a Trial design for testing miRNA–siRNA combination efficacy in the orthotopic PDAC model. b Tumor growth curves from biweekly fluorescent measurements of tumor-bearing mice treated with APA complexed with miR-34a/PLK1-siRNA, miR-34a/NC-siRNA, PLK1-siRNA/NC-miR, NC-miR/NC-siRNA or PBS (treatments are marked with arrows). ( n = 6, 7). Data represent mean ± SEM. One way ANOVA. c In vivo toxicity via mouse body weight evaluation. Data represent mean ± SEM. d An image of a representative mouse from each treatment group 33 days post tumor inoculation showing the difference in tumor fluorescent signal. e Kaplan–Meier survival graph. Log-Rank test, P

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: In Vivo, Mouse Assay

    Physicochemical characterization of APA-miRNA–siRNA polyplexes. a Schematic illustration of APA nanocarrier complexed with small RNAs (polyplex) and chemical structure of APA polymeric nanocarrier. b Polyplex formation of APA with miR-34a and PLK1-siRNA (total of 50 pmol oligonucleotides, miRNA/siRNA ratio of 1:1) showing the optimal Nitrogen/Phosphate (N/P) ratio using EMSA. c Hydrodynamic diameter and surface charge of the polyplex at N/P ratio of 2, measured by particle size analyzer and Zetasizer, respectively. d Representative TEM images of the polyplex. e miR-34a release from the polyplex obtained in vitro by the polyanion heparin displacement assay. f miR-34a release from the polyplex by cathepsin B (2 units per mg polymer) cleavage of the PGA backbone. g Direct labeling of active cathespins in PDAC tumor xenograft and in normal adjacent tissues. Frozen sections were fixed on slides, incubated with 0.25 µM Cy5-labeled cathepsin activity-based probe (in red), stained with 4′,6-diamidino-2-phenylindole (DAPI, in blue) and imaged with fluorescent microscope. For specificity of staining, additional slides were treated with a non-labeled cathepsin inhibitor (GB111, 5 µM) prior to incubation with the Cy5-labeled cathepsin activity-based probe (right image). Scale bar, 10 µm

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Physicochemical characterization of APA-miRNA–siRNA polyplexes. a Schematic illustration of APA nanocarrier complexed with small RNAs (polyplex) and chemical structure of APA polymeric nanocarrier. b Polyplex formation of APA with miR-34a and PLK1-siRNA (total of 50 pmol oligonucleotides, miRNA/siRNA ratio of 1:1) showing the optimal Nitrogen/Phosphate (N/P) ratio using EMSA. c Hydrodynamic diameter and surface charge of the polyplex at N/P ratio of 2, measured by particle size analyzer and Zetasizer, respectively. d Representative TEM images of the polyplex. e miR-34a release from the polyplex obtained in vitro by the polyanion heparin displacement assay. f miR-34a release from the polyplex by cathepsin B (2 units per mg polymer) cleavage of the PGA backbone. g Direct labeling of active cathespins in PDAC tumor xenograft and in normal adjacent tissues. Frozen sections were fixed on slides, incubated with 0.25 µM Cy5-labeled cathepsin activity-based probe (in red), stained with 4′,6-diamidino-2-phenylindole (DAPI, in blue) and imaged with fluorescent microscope. For specificity of staining, additional slides were treated with a non-labeled cathepsin inhibitor (GB111, 5 µM) prior to incubation with the Cy5-labeled cathepsin activity-based probe (right image). Scale bar, 10 µm

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Transmission Electron Microscopy, In Vitro, Labeling, Incubation, Activity Assay, Staining, Microscopy

    Proliferation, migration and survival inhibition of MiaPaCa2 cells following treatment with APA nanocarrier containing miRNA–siRNA combination. a miR-34a levels in MiaPaCa2 cells following treatment with APA polyplexes containing miR-34a or NC-miR, quantified relative to U6 RNA using qRT-PCR, showing in vitro delivery efficacy by APA nanocarrier. Untreated cells served as control. b miR-34a’s target genes (CDK6, MET, Notch, and Bcl2) levels 48 h following the same treatment as in a . c PLK1 mRNA levels following treatment with APA polyplexes containing PLK1-siRNA or NC-siRNA for 24 h, quantified relative to GAPDH mRNA using qRT-PCR. d PLK1 protein levels following the same treatment as in c . Densitometric analysis of western blot is presented as percentage of band intensity compared to untreated cells (unit). e – g Proliferation of MiaPaCa2 cells following treatment with APA polyplexes containing different concentrations of miR-34a or NC-miR e , PLK1-siRNA or NC-siRNA f , or miR-34a (100 nM) and PLK1-siRNA (50 nM) combination g . Statistical significance is shown for the comparison between miR-34a and NC-miR in e and between PLK1-siRNA and NC-siRNA in f ( n = 3). h , i Migration of MiaPaCa2 cells 48 h following incubation with the same treatments as in g . Representative images of the cells from 0 to 48 h time points h quantified as wound confluence (percent out of initial wound at time 0) using the IncuCyte software i . (2 biological repeats were done in triplicates). j Representative images of cell survival via colony formation assay for 11 days. k Quantification of colonies from 3 biological repeats as their total area relative to untreated cells (control) using ImageJ software (experiments were done in triplicates). Data represent mean ± SD. (Student’s t -test, NS; not significant for P > 0.05, * P

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Proliferation, migration and survival inhibition of MiaPaCa2 cells following treatment with APA nanocarrier containing miRNA–siRNA combination. a miR-34a levels in MiaPaCa2 cells following treatment with APA polyplexes containing miR-34a or NC-miR, quantified relative to U6 RNA using qRT-PCR, showing in vitro delivery efficacy by APA nanocarrier. Untreated cells served as control. b miR-34a’s target genes (CDK6, MET, Notch, and Bcl2) levels 48 h following the same treatment as in a . c PLK1 mRNA levels following treatment with APA polyplexes containing PLK1-siRNA or NC-siRNA for 24 h, quantified relative to GAPDH mRNA using qRT-PCR. d PLK1 protein levels following the same treatment as in c . Densitometric analysis of western blot is presented as percentage of band intensity compared to untreated cells (unit). e – g Proliferation of MiaPaCa2 cells following treatment with APA polyplexes containing different concentrations of miR-34a or NC-miR e , PLK1-siRNA or NC-siRNA f , or miR-34a (100 nM) and PLK1-siRNA (50 nM) combination g . Statistical significance is shown for the comparison between miR-34a and NC-miR in e and between PLK1-siRNA and NC-siRNA in f ( n = 3). h , i Migration of MiaPaCa2 cells 48 h following incubation with the same treatments as in g . Representative images of the cells from 0 to 48 h time points h quantified as wound confluence (percent out of initial wound at time 0) using the IncuCyte software i . (2 biological repeats were done in triplicates). j Representative images of cell survival via colony formation assay for 11 days. k Quantification of colonies from 3 biological repeats as their total area relative to untreated cells (control) using ImageJ software (experiments were done in triplicates). Data represent mean ± SD. (Student’s t -test, NS; not significant for P > 0.05, * P

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Migration, Inhibition, Quantitative RT-PCR, In Vitro, Western Blot, Incubation, Software, Colony Assay

    Cellular internalization and trafficking of APA-siRNA nano-polyplexes in MiaPaCa2 cells. a Confocal images of MiaPaCa2 cells incubated with APA:Cy5-labeled siRNA polyplexes (in red) for 4, 24, and 48 h showing a maximum peak of cellular uptake at 48 h (upper panel). Cy5-labeled siRNA alone was used as control (upper panel, left). Actin filaments are in green and nuclei are in blue. Lower panel is a larger magnification of a representative field following 48 h incubation with the polyplex showing predominant accumulation of siRNA in the cytoplasm. b Brightfield and fluorescent images of live MiaPaCa2 cells showing Cy5-labeled siRNA delivery by APA nanocarrier compared to delivery by Lipofectamine 2000, analyzed by Imaging Flow Cytometry. Cy5-labeled siRNA alone served as control. Lower panel shows the Cy5 internalization histograms. c Intracellular trafficking of APA:Cy5-labeled siRNA polyplexes (100 nM siRNA, light blue) in MiaPaCa2 cells at different time points showing internalization via endocytotic pathway. Cells were stained with early endosome marker EEA1 (green) or late endosome/lysosome marker LAMP1 (red). Nuclei were stained with DAPI (blue). d Quantitative analysis of c showing co-localization of APA:Cy5-labeled siRNA polyplexes with EEA1 and LAMP1 4, 24, and 48 h following polyplex incubation. Data represent mean ± SD of 7 random fields. e A z-stack confocal image at 4 h after incubation with the polyplex showing endosomes, lysosomes, endosome-containing polyplexes, and polyplexes inside a single cell. Endo; Endosome, Lyso; Lysosome. Scale bar; a - upper panel, 100 µm; b - lower panel, 25 µm; c - 50 µm; e - 10 µm. All confocal experiments were done 2–3 times and data are presented as mean ± SD

    Journal: Nature Communications

    Article Title: Amphiphilic nanocarrier-induced modulation of PLK1 and miR-34a leads to improved therapeutic response in pancreatic cancer

    doi: 10.1038/s41467-017-02283-9

    Figure Lengend Snippet: Cellular internalization and trafficking of APA-siRNA nano-polyplexes in MiaPaCa2 cells. a Confocal images of MiaPaCa2 cells incubated with APA:Cy5-labeled siRNA polyplexes (in red) for 4, 24, and 48 h showing a maximum peak of cellular uptake at 48 h (upper panel). Cy5-labeled siRNA alone was used as control (upper panel, left). Actin filaments are in green and nuclei are in blue. Lower panel is a larger magnification of a representative field following 48 h incubation with the polyplex showing predominant accumulation of siRNA in the cytoplasm. b Brightfield and fluorescent images of live MiaPaCa2 cells showing Cy5-labeled siRNA delivery by APA nanocarrier compared to delivery by Lipofectamine 2000, analyzed by Imaging Flow Cytometry. Cy5-labeled siRNA alone served as control. Lower panel shows the Cy5 internalization histograms. c Intracellular trafficking of APA:Cy5-labeled siRNA polyplexes (100 nM siRNA, light blue) in MiaPaCa2 cells at different time points showing internalization via endocytotic pathway. Cells were stained with early endosome marker EEA1 (green) or late endosome/lysosome marker LAMP1 (red). Nuclei were stained with DAPI (blue). d Quantitative analysis of c showing co-localization of APA:Cy5-labeled siRNA polyplexes with EEA1 and LAMP1 4, 24, and 48 h following polyplex incubation. Data represent mean ± SD of 7 random fields. e A z-stack confocal image at 4 h after incubation with the polyplex showing endosomes, lysosomes, endosome-containing polyplexes, and polyplexes inside a single cell. Endo; Endosome, Lyso; Lysosome. Scale bar; a - upper panel, 100 µm; b - lower panel, 25 µm; c - 50 µm; e - 10 µm. All confocal experiments were done 2–3 times and data are presented as mean ± SD

    Article Snippet: Electrophoretic mobility shift assay The optimal N/P ratio for polyplex formation was studied using EMSA. miRNA and siRNA (50 pmol total) and increasing amounts of APA were mixed together in RNase-free ultra-pure water (UPW, Biological Industries), incubated at room temperature for 20–30 min and analyzed by electrophoresis on a 2% agarose gel for 30 min at 100 V.

    Techniques: Incubation, Labeling, Imaging, Flow Cytometry, Cytometry, Staining, Marker

    Expression of PLEKHM2 gene in patients' cells. ( A ) RT-PCR products. RNA was extracted from lymphoblastoid cells and fibroblasts of patient II-1 and from comparable cells of control individuals. PCR was performed on the cDNA using primers in exons 10 and 15, flanking exon 12 that contains the mutation and the PCR products were separated on 2% agarose gel. The patient cells exhibited two fragments in contrast to control cells that had only one. The large PCR product of the patient (579 bp) contains the deletion of AG in exon 12 and the smaller fragment of 488 bp that appears only in patients' cells results from skipping of exon 11. ( B ) Sequence chromatogram of the 581 bp PCR product of the control cells (upper), the 579 bp PCR product of the patient (middle) and the 448 bp PCR product showing the skipping of exon 11 (exon 12 joining directly to exon 10 is marked by darker letters). ( C ). The mutant diagram presents the result of the frameshift mutation that will be created by the PLEKHM2 mRNA that produces the 579 bp RT-PCR product. The 12 amino acids marked in darker are created by the frameshift translation. The diagram of the mutant lacking exon 11 presents the amino acids flanking the deletion and in darker are the amino acids that are produced by the frameshift that is created by splicing exon 10–12 until the deletion of the AG nucleotide rescues the frameshift. ( D ) Sequence conservation of exon 11 and the first amino acids of exon 12 that are missing in the patients. The amino acids that are deleted by the mutation are shaded by gray. ( E ) PLEKHM2 protein is expressed in fibroblasts cells of patients II-1 and II-2 as demonstrated by western blot using an antibody to the C-terminal region. Control cells (C) are from fibroblasts from two control individuals as well as commercial fibroblasts. PLEKHM2 protein sample produced by expression of plasmid Pcmv-Myc-PLEKHM2 was loaded in parallel for use as size migration control (PLEKHM2). ( F ) Same as (E) with an antibody to the N-terminal region.

    Journal: Human Molecular Genetics

    Article Title: PLEKHM2 mutation leads to abnormal localization of lysosomes, impaired autophagy flux and associates with recessive dilated cardiomyopathy and left ventricular noncompaction

    doi: 10.1093/hmg/ddv423

    Figure Lengend Snippet: Expression of PLEKHM2 gene in patients' cells. ( A ) RT-PCR products. RNA was extracted from lymphoblastoid cells and fibroblasts of patient II-1 and from comparable cells of control individuals. PCR was performed on the cDNA using primers in exons 10 and 15, flanking exon 12 that contains the mutation and the PCR products were separated on 2% agarose gel. The patient cells exhibited two fragments in contrast to control cells that had only one. The large PCR product of the patient (579 bp) contains the deletion of AG in exon 12 and the smaller fragment of 488 bp that appears only in patients' cells results from skipping of exon 11. ( B ) Sequence chromatogram of the 581 bp PCR product of the control cells (upper), the 579 bp PCR product of the patient (middle) and the 448 bp PCR product showing the skipping of exon 11 (exon 12 joining directly to exon 10 is marked by darker letters). ( C ). The mutant diagram presents the result of the frameshift mutation that will be created by the PLEKHM2 mRNA that produces the 579 bp RT-PCR product. The 12 amino acids marked in darker are created by the frameshift translation. The diagram of the mutant lacking exon 11 presents the amino acids flanking the deletion and in darker are the amino acids that are produced by the frameshift that is created by splicing exon 10–12 until the deletion of the AG nucleotide rescues the frameshift. ( D ) Sequence conservation of exon 11 and the first amino acids of exon 12 that are missing in the patients. The amino acids that are deleted by the mutation are shaded by gray. ( E ) PLEKHM2 protein is expressed in fibroblasts cells of patients II-1 and II-2 as demonstrated by western blot using an antibody to the C-terminal region. Control cells (C) are from fibroblasts from two control individuals as well as commercial fibroblasts. PLEKHM2 protein sample produced by expression of plasmid Pcmv-Myc-PLEKHM2 was loaded in parallel for use as size migration control (PLEKHM2). ( F ) Same as (E) with an antibody to the N-terminal region.

    Article Snippet: RNA was extracted from lymphoblastoid cells and fibroblasts of patient II-1 and from comparable cells of control individuals using the EZ-RNA II Kit (Biological Industries, Israel). cDNA was prepared using the SuperScript Kit (Invitrogen), PCR was performed on the cDNA using primers in exons 10 and 15, forward: TCGGAGTTCAGAGTAGACAACAA and reverse: ATGCCTTCTTTGGTGATGGT flanking exon 12 that contains the mutation and the PCR products were separated on 2% agarose gel.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Mutagenesis, Agarose Gel Electrophoresis, Sequencing, Produced, Western Blot, Plasmid Preparation, Migration