restriction endonucleases xbai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs restriction endonucleases xbai
    (A) <t>PFGE</t> analysis of S . Typhimurium DT104 using <t>XbaI</t> and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,
    Restriction Endonucleases Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonucleases xbai/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    restriction endonucleases xbai - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain"

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.01041-13

    (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,
    Figure Legend Snippet: (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: Paragraph title: Cloning and mutagenesis of msbB gene. ... The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: PCR product was digested with SalI restriction endonuclease (New England Biolabs, Hitchin, UK) and inserted into pUC19 cloning vector digested with the same restriction enzyme. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Luciferase:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Lambda DNA Preparation:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Southern blot hybridization was performed at 65°C in Church buffer (1% BSA, 0.25 M Na2 HPO4 pH 7.3, 7% SDS, 1 mM EDTA) with a 1,104‐bp‐long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn‐HiC restriction fragments (obtained from SK1 genomic DNA with primers 5′‐TGGTGAAGAACTCAGGATTC‐3′ and 5′‐CAGTTACAATGAAGTCCAGG‐3′) and radiolabeled phage lambda DNA (molecular ladder).

    TA Cloning:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Construct:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Electrophoresis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis ... The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Electrophoresis was performed on the CHEF-DRII (Bio-Rad Laboratories, Richmond, Calif.) with the following conditions: 0.5× Tris-borate-EDTA, 1% agarose, 13°C, 6 V/cm for 23 h (with switch times ranging from 5 to 60 s).

    Incubation:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: The plugs were treated with 5 ml cell lysis buffer (50 mM Tris, 50 mM EDTA, pH 8.0, 1% Sarcosyl) and 25 µl proteinase K (20 mg/ml) and incubated at 54°C for 2 h in a shaking water bath. .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) with the following cycling parameters: 30 s of initial incubation at 98°C, 35 cycles at 98°C for 10 s and at 72°C for 2 min, and a final elongation step of 2 min at 72°C. .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector.

    Amplification:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: PCR amplification of this region was performed with N. meningitidis strain NMB genomic DNA and the primers gchtrB3 5"-CAACAGGCGGCGGTGGAACAG-3" and gchtrB4 5"-TTCGGCATCCACTCCCCTTTG-3". .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Transformation Assay:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs). .. This construct was ligated using T4 DNA ligase and subsequently transformed into E. coli DH5α cells (Invitrogen).

    Hybridization:

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. Hybridization was conducted under high stringency conditions (20% dextran sulfate, 2×SSC, 0.5% fat free milk powder, and 1% SDS) in the presence of 750 µg/mL of heat-denatured salmon sperm DNA.

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Southern blot hybridization was performed at 65°C in Church buffer (1% BSA, 0.25 M Na2 HPO4 pH 7.3, 7% SDS, 1 mM EDTA) with a 1,104‐bp‐long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn‐HiC restriction fragments (obtained from SK1 genomic DNA with primers 5′‐TGGTGAAGAACTCAGGATTC‐3′ and 5′‐CAGTTACAATGAAGTCCAGG‐3′) and radiolabeled phage lambda DNA (molecular ladder).

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. Hybridization and detection were performed using the North2South chemiluminescent hybridization and detection kit (Thermo Scientific, Rockport, IL) per manufacturer’s instructions.

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Southern Blot:

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: A Southern blot analysis was performed to confirm the transgene. .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion.

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: Paragraph title: Southern blot analysis of crossing‐over formation at the CCT6 hotspot ... The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genetic manipulation was confirmed by Southern blot analysis. .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion.

    Northern Blot:

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: Paragraph title: Southern and northern blotting: ... For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Generated:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. The specific sequences recognized by the restriction enzymes and DNA termini generated are shown in .

    Random Primed:

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Sequencing:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The sequence that showed the highest homology to the E. coli gene ( N. gonorrhoeae sequence bp 160985 to 162427) was used for the design of PCR primers. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: Paragraph title: Cloning and sequencing of the Ig heavy chain gene ... The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector.

    Binding Assay:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. We and others have previously reported that the C-terminus of Ku80 is dispensable for Ku/DNA binding [ , ].

    Pulsed-Field Gel:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis ... The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: .. Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Salmonella enterica serovar Braenderup H9812 (ATCC BAA-664) was used as the reference strain for the molecular size standard.

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis. ... Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ).

    Radioactivity:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Radiolabeling was performed with 32 P‐αdCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions.

    Mutagenesis:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: Paragraph title: Cloning and mutagenesis of msbB gene. ... The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Isolation:

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: .. Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Electrophoresis was performed on the CHEF-DRII (Bio-Rad Laboratories, Richmond, Calif.) with the following conditions: 0.5× Tris-borate-EDTA, 1% agarose, 13°C, 6 V/cm for 23 h (with switch times ranging from 5 to 60 s).

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. For northern blots, total RNA enriched for small RNA was extracted from 1 g potato leaves using the mirVana miRNA isolation kit (Ambion, Austin, TX) according to the manufacturer’s instructions.

    Size-exclusion Chromatography:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Labeling:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Radiolabeling was performed with 32 P‐αdCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Purification:

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: DNA was extracted from potato leaves ground in liquid nitrogen with TPS buffer (100 mM Tris-HCl pH 8, 100 mM EDTA pH 8, 1 M KCl), precipitated with isopropanol, treated with RNase, and purified with chloroform/isopropanol precipitation. .. For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Polymerase Chain Reaction:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs). .. This construct was ligated using T4 DNA ligase and subsequently transformed into E. coli DH5α cells (Invitrogen).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: PCR product was digested with SalI restriction endonuclease (New England Biolabs, Hitchin, UK) and inserted into pUC19 cloning vector digested with the same restriction enzyme. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Staining:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Gels were stained in a 1-μg/ml solution of ethidium bromide and visualized under UV light transillumination with Gel Doc (Bio-Rad, Munich, Germany).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Gels were stained with ethidium bromide and photographed using a Gel Doc 1000 system (Bio-Rad Laboratories).

    IA:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs).

    Plasmid Preparation:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: .. Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. The specific sequences recognized by the restriction enzymes and DNA termini generated are shown in .

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Software:

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Macrorestriction patterns were compared using the BioNumerics fingerprinting software (version 6.5; Applied Math, Austin, TX).

    Recombinant:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Agarose Gel Electrophoresis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA). .. Plugs were loaded onto a 1.0% agarose gel prepared using pulsed field certified agarose (Biorad, Hercules, CA, USA) in 0.5 × TBE.

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. Complete digestion of the plasmid DNA was analyzed by native agarose gel electrophoresis of the reaction products.

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: .. For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Produced:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: Construction of recombinant DNAs Plasmids and primers used in this study are listed in . pFI2576 rep (~2.0 kb) PCR product was produced with pFI2576 rep F-1 and R-1 primer set under the following PCR conditions: initial denaturation at 98°C for 30 s; 30 cycles of 98°C for 10 s and 72°C for 1 min; final extension at 72°C for 5 min. Phusion-HF DNA polymerase (Thermo Scientific, UK) was used for PCR. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Diffusion-based Assay:

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Molecular Weight:

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Molecular weight standards were a λ ladder that contained concatamers of the 48.5-kb phage DNA (FMC BioProduct, Rockland, Maine).

    DNA Purification:

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Lysis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: The plugs were treated with 5 ml cell lysis buffer (50 mM Tris, 50 mM EDTA, pH 8.0, 1% Sarcosyl) and 25 µl proteinase K (20 mg/ml) and incubated at 54°C for 2 h in a shaking water bath. .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Gel Extraction:

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs restriction endonucleases xbai
    (A) <t>PFGE</t> analysis of S . Typhimurium DT104 using <t>XbaI</t> and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,
    Restriction Endonucleases Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonucleases xbai/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    restriction endonucleases xbai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    New England Biolabs restriction endonuclease digestion
    (A) <t>PFGE</t> analysis of S . Typhimurium DT104 using <t>XbaI</t> and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,
    Restriction Endonuclease Digestion, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonuclease digestion/product/New England Biolabs
    Average 90 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    restriction endonuclease digestion - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,

    Journal: Applied and Environmental Microbiology

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain

    doi: 10.1128/AEM.01041-13

    Figure Lengend Snippet: (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,

    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ).

    Techniques: