residual dntps  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Qiagen residual dntps
    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of <t>dNTPs.</t> Samples were subjected to CE before and after a conventional <t>PCR</t> purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.
    Residual Dntps, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/residual dntps/product/Qiagen
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    residual dntps - by Bioz Stars, 2020-04
    86/100 stars

    Images

    1) Product Images from "Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR"

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkl257

    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.
    Figure Legend Snippet: Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.

    Techniques Used: Polymerase Chain Reaction, Purification

    Related Articles

    Amplification:

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: A 350 bp fragment harboring 25 CpGs was amplified from the bisulfite-treated pUC19 DNA samples (puc19bs-f: AAGTGTAAAGTTTGGGGTGTTTAA and puc19bs-r: AACCTTTTACTCACATATTCTTTCCTAC) while a nested primer PCR was performed to amplify the 280 bp fragment of CDKN2A (p16) gene harboring 37 CpGs from liver genomic DNA samples (p16bs-f: GATTAAAAGAAGAAGTTATAT, p16bs-r: TTCAAATCTTCTCAACATTC, p16nest-f: GTTGGTTGGTTATTAGAGG and p16nest-r: TCATTCCTCTTCCTTAACT). .. PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany).

    Article Title: A robust method for the amplification of RNA in the sense orientation
    Article Snippet: Paragraph title: RNA amplification protocol ... Hydrolyzed RNA and residual dNTPs are removed using the Minelute reaction cleanup kit (Qiagen) according to the manufacturer's protocol.

    Agarose Gel Electrophoresis:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: RNA concentration was determined spectrophotometrically and its integrity was assessed by agarose gel eletrophoresis. .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion.

    Concentration Assay:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: RNA concentration was determined spectrophotometrically and its integrity was assessed by agarose gel eletrophoresis. .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion.

    Isolation:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: RNA purification and preparation of labeled cDNA Total RNA from the bacteria recovered from the rhizosphere of six plants and from the control samples was extracted by using TRI Reagent (Ambion, ref. 9738, Austin, TX, USA) as recommended by the manufacturer except that Tripure Isolation reagent was preheated at 70°C followed by purification with RNeasy columns (Qiagen, cat no. 74104, Hilden, Germany). .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion.

    Labeling:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion. .. Dried aminoallyl-labeled cDNA was resuspended in 9 μl of 0.1 M sodium carbonate buffer (pH 9.0), mixed with either Cy3 (control) or Cy5 (rhizospheric samples) fluorescent dyes (mono-reactive NHS-esters; Amersham Biosciences, cat. no. PA23001 and PA25001, respectively), and allowed to couple for 2 h at room temperature in the dark.

    Purification:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion. .. Dried aminoallyl-labeled cDNA was resuspended in 9 μl of 0.1 M sodium carbonate buffer (pH 9.0), mixed with either Cy3 (control) or Cy5 (rhizospheric samples) fluorescent dyes (mono-reactive NHS-esters; Amersham Biosciences, cat. no. PA23001 and PA25001, respectively), and allowed to couple for 2 h at room temperature in the dark.

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: .. PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany). .. Purified DNA samples (100–500 ng) in 1× PCR buffer (Qiagen) were hydrolyzed using 0.005 U of snake venom phosphodiesterase (SVPD) (Amersham, Buckinghamshire, UK) for 1 h at 37°C.

    Sequencing:

    Article Title: A robust method for the amplification of RNA in the sense orientation
    Article Snippet: Hydrolyzed RNA and residual dNTPs are removed using the Minelute reaction cleanup kit (Qiagen) according to the manufacturer's protocol. .. Priming for second strand cDNA synthesis is accomplished by combining the eluted first-strand cDNA with 2 μL of random nonamer primers modified by the addition of a T3 promoter sequence at the 5' end (T3N9 primer, 100 ng/μL, Table )11 (Operon) followed by incubation at 95°C for 3 minutes.

    Incubation:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: The reaction was stopped by adding 10 μl of 50 mM EDTA and the RNA template was hydrolyzed with the addition of 10 μl of 1 N NaOH followed by incubation at 65°C for 15 minutes. .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion.

    Article Title: A robust method for the amplification of RNA in the sense orientation
    Article Snippet: Template RNA is hydrolyzed by adding 10 μL of 1N NaOH (Sigma) and 10 μL of 0.5M EDTA (Sigma) followed by incubation at 65°C for 15 minutes. .. Hydrolyzed RNA and residual dNTPs are removed using the Minelute reaction cleanup kit (Qiagen) according to the manufacturer's protocol.

    Polymerase Chain Reaction:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion. .. Dried aminoallyl-labeled cDNA was resuspended in 9 μl of 0.1 M sodium carbonate buffer (pH 9.0), mixed with either Cy3 (control) or Cy5 (rhizospheric samples) fluorescent dyes (mono-reactive NHS-esters; Amersham Biosciences, cat. no. PA23001 and PA25001, respectively), and allowed to couple for 2 h at room temperature in the dark.

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: .. PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany). .. Purified DNA samples (100–500 ng) in 1× PCR buffer (Qiagen) were hydrolyzed using 0.005 U of snake venom phosphodiesterase (SVPD) (Amersham, Buckinghamshire, UK) for 1 h at 37°C.

    Spectrophotometry:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion. .. Labeling efficiency was assessed using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA).

    Mass Spectrometry:

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany). .. For MS-PCR of CDKN2A, primers as following were used: p16ms-m-f: TTATTAGAGGGTGGGGCGGA, p16ms-m-r: ACCCCGAACCGCGACCGTAA, p16ms-u-f: TTATTAGAGGGTGGG GTGGA and p16-ms-u-r: CAACCCCAAACCACAACCAT.

    Modification:

    Article Title: A robust method for the amplification of RNA in the sense orientation
    Article Snippet: Hydrolyzed RNA and residual dNTPs are removed using the Minelute reaction cleanup kit (Qiagen) according to the manufacturer's protocol. .. Priming for second strand cDNA synthesis is accomplished by combining the eluted first-strand cDNA with 2 μL of random nonamer primers modified by the addition of a T3 promoter sequence at the 5' end (T3N9 primer, 100 ng/μL, Table )11 (Operon) followed by incubation at 95°C for 3 minutes.

    Hybridization:

    Article Title: Genomic analysis reveals the major driving forces of bacterial life in the rhizosphere
    Article Snippet: Indirect cDNA labeling was used to generate fluorescent probes for hybridization. cDNA synthesis was performed at 42°C for 2 h in a 30 μl reaction volume containing 0.5 mM (each) dATP, dCTP, and dGTP; 0.25 mM (each) dTTP and aminoallyl-dUTP (aa-dUTP; Sigma cat. no. A0410); 10 mM DTT; 40 U of RNaseOUT (Invitrogen, ref. 10777-019, Carlsbad, CA, USA); and 400 U of SuperScript II reverse transcriptase (Invitrogen, ref. 18064-014) in reverse transcriptase reaction buffer. .. Samples were then neutralized by adding 25 μl of 1 M HEPES (pH 7.5) and the hydrolyzed RNA and residual dNTPs were removed using QIAquick PCR purification columns (Qiagen, ref. 28104) according to the manufacturer's recommendations, except that the Tris-based elution buffer supplied with the kit was replaced with phosphate elution buffer (4 mM KPO4 pH 8.5) to avoid interferences with the subsequent labeling. cDNA samples were dried in a Speed-Vac to completion.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Qiagen residual dntps
    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of <t>dNTPs.</t> Samples were subjected to CE before and after a conventional <t>PCR</t> purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.
    Residual Dntps, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/residual dntps/product/Qiagen
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    residual dntps - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.

    Journal: Nucleic Acids Research

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR

    doi: 10.1093/nar/gkl257

    Figure Lengend Snippet: Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.

    Article Snippet: PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany).

    Techniques: Polymerase Chain Reaction, Purification