real time pcr analysis total rna  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Millipore real time pcr analysis total rna
    circCtrip is essential for proper development. A. Viability of circCtrip knockdown compared to their sibling controls. In green, percentage of pupae and in yellow 3rd instar larvae developed from sorted 1 st instar larvae. circCtrip KD flies show more than 90% of larval lethality when compared to the control flies ( actin -Gal4). For each KD strain we normalized the data to the one of the siblings (GFP+) individuals (n = 3 sets of 50 embryos each). B. Expression of circCtrip at different developmental stages. Data was extracted from (23) and reanalyzed for circRNA expression as described in (23) Y axis indicates number of circRNA reads per million reads. C. Schematic representation of the additional shRNAs (shRNA-2) designed against circCtrip. D. Developmental viability (% of siblings control) of flies expressing the second shRNAs against circCtrip. E. <t>qRT-PCR</t> evaluation of the efficiency of knockdown of the circRNA by the use of the different shRNA lines in the fly CNS. In all cases we utilized the elav -Gal4 driver to express two different shRNAs for circCtrip. We then determined the efficiency of the knockdown by comparing to the levels of the assayed circRNA in the control strain ( elav -Gal4). Data was normalized to 18S rRNA and rp49 (n=3, error bars represents standard error of the mean). F. 3’ <t>RNA-seq</t> data was used to determine the expression level of Ctrip mRNA in circCtrip KD lines (n=3, error bars represents standard error of the mean). G. Expression of putative off-targets genes in both circCtrip KD lines. Potential off-targets genes were selected using blast of the shRNA sequence against the drosophila transcriptome. 3’ RNA-seq data was used to determine the expression level of each putative off-targets gene relative to control line ( elav -Gal4) and presented as log2(Fold change). The different colors of the dots represent the statistical significance of the differences. H and I, assessment of off-targets of the indicated shRNAs by SYLAMER. Seed enrichment was calculated for the genes differentially expressed upon downregulation of circCtrip using each shRNA. shRNA and shRNA* seed sequences shown in red and blue, respectively. Genes were sorted from downregulated to upregulated. For both knockdowns we did not observed any shRNA seed enriched among the downregulated genes.
    Real Time Pcr Analysis Total Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time pcr analysis total rna/product/Millipore
    Average 93 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    real time pcr analysis total rna - by Bioz Stars, 2020-08
    93/100 stars

    Images

    1) Product Images from "An in vivo strategy for knockdown of circular RNAs"

    Article Title: An in vivo strategy for knockdown of circular RNAs

    Journal: bioRxiv

    doi: 10.1101/2020.01.23.916809

    circCtrip is essential for proper development. A. Viability of circCtrip knockdown compared to their sibling controls. In green, percentage of pupae and in yellow 3rd instar larvae developed from sorted 1 st instar larvae. circCtrip KD flies show more than 90% of larval lethality when compared to the control flies ( actin -Gal4). For each KD strain we normalized the data to the one of the siblings (GFP+) individuals (n = 3 sets of 50 embryos each). B. Expression of circCtrip at different developmental stages. Data was extracted from (23) and reanalyzed for circRNA expression as described in (23) Y axis indicates number of circRNA reads per million reads. C. Schematic representation of the additional shRNAs (shRNA-2) designed against circCtrip. D. Developmental viability (% of siblings control) of flies expressing the second shRNAs against circCtrip. E. qRT-PCR evaluation of the efficiency of knockdown of the circRNA by the use of the different shRNA lines in the fly CNS. In all cases we utilized the elav -Gal4 driver to express two different shRNAs for circCtrip. We then determined the efficiency of the knockdown by comparing to the levels of the assayed circRNA in the control strain ( elav -Gal4). Data was normalized to 18S rRNA and rp49 (n=3, error bars represents standard error of the mean). F. 3’ RNA-seq data was used to determine the expression level of Ctrip mRNA in circCtrip KD lines (n=3, error bars represents standard error of the mean). G. Expression of putative off-targets genes in both circCtrip KD lines. Potential off-targets genes were selected using blast of the shRNA sequence against the drosophila transcriptome. 3’ RNA-seq data was used to determine the expression level of each putative off-targets gene relative to control line ( elav -Gal4) and presented as log2(Fold change). The different colors of the dots represent the statistical significance of the differences. H and I, assessment of off-targets of the indicated shRNAs by SYLAMER. Seed enrichment was calculated for the genes differentially expressed upon downregulation of circCtrip using each shRNA. shRNA and shRNA* seed sequences shown in red and blue, respectively. Genes were sorted from downregulated to upregulated. For both knockdowns we did not observed any shRNA seed enriched among the downregulated genes.
    Figure Legend Snippet: circCtrip is essential for proper development. A. Viability of circCtrip knockdown compared to their sibling controls. In green, percentage of pupae and in yellow 3rd instar larvae developed from sorted 1 st instar larvae. circCtrip KD flies show more than 90% of larval lethality when compared to the control flies ( actin -Gal4). For each KD strain we normalized the data to the one of the siblings (GFP+) individuals (n = 3 sets of 50 embryos each). B. Expression of circCtrip at different developmental stages. Data was extracted from (23) and reanalyzed for circRNA expression as described in (23) Y axis indicates number of circRNA reads per million reads. C. Schematic representation of the additional shRNAs (shRNA-2) designed against circCtrip. D. Developmental viability (% of siblings control) of flies expressing the second shRNAs against circCtrip. E. qRT-PCR evaluation of the efficiency of knockdown of the circRNA by the use of the different shRNA lines in the fly CNS. In all cases we utilized the elav -Gal4 driver to express two different shRNAs for circCtrip. We then determined the efficiency of the knockdown by comparing to the levels of the assayed circRNA in the control strain ( elav -Gal4). Data was normalized to 18S rRNA and rp49 (n=3, error bars represents standard error of the mean). F. 3’ RNA-seq data was used to determine the expression level of Ctrip mRNA in circCtrip KD lines (n=3, error bars represents standard error of the mean). G. Expression of putative off-targets genes in both circCtrip KD lines. Potential off-targets genes were selected using blast of the shRNA sequence against the drosophila transcriptome. 3’ RNA-seq data was used to determine the expression level of each putative off-targets gene relative to control line ( elav -Gal4) and presented as log2(Fold change). The different colors of the dots represent the statistical significance of the differences. H and I, assessment of off-targets of the indicated shRNAs by SYLAMER. Seed enrichment was calculated for the genes differentially expressed upon downregulation of circCtrip using each shRNA. shRNA and shRNA* seed sequences shown in red and blue, respectively. Genes were sorted from downregulated to upregulated. For both knockdowns we did not observed any shRNA seed enriched among the downregulated genes.

    Techniques Used: Expressing, shRNA, Quantitative RT-PCR, RNA Sequencing Assay, Sequencing

    2) Product Images from "Differential Roles for DUSP Family Members in Epithelial-to-Mesenchymal Transition and Cancer Stem Cell Regulation in Breast Cancer"

    Article Title: Differential Roles for DUSP Family Members in Epithelial-to-Mesenchymal Transition and Cancer Stem Cell Regulation in Breast Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0148065

    DUSP1 and DUSP4 directly tether to the promoters of mesenchymal genes. MCF-7 cells were incubated with either vehicle alone or with PMA for 60 h. ChIP was performed with DUSP1 and DUSP4 antibodies. ChIP DNA was analysed by SYBR Green real-time PCR. Enrichment across the promoter regions of FN1 , PLAUR , and IL6 are shown for: ( A ) DUSP1 and ( B ) DUSP4. Data are expressed as percentage enrichment relative to total input control and represent the mean ± SE of three independent experiments. ( C ) Nuclear extracts were obtained from MCF-7 cells stimulated as previously described and subjected to half-ChIP using DUSP4 pull down or a no antibody control. Immunoblots of the samples were probed with primary rabbit antibodies to RNA-Pol-II-serine2p or RNA-Pol-II-serine5p and detected as described in the methods. Representative images of the immunoblots are depicted along with the Novex loading control (LC).
    Figure Legend Snippet: DUSP1 and DUSP4 directly tether to the promoters of mesenchymal genes. MCF-7 cells were incubated with either vehicle alone or with PMA for 60 h. ChIP was performed with DUSP1 and DUSP4 antibodies. ChIP DNA was analysed by SYBR Green real-time PCR. Enrichment across the promoter regions of FN1 , PLAUR , and IL6 are shown for: ( A ) DUSP1 and ( B ) DUSP4. Data are expressed as percentage enrichment relative to total input control and represent the mean ± SE of three independent experiments. ( C ) Nuclear extracts were obtained from MCF-7 cells stimulated as previously described and subjected to half-ChIP using DUSP4 pull down or a no antibody control. Immunoblots of the samples were probed with primary rabbit antibodies to RNA-Pol-II-serine2p or RNA-Pol-II-serine5p and detected as described in the methods. Representative images of the immunoblots are depicted along with the Novex loading control (LC).

    Techniques Used: Incubation, Chromatin Immunoprecipitation, SYBR Green Assay, Real-time Polymerase Chain Reaction, Western Blot

    3) Product Images from "The chromodomains of CHD1 are critical for enzymatic activity but less important for chromatin localization"

    Article Title: The chromodomains of CHD1 are critical for enzymatic activity but less important for chromatin localization

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq1298

    HS-induced transcription of Hsp70, Hsp83 and Hsp22 genes is decreased in Chd1 -deficient and Chd1 C D -rescued larvae. Larvae bearing the indicated transgenes in a Chd1 2 /Exel7014 genetic background and wild-type larvae were subjected to the indicated periods of HS before RNA was prepared and expression of the HS genes was analyzed by real-time PCR. All values were normalized against the non-HS (0) sample of the respective fly strain. Error bars indicate standard deviations of three independent experiments. ( A ) Hsp70 , ( B ) Hsp83 and ( C ) Hsp22 .
    Figure Legend Snippet: HS-induced transcription of Hsp70, Hsp83 and Hsp22 genes is decreased in Chd1 -deficient and Chd1 C D -rescued larvae. Larvae bearing the indicated transgenes in a Chd1 2 /Exel7014 genetic background and wild-type larvae were subjected to the indicated periods of HS before RNA was prepared and expression of the HS genes was analyzed by real-time PCR. All values were normalized against the non-HS (0) sample of the respective fly strain. Error bars indicate standard deviations of three independent experiments. ( A ) Hsp70 , ( B ) Hsp83 and ( C ) Hsp22 .

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    4) Product Images from "Establishment and Evaluation of a Stable Cattle Type II Alveolar Epithelial Cell Line"

    Article Title: Establishment and Evaluation of a Stable Cattle Type II Alveolar Epithelial Cell Line

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0076036

    Biological features of HTERT-AEC II cells at different passages and HTERT-AEC II cells purity analysis by flow cytometry. A: RT-PCR analysis of surfactant proteins A, B, and C. RNA of surfactant proteins A, B, and C was transcribed in HTERT-AEC II cells as in primary AEC II. B: Secretion of SP-A and SP-B as determined by Western blot analysis. SP-A and SP-B proteins were expressed in immortalized AEC II. C: HTERT-AEC II cell purity was analyzed by flow cytometry using FITC-CD74 as a marker for AEC II. D: Immunofluorescence identification of HTERT-AEC II. The cattle HTERT-AEC II cell line we established was determined positive by immunofluorescence testing for CD74, CK18, CK19, SP-A, SP-B, and TTF-1 and negative for vimentin, which confirms its lung epithelial cell characteristics.
    Figure Legend Snippet: Biological features of HTERT-AEC II cells at different passages and HTERT-AEC II cells purity analysis by flow cytometry. A: RT-PCR analysis of surfactant proteins A, B, and C. RNA of surfactant proteins A, B, and C was transcribed in HTERT-AEC II cells as in primary AEC II. B: Secretion of SP-A and SP-B as determined by Western blot analysis. SP-A and SP-B proteins were expressed in immortalized AEC II. C: HTERT-AEC II cell purity was analyzed by flow cytometry using FITC-CD74 as a marker for AEC II. D: Immunofluorescence identification of HTERT-AEC II. The cattle HTERT-AEC II cell line we established was determined positive by immunofluorescence testing for CD74, CK18, CK19, SP-A, SP-B, and TTF-1 and negative for vimentin, which confirms its lung epithelial cell characteristics.

    Techniques Used: Flow Cytometry, Cytometry, Reverse Transcription Polymerase Chain Reaction, Western Blot, Marker, Immunofluorescence

    Telomerase activity detection. A: Silver staining method used to detect telomerase activity. The ladders in the gel show that HTERT-AEC II cells display telomerase activity compared with primary AEC II cells. B: RT-PCR detection of HTERT gene transcription. HTERT-AEC II cells maintained RNA levels of HTERT at passages 30 and 50. C: Western blot detection of the HTERT gene. Expression of HTERT protein is shown by HTERT-AEC II cells at different passages.
    Figure Legend Snippet: Telomerase activity detection. A: Silver staining method used to detect telomerase activity. The ladders in the gel show that HTERT-AEC II cells display telomerase activity compared with primary AEC II cells. B: RT-PCR detection of HTERT gene transcription. HTERT-AEC II cells maintained RNA levels of HTERT at passages 30 and 50. C: Western blot detection of the HTERT gene. Expression of HTERT protein is shown by HTERT-AEC II cells at different passages.

    Techniques Used: Activity Assay, Silver Staining, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing

    5) Product Images from "Thermosensitive alternative splicing senses and mediates temperature adaptation in Drosophila"

    Article Title: Thermosensitive alternative splicing senses and mediates temperature adaptation in Drosophila

    Journal: bioRxiv

    doi: 10.1101/503409

    Tim transcription is advanced at 18°C compared to 25°C and 29°C. A. q-RT PCR results for tim mRNA, top, or chromatin-bound (nascent RNA) tim , bottom, levels on entrained WT fly heads at ZT3, ZT7, ZT11, ZT15, ZT19 and ZT23 (consecutive bars) at 18°C (blue), 25°C (grey) or 29°C (red). B. Same as in (A) but for per .
    Figure Legend Snippet: Tim transcription is advanced at 18°C compared to 25°C and 29°C. A. q-RT PCR results for tim mRNA, top, or chromatin-bound (nascent RNA) tim , bottom, levels on entrained WT fly heads at ZT3, ZT7, ZT11, ZT15, ZT19 and ZT23 (consecutive bars) at 18°C (blue), 25°C (grey) or 29°C (red). B. Same as in (A) but for per .

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    6) Product Images from "M2 receptor activation inhibits cell cycle progression and survival in human glioblastoma cells"

    Article Title: M2 receptor activation inhibits cell cycle progression and survival in human glioblastoma cells

    Journal: Journal of Cellular and Molecular Medicine

    doi: 10.1111/jcmm.12038

    M2 expression in glioma cells. ( A ) RT-PCR analysis of m2 transcript espression in two glioblastoma cell lines (U251 and U87). RNA from human brain was used as positive control, the GAPDH was used as housekeeping gene. ( B ) Levels of expression of m2 transcript by real time PCR in five primary cell cultures obtained from biopsies and in glioma cell lines U87 and U251. The levels of the transcript were normalized with the housekeeping gene (18s) and compared to the reference sample FCN-9. ( C ) Expression of M2 protein by Western blot analysis in both cell lines (U251 and U87) and in three primary cell cultures (CRL-8; FCN-9; MZC-12). GAPDH and tubulin were used to normalize the intensity of the bands.
    Figure Legend Snippet: M2 expression in glioma cells. ( A ) RT-PCR analysis of m2 transcript espression in two glioblastoma cell lines (U251 and U87). RNA from human brain was used as positive control, the GAPDH was used as housekeeping gene. ( B ) Levels of expression of m2 transcript by real time PCR in five primary cell cultures obtained from biopsies and in glioma cell lines U87 and U251. The levels of the transcript were normalized with the housekeeping gene (18s) and compared to the reference sample FCN-9. ( C ) Expression of M2 protein by Western blot analysis in both cell lines (U251 and U87) and in three primary cell cultures (CRL-8; FCN-9; MZC-12). GAPDH and tubulin were used to normalize the intensity of the bands.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Positive Control, Real-time Polymerase Chain Reaction, Western Blot

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: The chromodomains of CHD1 are critical for enzymatic activity but less important for chromatin localization
    Article Snippet: .. Real-time PCR analysis Total RNA was extracted by the TriBase (Sigma) method from larvae that had been subjected to various times (0, 5, 10, 15, 30 and 60 min) of heat treatment at 37°C and subsequently been frozen in liquid nitrogen. .. RNA was further purified using the RNeasy kit (Qiagen), digested with DNase I and cDNA was synthesized using Superscript III reverse transcriptase (Invitrogen) and random hexamer primers.

    Article Title: Characterisation of systemic dissemination of nonreplicating adenoviral vectors from tumours in local gene delivery
    Article Snippet: .. In the real-time PCR analysis, the primers and probes were purchased from Sigma-Genosis (Woodlands, TX USA). .. The forward primer sequence for Ad E4 region was: 5′-TGACACGCATACTCGGAGCTA-3′: 34 885–34 905; the reverse primer sequence was: 5′-TTTGAGCAGCACCTTGCATT-3′: 34 977–34 958; the fluorogenic probe sequence was: [DFAM]CGCCGCCCATGCAACAAGCTT[DBH1]: 34 930–34 951 ( ).

    Article Title: Chansu inhibits the expression of cortactin in colon cancer cell lines in vitro and in vivo
    Article Snippet: .. Real-time PCR was carried out in 20 μl of reaction solution, consisting of 0.4 μM primers (Sigma), 10 μl of Express SYBR GreenER qPCR SuperMixes (Invitrogen) and ddH2 O. Real-time PCR was performed in iQ5 multicolour real-time PCR detection system (Bio-Rad). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Millipore real time qpcr assay
    Comparison of B. tryoni LAMP and B. tryoni real-time <t>qPCR</t> assays. ( a ) LAMP, <t>DNA</t> dilution series amplification times for two biological replicates of B. tryoni (triangles). ( b ) Real-time qPCR, DNA dilution series Cq values, DNA samples as above. ( c ) Direct comparison of new LAMP assays and qPCR assays on dilution series DNA, symbols represent average replicates of B. tryoni (circles), linear regression R 2 = 0.91.
    Real Time Qpcr Assay, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time qpcr assay/product/Millipore
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time qpcr assay - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Millipore rt pcr analysis total rna
    Identification of direct notch targets using a GSI washout experiment . Jurkat cells were treated with 10 uM GSI (or DMSO (untreated)) for 48 hours to accumulate cell surface Notch before washing to permit Notch signalling. After washing, cells were treated with 20 uM cyclohexamide (CHX) or ethanol (vehicle control) to inhibit protein synthesis. After 4 hrs, <t>RNA</t> was isolated and cDNA made for real-time <t>PCR</t> analysis of known Notch target genes (A) and novel Notch target genes (B). Expression values were calculated using cDNA from untreated cells as the calibrator sample. * represents p
    Rt Pcr Analysis Total Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr analysis total rna/product/Millipore
    Average 93 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    rt pcr analysis total rna - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    94
    Millipore mrna expression semi quantitative pcr total rna
    Semi-quantitative <t>PCR</t> analysis of <t>mRNA</t> expression levels of interleukin-6 (IL-6) ( a ), interleukin-1β (IL1–β) ( b ), tumor necrosis factor-α (TNF-α) ( c ), nuclear factor erythroid 2-related factor-2 (Nrf2) ( d ), urocortin-1 (Ucn1) ( e ), glutathione peroxidase-1 (Gpx-1) ( f ) and β-actin ( g ) in the liver of control and hyperandrogenic PCOM rats.
    Mrna Expression Semi Quantitative Pcr Total Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mrna expression semi quantitative pcr total rna/product/Millipore
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mrna expression semi quantitative pcr total rna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of B. tryoni LAMP and B. tryoni real-time qPCR assays. ( a ) LAMP, DNA dilution series amplification times for two biological replicates of B. tryoni (triangles). ( b ) Real-time qPCR, DNA dilution series Cq values, DNA samples as above. ( c ) Direct comparison of new LAMP assays and qPCR assays on dilution series DNA, symbols represent average replicates of B. tryoni (circles), linear regression R 2 = 0.91.

    Journal: Scientific Reports

    Article Title: A LAMP assay for the detection of Bactrocera tryoni Queensland fruit fly (Diptera: Tephritidae)

    doi: 10.1038/s41598-020-65715-5

    Figure Lengend Snippet: Comparison of B. tryoni LAMP and B. tryoni real-time qPCR assays. ( a ) LAMP, DNA dilution series amplification times for two biological replicates of B. tryoni (triangles). ( b ) Real-time qPCR, DNA dilution series Cq values, DNA samples as above. ( c ) Direct comparison of new LAMP assays and qPCR assays on dilution series DNA, symbols represent average replicates of B. tryoni (circles), linear regression R 2 = 0.91.

    Article Snippet: The same serial dilution of DNA extracts was also used in real-time qPCR assay.

    Techniques: Real-time Polymerase Chain Reaction, Amplification

    Identification of direct notch targets using a GSI washout experiment . Jurkat cells were treated with 10 uM GSI (or DMSO (untreated)) for 48 hours to accumulate cell surface Notch before washing to permit Notch signalling. After washing, cells were treated with 20 uM cyclohexamide (CHX) or ethanol (vehicle control) to inhibit protein synthesis. After 4 hrs, RNA was isolated and cDNA made for real-time PCR analysis of known Notch target genes (A) and novel Notch target genes (B). Expression values were calculated using cDNA from untreated cells as the calibrator sample. * represents p

    Journal: Molecular Cancer

    Article Title: Identification of novel Notch target genes in T cell leukaemia

    doi: 10.1186/1476-4598-8-35

    Figure Lengend Snippet: Identification of direct notch targets using a GSI washout experiment . Jurkat cells were treated with 10 uM GSI (or DMSO (untreated)) for 48 hours to accumulate cell surface Notch before washing to permit Notch signalling. After washing, cells were treated with 20 uM cyclohexamide (CHX) or ethanol (vehicle control) to inhibit protein synthesis. After 4 hrs, RNA was isolated and cDNA made for real-time PCR analysis of known Notch target genes (A) and novel Notch target genes (B). Expression values were calculated using cDNA from untreated cells as the calibrator sample. * represents p

    Article Snippet: RT-PCR analysis Total RNA was isolated from GFP+ transduced cell lines or cells treated with gamma secretase inhibitor (GSI IX; Calbiochem) and reverse transcribed to cDNA using the High Capacity cDNA Archive kit (Applied Biosystems, Warrington, UK).

    Techniques: Isolation, Real-time Polymerase Chain Reaction, Expressing

    Semi-quantitative PCR analysis of mRNA expression levels of interleukin-6 (IL-6) ( a ), interleukin-1β (IL1–β) ( b ), tumor necrosis factor-α (TNF-α) ( c ), nuclear factor erythroid 2-related factor-2 (Nrf2) ( d ), urocortin-1 (Ucn1) ( e ), glutathione peroxidase-1 (Gpx-1) ( f ) and β-actin ( g ) in the liver of control and hyperandrogenic PCOM rats.

    Journal: Medicina

    Article Title: Effect of DHT-Induced Hyperandrogenism on the Pro-Inflammatory Cytokines in a Rat Model of Polycystic Ovary Morphology

    doi: 10.3390/medicina56030100

    Figure Lengend Snippet: Semi-quantitative PCR analysis of mRNA expression levels of interleukin-6 (IL-6) ( a ), interleukin-1β (IL1–β) ( b ), tumor necrosis factor-α (TNF-α) ( c ), nuclear factor erythroid 2-related factor-2 (Nrf2) ( d ), urocortin-1 (Ucn1) ( e ), glutathione peroxidase-1 (Gpx-1) ( f ) and β-actin ( g ) in the liver of control and hyperandrogenic PCOM rats.

    Article Snippet: Analysis of mRNA Expression (Semi-Quantitative PCR) Total RNA was isolated from control and DHT-treated PCOM rat liver using the TRIzol reagent (monophasic solution of phenol and guanidinium isothiocyanate; Cat # 93289, Millipore Sigma, Burlington, MA, USA) at indicated time points.

    Techniques: Real-time Polymerase Chain Reaction, Expressing