Journal: iScience

Article Title: Transcriptome, proteome, and protein synthesis within the intracellular cytomatrix

doi: 10.1016/j.isci.2023.105965

Figure Lengend Snippet:

Article Snippet: DDX6 , Cell Signaling Technology , Cat# 9407; RRID: AB_10556959.

Techniques: shRNA, Plasmid Preparation, Recombinant, Concentration Assay, Growth Assay, Mass Spectrometry, Expressing, Transduction, Software

Journal: BMC Genomics

Article Title: A highly expressed miR-101 isomiR is a functional silencing small RNA

doi: 10.1186/1471-2164-14-104

Figure Lengend Snippet: miR-101 and 5’-isomiR-101 bind Ago2 and Rck/p54. A. Specificity of miR-101 and 5’-isomiR-101 detection. SH-SY5Y cells were transfected with a negative control sequence (siGLO Green) or the mIRIDIAN mimics for miR-101 (dark bars) or 5’-isomiR-101 (light bars). Specific RT-qPCRs determinations for miR-101 and 5’-isomiR-101 were performed. Results are expressed as the Fold Change ratios (miridian mimic / control siGLO). B. Expression of exogenously transfected miR-101 or 5’-isomiR-101 in Ago2 immunocomplexes. SH-SY5Y cells were transfected with Siglo Green or the mIRIDIAN mimics for miR-101 or 5’-isomiR-101. Specific RT-qPCRs were performed in Ago2-FLAG immunoprecipitates.Results are expressed as the Fold Change ratios obtained from the FLAG antibody/Control antibody immunoprecipitates. Western-blot with anti-FLAG antibody shows the presence of Ago2-FLAG in the FLAG-IP and input, and the absence of Ago2-FLAG in the control IP. C. Detection of RISC components in miR-101 or 5’-isomiR-101 pull-down. SH-SY5Y cells stably expressing Ago2-FLAG were transfected with mIRIDIAN 3’-biotin-miR-101 or 3’-biotin-5’-isomiR-101. Biotin-miRNA complexes were pulled down with streptavidin beads and subsequently assayed for western blot analysis using Ago2 and Rck/p54 antibodies. The relative amount of Ago2 and Rck/p54 in 3’-biotin-5’-isomiR-101 versus 3’-biotin-miR-101 is shown in the middle panel. miRNA-101 transfected samples were used to normalize data and were assigned a value of 1. Left panel shows similar amounts of transfected 3’-biotin-miR-101 or 3’-biotin-5’-isomiR-101 determined in total cell extracts with the corresponding specific RT-qPCR assays. D. Expression of endogenous miR-101 and 5’isomiR-101 in Ago2-immunocomplexes in the human brain. Ago2 complexes were immunoprecipitated from human frontal cortex homogenates and miR-101, 5’-isomiR-101, miR-29a, U6 SNORD44 were determined by RT-qPCR. Results are expressed as the Fold Change ratios obtained from the Ago2 vs denatured Ago2 immunoprecipitates. Three independent experiments were performed in A- D . All data are expressed as the mean± SEM. Asterisks indicate statistical significance between miR-101 and 5’-isomiR-101 data : * (p ≤ 0.05), ** (p≤0.01) using Mann–Whitney test.

Article Snippet: Anti-Ago2 was from Millipore, anti-Rck/p54 was from MBL, anti-Mcl-1 was from Cell Signaling, anti-COX-2 was from Cayman, anti-EZH2 was obtained from Dr. Kristian Helllin (BRIC-University of Copenhagen), anti-MKP-1 was from Santa Cruz, anti-APP was from Abcam and anti-tubulin and anti-FLAG (M2) were from Sigma. miRIDIAN™ hsa-miRNA-101 mimics and siGLO Green (transfection indicator) were from Dharmacon: hsa-miRNA-101 (mature sequence: UACAGUACUGUGAUAACUGAA), hsa-5’-isomiR-101 (mature sequence: GUACAGUACUGUGAUAACUGA), 3’biotinilated hsa-miRNA-101 (mature sequence: UACAGUACUGUGAUAACUGAA-Bio) and 3’biotinilated hsa-5’-isomiR-101 (mature sequence: GUACAGUACUGUGAUAACUGA-Bio).

Techniques: Transfection, Negative Control, Sequencing, Expressing, Western Blot, Stable Transfection, Quantitative RT-PCR, Immunoprecipitation, MANN-WHITNEY

Journal: eLife

Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA

doi: 10.7554/eLife.39023

Figure Lengend Snippet: ( A ) Schematic illustrating the secondary structures present in the ZIKV 3′ UTR and RNAs used for affinity chromatography. Deletion mutant RNA constructs fused to a tobramycin aptamer at the 5′ end are shown. DENV NS2A coding sequence was used as a negative control RNA. ( B ) Purified RNAs bound to tobramycin-sepharose beads were incubated with HeLa cell lysate and unbound proteins were washed away prior to elution for western blotting for DDX6, FMRP, FXR1, FXR2, G3BP1 and PTB.

Article Snippet: The following antibodies were used for IP, western blotting and/or immunofluorescence analysis: anti-envelope protein 4G2 , rabbit IgG (2729S, Cell Signaling Technologies), anti-FMRP (ab17722, ABCAM, Cambridge, UK), anti-FXR1 (12295S, Cell Signaling Technologies), anti-FXR2 (7098S, Cell Signaling Technologies), anti-G3BP1 (A302-033A, Bethyl Laboratories), rabbit anti-DDX6 (9407S, Cell Signaling technologies), rabbit anti-PTB (homemade), rabbit anti-ZIKV NS4B (GTX133321, Genetex), anti-ZIKV NS2B (GTX133308, Genetex), anti-BRD4 (13440, Cell Signaling Technologies), anti-GAPDH (ab9485, ABCAM), anti-TLN1 (SC-365875, Santa Cruz Biotechnology), anti-PNPLA6 (SC-271049, Santa Cruz Biotechnology).

Techniques: Affinity Chromatography, Mutagenesis, Construct, Sequencing, Negative Control, Purification, Incubation, Western Blot

Journal: eLife

Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA

doi: 10.7554/eLife.39023

Figure Lengend Snippet:

Article Snippet: The following antibodies were used for IP, western blotting and/or immunofluorescence analysis: anti-envelope protein 4G2 , rabbit IgG (2729S, Cell Signaling Technologies), anti-FMRP (ab17722, ABCAM, Cambridge, UK), anti-FXR1 (12295S, Cell Signaling Technologies), anti-FXR2 (7098S, Cell Signaling Technologies), anti-G3BP1 (A302-033A, Bethyl Laboratories), rabbit anti-DDX6 (9407S, Cell Signaling technologies), rabbit anti-PTB (homemade), rabbit anti-ZIKV NS4B (GTX133321, Genetex), anti-ZIKV NS2B (GTX133308, Genetex), anti-BRD4 (13440, Cell Signaling Technologies), anti-GAPDH (ab9485, ABCAM), anti-TLN1 (SC-365875, Santa Cruz Biotechnology), anti-PNPLA6 (SC-271049, Santa Cruz Biotechnology).

Techniques: Knock-Out, Sequencing, Northern Blot

Journal: eLife

Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA

doi: 10.7554/eLife.39023

Figure Lengend Snippet: ( A ) Schematic illustrating the secondary structures present in the ZIKV 3′ UTR and RNAs used for affinity chromatography. Deletion mutant RNA constructs fused to a tobramycin aptamer at the 5′ end are shown. DENV NS2A coding sequence was used as a negative control RNA. ( B ) Purified RNAs bound to tobramycin-sepharose beads were incubated with HeLa cell lysate and unbound proteins were washed away prior to elution for western blotting for DDX6, FMRP, FXR1, FXR2, G3BP1 and PTB.

Article Snippet: Antibody , Anti-DDX6 (Rabbit polyclonal) , Cell Signaling Technology , Cell Signaling Technology Cat# 9407S, RRID: AB_10556959 , (1:1000).

Techniques: Affinity Chromatography, Mutagenesis, Construct, Sequencing, Negative Control, Purification, Incubation, Western Blot

Journal: eLife

Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA

doi: 10.7554/eLife.39023

Figure Lengend Snippet:

Article Snippet: Antibody , Anti-DDX6 (Rabbit polyclonal) , Cell Signaling Technology , Cell Signaling Technology Cat# 9407S, RRID: AB_10556959 , (1:1000).

Techniques: Knock-Out, Sequencing, Northern Blot