Structured Review

Promega ratp
Ratp, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ratp/product/Promega
Average 99 stars, based on 15 article reviews
Price from $9.99 to $1999.99
ratp - by Bioz Stars, 2019-12
99/100 stars

Images

Related Articles

Centrifugation:

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The homogenate was incubated for 10 min at room temperature before centrifugation at 1000 g for 3 min. 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 min at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions.

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: Cells were incubated at 37 °C (20 min) with anti-CR1 monoclonal antibody (3C10, 5 μg/ml) followed by centrifugation at 300 × g (2 min) and then washed in the same medium. .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Luciferase:

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: ATP release was measured using the GloMax®-Multi+ Detection System (Promega) and ENLITEN® (luciferase/luciferin) reagent, which was injected in equal volumes to the sample into each well and bioluminescence was read. .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Synthesized:

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: First, a DNA template was synthesized by PCR using specific primers for Kiss1 cDNA amplification carrying at their 5′-end sequences for synthetic promoters for bacteriophage-encoded DNA-dependent RNA polymerases (T7 and T3). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Construct:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Double-digest restriction site-associated DNA libraries were constructed from two populations at a time, in batches of twelve mosquitoes, with six individuals from each population per batch. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: RAD libraries were constructed following a protocol from Baird et al. ( ). .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Electrophoresis:

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. All 120 reactions were pooled and column-purified (MinElute PCR Purification Kit) and eluted in 52 μL of EB buffer (Qiagen, UK).

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: After electrophoresis on a 2% agarose (w/v) gel, a single DNA fragment was obtained of the expected size and gel purified with a QiaQuick gel extraction kit (Qiagen). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Incubation:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 minutes at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions.

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The homogenate was incubated for 10 min at room temperature before centrifugation at 1000 g for 3 min. 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 min at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions.

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Article Title: NMDA receptor activity downregulates KCC2 resulting in depolarizing GABAA receptor mediated currents
Article Snippet: We determined protein concentration using a Micro BCA protein assay kit (Thermo Scientific). .. We incubated 0.5 mg of His-C fusion protein with 50 μM rATP (Promega) and 5 ng of purified PKC (EMD Biosciences) in a buffer containing (in mM): 20 HEPES (pH 7.5) and 10 MgCl2 for 10 min at 30 °C and terminated by the addition of 2x SDS-PAGE sample buffer. .. We analyzed the reaction mixture by SDS-PAGE.

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: After cooling the reactions to room temperature, 2.5 μL of a premade barcode-adapter mix was added to the digested DNA, and incubated at room temperature for 10 min. .. Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: The adapter sequences were as follows: EcoR I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′, for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′, bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O. .. Samples were treated with heat denaturation at 65°C for 20 min again.

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: Cell suspension (55 μl) were pipetted into a black 96-well plate and secondary antibody (goat anti-mouse, Jackson, 115-005-003) was added in the same concentration (volume: 5 μl), followed by incubation at room temperature (70 min). .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: After cooling the reactions to room temperature, 3 μL of a premade barcode-adapter mix was added to the digested DNA, and incubated at room temperature for 10 min. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Amplification:

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. The pooled sample was column-purified (MinElute PCR Purification Kit, Qiagen, UK) and size selection of fragments, c. 320 bp to 590 bp, was performed by agarose gel electrophoresis.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: First, a DNA template was synthesized by PCR using specific primers for Kiss1 cDNA amplification carrying at their 5′-end sequences for synthetic promoters for bacteriophage-encoded DNA-dependent RNA polymerases (T7 and T3). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: The RAD library preparation protocol, including the design of RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences, followed . .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Activity Assay:

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: The barcoded adapters were designed such that adapter–genomic DNA ligations did not reconstitute RE sites, while residual RE activity limited concatemerization of genomic fragments during ligation. .. Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: The barcoded adapters were designed such that adapter–genomic DNA ligations did not reconstitute RE sites, while residual RE activity limited concatemerization of genomic fragments during ligation. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Translocation Assay:

Article Title: Mammalian SRP receptor switches the Sec61 translocase from Sec62 to SRP-dependent translocation
Article Snippet: Paragraph title: In vitro translocation assays ... Transcription reactions were carried out in a volume of 100 μl for 2 h at 37 °C, in the presence of 1 × transcription-optimised buffer (Promega), 10 mM DTT, 0.5 μg of template DNA, 0.25 mM each of rATP, rCTP, rGTP and rUTP (Promega), 0.5 mM Cap analogue (m7 G[5′]ppp[5′]G; New England Biolabs), 80 units of T7 RNA Polymerase (Promega) and 100 units of RNasin Plus RNase Inhibitor (Promega).

Gel Purification:

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. The pooled sample was column-purified (MinElute PCR Purification Kit, Qiagen, UK) and size selection of fragments, c. 320 bp to 590 bp, was performed by agarose gel electrophoresis.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Transfection:

Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
Article Snippet: CAUTION [γ-32 P]ATP is radioactive and carcinogenic; use personal protective equipment when you are handling it. .. SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A. .. Total RNA kit I (Omega Bio-Tek, cat. no. 101319-240) Ambion DNA-free kit (Life Technologies, cat. no. AM1906) M-MLV reverse transcriptase, supplied with 5× reaction buffer and HeLa extract stop solution (Promega, cat. no. E3110) MluCI (New England BioLabs, cat. no. R0538S) Cac8I (New England BioLabs, cat. no. R0579L) 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP; Oakwood Chemical, cat. no. 003409) Methanol (Fisher Scientific, cat. no. A452-SK4) Sodium chloride (EMD, cat. no. 7710) Sodium hydroxide (Fisher Scientific, cat. no. S318-10) Agarose (Sigma-Aldrich, cat. no. A9539) Sodium acetate (Sigma-Aldrich, cat. no. S2889) Tris base (Fisher Scientific, cat. no. BP152-5) EDTA (Teknova, cat. no. E5599) Hydrochloric acid (Fisher Scientific, cat. no. A144-500) !

Ligation:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Library construction was similar to the ‘optimized protocol’ of Hoffberg et al. [ ], although pooling occurred prior to size selection, rather than after adaptor ligation. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: The adapters included an inline five- or seven-base barcode for sample identification. .. Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. The reactions were terminated by addition of 20 μL PB buffer (Minelute PCR Purification Kit; Qiagen UK).

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: The adapter sequences were as follows: EcoR I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxx-3′ [x = barcode], bottom: 5′-Phos-AATTxxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′, for Sbf I digestion, top: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA-3′, bottom: 5′-Phos-xxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT-3′. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O. .. Samples were treated with heat denaturation at 65°C for 20 min again.

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: Ligation of RBC with anti-CD47 was performed according to the protocol for RBC/zymosan ligation at 2% Hct (see below). .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: The adapters included an inline five- or seven-base barcode for sample identification (Additional file : Table S1). .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. The ligated samples were then heat denatured at 65 °C for 20 min, cooled, and combined into a single pool.

Article Title: SNP Discovery and Genotyping for Evolutionary Genetics Using RAD Sequencing
Article Snippet: Paragraph title: 2.2. P1 Adapter Ligation, Purification and DNA Shearing ... NEB Buffer 2. rATP (Promega): 100 mM.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

ATP Assay:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: Paragraph title: ATP assay for adult H . polygyrus worms ... An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions.

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: Paragraph title: ATP Assay ... An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions.

Infection:

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The ATP of infective L3 H. polygyrus larvae, L4 H. polygyrus larvae (removed from intestinal wall at day 7 post infection) and adult L5 H. polygyrus worms was measured using the CellTiter-Glo® Luminescent Cell Viability Assay (Promega). .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions.

Viability Assay:

Article Title: Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline
Article Snippet: Concentrations of ATP were tested with the BacTiter-Glo microbial cell viability assay (p/n G8230; Promega, Madison, WI) on the GlowMax Discover microplate reader (p/n GM3000, Promega) following the manufacturer's instruction. .. Data were generated in relative luminescence units (RLU), which were not back calculated to ATP concentrations, although a standard of 10 mM rATP (p/n P113B; Promega) was added to each run to ensure run-to-run consistency.

Generated:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 minutes at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions. .. Fecal pellets were homogenized and DNA was extracted using the FastDNA Spin Kit for Soil (MP Biomedicals) as per the manufacturer’s recommendations.

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The homogenate was incubated for 10 min at room temperature before centrifugation at 1000 g for 3 min. 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 min at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions. .. The antibiotics Gentamicin sulfate salt (1 mg/mL, Sigma), Metronidazole (1 mg/mL, Sigma), Cefloxin sodium salt (1 mg/mL, Santa Cruz Biotechnology), Vancomycin hydrochloride (1 mg/mL, Sigma) were administered in the drinking water.

Article Title: Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline
Article Snippet: The plate was placed on the GlowMax Discover, which was preprogrammed to mix with an orbital shaker, incubate at room temperature for 5 min, and then read the luminescence. .. Data were generated in relative luminescence units (RLU), which were not back calculated to ATP concentrations, although a standard of 10 mM rATP (p/n P113B; Promega) was added to each run to ensure run-to-run consistency. .. All samples were tested in duplicate, except for the retest that had six replicates per sample, and statistical comparisons were made using Prism v. 7.04 (GraphPad, La Jolla, CA).

Article Title: Mammalian SRP receptor switches the Sec61 translocase from Sec62 to SRP-dependent translocation
Article Snippet: Templates for preprolactin , opsin-tagged preprocecropin A, apelin, statherin and cytochrome B5 were generated by PCR . .. Transcription reactions were carried out in a volume of 100 μl for 2 h at 37 °C, in the presence of 1 × transcription-optimised buffer (Promega), 10 mM DTT, 0.5 μg of template DNA, 0.25 mM each of rATP, rCTP, rGTP and rUTP (Promega), 0.5 mM Cap analogue (m7 G[5′]ppp[5′]G; New England Biolabs), 80 units of T7 RNA Polymerase (Promega) and 100 units of RNasin Plus RNase Inhibitor (Promega).

DNA Sequencing:

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: Restriction-site associated DNA (RAD) strategy combined with Illumina DNA sequencing was used for the fast and effective identification of SNP markers. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Sequencing:

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Paragraph title: Library preparation and sequencing ... Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: Paragraph title: RAD library construction and sequencing ... The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Paragraph title: RAD Library Preparation and Sequencing ... The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Paragraph title: ddRAD library preparation and sequencing ... Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Paragraph title: RAD library preparation and sequencing ... Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Paragraph title: RAD sequencing and SNP genotyping ... Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Sonication:

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Injection:

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: ATP release was measured using the GloMax®-Multi+ Detection System (Promega) and ENLITEN® (luciferase/luciferin) reagent, which was injected in equal volumes to the sample into each well and bioluminescence was read. .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Recombinant:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 minutes at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions. .. Fecal pellets were homogenized and DNA was extracted using the FastDNA Spin Kit for Soil (MP Biomedicals) as per the manufacturer’s recommendations.

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The homogenate was incubated for 10 min at room temperature before centrifugation at 1000 g for 3 min. 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 min at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions. .. The antibiotics Gentamicin sulfate salt (1 mg/mL, Sigma), Metronidazole (1 mg/mL, Sigma), Cefloxin sodium salt (1 mg/mL, Santa Cruz Biotechnology), Vancomycin hydrochloride (1 mg/mL, Sigma) were administered in the drinking water.

DNA Extraction:

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Genomic DNA was extracted from fin samples using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Genomic DNA was extracted from fin samples using the REALPure genomic DNA extraction kit (Durviz S.L.) and treated with RNase. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: High Resolution Genetic Mapping by Genome Sequencing Reveals Genome Duplication and Tetraploid Genetic Structure of the Diploid Miscanthus sinensis
Article Snippet: Paragraph title: DNA isolation and library construction ... Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C.

Nucleic Acid Electrophoresis:

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. Shearing (Covaris S2 sonication) and initial size selection (100 to 800 bp) by agarose gel electrophoresis [ ] was followed by gel purification, end repair, dA overhang addition, P2 paired-end adapter ligation and library amplification.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. Shearing (Covaris S2 sonication) and initial size selection (100 to 800 bp) by agarose gel electrophoresis [ ] was followed by gel purification, end repair, dA overhang addition, P2 paired-end adapter ligation and library amplification.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Fluorescence:

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: DNA quantity and quality were evaluated by fluorescence (Qubit) and agarose gels prior to library construction. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Magnetic Beads:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Digestions were cleaned using AxyPrep Mag PCR Clean-up Kits (Axygen, Union City, CA, USA), hereafter magnetic beads, following manufacturers protocols. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Isolation:

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Article Title: High Resolution Genetic Mapping by Genome Sequencing Reveals Genome Duplication and Tetraploid Genetic Structure of the Diploid Miscanthus sinensis
Article Snippet: Genomic DNA (gDNA) was isolated from dried leaf tissue using the DNeasy 96 Plant Kit (Qiagen). .. Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C.

Flow Cytometry:

Article Title: High Resolution Genetic Mapping by Genome Sequencing Reveals Genome Duplication and Tetraploid Genetic Structure of the Diploid Miscanthus sinensis
Article Snippet: Then, 500 ng DNA of each sample was digested with Fse I enzyme (New England Biolabs (NEB®), Hitchin, UK) at 37°C for 3 h; subsequently the enzyme was heat-inactivated at 65°C for 20 min. Twelve unique P1 adapters were designed, each with a different 6 bp barcode to enable a 12× sample multiplex per Illumina flow cell lane. .. Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C.

Labeling:

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Purification:

Article Title: NMDA receptor activity downregulates KCC2 resulting in depolarizing GABAA receptor mediated currents
Article Snippet: We determined protein concentration using a Micro BCA protein assay kit (Thermo Scientific). .. We incubated 0.5 mg of His-C fusion protein with 50 μM rATP (Promega) and 5 ng of purified PKC (EMD Biosciences) in a buffer containing (in mM): 20 HEPES (pH 7.5) and 10 MgCl2 for 10 min at 30 °C and terminated by the addition of 2x SDS-PAGE sample buffer. .. We analyzed the reaction mixture by SDS-PAGE.

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Each DNA sample was processed in duplicate (i.e. 120 separate digestion – ligation reactions).

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: SNP Discovery and Genotyping for Evolutionary Genetics Using RAD Sequencing
Article Snippet: Paragraph title: 2.2. P1 Adapter Ligation, Purification and DNA Shearing ... NEB Buffer 2. rATP (Promega): 100 mM.

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: After electrophoresis on a 2% agarose (w/v) gel, a single DNA fragment was obtained of the expected size and gel purified with a QiaQuick gel extraction kit (Qiagen). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Article Title: High Resolution Genetic Mapping by Genome Sequencing Reveals Genome Duplication and Tetraploid Genetic Structure of the Diploid Miscanthus sinensis
Article Snippet: Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C. .. Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C.

Polymerase Chain Reaction:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Digestions were cleaned using AxyPrep Mag PCR Clean-up Kits (Axygen, Union City, CA, USA), hereafter magnetic beads, following manufacturers protocols. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Each DNA sample was processed in duplicate (i.e. 120 separate digestion – ligation reactions).

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences used in this study are detailed in . .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: SNP Discovery and Genotyping for Evolutionary Genetics Using RAD Sequencing
Article Snippet: NEB Buffer 2. rATP (Promega): 100 mM. .. NEB Buffer 2. rATP (Promega): 100 mM.

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: After electrophoresis on a 2% agarose (w/v) gel, a single DNA fragment was obtained of the expected size and gel purified with a QiaQuick gel extraction kit (Qiagen). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega). .. After 120 min of incubation at 37 °C, another 1 μl of T7 RNA was added to the mix, and the reaction was maintained for an additional 60 min at 37 °C.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: The RAD library preparation protocol, including the design of RAD-specific P1 and P2 paired-end adapters and library amplification PCR primer sequences, followed . .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Article Title: Mammalian SRP receptor switches the Sec61 translocase from Sec62 to SRP-dependent translocation
Article Snippet: Templates for preprolactin , opsin-tagged preprocecropin A, apelin, statherin and cytochrome B5 were generated by PCR . .. Transcription reactions were carried out in a volume of 100 μl for 2 h at 37 °C, in the presence of 1 × transcription-optimised buffer (Promega), 10 mM DTT, 0.5 μg of template DNA, 0.25 mM each of rATP, rCTP, rGTP and rUTP (Promega), 0.5 mM Cap analogue (m7 G[5′]ppp[5′]G; New England Biolabs), 80 units of T7 RNA Polymerase (Promega) and 100 units of RNasin Plus RNase Inhibitor (Promega).

Mouse Assay:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: Briefly, H . polygyrus adult worms were removed from the duodenum of mice and homogenised using a motorised pestle in 110 μL of PBS and 110 μL of CellTiter-Glo Reagent. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions.

SDS Page:

Article Title: NMDA receptor activity downregulates KCC2 resulting in depolarizing GABAA receptor mediated currents
Article Snippet: We determined protein concentration using a Micro BCA protein assay kit (Thermo Scientific). .. We incubated 0.5 mg of His-C fusion protein with 50 μM rATP (Promega) and 5 ng of purified PKC (EMD Biosciences) in a buffer containing (in mM): 20 HEPES (pH 7.5) and 10 MgCl2 for 10 min at 30 °C and terminated by the addition of 2x SDS-PAGE sample buffer. .. We analyzed the reaction mixture by SDS-PAGE.

Plasmid Preparation:

Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
Article Snippet: CAUTION [γ-32 P]ATP is radioactive and carcinogenic; use personal protective equipment when you are handling it. .. SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A. .. Total RNA kit I (Omega Bio-Tek, cat. no. 101319-240) Ambion DNA-free kit (Life Technologies, cat. no. AM1906) M-MLV reverse transcriptase, supplied with 5× reaction buffer and HeLa extract stop solution (Promega, cat. no. E3110) MluCI (New England BioLabs, cat. no. R0538S) Cac8I (New England BioLabs, cat. no. R0579L) 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP; Oakwood Chemical, cat. no. 003409) Methanol (Fisher Scientific, cat. no. A452-SK4) Sodium chloride (EMD, cat. no. 7710) Sodium hydroxide (Fisher Scientific, cat. no. S318-10) Agarose (Sigma-Aldrich, cat. no. A9539) Sodium acetate (Sigma-Aldrich, cat. no. S2889) Tris base (Fisher Scientific, cat. no. BP152-5) EDTA (Teknova, cat. no. E5599) Hydrochloric acid (Fisher Scientific, cat. no. A144-500) !

Enzyme-linked Immunosorbent Assay:

Article Title: Transcriptional and Functional Analysis of Bifidobacterium animalis subsp. lactis Exposure to Tetracycline
Article Snippet: Data were generated in relative luminescence units (RLU), which were not back calculated to ATP concentrations, although a standard of 10 mM rATP (p/n P113B; Promega) was added to each run to ensure run-to-run consistency. .. Data were generated in relative luminescence units (RLU), which were not back calculated to ATP concentrations, although a standard of 10 mM rATP (p/n P113B; Promega) was added to each run to ensure run-to-run consistency.

Multiplex Assay:

Article Title: High Resolution Genetic Mapping by Genome Sequencing Reveals Genome Duplication and Tetraploid Genetic Structure of the Diploid Miscanthus sinensis
Article Snippet: Then, 500 ng DNA of each sample was digested with Fse I enzyme (New England Biolabs (NEB®), Hitchin, UK) at 37°C for 3 h; subsequently the enzyme was heat-inactivated at 65°C for 20 min. Twelve unique P1 adapters were designed, each with a different 6 bp barcode to enable a 12× sample multiplex per Illumina flow cell lane. .. Each Fse I digested DNA sample was ligated to one of the P1 adapters in a 20 µl reaction mixture containing 1 µl of 10 nM adapter, 1 µl rATP (100 mM, Promega), 1 µl NEB buffer 4, and 0.5 µl T4 ligase (400,000 cohesive end units/mL, NEB) by incubating for 4 h at 16°C.

Selection:

Article Title: Population genomics of Culiseta melanura, the principal vector of Eastern equine encephalitis virus in the United States
Article Snippet: Library construction was similar to the ‘optimized protocol’ of Hoffberg et al. [ ], although pooling occurred prior to size selection, rather than after adaptor ligation. .. Adaptors containing sample barcodes were then ligated to each individual sample in a 25 μl reaction with 17 μl of digested DNA, 2.5 μl of 10X T4 DNA Ligase Reaction Buffer (NEB), 1 μl of 10 μM read 1 adaptor, 2 μl of 10 μM read 2 adaptor, 1.5 μl of 10μM rATP (Promega, Madison, WI, USA), and 100 units of T4 DNA Ligase.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

Agarose Gel Electrophoresis:

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. All 120 reactions were pooled and column-purified (MinElute PCR Purification Kit) and eluted in 52 μL of EB buffer (Qiagen, UK).

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. After heat-inactivation at 65°C for 20 min, the ligation reactions were slowly cooled to room temperature (over 1 h), then combined in appropriate multiplex pools.

Article Title: Evolution and conservation of Characidium sex chromosomes
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water. .. Individual specific P1 adapters, each with a unique 5 or 7 base barcode ( ) were ligated to the SbfI digested DNA, at 22 °C for 90 min, by adding 0.5 µL 100 nM P1 adapter, 0.12 µL 100 mM rATP (Promega), 0.2 µL 10× Reaction Buffer 2 (NEB), 0.1 µL T4 ligase (NEB, 2 M U/mL) and reaction volumes made up to 12 µL volume with nuclease free water.

In Vitro:

Article Title: NMDA receptor activity downregulates KCC2 resulting in depolarizing GABAA receptor mediated currents
Article Snippet: Paragraph title: In vitro phosphorylation of fusion proteins ... We incubated 0.5 mg of His-C fusion protein with 50 μM rATP (Promega) and 5 ng of purified PKC (EMD Biosciences) in a buffer containing (in mM): 20 HEPES (pH 7.5) and 10 MgCl2 for 10 min at 30 °C and terminated by the addition of 2x SDS-PAGE sample buffer.

Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
Article Snippet: CAUTION [γ-32 P]ATP is radioactive and carcinogenic; use personal protective equipment when you are handling it. .. SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A. .. Total RNA kit I (Omega Bio-Tek, cat. no. 101319-240) Ambion DNA-free kit (Life Technologies, cat. no. AM1906) M-MLV reverse transcriptase, supplied with 5× reaction buffer and HeLa extract stop solution (Promega, cat. no. E3110) MluCI (New England BioLabs, cat. no. R0538S) Cac8I (New England BioLabs, cat. no. R0579L) 1,1,1,3,3,3-Hexafluoro-2-propanol (HFIP; Oakwood Chemical, cat. no. 003409) Methanol (Fisher Scientific, cat. no. A452-SK4) Sodium chloride (EMD, cat. no. 7710) Sodium hydroxide (Fisher Scientific, cat. no. S318-10) Agarose (Sigma-Aldrich, cat. no. A9539) Sodium acetate (Sigma-Aldrich, cat. no. S2889) Tris base (Fisher Scientific, cat. no. BP152-5) EDTA (Teknova, cat. no. E5599) Hydrochloric acid (Fisher Scientific, cat. no. A144-500) !

Article Title: Mammalian SRP receptor switches the Sec61 translocase from Sec62 to SRP-dependent translocation
Article Snippet: Paragraph title: In vitro translocation assays ... Transcription reactions were carried out in a volume of 100 μl for 2 h at 37 °C, in the presence of 1 × transcription-optimised buffer (Promega), 10 mM DTT, 0.5 μg of template DNA, 0.25 mM each of rATP, rCTP, rGTP and rUTP (Promega), 0.5 mM Cap analogue (m7 G[5′]ppp[5′]G; New England Biolabs), 80 units of T7 RNA Polymerase (Promega) and 100 units of RNasin Plus RNase Inhibitor (Promega).

Spectrophotometry:

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Concentration Assay:

Article Title: CR1-mediated ATP Release by Human Red Blood Cells Promotes CR1 Clustering and Modulates the Immune Transfer Process
Article Snippet: Cell suspension (55 μl) were pipetted into a black 96-well plate and secondary antibody (goat anti-mouse, Jackson, 115-005-003) was added in the same concentration (volume: 5 μl), followed by incubation at room temperature (70 min). .. An ATP standard using rATP (Promega) was prepared each day in the following concentrations: 0.5, 1, 5, 10, 50, 100, and 200 n m .

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: Accuracy of Genomic Evaluations of Juvenile Growth Rate in Common Carp (Cyprinus carpio) Using Genotyping by Sequencing
Article Snippet: Each sample was quantified by spectrophotometry (Nanodrop), and its quality was assessed by agarose gel electrophoresis, before being diluted to a concentration of 20 ng/μL [measured by Qubit Fluorometer (Invitrogen)] in 5 mmol/L Tris, pH 8.5. .. The reactions (12 μL final volumes) were then heat inactivated at 65°C for 20 min. Individual-specific P1 adapters, each with a unique 5 bp barcode, were ligated to the Sbf I-digested DNA at 20°C for 60 min by adding 1.8/0.6 μL 100 nmol/L P1 adapter, 0.45/0.15 μL 100 mmol/L rATP (Promega), 0.75/0.25 μL 10× Reaction Buffer 2 (NEB), 0.36/0.12 μL T4 ligase (NEB, 2 M U/mL), and reaction volumes made up to 45/15 μL with nuclease-free water for each parental/offspring sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Briefly, each sample (0.25 μg DNA) was digested at 37°C for 40 min with the high-fidelity restriction enzyme Pst I that recognises the CTGCA|G motif (New England Biolabs; NEB) using 6 U Pst I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of about 1 μg DNA per 50 μL reaction volume. .. Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Briefly, each sample (0.25 μg DNA) was digested at 37°C for 40 min with the high-fidelity restriction enzyme Pst I that recognises the CTGCA|G motif (New England Biolabs; NEB) using 6 U Pst I per μg genomic DNA in 1× Reaction Buffer 4 (NEB) at a final concentration of about 1 μg DNA per 50 μL reaction volume. .. Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample.

High Throughput Screening Assay:

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. 120 μL of each amplified library was size-selected (about 250 to 500 bp) by gel electrophoresis.

Article Title: New diagnostic SNP molecular markers for the Mytilus species complex
Article Snippet: Individual specific P1 adapters, each with a unique 5 or 7 bp barcode , were ligated to the Pst I digested DNA at 22°C for 15 min by adding 0.6 μL (DNA samples) 100 nmol/L P1 adapter, 0.15 μL 100 mmol/L rATP (Promega), 0.25 μL 10× Reaction Buffer 2 (NEB), 0.125 μL T4 ligase (NEB, 2,000 U/μL) and reaction volumes made up to 15 μL with nuclease-free water for each sample. .. 120 μL of each amplified library was size-selected (about 250 to 500 bp) by gel electrophoresis.

Gel Extraction:

Article Title: Genetic diversity and structure in Arapaima gigas populations from Amazon and Araguaia-Tocantins river basins
Article Snippet: Ligation was performed over 75 min at 22 °C by addition of a further 2.5 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. All 120 reactions were pooled and column-purified (MinElute PCR Purification Kit) and eluted in 52 μL of EB buffer (Qiagen, UK).

Article Title: A High Density Genetic Map Derived from RAD Sequencing and Its Application in QTL Analysis of Yield-Related Traits in Vigna unguiculata
Article Snippet: The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O. .. The ligation reaction was incubated at room temperature (RT) for 20 min in a final volume of 10 μL containing 2.5 μL P1Adapter (100 nM), 1 μL rATP (100 mM) (Promega), 1 μL 10 × EcoR I buffer, 0.5 μL T4 DNA Ligase (1,000 U) (NEB), and 5 μL H2 O.

Article Title: Gene-centromere mapping in meiotic gynogenetic European seabass
Article Snippet: Ligation was performed over 40 min at 22 °C by addition of a further 3 μL of a ligation mix comprising 4 mM rATP (Promega, UK), and 2000 cohesive-end units of T4 ligase (NEB) in 1× CutSmart buffer. .. The pooled sample was column-purified (MinElute PCR Purification Kit, Qiagen, UK) and size selection of fragments, c. 320 bp to 590 bp, was performed by agarose gel electrophoresis.

Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
Article Snippet: Ethanol (Fisher Scientific, cat. no. BP2818) QIAquick gel extraction kit (Qiagen, cat. no. 28704) [γ-32 P]ATP (PerkinElmer, cat. no. NEG002H250UC) ! .. SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A.

Article Title: Defining a novel leptin–melanocortin–kisspeptin pathway involved in the metabolic control of puberty
Article Snippet: After electrophoresis on a 2% agarose (w/v) gel, a single DNA fragment was obtained of the expected size and gel purified with a QiaQuick gel extraction kit (Qiagen). .. For the generation of the antisense Kiss1 riboprobe, the product of the PCR was used as template for the transcription reaction, as follows (final volume of 20 μl): 250 Ci [33P]-UTP (Perkin Elmer, Massachusetts, USA), 0.5 μg of template, 2 μl 3NTPs (5 mM rATP, rCTP and rGTP), 1 μl RNasin Ribonuclease Inhibitor (Promega), 4 μl transcription buffer, and 2 μl T7 RNA polymerase (Promega).

Cell Viability Assay:

Article Title: TPL-2 restricts Ccl24-dependent immunity to Heligmosomoides polygyrus
Article Snippet: 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 minutes at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo Luminescent Cell Viability Assay instructions. .. Fecal pellets were homogenized and DNA was extracted using the FastDNA Spin Kit for Soil (MP Biomedicals) as per the manufacturer’s recommendations.

Article Title: Epithelial-Cell-Derived Phospholipase A2 Group 1B Is an Endogenous Anthelmintic
Article Snippet: The homogenate was incubated for 10 min at room temperature before centrifugation at 1000 g for 3 min. 200 μL of the supernatant was transferred to a 96 well opaque-walled plate and incubated for 10 min at room temperature before recording luminescence. .. An ATP standard curve was generated by using recombinant ATP (Promega) as detailed in the CellTiter-Glo® Luminescent Cell Viability Assay instructions. .. The antibiotics Gentamicin sulfate salt (1 mg/mL, Sigma), Metronidazole (1 mg/mL, Sigma), Cefloxin sodium salt (1 mg/mL, Santa Cruz Biotechnology), Vancomycin hydrochloride (1 mg/mL, Sigma) were administered in the drinking water.

Hood:

Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
Article Snippet: SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A. .. SfaNI (New England BioLabs, cat. no. R0172S) NcoI (New England BioLabs, cat. no. R0193S) NotI (New England BioLabs, cat. no. R0189S) T7 RNA polymerase, supplied with 5× transcription buffer (Promega, cat. no. P2075) 100 mM DTT (Promega, cat. no. P1171) 100 mM rATP (Promega, cat. no. E6011) 100 mM rUTP (Promega, cat. no. E6021) 100 mM rGTP (Promega, cat. no. E6031) 100 mM rCTP (Promega, cat. no. E6041) RNase inhibitor (New England BioLabs, cat. no. M0307S) HeLaScribe nuclear extract in vitro transcription system, supplied with HeLa nuclear extract, 1× transcription buffer and HeLa extract stop solution (Promega, cat. no. E3110) pGEM-T vector (Promega, cat. no. A3600) Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668-019) DMEM (Life Technologies, cat. no. 11995-073) FBS (Life Technologies, cat. no. 16000-044) Penicillin-streptomycin solution (American Type Culture Collection, cat. no. 30-2300) 0.25% (wt/vol) trypsin-EDTA (Life Technologies, cat. no. 25200-056) 10× PBS solution (VWR, cat. no. 97064-158) E.Z.N.A.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 77
    Promega recombinant atp ratp
    RSV increases ph-PKR protein and PKR activity. A , A549 cells were exposed to RSV (m.o.i. 2) for the indicated periods of time. Whole cell lysates were obtained, and Western blot was performed for ph-PKR protein at two sites of autophosphorylation, Thr-451 and Thr-446. Densitometry shows relative amounts of protein. Western blots shown are representative of three experiments. B , A549 cells were exposed to control media for 24 h, RSV (m.o.i. 2) for 24 h, or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were harvested, and PKR protein was immunoprecipitated and then incubated with luminescent <t>ATP.</t> Depletion of luminescent <t>rATP</t> in media indicates PKR autophosphorylation. Data shown are a composite of three experiments ( n = 3). Statistical significance is demonstrated using analysis of variance to compare values between the three groups. A549 cells were again exposed to control media, RSV (m.o.i. 2), or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were obtained, and PKR protein was immunoprecipitated. PKR protein was incubated with [32 P]ATP to measure PKR autophosphorylation, and the products were run on a gel. Autoradiography shows that both RSV and poly(I-C) transfection result in PKR activation. Densitometry shows relative amounts of protein. Western blot ( WB ) confirms the presence of PKR protein on the membrane. Asterisk corresponds to the statistical significance p < 0.0001 noted at the bottom of the figure.
    Recombinant Atp Ratp, supplied by Promega, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant atp ratp/product/Promega
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    recombinant atp ratp - by Bioz Stars, 2019-12
    77/100 stars
      Buy from Supplier

    Image Search Results


    RSV increases ph-PKR protein and PKR activity. A , A549 cells were exposed to RSV (m.o.i. 2) for the indicated periods of time. Whole cell lysates were obtained, and Western blot was performed for ph-PKR protein at two sites of autophosphorylation, Thr-451 and Thr-446. Densitometry shows relative amounts of protein. Western blots shown are representative of three experiments. B , A549 cells were exposed to control media for 24 h, RSV (m.o.i. 2) for 24 h, or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were harvested, and PKR protein was immunoprecipitated and then incubated with luminescent ATP. Depletion of luminescent rATP in media indicates PKR autophosphorylation. Data shown are a composite of three experiments ( n = 3). Statistical significance is demonstrated using analysis of variance to compare values between the three groups. A549 cells were again exposed to control media, RSV (m.o.i. 2), or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were obtained, and PKR protein was immunoprecipitated. PKR protein was incubated with [32 P]ATP to measure PKR autophosphorylation, and the products were run on a gel. Autoradiography shows that both RSV and poly(I-C) transfection result in PKR activation. Densitometry shows relative amounts of protein. Western blot ( WB ) confirms the presence of PKR protein on the membrane. Asterisk corresponds to the statistical significance p < 0.0001 noted at the bottom of the figure.

    Journal:

    Article Title: Respiratory Syncytial Virus Limits ? Subunit of Eukaryotic Translation Initiation Factor 2 (eIF2?) Phosphorylation to Maintain Translation and Viral Replication

    doi: 10.1074/jbc.M109.077321

    Figure Lengend Snippet: RSV increases ph-PKR protein and PKR activity. A , A549 cells were exposed to RSV (m.o.i. 2) for the indicated periods of time. Whole cell lysates were obtained, and Western blot was performed for ph-PKR protein at two sites of autophosphorylation, Thr-451 and Thr-446. Densitometry shows relative amounts of protein. Western blots shown are representative of three experiments. B , A549 cells were exposed to control media for 24 h, RSV (m.o.i. 2) for 24 h, or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were harvested, and PKR protein was immunoprecipitated and then incubated with luminescent ATP. Depletion of luminescent rATP in media indicates PKR autophosphorylation. Data shown are a composite of three experiments ( n = 3). Statistical significance is demonstrated using analysis of variance to compare values between the three groups. A549 cells were again exposed to control media, RSV (m.o.i. 2), or transfected poly(I-C) (20 μg/ml) for 6 h. Cell lysates were obtained, and PKR protein was immunoprecipitated. PKR protein was incubated with [32 P]ATP to measure PKR autophosphorylation, and the products were run on a gel. Autoradiography shows that both RSV and poly(I-C) transfection result in PKR activation. Densitometry shows relative amounts of protein. Western blot ( WB ) confirms the presence of PKR protein on the membrane. Asterisk corresponds to the statistical significance p < 0.0001 noted at the bottom of the figure.

    Article Snippet: PKR protein was immunoprecipitated as described above, and PKR activity was determined by performing a PKR activity assay using the Kinase-Glo luminescent kinase assay (V6711) and recombinant ATP (rATP) (P1132) from Promega (Madison, WI) according to the manufacturer's instructions.

    Techniques: Activity Assay, Western Blot, Transfection, Immunoprecipitation, Incubation, Autoradiography, Activation Assay