rapid dna ligation kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher rapid dna ligation kit
    Rapid Dna Ligation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rapid dna ligation kit/product/Thermo Fisher
    Average 94 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    rapid dna ligation kit - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    DNA Extraction:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: The genomic DNA isolation kit was purchased from Promega (Madison, WI, USA). .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA).

    Expressing:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. Inactivation of genes was confirmed by QRT-PCR detection of gene expression and Sanger sequencing (Supplementary Fig. ).

    DNA Ligation:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA). .. The DNA oligonucleotides containing a 5mC and/or an 8-oxoG were synthesized by Midland Certified Reagent Company Inc. (Midland, TX, USA).

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: .. The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. For CRISPR-Trp53 and CRISPR-Rb1 experiments three sets of Trp53- sgRNAs (CRISPR-Trp53a: AGTGAAGCCCTCCGAGTGTC, CRISPR-Trp53b: GAAGTCACAGCACATGACGG, CRISPR-Trp53c: AAATTTGTATCCCGAGTATC) and three sets of Rb1- sgRNAs (CRISPR-Rb1a: TGTAGCTCAGTAAAAGTGAA, CRISPR-Rb1b: TTGGGAGAAAGTTTCATCCG, CRISPR-Rb1c: AGAAATCGATACCAGTACCA) were separately inserted into the lentiCRISPR v2 plasmid following manufacture’s recommendation.

    Synthesized:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA). .. The DNA oligonucleotides containing a 5mC and/or an 8-oxoG were synthesized by Midland Certified Reagent Company Inc. (Midland, TX, USA).

    Isolation:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. To analyze the frequency of Cd44 mutations DNA isolated from individual cells infected with CRISPR-Cd44 was extracted using the Nucleospin Tissue XS kit (TakaBio).

    TA Cloning:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: The Dream Taq polymerase master mix and the Original TA Cloning kit were purchased from Invitrogen (Carlsbad, CA, USA). .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA).

    Cell Culture:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: Fetal bovine serum (FBS) and Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose cell culture medium was purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA).

    Sequencing:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA). .. The DNA oligonucleotides containing a 5mC and/or an 8-oxoG were synthesized by Midland Certified Reagent Company Inc. (Midland, TX, USA).

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. Inactivation of genes was confirmed by QRT-PCR detection of gene expression and Sanger sequencing (Supplementary Fig. ).

    Infection:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. To analyze the frequency of Cd44 mutations DNA isolated from individual cells infected with CRISPR-Cd44 was extracted using the Nucleospin Tissue XS kit (TakaBio).

    Quantitative RT-PCR:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. Inactivation of genes was confirmed by QRT-PCR detection of gene expression and Sanger sequencing (Supplementary Fig. ).

    CRISPR:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: Paragraph title: Construction of CRISPR plasmids ... The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s).

    Modification:

    Article Title: Oxidative DNA Damage Modulates DNA Methylation Pattern in Human Breast Cancer 1 (BRCA1) Gene via the Crosstalk between DNA Polymerase β and a de novo DNA Methyltransferase.
    Article Snippet: Fetal bovine serum (FBS) and Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose cell culture medium was purchased from Thermo Fisher Scientific (Waltham, MA, USA). .. The Rapid DNA Ligation kit was purchased from Thermo Scientific (Waltham, MA, USA), and the BigDye kit for sequencing was purchased from Applied Biosystems (Foster City, CA, USA).

    Plasmid Preparation:

    Article Title: Gastric squamous-columnar junction contains a large pool of cancer-prone immature osteopontin responsive Lgr5−CD44+ cells
    Article Snippet: .. The sgRNA dimers were phosphorylated by T4 polynucleotide Kinase (NEB) and ligated into plasmid using Rapid DNA Ligation Kit (Thermo Fischer Scientific; K1423s). .. For CRISPR-Trp53 and CRISPR-Rb1 experiments three sets of Trp53- sgRNAs (CRISPR-Trp53a: AGTGAAGCCCTCCGAGTGTC, CRISPR-Trp53b: GAAGTCACAGCACATGACGG, CRISPR-Trp53c: AAATTTGTATCCCGAGTATC) and three sets of Rb1- sgRNAs (CRISPR-Rb1a: TGTAGCTCAGTAAAAGTGAA, CRISPR-Rb1b: TTGGGAGAAAGTTTCATCCG, CRISPR-Rb1c: AGAAATCGATACCAGTACCA) were separately inserted into the lentiCRISPR v2 plasmid following manufacture’s recommendation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher rapid dna ligation kit
    High fGly conversion yields can be obtained from stably transduced cell lines under high titer cell culture conditions. Stable transduction of <t>DNA</t> encoding <t>FGE,</t> antibody light chain, and antibody heavy chain bearing one (CT only) or two (C H 1 and CT) aldehyde tags was performed with viral retrovector transduction into CHO cells (GPEx® technology). The resulting stable pools were cultured in three types of media +/- supplementation with copper(II) sulfate ( n = 3). Titers ( a ) and fGly conversion ( b ) of CT-tagged antibodies were assessed. Then, the stable pools were cloned by limiting dilution and clone performance was assessed in fed batch cultures ( c and d ; shake flask, n = 5 clones; bioreactor, n = 3 clones single tag, n = 1 clone double tag). The top performing stable single-tagged clonal cell line produced antibody in very high titer (5.2 g/L) with 98 % conversion of Cys to fGly ( c and d ). The specific productivity (75 pg/cell/d) of this top clone demonstrates the capabilities of the GPEx® technology for efficient production of highly converted antibody. The generation of fGly in single- and doubly-tagged antibodies scaled successfully to bioreactors (2 L cultures; c and d ). Error bars indicate standard deviation
    Rapid Dna Ligation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rapid dna ligation kit/product/Thermo Fisher
    Average 99 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    rapid dna ligation kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    High fGly conversion yields can be obtained from stably transduced cell lines under high titer cell culture conditions. Stable transduction of DNA encoding FGE, antibody light chain, and antibody heavy chain bearing one (CT only) or two (C H 1 and CT) aldehyde tags was performed with viral retrovector transduction into CHO cells (GPEx® technology). The resulting stable pools were cultured in three types of media +/- supplementation with copper(II) sulfate ( n = 3). Titers ( a ) and fGly conversion ( b ) of CT-tagged antibodies were assessed. Then, the stable pools were cloned by limiting dilution and clone performance was assessed in fed batch cultures ( c and d ; shake flask, n = 5 clones; bioreactor, n = 3 clones single tag, n = 1 clone double tag). The top performing stable single-tagged clonal cell line produced antibody in very high titer (5.2 g/L) with 98 % conversion of Cys to fGly ( c and d ). The specific productivity (75 pg/cell/d) of this top clone demonstrates the capabilities of the GPEx® technology for efficient production of highly converted antibody. The generation of fGly in single- and doubly-tagged antibodies scaled successfully to bioreactors (2 L cultures; c and d ). Error bars indicate standard deviation

    Journal: BMC Biotechnology

    Article Title: Generating aldehyde-tagged antibodies with high titers and high formylglycine yields by supplementing culture media with copper(II)

    doi: 10.1186/s12896-016-0254-0

    Figure Lengend Snippet: High fGly conversion yields can be obtained from stably transduced cell lines under high titer cell culture conditions. Stable transduction of DNA encoding FGE, antibody light chain, and antibody heavy chain bearing one (CT only) or two (C H 1 and CT) aldehyde tags was performed with viral retrovector transduction into CHO cells (GPEx® technology). The resulting stable pools were cultured in three types of media +/- supplementation with copper(II) sulfate ( n = 3). Titers ( a ) and fGly conversion ( b ) of CT-tagged antibodies were assessed. Then, the stable pools were cloned by limiting dilution and clone performance was assessed in fed batch cultures ( c and d ; shake flask, n = 5 clones; bioreactor, n = 3 clones single tag, n = 1 clone double tag). The top performing stable single-tagged clonal cell line produced antibody in very high titer (5.2 g/L) with 98 % conversion of Cys to fGly ( c and d ). The specific productivity (75 pg/cell/d) of this top clone demonstrates the capabilities of the GPEx® technology for efficient production of highly converted antibody. The generation of fGly in single- and doubly-tagged antibodies scaled successfully to bioreactors (2 L cultures; c and d ). Error bars indicate standard deviation

    Article Snippet: Both the FGE vector and the EF1α PCR product were digested with NruI and NheI and ligated with the Rapid DNA Ligation Kit (Thermo/Life Technologies) to generate WT pEF-FGE-hygro, which was amplified in XL-10 gold cells (Agilent) and purified according to the manufacturer’s instructions.

    Techniques: Stable Transfection, Cell Culture, Transduction, Clone Assay, Produced, Standard Deviation