rapid dna ligation kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Rapid DNA Ligation Kit
    Description:
    Thermo Scientific Rapid DNA Ligation Kit enables fast sticky end or blunt end DNA ligation in only 5 minutes at room temperature The kit contains T4 DNA ligase and a specially formulated 5X rapid ligation buffer optimized for fast and efficient DNA ligation Fast ligation efficiency is equal to that obtained with T4 DNA ligase in a standard 1 hour ligation The ligation reaction mixture can be used directly for bacterial transformation with the TransformAid Bacterial Transformation Kit or with other conventional transformation procedures Highlights• Fast ligation of either sticky or blunt end DNA in only 5 minutes• Convenient reaction mixture can be used directly for bacterial transformationApplications• Routine cloning experiments• Blunt end cloning• Library construction• TA cloningIncludes• T4 DNA Ligase• 5X Rapid Ligation Buffer• Water nuclease free• Detailed ProtocolNotePrior to electroporation it is necessary to inactivate T4 DNA ligase by chloroform extraction or spin column purification e g with Thermo Scientific GeneJET PCR Purification Kit K0701 Related ProductsRapid DNA Ligation Kit
    Catalog Number:
    k1422
    Price:
    None
    Applications:
    Cloning|PCR Cloning|Restriction Enzyme Cloning
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher rapid dna ligation kit
    Identification of the Tol2 construct genomic insertion sites on the T2EC clone #1 . A : Splinkerette PCR products on 1.5% agar gel. 1: <t>Fermentas</t> <t>DNA</t> Ladder Mix; 2: genomic DNA from non-transfected T2EC; 3: pT2.CMV-hKO plasmid; 4: genomic DNA from T2EC clone #1, cotransfected with the pT2.CMV-hKO plasmid and the transposase plasmid, pCAGGS-T2TP (molecular ratio: 5/1). B : Alignment of the splinkerette PCR product with the Gallus gallus genome. The sequence corresponding to the Tol2 construct is shown in bold . C : Localization of the Tol2 construct insertion site into chromosome 4 of the Gallus gallus genome.
    Thermo Scientific Rapid DNA Ligation Kit enables fast sticky end or blunt end DNA ligation in only 5 minutes at room temperature The kit contains T4 DNA ligase and a specially formulated 5X rapid ligation buffer optimized for fast and efficient DNA ligation Fast ligation efficiency is equal to that obtained with T4 DNA ligase in a standard 1 hour ligation The ligation reaction mixture can be used directly for bacterial transformation with the TransformAid Bacterial Transformation Kit or with other conventional transformation procedures Highlights• Fast ligation of either sticky or blunt end DNA in only 5 minutes• Convenient reaction mixture can be used directly for bacterial transformationApplications• Routine cloning experiments• Blunt end cloning• Library construction• TA cloningIncludes• T4 DNA Ligase• 5X Rapid Ligation Buffer• Water nuclease free• Detailed ProtocolNotePrior to electroporation it is necessary to inactivate T4 DNA ligase by chloroform extraction or spin column purification e g with Thermo Scientific GeneJET PCR Purification Kit K0701 Related ProductsRapid DNA Ligation Kit
    https://www.bioz.com/result/rapid dna ligation kit/product/Thermo Fisher
    Average 90 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    rapid dna ligation kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "A combination of transposable elements and magnetic cell sorting provides a very efficient transgenesis system for chicken primary erythroid progenitors"

    Article Title: A combination of transposable elements and magnetic cell sorting provides a very efficient transgenesis system for chicken primary erythroid progenitors

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-9-81

    Identification of the Tol2 construct genomic insertion sites on the T2EC clone #1 . A : Splinkerette PCR products on 1.5% agar gel. 1: Fermentas DNA Ladder Mix; 2: genomic DNA from non-transfected T2EC; 3: pT2.CMV-hKO plasmid; 4: genomic DNA from T2EC clone #1, cotransfected with the pT2.CMV-hKO plasmid and the transposase plasmid, pCAGGS-T2TP (molecular ratio: 5/1). B : Alignment of the splinkerette PCR product with the Gallus gallus genome. The sequence corresponding to the Tol2 construct is shown in bold . C : Localization of the Tol2 construct insertion site into chromosome 4 of the Gallus gallus genome.
    Figure Legend Snippet: Identification of the Tol2 construct genomic insertion sites on the T2EC clone #1 . A : Splinkerette PCR products on 1.5% agar gel. 1: Fermentas DNA Ladder Mix; 2: genomic DNA from non-transfected T2EC; 3: pT2.CMV-hKO plasmid; 4: genomic DNA from T2EC clone #1, cotransfected with the pT2.CMV-hKO plasmid and the transposase plasmid, pCAGGS-T2TP (molecular ratio: 5/1). B : Alignment of the splinkerette PCR product with the Gallus gallus genome. The sequence corresponding to the Tol2 construct is shown in bold . C : Localization of the Tol2 construct insertion site into chromosome 4 of the Gallus gallus genome.

    Techniques Used: Construct, Polymerase Chain Reaction, Transfection, Plasmid Preparation, Sequencing

    2) Product Images from "Generating aldehyde-tagged antibodies with high titers and high formylglycine yields by supplementing culture media with copper(II)"

    Article Title: Generating aldehyde-tagged antibodies with high titers and high formylglycine yields by supplementing culture media with copper(II)

    Journal: BMC Biotechnology

    doi: 10.1186/s12896-016-0254-0

    High fGly conversion yields can be obtained from stably transduced cell lines under high titer cell culture conditions. Stable transduction of DNA encoding FGE, antibody light chain, and antibody heavy chain bearing one (CT only) or two (C H 1 and CT) aldehyde tags was performed with viral retrovector transduction into CHO cells (GPEx® technology). The resulting stable pools were cultured in three types of media +/- supplementation with copper(II) sulfate ( n = 3). Titers ( a ) and fGly conversion ( b ) of CT-tagged antibodies were assessed. Then, the stable pools were cloned by limiting dilution and clone performance was assessed in fed batch cultures ( c and d ; shake flask, n = 5 clones; bioreactor, n = 3 clones single tag, n = 1 clone double tag). The top performing stable single-tagged clonal cell line produced antibody in very high titer (5.2 g/L) with 98 % conversion of Cys to fGly ( c and d ). The specific productivity (75 pg/cell/d) of this top clone demonstrates the capabilities of the GPEx® technology for efficient production of highly converted antibody. The generation of fGly in single- and doubly-tagged antibodies scaled successfully to bioreactors (2 L cultures; c and d ). Error bars indicate standard deviation
    Figure Legend Snippet: High fGly conversion yields can be obtained from stably transduced cell lines under high titer cell culture conditions. Stable transduction of DNA encoding FGE, antibody light chain, and antibody heavy chain bearing one (CT only) or two (C H 1 and CT) aldehyde tags was performed with viral retrovector transduction into CHO cells (GPEx® technology). The resulting stable pools were cultured in three types of media +/- supplementation with copper(II) sulfate ( n = 3). Titers ( a ) and fGly conversion ( b ) of CT-tagged antibodies were assessed. Then, the stable pools were cloned by limiting dilution and clone performance was assessed in fed batch cultures ( c and d ; shake flask, n = 5 clones; bioreactor, n = 3 clones single tag, n = 1 clone double tag). The top performing stable single-tagged clonal cell line produced antibody in very high titer (5.2 g/L) with 98 % conversion of Cys to fGly ( c and d ). The specific productivity (75 pg/cell/d) of this top clone demonstrates the capabilities of the GPEx® technology for efficient production of highly converted antibody. The generation of fGly in single- and doubly-tagged antibodies scaled successfully to bioreactors (2 L cultures; c and d ). Error bars indicate standard deviation

    Techniques Used: Stable Transfection, Cell Culture, Transduction, Clone Assay, Produced, Standard Deviation

    3) Product Images from "FlgM as a Secretion Moiety for the Development of an Inducible Type III Secretion System"

    Article Title: FlgM as a Secretion Moiety for the Development of an Inducible Type III Secretion System

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0059034

    Transcription of the master operon flhDC . ( A ) To verify the transcription of the plasmid-encoded master operon flhDC Reverse Transcriptase PCR Reaction of the isolated RNA was performed. It was assumed that within the overnight culture cells exhibiting flagellar assembly were found and therefore this culture was used as a positive control. Cells before addition of the inducer IPTG were used as reference compared to cells after induction of the plasmid-encoded flhDC . To evaluate genomic DNA contamination the isolated RNA samples were also subjected to subsequent PCR. Plasmid-encoded flhDC was used as a positive control for the PCR reaction. Fermentas 1 KB GeneRuler, ON overnight culture sample, -I whole cell sample without induction of plasmid-encoded flhDC , +I whole cell samples with induction of plasmid-encoded flhDC , RT Reverse Transcriptase Reaction, + plasmid-encoded flhDC ; ( B ) Scheme of the plasmid-encoded master operon under the control of the lacUV5 promoter
    Figure Legend Snippet: Transcription of the master operon flhDC . ( A ) To verify the transcription of the plasmid-encoded master operon flhDC Reverse Transcriptase PCR Reaction of the isolated RNA was performed. It was assumed that within the overnight culture cells exhibiting flagellar assembly were found and therefore this culture was used as a positive control. Cells before addition of the inducer IPTG were used as reference compared to cells after induction of the plasmid-encoded flhDC . To evaluate genomic DNA contamination the isolated RNA samples were also subjected to subsequent PCR. Plasmid-encoded flhDC was used as a positive control for the PCR reaction. Fermentas 1 KB GeneRuler, ON overnight culture sample, -I whole cell sample without induction of plasmid-encoded flhDC , +I whole cell samples with induction of plasmid-encoded flhDC , RT Reverse Transcriptase Reaction, + plasmid-encoded flhDC ; ( B ) Scheme of the plasmid-encoded master operon under the control of the lacUV5 promoter

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Isolation, Positive Control

    Related Articles

    Clone Assay:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: E. coli XL‐1‐Blue cells were transformed with the recombinant plasmid, and the resulting clones were tested for the insert after plasmid preparation (GENEJET PL MINIPREP, Thermo Fisher Scientific, Schwerte, Germany) and digestion of the plasmid with BamHI and HindIII. .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific).

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Paragraph title: 2.4. Amplification and Cloning of the cry7Aa2 Gene ... Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas). .. Five µl of ligation product was used for the transformation of E. coli DH5α and positive clones were selected on LB agar plates supplemented with 50 µg ml−1 Ampicillin.

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. GFP-Stx17 was constructed by double-digesting YFP-Stx17 and pEGFP-C1 (Takara Bio Inc.) with XhoI and XbaI, followed by a ligation as above.

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. The procedures resulted in plasmids carrying genes encoding proteins with their native signal sequences cloned under the control of the methanol inducible AOX1 promoter.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: Paragraph title: Design and cloning of Ms sGC constructs ... The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: This redesigned plasmid served as a cloning vector for the production of the N-terminal His6 -tagged version of FliC-xylanase A. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: .. The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas. .. The procedures resulted in genes encoding proteins with their native signal sequences cloned under the control of the methanol-inducible AOX1 promoter.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Amplification:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: After amplification, the PCR product was purified (Nucleospin Gel and PCR Clean‐up, Macherey & Nagel, Düren, Germany) and cloned into a TOPO TA 2.1 vector (Thermo Fisher Scientific, Schwerte, Germany). .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific).

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Paragraph title: 2.4. Amplification and Cloning of the cry7Aa2 Gene ... Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: For construction of a dur31 Δ/Δ::DUR31 -reconstituted strain, the open reading frame of DUR31 as well as 504 base pairs of upstream and 460 base pairs of downstream sequence were amplified from SC5314 genomic DNA with the Phusion High-Fidelity DNA Polymerase Kit (Finnzymes) using the Hind III restriction site containing primers DUR31rec-F1 and DUR31rec-R1 ( ). .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: This was cloned by PCR amplification from the Ms sGC NT13 template using forward primer 5'-gatcggcgtggctagcttctgcaaagcgtttccatggc-3', and reverse primer 5'-gcgagcaaagcagtagacaaggaacgagagaagacctggagccacccacaattcgaaaaatgaaagcttagcctt-3'. .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: This modified ΔD3-FliC gene was amplified using forward primer 5′-ACATCATATGATGGCACAAGTCATTAATACAAACAGCC-3′ and reverse primer 5′-ACATGGATCCTTAACGCAGTAAAGAGAGGACGTTTTG-3′ , and then it was inserted into a pET19b vector (Novagene) using the Nde I and Bam HI sites. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: Previously reported plasmids pNCIIA and pNCIIB ( ) were used as templates for the amplification of cdhIIA and cdhIIB with primers 5NCa-BstBI ( 5′-TATTTCGAAACGATGAGGACCACCTCGGCC-3′ ) and 3NCa-XbaI ( 5′-TATCACGTGCTACACACACTGCCAATACC-3′ ) and primers 5NCb-EcoRI ( 5′-TATGAATTCATGAAGGTCTTCACCCGC-3′ ) and 3NCb-NotI ( 5′-TATGCGGCCGCTCATCTTCTCCATTTTCCC-3′ ), respectively. .. The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: Amplified control clones were digested with 10 units each of BamH I and BspE I for 2 hrs at 37 C, and for amplified cDNA of TLE patients the amount of restriction enzymes was adjusted proportionally to rule out any relaxed enzyme activity. .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany).

    Mass Spectrometry:

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: Paragraph title: Design and cloning of Ms sGC constructs ... The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    DNA Ligation:

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Ligation products were then electroporated into E. coli XL1 blue cells by using standard protocols [ ].

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas). .. Five µl of ligation product was used for the transformation of E. coli DH5α and positive clones were selected on LB agar plates supplemented with 50 µg ml−1 Ampicillin.

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: .. The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas). .. Similarly, the coding sequence for sFRP-1 in pCEP4 was used as a template to obtain the constructs sFRP-1-Fz (deleted residues 171–314) and sFRP-1-ΔNterm (deleted residues 32–52).

    Article Title: Embryonic Stem Cell (ES)-Specific Enhancers Specify the Expression Potential of ES Genes in Cancer
    Article Snippet: .. A pair of phosphorylated oligos targeting the ESSE methylation site were annealed and ligated to the linearized vector with the aid of a Rapid DNA Ligation Kit (Thermo scientific). ..

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. GFP-Stx17 was constructed by double-digesting YFP-Stx17 and pEGFP-C1 (Takara Bio Inc.) with XhoI and XbaI, followed by a ligation as above.

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: .. Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. The procedures resulted in plasmids carrying genes encoding proteins with their native signal sequences cloned under the control of the methanol inducible AOX1 promoter.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. A stop codon was inserted into the CT1 α1 sequence at position 451 using primer 5'-caaggaacgagagaagtaagtcagcctgctgcatttaatattcc-3'.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: .. PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions. .. It was used to transform competent Escherichia coli Tuner cells (Novagen) and subsequently as a template to generate a mutant copy of FARS2 by site-directed mutagenesis using the Quikchange procedure (Stratagene).

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: .. Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Antibodies Antibodies to c-myc epitope produced by C-MYC hybridoma antibodies to 3-flag epitope conjugated to horseradish peroxidase (Sigma, USA) antibodies to M13 phage envelope protein conjugated and nonconjugated to horseradish peroxidase (GE Healthcare, USA).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas). .. The obtained plasmid construct (containing the gene of FliC(XynA)) was transformed into E. coli TOP10 cells (Invitrogen) using the CaCl2 procedure, checked by Xho I and Sac I digestion, and sequenced to confirm the presence of the desired DNA sequence and the correct reading frame.

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: .. The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas. .. The procedures resulted in genes encoding proteins with their native signal sequences cloned under the control of the methanol-inducible AOX1 promoter.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Article Title: An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement in the Escherichia coli DH1 genome
    Article Snippet: .. The Rapid DNA Ligation Kit, DNA polymerase, Gel Extraction Kit, and Plasmid Miniprep Kit were purchased from Thermo Fisher Scientific Inc. (MA, USA), TaKaRa Biotechnology Co. (Dalian, China), or Corning Inc. (Wujiang, China). .. Cell culture E . coli DH5α was grown in tubes containing 5 mL Luria Bertani (LB) medium at 37°C.

    Synthesized:

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas). .. The obtained plasmid construct (containing the gene of FliC(XynA)) was transformed into E. coli TOP10 cells (Invitrogen) using the CaCl2 procedure, checked by Xho I and Sac I digestion, and sequenced to confirm the presence of the desired DNA sequence and the correct reading frame.

    Article Title: An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement in the Escherichia coli DH1 genome
    Article Snippet: Gene I-CreI and I-SceI were artificially synthesized by GENEWIZ Company and cloned into the Kpn I/BamH I site of pUC19 to generate pUCIS and pUCIC. .. The Rapid DNA Ligation Kit, DNA polymerase, Gel Extraction Kit, and Plasmid Miniprep Kit were purchased from Thermo Fisher Scientific Inc. (MA, USA), TaKaRa Biotechnology Co. (Dalian, China), or Corning Inc. (Wujiang, China).

    Construct:

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: In this study, mouse Ago2 was constructed as examples to elaborate this strategy. mAgo2 (NM_153178.4) was submitted to NEBcutter V2.0 ( http://nc2.neb.com/NEBcutter2/ ) for restriction analysis. .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas). .. Similarly, the coding sequence for sFRP-1 in pCEP4 was used as a template to obtain the constructs sFRP-1-Fz (deleted residues 171–314) and sFRP-1-ΔNterm (deleted residues 32–52).

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: YFP-Stx17 was constructed by first performing sequential digestions of Flag-Stx17 with XbaI and then EcoRI (New England Biolabs, Inc.). .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. A stop codon was inserted into the CT1 α1 sequence at position 451 using primer 5'-caaggaacgagagaagtaagtcagcctgctgcatttaatattcc-3'.

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: To minimize the number of extra N-terminal amino acids which may disturb polymerization ability of the expressed protein, the original N-terminal 10 His-tag was shortened to 6-His and the enterokinase cleavage site together with the Nde I site was removed from the construct applying 2-step site directed mutagenesis. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Incubation:

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: In parallel 0.3 µg µl−1 of plasmid CIp10 was digested with Hind III and the restriction enzyme then heat inactivated by incubation at 65°C for 20 min. .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Activity Assay:

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: Amplified control clones were digested with 10 units each of BamH I and BspE I for 2 hrs at 37 C, and for amplified cDNA of TLE patients the amount of restriction enzymes was adjusted proportionally to rule out any relaxed enzyme activity. .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany).

    Expressing:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific). .. Competent bacteria were transformed with the ligation mixture, plated, and then selected for antibiotic resistance.

    Article Title: Embryonic Stem Cell (ES)-Specific Enhancers Specify the Expression Potential of ES Genes in Cancer
    Article Snippet: Plasmid preparation px330 vector [ ] expressing Cas9 and sgRNA was digested with restriction enzyme BbsI and the linearized vector was gel purified. .. A pair of phosphorylated oligos targeting the ESSE methylation site were annealed and ligated to the linearized vector with the aid of a Rapid DNA Ligation Kit (Thermo scientific).

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: .. Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. The procedures resulted in plasmids carrying genes encoding proteins with their native signal sequences cloned under the control of the methanol inducible AOX1 promoter.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. Sequencing with pET-Duet1 primers UP1 (5'-atgcgtccggcgtaga-3') and UP2 (5'-ttgtacacggccgcataatc-3') confirmed appropriate sequence for expression of α1 272–450 and β1 1–380.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: Paragraph title: Expression and purification of human FARS2 ... PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions.

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Protein expression and purification Preparations of purified bovine MBP and recombinant human MOG (30–147 a.a.) were done according to the previously published procedure [ ].

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: Paragraph title: Construction of CDH IIA, CDH IIB, and NCU02916 expression vectors. ... The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas.

    Modification:

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: This modified ΔD3-FliC gene was amplified using forward primer 5′-ACATCATATGATGGCACAAGTCATTAATACAAACAGCC-3′ and reverse primer 5′-ACATGGATCCTTAACGCAGTAAAGAGAGGACGTTTTG-3′ , and then it was inserted into a pET19b vector (Novagene) using the Nde I and Bam HI sites. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Transformation Assay:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: E. coli XL‐1‐Blue cells were transformed with the recombinant plasmid, and the resulting clones were tested for the insert after plasmid preparation (GENEJET PL MINIPREP, Thermo Fisher Scientific, Schwerte, Germany) and digestion of the plasmid with BamHI and HindIII. .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific).

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas). .. Five µl of ligation product was used for the transformation of E. coli DH5α and positive clones were selected on LB agar plates supplemented with 50 µg ml−1 Ampicillin.

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end. .. Ligation product was transformed into Top 10 competent E. coli. and plated onto LB agar plate supplemented with X-gal, IPTG and Ampicillin.

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. The plasmids were linearized with the restriction enzyme Sac I and transformed into electro-competent P. pastoris cells.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: The final construct, pETDuet-NT19, was transformed into pLysS cells. .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas). .. The obtained plasmid construct (containing the gene of FliC(XynA)) was transformed into E. coli TOP10 cells (Invitrogen) using the CaCl2 procedure, checked by Xho I and Sac I digestion, and sequenced to confirm the presence of the desired DNA sequence and the correct reading frame.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Derivative Assay:

    Article Title: An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement in the Escherichia coli DH1 genome
    Article Snippet: Plasmids pKOBEGK, pSNA, pSNK, and pCNA were derived from pKOBEG or pKOBEGA, and plasmid maps of all plasmids containing the λ-Red system or endonuclease gene used in this study are shown in . .. The Rapid DNA Ligation Kit, DNA polymerase, Gel Extraction Kit, and Plasmid Miniprep Kit were purchased from Thermo Fisher Scientific Inc. (MA, USA), TaKaRa Biotechnology Co. (Dalian, China), or Corning Inc. (Wujiang, China).

    Positive Control:

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. The amount of haGlyRs in human hippocampi was expressed as a percentage fraction of the number of true positive cfu obtained from human samples and the number of true positive cfu obtained from the respective positive control clone.

    Southern Blot:

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: Additionally, Southern blot analysis ( ) using a 354 base-pair PCR product, generated with the primers DUR31-F2 and DUR31-R2 ( ) from C. albicans SC5314 genomic DNA, as a probe on HindII-digested genomic DNA was used to confirm deletion of DUR31 /orf19.6656. .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Ligation:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific). .. Competent bacteria were transformed with the ligation mixture, plated, and then selected for antibiotic resistance.

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Ligation products were then electroporated into E. coli XL1 blue cells by using standard protocols [ ]. .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas). .. Five µl of ligation product was used for the transformation of E. coli DH5α and positive clones were selected on LB agar plates supplemented with 50 µg ml−1 Ampicillin.

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. GFP-Stx17 was constructed by double-digesting YFP-Stx17 and pEGFP-C1 (Takara Bio Inc.) with XhoI and XbaI, followed by a ligation as above.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: .. PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions. .. It was used to transform competent Escherichia coli Tuner cells (Novagen) and subsequently as a template to generate a mutant copy of FARS2 by site-directed mutagenesis using the Quikchange procedure (Stratagene).

    Introduce:

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Generated:

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Once pSTABr-cry7Aa 2 was generated, it was introduced into the acrystalliferous Bt strain BMB171. pSTABr empty plasmid was also introduced into BMB171 strain as a negative control.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: Additionally, Southern blot analysis ( ) using a 354 base-pair PCR product, generated with the primers DUR31-F2 and DUR31-R2 ( ) from C. albicans SC5314 genomic DNA, as a probe on HindII-digested genomic DNA was used to confirm deletion of DUR31 /orf19.6656. .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: All mutations and deletions were generated with the QuikChange XL site-directed mutagenesis kit from Stratagene. .. The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas).

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. Flag- and YFP-tagged Stx17Q196R were generated using a QuikChange II site-directed mutagenesis kit (Agilent Technologies) by mutagenizing Stx17WT with the primer pair of 5′-CTCCTAGTGAATTCTCGGCAGGAGAAGATTGAC-3′ and 5′-GTCAATCTTCTCCTGCCGAGAATTCACTAGGAG-3′ according to the manufacturer’s instructions.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: 2.13 Expression and purification of human FARS2 FARS2 amplicons were generated from IMAGE clone 5088776/MGC 31883 (BC021112.1) by standard 35 cycle PCR using a proofreading polymerase (KOD Hot Start Novagen) and the following primers, forward 5′-CACACA GGATCC GCAGAGTGTGCCACCCAAAG-3′ and reverse 5′-CACACA GGATCC AGCCTGAGTGAAGTGGTGAC 3′, incorporating BamH I restriction sites (underlined). .. PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions.

    Sequencing:

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Subsequently, pJET plasmids were verified by sequencing (StabVida, Caparica, Portugal) and digested with the appropriate combination of restriction enzymes to allow cloning into the pSTABr vector. .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: For construction of a dur31 Δ/Δ::DUR31 -reconstituted strain, the open reading frame of DUR31 as well as 504 base pairs of upstream and 460 base pairs of downstream sequence were amplified from SC5314 genomic DNA with the Phusion High-Fidelity DNA Polymerase Kit (Finnzymes) using the Hind III restriction site containing primers DUR31rec-F1 and DUR31rec-R1 ( ). .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: The coding sequence for sizzled- C115S/C159S in pCEP4 was also used as a template to generate individual Fz and NTR domains. .. The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas).

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. GFP-Stx17 was constructed by double-digesting YFP-Stx17 and pEGFP-C1 (Takara Bio Inc.) with XhoI and XbaI, followed by a ligation as above.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: Construct Ms sGC NT19 contains the same α1 and β1 sequence as NT13, but has an additional C-terminal Strep purification tag (WSHPQFEK) on the α subunit. .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas). .. The obtained plasmid construct (containing the gene of FliC(XynA)) was transformed into E. coli TOP10 cells (Invitrogen) using the CaCl2 procedure, checked by Xho I and Sac I digestion, and sequenced to confirm the presence of the desired DNA sequence and the correct reading frame.

    Affinity Purification:

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions. .. Both fusion proteins were expressed following induction with 1 mM IPTG at 37 °C for 4 h and affinity purified using Glutathione Sepharose™ 4B.

    Recombinant:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific). .. Competent bacteria were transformed with the ligation mixture, plated, and then selected for antibiotic resistance.

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Ligation products were then electroporated into E. coli XL1 blue cells by using standard protocols [ ].

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Protein expression and purification Preparations of purified bovine MBP and recombinant human MOG (30–147 a.a.) were done according to the previously published procedure [ ].

    Molecular Weight:

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: .. Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Antibodies Antibodies to c-myc epitope produced by C-MYC hybridoma antibodies to 3-flag epitope conjugated to horseradish peroxidase (Sigma, USA) antibodies to M13 phage envelope protein conjugated and nonconjugated to horseradish peroxidase (GE Healthcare, USA).

    Methylation:

    Article Title: Embryonic Stem Cell (ES)-Specific Enhancers Specify the Expression Potential of ES Genes in Cancer
    Article Snippet: .. A pair of phosphorylated oligos targeting the ESSE methylation site were annealed and ligated to the linearized vector with the aid of a Rapid DNA Ligation Kit (Thermo scientific). ..

    Mutagenesis:

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: All mutations and deletions were generated with the QuikChange XL site-directed mutagenesis kit from Stratagene. .. The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas).

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: Paragraph title: Plasmids, subcloning, and mutagenesis ... Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions. .. It was used to transform competent Escherichia coli Tuner cells (Novagen) and subsequently as a template to generate a mutant copy of FARS2 by site-directed mutagenesis using the Quikchange procedure (Stratagene).

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: To minimize the number of extra N-terminal amino acids which may disturb polymerization ability of the expressed protein, the original N-terminal 10 His-tag was shortened to 6-His and the enterokinase cleavage site together with the Nde I site was removed from the construct applying 2-step site directed mutagenesis. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Subcloning:

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Since the digestion and ligation sub-cloning does not introduce random mutation, and restriction sites were found in the sequence to be cloned, ligation will not break open reading frame (ORF). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: Paragraph title: Plasmids, subcloning, and mutagenesis ... Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing.

    Purification:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: Paragraph title: Bacterial expression and purification of MF‐LOX1 ... After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific).

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Ligation products were then electroporated into E. coli XL1 blue cells by using standard protocols [ ].

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The PCR product was first digested with Hind III and then further purified with the QIAquick PCR Purification Kit (Qiagen). .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end. .. Ligation product was transformed into Top 10 competent E. coli. and plated onto LB agar plate supplemented with X-gal, IPTG and Ampicillin.

    Article Title: Embryonic Stem Cell (ES)-Specific Enhancers Specify the Expression Potential of ES Genes in Cancer
    Article Snippet: Plasmid preparation px330 vector [ ] expressing Cas9 and sgRNA was digested with restriction enzyme BbsI and the linearized vector was gel purified. .. A pair of phosphorylated oligos targeting the ESSE methylation site were annealed and ligated to the linearized vector with the aid of a Rapid DNA Ligation Kit (Thermo scientific).

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing. .. GFP-Stx17 was constructed by double-digesting YFP-Stx17 and pEGFP-C1 (Takara Bio Inc.) with XhoI and XbaI, followed by a ligation as above.

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. C-terminal tags for purification or antibody detection were omitted.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. A stop codon was inserted into the CT1 α1 sequence at position 451 using primer 5'-caaggaacgagagaagtaagtcagcctgctgcatttaatattcc-3'.

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: Paragraph title: Expression and purification of human FARS2 ... PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions.

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Protein expression and purification Preparations of purified bovine MBP and recombinant human MOG (30–147 a.a.) were done according to the previously published procedure [ ].

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas. .. C-terminal tags for purification or antibody detection were omitted.

    Polymerase Chain Reaction:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: After amplification, the PCR product was purified (Nucleospin Gel and PCR Clean‐up, Macherey & Nagel, Düren, Germany) and cloned into a TOPO TA 2.1 vector (Thermo Fisher Scientific, Schwerte, Germany). .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific).

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: PCR products were purified by NucleoSpin® Gel and PCR Clean Up kit (Macherey-Nagel Inc., Bethlehem, PA, USA) and ligated into the pJET plasmid (CloneJET PCR Cloning Kit, Thermo Scientific, Waltham, MA, USA). .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2.

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The PCR product was first digested with Hind III and then further purified with the QIAquick PCR Purification Kit (Qiagen). .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end. .. Ligation product was transformed into Top 10 competent E. coli. and plated onto LB agar plate supplemented with X-gal, IPTG and Ampicillin.

    Article Title: Sizzled Is Unique among Secreted Frizzled-related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein-1 (BMP-1)/Tolloid-like Proteinases *
    Article Snippet: .. The 5′-phosphorylated PCR products were then ligated with T4 DNA ligase (rapid DNA ligation kit, Fermentas). .. Similarly, the coding sequence for sFRP-1 in pCEP4 was used as a template to obtain the constructs sFRP-1-Fz (deleted residues 171–314) and sFRP-1-ΔNterm (deleted residues 32–52).

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: The PCR product was cloned into the p-GEM T Easy vector, removed with restriction endonucleases NheI and HindIII, and subsequently ligated into the pETDuet-NT13 construct using the same restriction enzymes. .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: Mutation of the human mitochondrial phenylalanine-tRNA synthetase causes infantile-onset epilepsy and cytochrome c oxidase deficiency
    Article Snippet: .. PCR products were digested prior to ligation into BamH I linearized pGEX-6P-1, using a Rapid DNA Ligation Kit (Thermo Scientific) according to manufacturer's instructions. .. It was used to transform competent Escherichia coli Tuner cells (Novagen) and subsequently as a template to generate a mutant copy of FARS2 by site-directed mutagenesis using the Quikchange procedure (Stratagene).

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: PCR was performed with Phusion high-fidelity DNA polymerase from New England BioLabs, a deoxynucleoside triphosphate (dNTP) mix from Fermentas, oligonucleotide primers from VBC Biotech (Vienna, Austria), and a C-1000 thermocycler from Bio-Rad Laboratories. .. The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Activated Clotting Time Assay:

    Article Title: Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning
    Article Snippet: Each interrupted fragments were PCR-amplified from N2A cDNA using primers mAgo2F1 ( 5'-ACG GAT CCG CCA CC A TGT ACT CGG GAG CCG GCC CCG TTC -3'), mAgo2R1 (5' - ACT TGC ATA CAC AGG AGT T -3'), mAgo2F2 ( 5'- AGC GCC AGT GTA CAG AAG TC -3') mAgo2R2 (5'-ACG AAT TC A GCA AAG TAC ATG GTG CGC AG -3') by KOD-FX (Cat: KFX-101). .. PCR product was purified (Guangzhou Dongsheng Biotech) and ligated (Fermentas # K1423) to pBlueScript-KSII that had been digested with EcoRV to give blunt end.

    Plasmid Preparation:

    Article Title: Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns. Functional characterization of a novel arachidonic acid 12S‐lipoxygenase in the halotolerant bacterium Myxococcus fulvus exhibiting complex social living patterns
    Article Snippet: .. After preparative digestion of the recombinant plasmid with BamHI and HindIII , the digestion product was ligated (Rapid DNA Ligations‐kit, Thermo Fisher Scientific) into the expression vector pET28b (Thermo Fisher Scientific). .. Competent bacteria were transformed with the ligation mixture, plated, and then selected for antibiotic resistance.

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: .. Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Ligation products were then electroporated into E. coli XL1 blue cells by using standard protocols [ ].

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas). .. Five µl of ligation product was used for the transformation of E. coli DH5α and positive clones were selected on LB agar plates supplemented with 50 µg ml−1 Ampicillin.

    Article Title: Embryonic Stem Cell (ES)-Specific Enhancers Specify the Expression Potential of ES Genes in Cancer
    Article Snippet: .. A pair of phosphorylated oligos targeting the ESSE methylation site were annealed and ligated to the linearized vector with the aid of a Rapid DNA Ligation Kit (Thermo scientific). ..

    Article Title: Syntaxin-17 delivers PINK1/parkin-dependent mitochondrial vesicles to the endolysosomal system
    Article Snippet: YFP-C1 (mVenus-C1, plasmid 27794; Addgene) was cut in the same manner but dephosphorylated using SAP (Affymetrix) before separation on the gel. .. Purified components were ligated using Rapid DNA Ligation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions, and positive clones were identified by sequencing.

    Article Title: Production of four Neurospora crassa lytic polysaccharide monooxygenases in Pichia pastoris monitored by a fluorimetric assay
    Article Snippet: .. Construction of pmo expression vectors for P. pastoris The synthetic pmo genes were digested with the restriction enzymes Bst BI and Xba I and ligated into the equally treated vector pPICZα A using the Rapid DNA Ligation Kit from Fermentas. .. The procedures resulted in plasmids carrying genes encoding proteins with their native signal sequences cloned under the control of the methanol inducible AOX1 promoter.

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. A stop codon was inserted into the CT1 α1 sequence at position 451 using primer 5'-caaggaacgagagaagtaagtcagcctgctgcatttaatattcc-3'.

    Article Title: Construction of a Xylanase A Variant Capable of Polymerization
    Article Snippet: This redesigned plasmid served as a cloning vector for the production of the N-terminal His6 -tagged version of FliC-xylanase A. .. The gene of xylanase A was synthesized by Genscript Corporation (Piscataway, NJ, USA) based on the protein sequence of xylanase A from Bacillus subtilis (UniProt P18429), and it was inserted into the ΔD3-FliC gene between the Xho I and Sac I restriction sites using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Characterization of the Two Neurospora crassa Cellobiose Dehydrogenases and Their Connection to Oxidative Cellulose Degradation
    Article Snippet: .. The resulting cdhIIA cDNA and the NCU02916 gene in the cloning vector were digested with BstBI and XbaI and cloned into the equally treated vector pPICZα A. cDNA from cdhIIB and vector pPICZ B were digested with EcoRI and XbaI and ligated by using the Rapid DNA ligation kit from Fermentas. .. The procedures resulted in genes encoding proteins with their native signal sequences cloned under the control of the methanol-inducible AOX1 promoter.

    Article Title: Glycinergic tonic inhibition of hippocampal neurons with depolarizing GABAergic transmission elicits histopathological signs of temporal lobe epilepsy
    Article Snippet: .. Equimolar amounts of double-digested cloning vector (modified pBluescript SK II vector, into which a BspE I site was introduced) and of samples were ligated using the Rapid DNA Ligation Kit (Fermentas GmbH, St. Leon-Rot, Germany). .. Following transformation of JM109 competent bacteria (Promega, Madison, WI, USA), the number of true positive colony forming units (cfu) was determined by PCR on cfu.

    Article Title: An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement in the Escherichia coli DH1 genome
    Article Snippet: .. The Rapid DNA Ligation Kit, DNA polymerase, Gel Extraction Kit, and Plasmid Miniprep Kit were purchased from Thermo Fisher Scientific Inc. (MA, USA), TaKaRa Biotechnology Co. (Dalian, China), or Corning Inc. (Wujiang, China). .. Cell culture E . coli DH5α was grown in tubes containing 5 mL Luria Bertani (LB) medium at 37°C.

    Negative Control:

    Article Title: A Strain of Bacillus thuringiensis Containing a Novel cry7Aa2 Gene that Is Toxic to Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)
    Article Snippet: Fragments from Nco I and Pst I were purified from agarose gels and ligated into a pre-digested pSTABr vector using the Rapid DNA ligation kit (Thermo Scientific) to obtain the recombinant plasmid pSTABr-cry7Aa2. .. Once pSTABr-cry7Aa 2 was generated, it was introduced into the acrystalliferous Bt strain BMB171. pSTABr empty plasmid was also introduced into BMB171 strain as a negative control.

    Positron Emission Tomography:

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific). .. A stop codon was inserted into the CT1 α1 sequence at position 451 using primer 5'-caaggaacgagagaagtaagtcagcctgctgcatttaatattcc-3'.

    Agarose Gel Electrophoresis:

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: Construct Ms sGC NT21, which lacks the α1 H-NOX domain, was prepared by first excising the α1 subunit from the Ms sGC NT13 pET Duet1 vector with restriction endonucleases BamHI and NotI, purifying on a 1% agarose gel, excising the 6.6 kb gel band, and purifying with a GeneJET Gel Extraction Kit (Fermentas). .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Produced:

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: The other reagents were produced in Russia and were of ultrapure grade. .. Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA).

    Marker:

    Article Title: Polyreactive Monoclonal Autoantibodies in Multiple Sclerosis: Functional Selection from Phage Display Library and Characterization by Deep Sequencing Analysis
    Article Snippet: .. Enzymes Thermostable DNA-dependent DNA polymerase, alkaline phosphatase, Rapid DNA Ligation kit (Fermentas, Lithuania), restriction endonucleases and the corresponding standard buffer solutions (Fermentas, Lithuania), deoxyribonuclease I (Biozyme Laboratories Ltd., USA), trypsin, lysozyme (Merck, Germany) DNA fragment size markers and molecular weight markers: GeneRulerTM 50 bp DNA Ladder GeneRulerTM 1 kb DNA Ladder, Protein Molecular Weight Marker 14.4–116.0 kDa, Prestained Protein Molecular Weight Marker 19.0- 118.0 kDa (Fermentas, Lithuania) low molecular weight marker 2.5–16.9 kDa (Amersham, USA). .. Antibodies Antibodies to c-myc epitope produced by C-MYC hybridoma antibodies to 3-flag epitope conjugated to horseradish peroxidase (Sigma, USA) antibodies to M13 phage envelope protein conjugated and nonconjugated to horseradish peroxidase (GE Healthcare, USA).

    Gel Extraction:

    Article Title: The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
    Article Snippet: The linearized plasmid was dephosphorylated with calf intestinal alkaline phosphatase (New England BioLabs) and gel extracted using the QIAquick Gel Extraction Kit (Qiagen). .. The DUR31 insert and CIp10 vector were then ligated for 30 min at 22°C using the Rapid DNA Ligation Kit (Fermentas).

    Article Title: Molecular Model of a Soluble Guanylyl Cyclase Fragment Determined by Small-Angle X\u2013ray Scattering and Chemical Cross-Linking
    Article Snippet: Construct Ms sGC NT21, which lacks the α1 H-NOX domain, was prepared by first excising the α1 subunit from the Ms sGC NT13 pET Duet1 vector with restriction endonucleases BamHI and NotI, purifying on a 1% agarose gel, excising the 6.6 kb gel band, and purifying with a GeneJET Gel Extraction Kit (Fermentas). .. The α1 subunit residues 272–699 from construct CT1 (unpublished data, footnote 2) was excised with BamHI and NotI, gel purified, and ligated into the pET-Duet1 vector containing NT13 β1 using a Rapid DNA Ligation kit (Thermo Scientific).

    Article Title: An electroporation-free method based on Red recombineering for markerless deletion and genomic replacement in the Escherichia coli DH1 genome
    Article Snippet: .. The Rapid DNA Ligation Kit, DNA polymerase, Gel Extraction Kit, and Plasmid Miniprep Kit were purchased from Thermo Fisher Scientific Inc. (MA, USA), TaKaRa Biotechnology Co. (Dalian, China), or Corning Inc. (Wujiang, China). .. Cell culture E . coli DH5α was grown in tubes containing 5 mL Luria Bertani (LB) medium at 37°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher rapid dna ligation kit
    Rapid Dna Ligation Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rapid dna ligation kit/product/Thermo Fisher
    Average 90 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    rapid dna ligation kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results