nf κb inhibitor pdtc  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Millipore nf κb inhibitor pdtc
    The <t>CCR5/AMPK/p38</t> pathway is involved in CCL3-mediated NF-κB activation. (A): JJ012 cells were pre-treated with CCR5 mAb, Ara A, SB203580, or <t>PDTC</t> followed by stimulation with CCL3 for 120 min and analyses using the chromatin immunoprecipitation assay. Chromatin was immunoprecipitated with anti-p65 antibody. One percentage of the precipitated chromatin was assayed to verify equal loading (input). (B): JJ012 cells were pretreated with Met-RANTES, Ara A, compound C, or SB203580 followed by stimulation with CCL3 for 120 min, and p65 immunofluorescence staining was performed. * P
    Nf κb Inhibitor Pdtc, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 17816 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nf κb inhibitor pdtc/product/Millipore
    Average 89 stars, based on 17816 article reviews
    Price from $9.99 to $1999.99
    nf κb inhibitor pdtc - by Bioz Stars, 2020-08
    89/100 stars

    Images

    1) Product Images from "AMP-activated protein kinase activation mediates CCL3-induced cell migration and matrix metalloproteinase-2 expression in human chondrosarcoma"

    Article Title: AMP-activated protein kinase activation mediates CCL3-induced cell migration and matrix metalloproteinase-2 expression in human chondrosarcoma

    Journal: Cell Communication and Signaling : CCS

    doi: 10.1186/1478-811X-11-68

    The CCR5/AMPK/p38 pathway is involved in CCL3-mediated NF-κB activation. (A): JJ012 cells were pre-treated with CCR5 mAb, Ara A, SB203580, or PDTC followed by stimulation with CCL3 for 120 min and analyses using the chromatin immunoprecipitation assay. Chromatin was immunoprecipitated with anti-p65 antibody. One percentage of the precipitated chromatin was assayed to verify equal loading (input). (B): JJ012 cells were pretreated with Met-RANTES, Ara A, compound C, or SB203580 followed by stimulation with CCL3 for 120 min, and p65 immunofluorescence staining was performed. * P
    Figure Legend Snippet: The CCR5/AMPK/p38 pathway is involved in CCL3-mediated NF-κB activation. (A): JJ012 cells were pre-treated with CCR5 mAb, Ara A, SB203580, or PDTC followed by stimulation with CCL3 for 120 min and analyses using the chromatin immunoprecipitation assay. Chromatin was immunoprecipitated with anti-p65 antibody. One percentage of the precipitated chromatin was assayed to verify equal loading (input). (B): JJ012 cells were pretreated with Met-RANTES, Ara A, compound C, or SB203580 followed by stimulation with CCL3 for 120 min, and p65 immunofluorescence staining was performed. * P

    Techniques Used: Activation Assay, Acetylene Reduction Assay, Chromatin Immunoprecipitation, Immunoprecipitation, Immunofluorescence, Staining

    CCL3 induces cells migration and MMP-2 upregulation through NF-κB. (A-E): Cells were pretreated for 30 min with PDTC (10 μM) and TPCK (3 μM) or transfected with IKKα and IKKβ mutant for 24 h following which they were stimulated with CCL3 (30 ng/ml) for 24 h, and in vitro migration (A B) , invasion (C) , and MMP-2 (D E) expression were measured with the Transwell assay, wound healing assay, qPCR, and western blotting. (F): JJ012 cells were incubated with CCL3 for indicated time intervals, and p-IKK or p-p65 expression was examined by western blotting. (G): Cells were pretreated for 30 min with CCR5 mAb, compound C, or SB203580, and subsequently stimulated with CCL3. The p-p65 expression was measured by western blotting. Results are expressed as the mean ± SE. * P
    Figure Legend Snippet: CCL3 induces cells migration and MMP-2 upregulation through NF-κB. (A-E): Cells were pretreated for 30 min with PDTC (10 μM) and TPCK (3 μM) or transfected with IKKα and IKKβ mutant for 24 h following which they were stimulated with CCL3 (30 ng/ml) for 24 h, and in vitro migration (A B) , invasion (C) , and MMP-2 (D E) expression were measured with the Transwell assay, wound healing assay, qPCR, and western blotting. (F): JJ012 cells were incubated with CCL3 for indicated time intervals, and p-IKK or p-p65 expression was examined by western blotting. (G): Cells were pretreated for 30 min with CCR5 mAb, compound C, or SB203580, and subsequently stimulated with CCL3. The p-p65 expression was measured by western blotting. Results are expressed as the mean ± SE. * P

    Techniques Used: Migration, Transfection, Mutagenesis, In Vitro, Expressing, Transwell Assay, Wound Healing Assay, Real-time Polymerase Chain Reaction, Western Blot, Incubation

    2) Product Images from "Telmisartan directly ameliorates the neuronal inflammatory response to IL-1? partly through the JNK/c-Jun and NADPH oxidase pathways"

    Article Title: Telmisartan directly ameliorates the neuronal inflammatory response to IL-1? partly through the JNK/c-Jun and NADPH oxidase pathways

    Journal: Journal of Neuroinflammation

    doi: 10.1186/1742-2094-9-102

    The nuclear factor-kappa B (NF-κB) pathway is not involved in the neuroprotective effect of telmisartan in SK-N-SH neuroblasts. (A) Telmisartan does not prevent time-dependent IκB-α protein degradation in cells in response to interleukin-1 beta (IL-1β). Cells were pretreated for 2 hours with 10 μmol/l telmisartan (Telm) before exposure to 10 ng/ml IL-1β for the indicated time intervals. IκB-α protein levels were determined in whole-cell extracts, and normalized to β-actin. (B) Neither telmisartan nor diphenyleneiodonium (DPI) modified IL-1β-induced expression of IκB-α mRNA. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 3 hours to 10 ng/ml IL-1β to determine IκB-α mRNA expression. (C) Neither telmisartan nor DPI affected IL-1β-induced nuclear translocation of the NF-κB p65 subunit. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 30 minutes to 10 ng/ml IL-1β. The NF-κB p65 subunit protein was determined in nuclear extracts and normalized to the level of the nuclear protein histone H4. Representative western blots are shown below the corresponding bar graphs. Results are presented as means ± SEM from three independent experiments. # P
    Figure Legend Snippet: The nuclear factor-kappa B (NF-κB) pathway is not involved in the neuroprotective effect of telmisartan in SK-N-SH neuroblasts. (A) Telmisartan does not prevent time-dependent IκB-α protein degradation in cells in response to interleukin-1 beta (IL-1β). Cells were pretreated for 2 hours with 10 μmol/l telmisartan (Telm) before exposure to 10 ng/ml IL-1β for the indicated time intervals. IκB-α protein levels were determined in whole-cell extracts, and normalized to β-actin. (B) Neither telmisartan nor diphenyleneiodonium (DPI) modified IL-1β-induced expression of IκB-α mRNA. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 3 hours to 10 ng/ml IL-1β to determine IκB-α mRNA expression. (C) Neither telmisartan nor DPI affected IL-1β-induced nuclear translocation of the NF-κB p65 subunit. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 30 minutes to 10 ng/ml IL-1β. The NF-κB p65 subunit protein was determined in nuclear extracts and normalized to the level of the nuclear protein histone H4. Representative western blots are shown below the corresponding bar graphs. Results are presented as means ± SEM from three independent experiments. # P

    Techniques Used: Modification, Expressing, Translocation Assay, Western Blot

    3) Product Images from "δ- and γ-Tocopherols Inhibit PhIP/DSS-induced Colon Carcinogenesis by Protection against Early Cellular and DNA Damages"

    Article Title: δ- and γ-Tocopherols Inhibit PhIP/DSS-induced Colon Carcinogenesis by Protection against Early Cellular and DNA Damages

    Journal: Molecular carcinogenesis

    doi: 10.1002/mc.22481

    Dietary δ-T and γ-T reduce 8-oxo-dG and nitrotyrosine in colon mucosa of PhIP-treated mice at the early time points
    Figure Legend Snippet: Dietary δ-T and γ-T reduce 8-oxo-dG and nitrotyrosine in colon mucosa of PhIP-treated mice at the early time points

    Techniques Used: Mouse Assay

    4) Product Images from "Liver X receptor agonist treatment attenuates cardiac dysfunction in type 2 diabetic db/db mice"

    Article Title: Liver X receptor agonist treatment attenuates cardiac dysfunction in type 2 diabetic db/db mice

    Journal: Cardiovascular Diabetology

    doi: 10.1186/s12933-014-0149-0

    GW3965 attenuated diabetes-induced myocardial oxidative/nitrative stress. a - c . GW3965 attenuated oxidative stress in the myocardial tissues. a . Myocardial oxidative stress was measured by confocal microscopy with in situ dihydroethidium stain (n =5-6, scale bar 25 μm). b . NADPH oxidase activity was determined by lucigenin-enhanced chemiluminescence (n =6-11). c . NADPH oxidase gp 91phox gene expression was determined by real-time PCR (n =6). Results were normalized against GAPDH and converted to fold induction relative to db /+ mice. d - f . GW3965 attenuated nitrative stress in the myocardial tissues. d . Myocardial nitrative stress was assessed via nitrotyrosine levels determined by immunohistochemistry (n =5-6, scale bar 25 μm). e . Myocardial nitrotyrosine content was determined by ELISA analysis (n =6-11). f . iNOS gene expression was determined by real-time PCR (n =6). Results were normalized against GAPDH and converted to fold induction relative to db /+ mice. * P
    Figure Legend Snippet: GW3965 attenuated diabetes-induced myocardial oxidative/nitrative stress. a - c . GW3965 attenuated oxidative stress in the myocardial tissues. a . Myocardial oxidative stress was measured by confocal microscopy with in situ dihydroethidium stain (n =5-6, scale bar 25 μm). b . NADPH oxidase activity was determined by lucigenin-enhanced chemiluminescence (n =6-11). c . NADPH oxidase gp 91phox gene expression was determined by real-time PCR (n =6). Results were normalized against GAPDH and converted to fold induction relative to db /+ mice. d - f . GW3965 attenuated nitrative stress in the myocardial tissues. d . Myocardial nitrative stress was assessed via nitrotyrosine levels determined by immunohistochemistry (n =5-6, scale bar 25 μm). e . Myocardial nitrotyrosine content was determined by ELISA analysis (n =6-11). f . iNOS gene expression was determined by real-time PCR (n =6). Results were normalized against GAPDH and converted to fold induction relative to db /+ mice. * P

    Techniques Used: Confocal Microscopy, In Situ, Staining, Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Mouse Assay, Immunohistochemistry, Enzyme-linked Immunosorbent Assay

    5) Product Images from "Ethyl pyruvate significantly inhibits tumour necrosis factor-?, interleukin-1? and high mobility group box 1 releasing and attenuates sodium taurocholate-induced severe acute pancreatitis associated with acute lung injury"

    Article Title: Ethyl pyruvate significantly inhibits tumour necrosis factor-?, interleukin-1? and high mobility group box 1 releasing and attenuates sodium taurocholate-induced severe acute pancreatitis associated with acute lung injury

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/cei.12062

    Effect of ethyl pyruvate (EP) on the increase in specific binding of p50 and p65 to DNA in the lung. (a) Changes of p50/p65 DNA binding activity in the lung after induction of severe acute pancreatitis (SAP)at the corresponding time-points. (b) Rats undergoing
    Figure Legend Snippet: Effect of ethyl pyruvate (EP) on the increase in specific binding of p50 and p65 to DNA in the lung. (a) Changes of p50/p65 DNA binding activity in the lung after induction of severe acute pancreatitis (SAP)at the corresponding time-points. (b) Rats undergoing

    Techniques Used: Binding Assay, Activity Assay

    6) Product Images from "Anti-allergic Inflammatory Effects of the Essential Oil From Fruits of Zanthoxylum coreanum Nakai"

    Article Title: Anti-allergic Inflammatory Effects of the Essential Oil From Fruits of Zanthoxylum coreanum Nakai

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.01441

    Effect of ZCO on the production of inflammatory mediators in LPS-activated RAW264.7 cells. RAW264.7 cells seeded into 48-well plate were pretreated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to addition of LPS (500 ng/mL) for 24 h. TNF-α (A) and IL-6 (B) in the supernatants was measured by ELISA and NO production (C) in the supernatants was detected by Griess reagent. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P
    Figure Legend Snippet: Effect of ZCO on the production of inflammatory mediators in LPS-activated RAW264.7 cells. RAW264.7 cells seeded into 48-well plate were pretreated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to addition of LPS (500 ng/mL) for 24 h. TNF-α (A) and IL-6 (B) in the supernatants was measured by ELISA and NO production (C) in the supernatants was detected by Griess reagent. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P

    Techniques Used: Enzyme-linked Immunosorbent Assay

    Effect of ZCO on NF-κB transcription and translocation. (A) Effect of ZCO on PMA-induced NF-κB activation in 293T cells. 293T cells seeded into poly-D-lysine hydrobromide coated 96-well plate were transfected with a reporter plasmid, pNF-κB-SEAP for 4 h. Cells were treated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to stimulation with 3 ng/mL of PMA for 24 h. The supernatants were collected for NF-κB activity assay. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P
    Figure Legend Snippet: Effect of ZCO on NF-κB transcription and translocation. (A) Effect of ZCO on PMA-induced NF-κB activation in 293T cells. 293T cells seeded into poly-D-lysine hydrobromide coated 96-well plate were transfected with a reporter plasmid, pNF-κB-SEAP for 4 h. Cells were treated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to stimulation with 3 ng/mL of PMA for 24 h. The supernatants were collected for NF-κB activity assay. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P

    Techniques Used: Translocation Assay, Activation Assay, Transfection, Plasmid Preparation, Activity Assay

    Effect of ZCO on MAPKs in LPS-activated RAW264.7 cells. RAW264.7 cells cultured into 6-well plate were pretreated with ZCO (0.01 and 0.005%) or Bay11-7082 (10 μM) for 4 h, and then stimulated with LPS (1 μg/mL) for 30 min. Cell lysates (50 μg) were used for Western blotting of the target proteins. Phosphorylated MAPKs were detected by using anti-phospho-JNK, anti-phospho-ERK or anti-phospho-p38 antibody. The membrane was stripped and reassessed with the antibodies targeting non-phosphorylated MAPKs.
    Figure Legend Snippet: Effect of ZCO on MAPKs in LPS-activated RAW264.7 cells. RAW264.7 cells cultured into 6-well plate were pretreated with ZCO (0.01 and 0.005%) or Bay11-7082 (10 μM) for 4 h, and then stimulated with LPS (1 μg/mL) for 30 min. Cell lysates (50 μg) were used for Western blotting of the target proteins. Phosphorylated MAPKs were detected by using anti-phospho-JNK, anti-phospho-ERK or anti-phospho-p38 antibody. The membrane was stripped and reassessed with the antibodies targeting non-phosphorylated MAPKs.

    Techniques Used: Cell Culture, Western Blot

    7) Product Images from "Anti-allergic Inflammatory Effects of the Essential Oil From Fruits of Zanthoxylum coreanum Nakai"

    Article Title: Anti-allergic Inflammatory Effects of the Essential Oil From Fruits of Zanthoxylum coreanum Nakai

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.01441

    Effect of ZCO on the production of inflammatory mediators in LPS-activated RAW264.7 cells. RAW264.7 cells seeded into 48-well plate were pretreated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to addition of LPS (500 ng/mL) for 24 h. TNF-α (A) and IL-6 (B) in the supernatants was measured by ELISA and NO production (C) in the supernatants was detected by Griess reagent. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P
    Figure Legend Snippet: Effect of ZCO on the production of inflammatory mediators in LPS-activated RAW264.7 cells. RAW264.7 cells seeded into 48-well plate were pretreated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to addition of LPS (500 ng/mL) for 24 h. TNF-α (A) and IL-6 (B) in the supernatants was measured by ELISA and NO production (C) in the supernatants was detected by Griess reagent. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P

    Techniques Used: Enzyme-linked Immunosorbent Assay

    Effect of ZCO on NF-κB transcription and translocation. (A) Effect of ZCO on PMA-induced NF-κB activation in 293T cells. 293T cells seeded into poly-D-lysine hydrobromide coated 96-well plate were transfected with a reporter plasmid, pNF-κB-SEAP for 4 h. Cells were treated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to stimulation with 3 ng/mL of PMA for 24 h. The supernatants were collected for NF-κB activity assay. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P
    Figure Legend Snippet: Effect of ZCO on NF-κB transcription and translocation. (A) Effect of ZCO on PMA-induced NF-κB activation in 293T cells. 293T cells seeded into poly-D-lysine hydrobromide coated 96-well plate were transfected with a reporter plasmid, pNF-κB-SEAP for 4 h. Cells were treated with ZCO (0.0025, 0.005, and 0.01%) or Bay11-7082 (20 μM) for 2 h prior to stimulation with 3 ng/mL of PMA for 24 h. The supernatants were collected for NF-κB activity assay. Experiments were conducted in quadruplicate and expressed as mean ± SEM ( ∗∗∗ P

    Techniques Used: Translocation Assay, Activation Assay, Transfection, Plasmid Preparation, Activity Assay

    Effect of ZCO on MAPKs in LPS-activated RAW264.7 cells. RAW264.7 cells cultured into 6-well plate were pretreated with ZCO (0.01 and 0.005%) or Bay11-7082 (10 μM) for 4 h, and then stimulated with LPS (1 μg/mL) for 30 min. Cell lysates (50 μg) were used for Western blotting of the target proteins. Phosphorylated MAPKs were detected by using anti-phospho-JNK, anti-phospho-ERK or anti-phospho-p38 antibody. The membrane was stripped and reassessed with the antibodies targeting non-phosphorylated MAPKs.
    Figure Legend Snippet: Effect of ZCO on MAPKs in LPS-activated RAW264.7 cells. RAW264.7 cells cultured into 6-well plate were pretreated with ZCO (0.01 and 0.005%) or Bay11-7082 (10 μM) for 4 h, and then stimulated with LPS (1 μg/mL) for 30 min. Cell lysates (50 μg) were used for Western blotting of the target proteins. Phosphorylated MAPKs were detected by using anti-phospho-JNK, anti-phospho-ERK or anti-phospho-p38 antibody. The membrane was stripped and reassessed with the antibodies targeting non-phosphorylated MAPKs.

    Techniques Used: Cell Culture, Western Blot

    Related Articles

    Immunohistochemistry:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat#:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Immunostaining:

    Article Title: H2A.Z.1 crosstalk with H3K56-acetylation controls gliogenesis through the transcription of folate receptor
    Article Snippet: .. Immunostaining was performed with the following primary antibodies: H2A.Z.1 (Active-Motif, # 39943, Rabbit, 1:2000), GFAP (Sigma, G6171, Mouse, 1:10 000; Dako, Z033429, Rabbit, 1:3000), Acsbg1 (Abcam, ab 118154, Mouse, 1:1000), Aldh1l1 (Abcam, ab56777, Rabbit, 1:500), GLAST (Proteintech, 20785-1-AP, Rabbit, 1:1000), BLBP (Proteintech, 14836-1-AP, Rabbit, 1:000), S100β (Proteintech, 15146-1-AP, Rabbit, 1:500), Pax6 (Abcam, ab5790, Rabbit, 1:000), Sox2 (R & D,MAB2018, Mouse, 1:1000), BrdU (Abcam, ab6326, Rat, 1:1000), TUJ1 (Millipore, MAB1637, Rabbit, 1:2000), STAT3 (Cell Signaling Technology, 4904P, Mouse, 1:2000), phospho-STAT3 (Tyr705) (Cell Signaling Technology, 9145S, Rabbit, 1:500), β-Actin (Proteintech, 20536-1-AP, Rabbit, 1:5000), Flag (Sigma, F7425, Mouse, 1:2000), H2A (Proteintech, 10445-1-AP, Rabbit, 1:000), H3 (Cell Signaling Technology, 4499, Rabbit, 1:2000), H3K56ac (Abcam, ab76307, Rabbit, 1:2000), H3K9ac (Millipore, 07-352, Rabbit, 1:2000), H3K27ac (Millipore, 07-360, Rabbit, 1:2000), H3K4me3 (Millipore, 07-473, Rabbit, 1:2000), Tri-Methyl-Histone H3 (Lys36) (Cell Signaling Technology, # 9763, Rabbit, 1:2000), FOLR1 (Bioworld Technology, BS3861, Rabbit, 1:500). .. E16.5 NPCs were isolated from pregnant ICR mice cortex.

    Incubation:

    Article Title: Altered expression pattern of integrin alphavbeta3 correlates with actin cytoskeleton in primary cultures of human breast cancer
    Article Snippet: .. The parts of the membranes containing proteins from 75 to 175 kDa were incubated overnight at 4°C with primary antibody rabbit anti-human integrin beta3 (1:2,000) (AB1932, Chemicon) and the parts of the membranes containing proteins from 20 to 75 kDa were incubated overnight at 4°C with the mouse anti-human actin antibody (1:2,000) (MAB1501, Chemicon). ..

    Article Title: Layer 4 Pyramidal Neurons Exhibit Robust Dendritic Spine Plasticity In Vivo after Input Deprivation
    Article Snippet: .. Briefly, sections (30–40 μm) were blocked in PBS containing 5% Goat serum (Thermo Fisher Scientific PCN5000) and 0.1% Triton X-100 (Sigma-Aldrich), and then incubated with primary antibodies overnight at RT at the following dilutions: chicken anti-GFP (1:500, Millipore Bioscience Research Reagents AB16901), guinea pig anti-VGlut2 (1:2000, Millipore Bioscience Research Reagents, AB2251), rabbit anti-Cux1 (1:500, Santa-Cruz Biotechnology, sc-13024), rat anti-Ctip2 (1:750, Abcam AB18465), and rabbit anti-GABA (1:500, Sigma-Aldrich A2052). .. For secondary antibodies, we used donkey anti-chicken-FITC (Jackson Laboratories), AlexaFluor 568 donkey anti-rabbit, AlexaFluor 568 goat anti-guinea pig, and Cy5-goat anti-rat (all from Life Technologies).

    other:

    Article Title: An Anti-Parkinson’s Disease Drug via Targeting Adenosine A2A Receptor Enhances Amyloid-β Generation and γ-Secretase Activity
    Article Snippet: Antibodies Anti-PS1-N-terminus (1–65) (PRB-354P, 1:1,000, Covance, Davis, CA, USA); Anti-PS1-N-terminus (MAB1563, 1:100, EMD Millipore, Darmstadt, Germany); anti-PS1 loop (263–407) (529592, 1:2,000, Calbiochem); anti-APH1aL/C terminal (245–265) (PRB-550P, 1:1,000, Covance); anti-NCT (N1660, 1:1,000, Sigma), Anti-Pen2 (P5622, 1:1,000, Sigma); anti-BACE1 (AP7774b, 1:1,000, Abgent, Suzhou, China); anti-HA (H6908, 1:5,000, Sigma); anti-Flag (F3156, 1:2,000, Sigma); anti-A2A R (05–717, 1:1,1000, Millipore); anti-EEA1 (610457, dilution 1:200, BD transduction laboratories).

    Marker:

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Western Blot:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat#:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Reciprocal control of excitatory synapse numbers by Wnt and Wnt inhibitor PRR7 secreted on exosomes
    Article Snippet: .. Antibodies, reagents, and inhibitors Primary antibodies and their dilution factors used for IC, immunohistochemistry (IHC), and western blotting (W) are: Akt (CST, Cat#: 4691, 1:1000 W), phospho-Akt (CST, Cat#: 13038, 1:1000 W), Alix1 (BD, Cat#: 611620, 1:1000 W), β-Gal (Promega, Cat:Z378A,1:1000 IC), active β-catenin (Millipore, Cat#: 05-665, 1:500 W), α-CaMKII (ThermoFisher Scientific, Cat#: 13-7300, 1:1000 W), β-CaMKII (ThermoFisher Scientific, Cat#: 13-9800, 1:1000 W), phospho-CaMKII (Phospho Solutions, Cat#: p1005-286, 1:1000 W), cleaved caspase-3 (CST, Cat#: 9661, 1:1000 W, 1:400 IC), EEA1 (BD, Cat#: 610456, 1:250 IC), Flotillin-1 (BD, Cat#: 610820, 1:2000 W), GABAA Rα2 (Synaptic Systems, Cat#: 224102, 1:250 IC; 1:1000 W), GABAA Rγ2 (Synaptic systems, Cat#: 224003, 1:250 IC; 1:1000 W), GAPDH (CST, Cat#: 2118, 1:1000 W), gephyrin (Synaptic Systems, Cat#: 147111, 1:1000 W), GFAP (Millipore, Cat#: AB5804, 1:1000 IC), GFP (Abcam, Cat#: ab290, 1:10,000 IC; 1:5000 W), GluR2/3 (Millipore, Cat#: AB1506, 1:1000 W), GSK3β (CST, Cat#: 9832, 1:1000 W), phospho-GSK3β, S9 (CST, Cat#: 5558, 1:1000 W), phospho-GSK3, Y279/Y216 (Millipore, Cat#: 05-413, 1:1000 W), rat-HA (Roche, Cat#: 11867423001, 1:200 IC), rabbit-HA (CST, Cat#: 3724, 1:200 IC), Lamp2 (ThermoFisher Scientific, Cat#: 51-2200, 1:500 W; 1:400 IC), mouse-myc (Santa Cruz, Cat#: sc-40, 1:100 IC), rabbit-myc (CST, Cat#: 3724, 1:200 IC), NeuN (Millipore, Cat#: MAB377, 1:75 IC), NSF (Millipore, Cat#: NB21, 1:2000 W), PRR7 (Abnova, Cat#: MAB6689, 1:150 IC; 1:1000 W), PSD-95 (NeuroMab, Cat#: 75-028, 1:400 IC; 1:5000 W), pan-MAGUK (NeuroMab, Cat#: 73-029, 1:400 IC; 1:1000 W), pan-SAPAP (NeuroMab, Cat#: 75-156, 1:500 IC; 1:1,000 W), pan-Shank (NeuroMab, Cat#: 75-089, 1:1000 W), SVP-38 (Sigma, Cat#: S-5768, 1:400 IC), Rab9 (Millipore, Cat#: 552101, 1:500 IC), K48-specific ubiquitin (Millipore, Cat#: 05-1307, 1:1000 W), mouse-vGLUT1 (Millipore, Cat#: MAB5502, 1:1000 W), guinea pig vGLUT (Synaptic Systems, Cat#: AB5905, 1:1000 IC and IHC), vGAT (Synaptic Systems, Cat#: 131,011, 1:400 IC and IHC; 1:1000 W), Wnt5a (Abcam, Cat#: ab72583, 1:250 W), and Wnt7a (R & D Systems, Cat#: AF3008, 1:250 W). .. Soluble forms of Wnt5a, Wnt7a, sFRP-1, and sFz5c-Fc were obtained from R & D Systems and used at the final concentrations of 100 ng ml−1 for Wnts and 1 μg ml−1 for sFRP-1 and sFz5c-Fc.

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Binding Assay:

    Article Title: The rod signaling pathway in marsupial retinae
    Article Snippet: .. As a marker for AII cells, we used a goat antiserum against calretinin (dilution 1:2000; AB1550, EMD Millipore) [ – ], and as a marker for synaptic ribbons, we used a mouse antibody against C-terminal binding protein 2 (CtBP2; dilution 1:5000; Cat.-No. 612044, BD Biosciences, Heidelberg, Germany) [ ]. .. Secondary fluorophore-conjugated antibodies were used to detect primary antibodies by indirect immunofluorescence.

    Chromatin Immunoprecipitation:

    Article Title: MYC dephosphorylation by the PP1/PNUTS phosphatase complex regulates chromatin binding and protein stability
    Article Snippet: .. Antibodies, primers, and siRNAs Antibodies for MYC pT58 (04-217, Millipore, used at 1:2000), MYC p62 (ab78318, abcam, used at 1:1000), MAX for ChIP (sc-765, Santa Cruz, 10 µg used for ChIP), PP1α isoform (438100, Invitrogen, used at 1:2000), PP1β isoform (ab53315, abcam, used at 1:1000), PP1γ isoform (A300-906A, Bethyl laboratories, used at 1:5000), biotin anti-mouse SV40 large T and small T antigen (554151, BD Biosciences, used at 1:1000), PNUTS for immunoblotting (A300-439A, Bethyl Laboratories, used at 1:15,000 to 1:20,000), MYC for ChIP (homemade N262, 2 µg used for ChIP, 4 µg used for re-ChIP), PNUTS for ChIP (A300-440A, Bethyl Laboratories, 4 µg for ChIP, 10 µg for re-ChIP), Actin (A2066, Sigma, used at 1:10000), Anti-mouse HRP (NA931V, GE healthcare, used at 1:10,000), Anti-tubulin (DM1A, Calbiochem, used at 1:2000), Anti-laminB1 (ab16048, Abcam, used at 1:1000) and Anti-rabbit HRP (NA934V, Sigma, used at 1:10,000). .. The qPCR primers for PP1α isoform (fwd GTTCCTCCACAAGCACGACT, rev GTTCCTCCACAAGCACGACT), PP1β isoform (fwd GAAGATCTTCTGTTGTCATG, rev GCACATCCTTATCTGGATCAGAC), PP1γ isoform (fwd ACTAGAACTTGAAGCACCACT, rev CGCAGCAAATCATAGTATTGTCC), and RPLPO (fwd CAGATTGGCTACCCAACTGTT, rev GGGAAGGTGTAATCCGTCTCC).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore rabbit polyclonal anti nuclear factor kappa b nf κb p65 antibody
    The nuclear factor-kappa B (NF-κB) pathway is not involved in the neuroprotective effect of telmisartan in SK-N-SH neuroblasts. (A) Telmisartan does not prevent time-dependent IκB-α protein degradation in cells in response to interleukin-1 beta (IL-1β). Cells were pretreated for 2 hours with 10 μmol/l telmisartan (Telm) before exposure to 10 ng/ml IL-1β for the indicated time intervals. IκB-α protein levels were determined in whole-cell extracts, and normalized to β-actin. (B) Neither telmisartan nor diphenyleneiodonium (DPI) modified IL-1β-induced expression of IκB-α mRNA. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 3 hours to 10 ng/ml IL-1β to determine IκB-α mRNA expression. (C) Neither telmisartan nor DPI affected IL-1β-induced nuclear translocation of the NF-κB <t>p65</t> subunit. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 30 minutes to 10 ng/ml IL-1β. The NF-κB p65 subunit protein was determined in nuclear extracts and normalized to the level of the nuclear protein histone H4. Representative western blots are shown below the corresponding bar graphs. Results are presented as means ± SEM from three independent experiments. # P
    Rabbit Polyclonal Anti Nuclear Factor Kappa B Nf κb P65 Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit polyclonal anti nuclear factor kappa b nf κb p65 antibody/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    rabbit polyclonal anti nuclear factor kappa b nf κb p65 antibody - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    The nuclear factor-kappa B (NF-κB) pathway is not involved in the neuroprotective effect of telmisartan in SK-N-SH neuroblasts. (A) Telmisartan does not prevent time-dependent IκB-α protein degradation in cells in response to interleukin-1 beta (IL-1β). Cells were pretreated for 2 hours with 10 μmol/l telmisartan (Telm) before exposure to 10 ng/ml IL-1β for the indicated time intervals. IκB-α protein levels were determined in whole-cell extracts, and normalized to β-actin. (B) Neither telmisartan nor diphenyleneiodonium (DPI) modified IL-1β-induced expression of IκB-α mRNA. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 3 hours to 10 ng/ml IL-1β to determine IκB-α mRNA expression. (C) Neither telmisartan nor DPI affected IL-1β-induced nuclear translocation of the NF-κB p65 subunit. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 30 minutes to 10 ng/ml IL-1β. The NF-κB p65 subunit protein was determined in nuclear extracts and normalized to the level of the nuclear protein histone H4. Representative western blots are shown below the corresponding bar graphs. Results are presented as means ± SEM from three independent experiments. # P

    Journal: Journal of Neuroinflammation

    Article Title: Telmisartan directly ameliorates the neuronal inflammatory response to IL-1? partly through the JNK/c-Jun and NADPH oxidase pathways

    doi: 10.1186/1742-2094-9-102

    Figure Lengend Snippet: The nuclear factor-kappa B (NF-κB) pathway is not involved in the neuroprotective effect of telmisartan in SK-N-SH neuroblasts. (A) Telmisartan does not prevent time-dependent IκB-α protein degradation in cells in response to interleukin-1 beta (IL-1β). Cells were pretreated for 2 hours with 10 μmol/l telmisartan (Telm) before exposure to 10 ng/ml IL-1β for the indicated time intervals. IκB-α protein levels were determined in whole-cell extracts, and normalized to β-actin. (B) Neither telmisartan nor diphenyleneiodonium (DPI) modified IL-1β-induced expression of IκB-α mRNA. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 3 hours to 10 ng/ml IL-1β to determine IκB-α mRNA expression. (C) Neither telmisartan nor DPI affected IL-1β-induced nuclear translocation of the NF-κB p65 subunit. The cells were pretreated for 2 hours with 10 μmol/l Telm or 5 μmol/l DPI before exposure for 30 minutes to 10 ng/ml IL-1β. The NF-κB p65 subunit protein was determined in nuclear extracts and normalized to the level of the nuclear protein histone H4. Representative western blots are shown below the corresponding bar graphs. Results are presented as means ± SEM from three independent experiments. # P

    Article Snippet: Primary antibodies used for western blot analysis were: rabbit polyclonal anti-nuclear factor-kappa B (NF-κB)-p65 antibody (1:2000, Millipore, Billerica, MA, USA); mouse polyclonal anti-cyclooxygenase-2 (COX-2) (1:1000, Cayman Chemical, Ann Arbor, MI, USA); rabbit anti-phospho-p38 mitogen-activated protein kinase (MAPK) (1:1000), rabbit anti-phospho-extracellular signal-regulated kinases (ERK)1/2 (1:1000), rabbit anti-phospho-JNK (1:1000), rabbit anti-phospho-c-Jun (1:1000), rabbit anti-IκB-α (1:1000), rabbit anti-β-actin (1:1000), and rabbit anti-histone H4 (1:1000), all from Cell Signaling Technology (Danvers, MA, USA).

    Techniques: Modification, Expressing, Translocation Assay, Western Blot