Structured Review

Cell Signaling Technology Inc rabbit monoclonal ab against sp1
ZEB1 activates VEGFA transcription by recruiting <t>SP1</t> to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P
Rabbit Monoclonal Ab Against Sp1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit monoclonal ab against sp1/product/Cell Signaling Technology Inc
Average 90 stars, based on 1 article reviews
Price from $9.99 to $1999.99
rabbit monoclonal ab against sp1 - by Bioz Stars, 2020-07
90/100 stars

Related Products / Commonly Used Together

anti-rabbit normal igg

Images

1) Product Images from "ZEB1 Upregulates VEGF Expression and Stimulates Angiogenesis in Breast Cancer"

Article Title: ZEB1 Upregulates VEGF Expression and Stimulates Angiogenesis in Breast Cancer

Journal: PLoS ONE

doi: 10.1371/journal.pone.0148774

ZEB1 activates VEGFA transcription by recruiting SP1 to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P
Figure Legend Snippet: ZEB1 activates VEGFA transcription by recruiting SP1 to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P

Techniques Used: Mutagenesis, Luciferase, Multiple Displacement Amplification, Transfection, Expressing, Plasmid Preparation, Construct

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Cell Signaling Technology Inc rabbit monoclonal ab against sp1
    ZEB1 activates VEGFA transcription by recruiting <t>SP1</t> to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P
    Rabbit Monoclonal Ab Against Sp1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit monoclonal ab against sp1/product/Cell Signaling Technology Inc
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rabbit monoclonal ab against sp1 - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc rabbit antibodies against sp1
    <t>Sp1</t> and SF1 binding sites in the proximal promoter region of Adcy4 . A, DNA-protein interactions were assessed using radiolabeleld double-stranded oligonucleotides that included the Sp1A site (1), the Sp1A site mutated (2), the overlapping Sp1B/SF1 sites (3), and the Sp1B and SF1 sites mutated (4 and 5, respectively). These radiolabeled oligonucleotides were evaluated for interaction with BSA or with nuclear extracts (NE) from Y1 adrenal cells by EMSA. Where indicated, binding reactions were carried out in the presence of a 100-fold molar excess of the corresponding unlabeled oligonucleotides, or bona fide Sp1 (ATTCGATCGGGGCGGGGCGAGC) and SF1 (CTTTACTCAAGGTGAGGATAAA)binding sites. The positions of specific shifted complexes ( arrows ) are indicated. B, Complex formation was determined as in panel A using double-stranded oligonucleotide probes containing the Sp1A site (1) or the overlapping Sp1B/SF1 sites (2). Where indicated, the corresponding unlabeled oligonucleotides (100-fold molar excess), a rabbit IgG control, IgG antibodies against Sp1 or Sp3 (1 μg), or SF1 antiserum (1 μl) were added to the reaction. The positions of the complexes displaced by the Sp1, Sp3, and SF1 antibodies are indicated. C, DNA-protein interactions on the overlapping Sp1B/SF1 site were assessed using nuclear extracts from either Y1 or 10r6 cells or BSA as indicated. Reactions carried out in the presence of 100-fold molar excess of the unlabeled SP1B/SF1 oligonucleotide were included as controls for specificity. The identities of the shifted complexes are based on their displacement with specific antibodies (B).
    Rabbit Antibodies Against Sp1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit antibodies against sp1/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rabbit antibodies against sp1 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    ZEB1 activates VEGFA transcription by recruiting SP1 to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P

    Journal: PLoS ONE

    Article Title: ZEB1 Upregulates VEGF Expression and Stimulates Angiogenesis in Breast Cancer

    doi: 10.1371/journal.pone.0148774

    Figure Lengend Snippet: ZEB1 activates VEGFA transcription by recruiting SP1 to the endogenous VEGFA promoter. (A) Sequential deletion and mutation of SP1 elements on the human VEGFA promoter were fused to the luciferase reporter. (B) MDA-MB-231 cells were co-transfected with the ZEB1 expression plasmid (1 μg/well) and different wild-type VEGFA promoter luciferase reporter constructs (1 μg/well). Extract luciferase activities were determined 48 h after transfection using a Betascope analyzer. Luciferase values were normalized to Renilla activities. * P

    Article Snippet: The Abs used in these experiments were rabbit monoclonal Ab against SP1 (#9389S; CST) and anti-rabbit normal IgG (sc-2345, Santa Cruz).

    Techniques: Mutagenesis, Luciferase, Multiple Displacement Amplification, Transfection, Expressing, Plasmid Preparation, Construct

    Sp1 and SF1 binding sites in the proximal promoter region of Adcy4 . A, DNA-protein interactions were assessed using radiolabeleld double-stranded oligonucleotides that included the Sp1A site (1), the Sp1A site mutated (2), the overlapping Sp1B/SF1 sites (3), and the Sp1B and SF1 sites mutated (4 and 5, respectively). These radiolabeled oligonucleotides were evaluated for interaction with BSA or with nuclear extracts (NE) from Y1 adrenal cells by EMSA. Where indicated, binding reactions were carried out in the presence of a 100-fold molar excess of the corresponding unlabeled oligonucleotides, or bona fide Sp1 (ATTCGATCGGGGCGGGGCGAGC) and SF1 (CTTTACTCAAGGTGAGGATAAA)binding sites. The positions of specific shifted complexes ( arrows ) are indicated. B, Complex formation was determined as in panel A using double-stranded oligonucleotide probes containing the Sp1A site (1) or the overlapping Sp1B/SF1 sites (2). Where indicated, the corresponding unlabeled oligonucleotides (100-fold molar excess), a rabbit IgG control, IgG antibodies against Sp1 or Sp3 (1 μg), or SF1 antiserum (1 μl) were added to the reaction. The positions of the complexes displaced by the Sp1, Sp3, and SF1 antibodies are indicated. C, DNA-protein interactions on the overlapping Sp1B/SF1 site were assessed using nuclear extracts from either Y1 or 10r6 cells or BSA as indicated. Reactions carried out in the presence of 100-fold molar excess of the unlabeled SP1B/SF1 oligonucleotide were included as controls for specificity. The identities of the shifted complexes are based on their displacement with specific antibodies (B).

    Journal: Endocrinology

    Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells

    doi: 10.1210/en.2008-0203

    Figure Lengend Snippet: Sp1 and SF1 binding sites in the proximal promoter region of Adcy4 . A, DNA-protein interactions were assessed using radiolabeleld double-stranded oligonucleotides that included the Sp1A site (1), the Sp1A site mutated (2), the overlapping Sp1B/SF1 sites (3), and the Sp1B and SF1 sites mutated (4 and 5, respectively). These radiolabeled oligonucleotides were evaluated for interaction with BSA or with nuclear extracts (NE) from Y1 adrenal cells by EMSA. Where indicated, binding reactions were carried out in the presence of a 100-fold molar excess of the corresponding unlabeled oligonucleotides, or bona fide Sp1 (ATTCGATCGGGGCGGGGCGAGC) and SF1 (CTTTACTCAAGGTGAGGATAAA)binding sites. The positions of specific shifted complexes ( arrows ) are indicated. B, Complex formation was determined as in panel A using double-stranded oligonucleotide probes containing the Sp1A site (1) or the overlapping Sp1B/SF1 sites (2). Where indicated, the corresponding unlabeled oligonucleotides (100-fold molar excess), a rabbit IgG control, IgG antibodies against Sp1 or Sp3 (1 μg), or SF1 antiserum (1 μl) were added to the reaction. The positions of the complexes displaced by the Sp1, Sp3, and SF1 antibodies are indicated. C, DNA-protein interactions on the overlapping Sp1B/SF1 site were assessed using nuclear extracts from either Y1 or 10r6 cells or BSA as indicated. Reactions carried out in the presence of 100-fold molar excess of the unlabeled SP1B/SF1 oligonucleotide were included as controls for specificity. The identities of the shifted complexes are based on their displacement with specific antibodies (B).

    Article Snippet: Where indicated, competitor oligonucleotides (100-fold molar excess) or rabbit antibodies against Sp1, Sp3 (1 μg purified IgG/reaction; Upstate Cell Signaling Solutions, Lake Placid, NY) and SF1 (1 μl antiserum) were added.

    Techniques: Binding Assay

    The proximal promoter region of Adcy4 . A, The 5′ ends of Adcy4 transcripts were determined by primer extension using total and poly(A)-enriched RNA from Y1 cells and from mouse liver. The sizes of the extended fragments were determined by sequencing the complementary strand of an Adcy4 cDNA clone (accession no. AF442771) using the same primer. The sequences in capital letters are derived from the Adcy4 cDNA, the sequences in small letters are derived from the vector; the relative positions of the major ( arrow ) and minor ( asterisks ) transcripts on the sequencing ladder are indicated. B, The 5′ ends of the Adcy4 transcripts from Y1 cells and mouse liver were compared with those of several full-length RIKEN cDNA clones obtained from various origins. These ends were mapped to a region of the Adcy4 genomic clone (accession no. AC098877). The 5′-end of the major transcript identified in Y1 adrenal cells and C57BL/6 mouse liver is arbitrarily designated +1. Minor transcripts are denoted with asterisks . This region contains three putative Sp1 binding sites ( underlined and labeled Sp1A, Sp1B and Sp1C) and a putative SF1 binding site that partially overlaps the Sp1B site ( boxed ). C, The proximal 144 bp of DNA sequence flanking the mouse Adcy4 was compared with corresponding sequences flanking the Adcy4 from rat (accession no. NT_039606), human (accession no. NT_026437), chimpanzee (accession no. NW_001224596), rhesus monkey (accession no. NW_0011211199), and dog (accession no. NW_8876327). The sequences were aligned using a ClustalW alignment tool provided with MacVector 7.2 software (MacVector, Inc., Cary, NC); conserved sequences ( boxed ) and gaps introduced for optimal alignment (−) are indicated. Part of the sequence assigned to exon I of the rhesus monkey Adcy4 ( underlined ) is included to complete the comparison.

    Journal: Endocrinology

    Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells

    doi: 10.1210/en.2008-0203

    Figure Lengend Snippet: The proximal promoter region of Adcy4 . A, The 5′ ends of Adcy4 transcripts were determined by primer extension using total and poly(A)-enriched RNA from Y1 cells and from mouse liver. The sizes of the extended fragments were determined by sequencing the complementary strand of an Adcy4 cDNA clone (accession no. AF442771) using the same primer. The sequences in capital letters are derived from the Adcy4 cDNA, the sequences in small letters are derived from the vector; the relative positions of the major ( arrow ) and minor ( asterisks ) transcripts on the sequencing ladder are indicated. B, The 5′ ends of the Adcy4 transcripts from Y1 cells and mouse liver were compared with those of several full-length RIKEN cDNA clones obtained from various origins. These ends were mapped to a region of the Adcy4 genomic clone (accession no. AC098877). The 5′-end of the major transcript identified in Y1 adrenal cells and C57BL/6 mouse liver is arbitrarily designated +1. Minor transcripts are denoted with asterisks . This region contains three putative Sp1 binding sites ( underlined and labeled Sp1A, Sp1B and Sp1C) and a putative SF1 binding site that partially overlaps the Sp1B site ( boxed ). C, The proximal 144 bp of DNA sequence flanking the mouse Adcy4 was compared with corresponding sequences flanking the Adcy4 from rat (accession no. NT_039606), human (accession no. NT_026437), chimpanzee (accession no. NW_001224596), rhesus monkey (accession no. NW_0011211199), and dog (accession no. NW_8876327). The sequences were aligned using a ClustalW alignment tool provided with MacVector 7.2 software (MacVector, Inc., Cary, NC); conserved sequences ( boxed ) and gaps introduced for optimal alignment (−) are indicated. Part of the sequence assigned to exon I of the rhesus monkey Adcy4 ( underlined ) is included to complete the comparison.

    Article Snippet: Where indicated, competitor oligonucleotides (100-fold molar excess) or rabbit antibodies against Sp1, Sp3 (1 μg purified IgG/reaction; Upstate Cell Signaling Solutions, Lake Placid, NY) and SF1 (1 μl antiserum) were added.

    Techniques: Sequencing, Derivative Assay, Plasmid Preparation, Clone Assay, Binding Assay, Labeling, Software