Structured Review

Agilent technologies quikchange xl multi site directed mutagenesis kit
Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent <t>QuikChange</t> XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.
Quikchange Xl Multi Site Directed Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quikchange xl multi site directed mutagenesis kit/product/Agilent technologies
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
quikchange xl multi site directed mutagenesis kit - by Bioz Stars, 2021-06
86/100 stars

Images

1) Product Images from "Role of the C-terminal tail in regulating Proteinase Activated Receptor 2 (PAR2) signalling"

Article Title: Role of the C-terminal tail in regulating Proteinase Activated Receptor 2 (PAR2) signalling

Journal: bioRxiv

doi: 10.1101/2020.03.02.973842

Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent QuikChange XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.
Figure Legend Snippet: Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent QuikChange XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.

Techniques Used: Generated, Mutagenesis, Clone Assay, Construct

Related Articles

Introduce:

Article Title: Two distinct mechanisms underlie dosage sensitivity in Pumilio1-associated diseases
Article Snippet: Human FMRP , AGO2 and CNOT1 , full-length cDNA were cloned and contain the GST tag sequence at the N-terminal as described for GST-PUM1. .. To introduce the T1035S or R1147W mutations we used the QuikChange II XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, #200521). .. The primers for the single mutagenesis experiments were designed by QuikChange software (Stratagene, San Diego, https://www.genomics.agilent.com/ primerDesignProgram.jsp).

Mutagenesis:

Article Title: Two distinct mechanisms underlie dosage sensitivity in Pumilio1-associated diseases
Article Snippet: Human FMRP , AGO2 and CNOT1 , full-length cDNA were cloned and contain the GST tag sequence at the N-terminal as described for GST-PUM1. .. To introduce the T1035S or R1147W mutations we used the QuikChange II XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, #200521). .. The primers for the single mutagenesis experiments were designed by QuikChange software (Stratagene, San Diego, https://www.genomics.agilent.com/ primerDesignProgram.jsp).

Article Title: Y44A Mutation in the Acidic Domain of HIV-2 Tat Impairs Viral Reverse Transcription and LTR-Transactivation
Article Snippet: HIV-2 CGP, HIV-2-CRU5SIN-CGW and HIV-2-CRU5SIN-WPRE were a kind gift from Joseph P. Dougherty at the Robert Wood Johnson Medical School (New Brunswick, NJ, USA) [ ]. .. Mutagenesis To generate the Y44A and Y55A mutations in HIV-2 Tat protein, HIV-2 tat gene, encoded by the HIV-2 CGP vector, was modified by site-directed mutagenesis using QuikChange Lightning Multi Site-Directed Mutagenesis Kit and QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA), respectively. .. The following mutagenesis primers were used: Y44A_forward primer: 5′-CTC TCT CAG CTA GC C CGA CCC CTA GAA AC-3′, Y44A_reverse primer: 5′-GT TTC TAG GGG TCG G GC TAG CTG AGA GAG-3′Y55A_forward primer: 5′-CA TGC AAT AAC TCA TGC GCC TGT AAG CGA TGC TGC TAC CAT TG-3′, and Y55A_reverse primer: 5′-CA ATG GTA GCA GCA TCG CTT ACA GGC GCA TGA GTT ATT GCA TG-3′.

Article Title: Quadruplex-Forming Motif Inserted into 3′UTR of Ty1his3-AI Retrotransposon Inhibits Retrotransposition in Yeast
Article Snippet: Plasmid Construction All plasmids were based on the pGTy1his3-AI plasmid (Addgene plasmid # 62228; http://n2t.net/addgene:62228 (accessed on 5 January 2018); RRID:Addgene_62228). .. In order to clone the sequences of interest into the plasmid, a SacII recognition site was introduced into the Ty1his3-AI 3′UTR using a single mutagenic primer GAGGATCCCGCGGGGAGCTC and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA). .. The mutant product was electroporated into XL-1 blue competent cells (Agilent) and the mutation was verified by SacII digestion and sequencing.

Article Title: Role of the C-terminal tail in regulating Proteinase Activated Receptor 2 (PAR2) signalling
Article Snippet: .. Plasmid DNA mutations in the C-terminus of PAR2 were created using QuikChange XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, Mississauga, ON, Canada) to generate all mutants described in this study. .. All constructs were verified by sanger sequencing (London Regional Genomics Centre, University of Western Ontario).

Plasmid Preparation:

Article Title: Y44A Mutation in the Acidic Domain of HIV-2 Tat Impairs Viral Reverse Transcription and LTR-Transactivation
Article Snippet: HIV-2 CGP, HIV-2-CRU5SIN-CGW and HIV-2-CRU5SIN-WPRE were a kind gift from Joseph P. Dougherty at the Robert Wood Johnson Medical School (New Brunswick, NJ, USA) [ ]. .. Mutagenesis To generate the Y44A and Y55A mutations in HIV-2 Tat protein, HIV-2 tat gene, encoded by the HIV-2 CGP vector, was modified by site-directed mutagenesis using QuikChange Lightning Multi Site-Directed Mutagenesis Kit and QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA), respectively. .. The following mutagenesis primers were used: Y44A_forward primer: 5′-CTC TCT CAG CTA GC C CGA CCC CTA GAA AC-3′, Y44A_reverse primer: 5′-GT TTC TAG GGG TCG G GC TAG CTG AGA GAG-3′Y55A_forward primer: 5′-CA TGC AAT AAC TCA TGC GCC TGT AAG CGA TGC TGC TAC CAT TG-3′, and Y55A_reverse primer: 5′-CA ATG GTA GCA GCA TCG CTT ACA GGC GCA TGA GTT ATT GCA TG-3′.

Article Title: Quadruplex-Forming Motif Inserted into 3′UTR of Ty1his3-AI Retrotransposon Inhibits Retrotransposition in Yeast
Article Snippet: Plasmid Construction All plasmids were based on the pGTy1his3-AI plasmid (Addgene plasmid # 62228; http://n2t.net/addgene:62228 (accessed on 5 January 2018); RRID:Addgene_62228). .. In order to clone the sequences of interest into the plasmid, a SacII recognition site was introduced into the Ty1his3-AI 3′UTR using a single mutagenic primer GAGGATCCCGCGGGGAGCTC and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA). .. The mutant product was electroporated into XL-1 blue competent cells (Agilent) and the mutation was verified by SacII digestion and sequencing.

Article Title: Role of the C-terminal tail in regulating Proteinase Activated Receptor 2 (PAR2) signalling
Article Snippet: .. Plasmid DNA mutations in the C-terminus of PAR2 were created using QuikChange XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, Mississauga, ON, Canada) to generate all mutants described in this study. .. All constructs were verified by sanger sequencing (London Regional Genomics Centre, University of Western Ontario).

Modification:

Article Title: Y44A Mutation in the Acidic Domain of HIV-2 Tat Impairs Viral Reverse Transcription and LTR-Transactivation
Article Snippet: HIV-2 CGP, HIV-2-CRU5SIN-CGW and HIV-2-CRU5SIN-WPRE were a kind gift from Joseph P. Dougherty at the Robert Wood Johnson Medical School (New Brunswick, NJ, USA) [ ]. .. Mutagenesis To generate the Y44A and Y55A mutations in HIV-2 Tat protein, HIV-2 tat gene, encoded by the HIV-2 CGP vector, was modified by site-directed mutagenesis using QuikChange Lightning Multi Site-Directed Mutagenesis Kit and QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA), respectively. .. The following mutagenesis primers were used: Y44A_forward primer: 5′-CTC TCT CAG CTA GC C CGA CCC CTA GAA AC-3′, Y44A_reverse primer: 5′-GT TTC TAG GGG TCG G GC TAG CTG AGA GAG-3′Y55A_forward primer: 5′-CA TGC AAT AAC TCA TGC GCC TGT AAG CGA TGC TGC TAC CAT TG-3′, and Y55A_reverse primer: 5′-CA ATG GTA GCA GCA TCG CTT ACA GGC GCA TGA GTT ATT GCA TG-3′.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Agilent technologies quikchange xl multi site directed mutagenesis kit
    Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent <t>QuikChange</t> XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.
    Quikchange Xl Multi Site Directed Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quikchange xl multi site directed mutagenesis kit/product/Agilent technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quikchange xl multi site directed mutagenesis kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    86
    Agilent technologies quikchange ii xl multi site directed mutagenesis kit
    Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent <t>QuikChange</t> XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.
    Quikchange Ii Xl Multi Site Directed Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quikchange ii xl multi site directed mutagenesis kit/product/Agilent technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quikchange ii xl multi site directed mutagenesis kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    86
    Agilent technologies quikchange lightning multi site directed mutagenesis kit
    Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent <t>QuikChange</t> XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.
    Quikchange Lightning Multi Site Directed Mutagenesis Kit, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quikchange lightning multi site directed mutagenesis kit/product/Agilent technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quikchange lightning multi site directed mutagenesis kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent QuikChange XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.

    Journal: bioRxiv

    Article Title: Role of the C-terminal tail in regulating Proteinase Activated Receptor 2 (PAR2) signalling

    doi: 10.1101/2020.03.02.973842

    Figure Lengend Snippet: Summary of PAR2 C-tail residue mutations ( A) Cartoon depicting PAR2 with palmitoylation site (green) and phosphorylation sites (blue) shown (generated with GPCRdb) ( 67 , 68 ). (B) Mutant receptor clones generated using Agilent QuikChange XL site-directed mutagenesis. Sequences of the wildtype PAR2 and mutant PAR2 receptor C-tail constructs (mutations are shown underlined). PAR2C 361 A mutation was generated to study the effects of this residue on signalling endpoints. PAR2S 383-386 A and PAR2S 387- T 392A mutants were generated to determine the effects of partial mutation of the serine/threonine rich region of the PAR2 C-tail. A combined mutant of PAR2S 383-385 A, S 387- T 392 A was also generated to determine the effect on mutation of serine/threonine rich C-tail motif on signalling.

    Article Snippet: Plasmid DNA mutations in the C-terminus of PAR2 were created using QuikChange XL Multi Site-Directed Mutagenesis kit (Agilent Technologies, Mississauga, ON, Canada) to generate all mutants described in this study.

    Techniques: Generated, Mutagenesis, Clone Assay, Construct