qubit dsdna hs assay kit  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher qubit dsdna hs assay kit
    A tissue-level cross-link reversal allows efficient extraction of high-quality chromatin from FFPE tissues. a Schematic diagram of chromatin extraction method from FFPE tissues (ChromEX-PE). A tissue-level, cross-link reversal was introduced by incubating deparaffinized tissue in the range of temperature from 25 to 75 °C before chromatin extraction. b Chrom-EX PE dramatically increases soluble chromatin from FFPE tissues. Chromatin was prepared by Chrom-EX PE with 65 °C overnight incubation or without incubation. A commercial kit from Active motif was used as control and for comparison. DNAs were purified from soluble fraction and insoluble pellet fraction and were quantified using <t>Qubit</t> <t>dsDNA</t> High Sensitivity assay. The percentage of soluble chromatin was calculated from mouse spleen, kidney, and liver FFPE tissues. The data were generated from two independent experiments. c Chrom-EX PE generates different sizes of chromatin in a controlled manner. Chromatin was prepared from mouse liver FFPE tissues by Chrom-EX PE in the range of temperatures from 25 °C to 75 °C. Deparaffinized tissue was incubated in the indicated temperature overnight in the chromatin stabilization buffer. In the range of 25–37 °C, a majority of soluble chromatin is larger than 1 kb. The temperature ranges (45–55 °C) produce nucleosomal DNA patterns. The majority of DNA was mononucleosomal DNA at 60 °C incubation and DNA size is closer or smaller than mononucleosomal DNA with temperature above 60 °C. d Chromatin yield by Chrom-EX PE from various mouse tissues. The tissue volume is measured in FFPE block and two 20-μm sections were processed by Chrom-EX PE at 65 °C condition with chromatin stabilization buffer. The DNA amount purified from soluble fraction was measured and the yield was calculated per tissue volume
    Qubit Dsdna Hs Assay Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qubit dsdna hs assay kit/product/Thermo Fisher
    Average 99 stars, based on 322 article reviews
    Price from $9.99 to $1999.99
    qubit dsdna hs assay kit - by Bioz Stars, 2019-10
    99/100 stars


    1) Product Images from "Enhanced and controlled chromatin extraction from FFPE tissues and the application to ChIP-seq"

    Article Title: Enhanced and controlled chromatin extraction from FFPE tissues and the application to ChIP-seq

    Journal: BMC Genomics

    doi: 10.1186/s12864-019-5639-8

    A tissue-level cross-link reversal allows efficient extraction of high-quality chromatin from FFPE tissues. a Schematic diagram of chromatin extraction method from FFPE tissues (ChromEX-PE). A tissue-level, cross-link reversal was introduced by incubating deparaffinized tissue in the range of temperature from 25 to 75 °C before chromatin extraction. b Chrom-EX PE dramatically increases soluble chromatin from FFPE tissues. Chromatin was prepared by Chrom-EX PE with 65 °C overnight incubation or without incubation. A commercial kit from Active motif was used as control and for comparison. DNAs were purified from soluble fraction and insoluble pellet fraction and were quantified using Qubit dsDNA High Sensitivity assay. The percentage of soluble chromatin was calculated from mouse spleen, kidney, and liver FFPE tissues. The data were generated from two independent experiments. c Chrom-EX PE generates different sizes of chromatin in a controlled manner. Chromatin was prepared from mouse liver FFPE tissues by Chrom-EX PE in the range of temperatures from 25 °C to 75 °C. Deparaffinized tissue was incubated in the indicated temperature overnight in the chromatin stabilization buffer. In the range of 25–37 °C, a majority of soluble chromatin is larger than 1 kb. The temperature ranges (45–55 °C) produce nucleosomal DNA patterns. The majority of DNA was mononucleosomal DNA at 60 °C incubation and DNA size is closer or smaller than mononucleosomal DNA with temperature above 60 °C. d Chromatin yield by Chrom-EX PE from various mouse tissues. The tissue volume is measured in FFPE block and two 20-μm sections were processed by Chrom-EX PE at 65 °C condition with chromatin stabilization buffer. The DNA amount purified from soluble fraction was measured and the yield was calculated per tissue volume
    Figure Legend Snippet: A tissue-level cross-link reversal allows efficient extraction of high-quality chromatin from FFPE tissues. a Schematic diagram of chromatin extraction method from FFPE tissues (ChromEX-PE). A tissue-level, cross-link reversal was introduced by incubating deparaffinized tissue in the range of temperature from 25 to 75 °C before chromatin extraction. b Chrom-EX PE dramatically increases soluble chromatin from FFPE tissues. Chromatin was prepared by Chrom-EX PE with 65 °C overnight incubation or without incubation. A commercial kit from Active motif was used as control and for comparison. DNAs were purified from soluble fraction and insoluble pellet fraction and were quantified using Qubit dsDNA High Sensitivity assay. The percentage of soluble chromatin was calculated from mouse spleen, kidney, and liver FFPE tissues. The data were generated from two independent experiments. c Chrom-EX PE generates different sizes of chromatin in a controlled manner. Chromatin was prepared from mouse liver FFPE tissues by Chrom-EX PE in the range of temperatures from 25 °C to 75 °C. Deparaffinized tissue was incubated in the indicated temperature overnight in the chromatin stabilization buffer. In the range of 25–37 °C, a majority of soluble chromatin is larger than 1 kb. The temperature ranges (45–55 °C) produce nucleosomal DNA patterns. The majority of DNA was mononucleosomal DNA at 60 °C incubation and DNA size is closer or smaller than mononucleosomal DNA with temperature above 60 °C. d Chromatin yield by Chrom-EX PE from various mouse tissues. The tissue volume is measured in FFPE block and two 20-μm sections were processed by Chrom-EX PE at 65 °C condition with chromatin stabilization buffer. The DNA amount purified from soluble fraction was measured and the yield was calculated per tissue volume

    Techniques Used: Formalin-fixed Paraffin-Embedded, Incubation, Purification, Sensitive Assay, Generated, Blocking Assay

    2) Product Images from "Functional DNA quantification guides accurate next-generation sequencing mutation detection in formalin-fixed, paraffin-embedded tumor biopsies"

    Article Title: Functional DNA quantification guides accurate next-generation sequencing mutation detection in formalin-fixed, paraffin-embedded tumor biopsies

    Journal: Genome Medicine

    doi: 10.1186/gm481

    FFPE DNA characterization by QFI-PCR and fluorescence-based assays from 165 tumor DNA samples. (A) Distribution of FFPE DNA quantification using QFI-PCR and the fluorescence-based Qubit dsDNA HS assay from 5 ng bulk DNA input as determined by NanoDrop spectrophotometry. A total of 27 samples were undetected by fluorescence assay (
    Figure Legend Snippet: FFPE DNA characterization by QFI-PCR and fluorescence-based assays from 165 tumor DNA samples. (A) Distribution of FFPE DNA quantification using QFI-PCR and the fluorescence-based Qubit dsDNA HS assay from 5 ng bulk DNA input as determined by NanoDrop spectrophotometry. A total of 27 samples were undetected by fluorescence assay (

    Techniques Used: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Fluorescence, Spectrophotometry

    3) Product Images from "Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study"

    Article Title: Evaluation of pre-analytical conditions and comparison of the performance of several digital PCR assays for the detection of major EGFR mutations in circulating DNA from non-small cell lung cancers: the CIRCAN_0 study

    Journal: Oncotarget

    doi: 10.18632/oncotarget.21256

    Optimization of circulating free DNA (cfDNA) extraction and quantification of cfDNA in the samples (A) Reproducibility of cfDNA extraction using the QIAamp Circulating Acid Kit (Qiagen, Cat No 55114, Valencia, CA, USA) on two independent cfDNA samples extracted from 1 mL (Ai) and 3 mL (Aii) of plasma from NSCLC patients. After extraction, cfDNA was quantified by Qubit dsDNA HS Assay Kit (Life Technologies, Q32854, Carlsbad, CA, USA) according to the manufacturer's instructions. (B) Correlation between the initial volume of plasma 1 mL versus 3 mL (Bi) or 3 mL versus 5 mL (Bii) and the quantity of cfDNA extracted (in ng/μL). (Ci) Fragment size visualization of cfDNA (in bp) from a concentrated (left) and a less concentrated (right) sample obtained using the Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) (Cii) , and average size distribution (10 bp increments) of cfDNA fragments in 77 plasma samples. (D) Correlation between cfDNA concentration measured using the Qubit method and the number of amplifiable copies in the corresponding plasma samples determined using the Quantifiler Kit.
    Figure Legend Snippet: Optimization of circulating free DNA (cfDNA) extraction and quantification of cfDNA in the samples (A) Reproducibility of cfDNA extraction using the QIAamp Circulating Acid Kit (Qiagen, Cat No 55114, Valencia, CA, USA) on two independent cfDNA samples extracted from 1 mL (Ai) and 3 mL (Aii) of plasma from NSCLC patients. After extraction, cfDNA was quantified by Qubit dsDNA HS Assay Kit (Life Technologies, Q32854, Carlsbad, CA, USA) according to the manufacturer's instructions. (B) Correlation between the initial volume of plasma 1 mL versus 3 mL (Bi) or 3 mL versus 5 mL (Bii) and the quantity of cfDNA extracted (in ng/μL). (Ci) Fragment size visualization of cfDNA (in bp) from a concentrated (left) and a less concentrated (right) sample obtained using the Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) (Cii) , and average size distribution (10 bp increments) of cfDNA fragments in 77 plasma samples. (D) Correlation between cfDNA concentration measured using the Qubit method and the number of amplifiable copies in the corresponding plasma samples determined using the Quantifiler Kit.

    Techniques Used: Concentration Assay

    4) Product Images from "Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application"

    Article Title: Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-4371-5

    Storage condition of purified ChIP DNA is important. Purified ChIP DNA was adjusted to a concentration of 1 ng/μL ( a ) or 0.1 ng/μL ( b ), aliquoted into 4 different types of microcentrifuge tubes in 15 μL volume, and stored at −20 °C. DNA was quantified using Qubit dsDNA High Sensitivity assay at the indicated time points and expressed as a percentage of the amount measured at day 0. Three independent DNA samples were used in the experiment and DNA concentration from five tubes were measured at each time point. MaxyClear, Axygen® 1.7 mL MaxyClear Snaplock Microcentrifuge Tube; LoBind, Eppendorf DNA LoBind Snap Cap PCR Tube; Siliconized, Fisherbrand™ Siliconized Low-Retention Microcentrifuge Tube; Premium, Fisherbrand™ Premium Microcentrifuge Tube
    Figure Legend Snippet: Storage condition of purified ChIP DNA is important. Purified ChIP DNA was adjusted to a concentration of 1 ng/μL ( a ) or 0.1 ng/μL ( b ), aliquoted into 4 different types of microcentrifuge tubes in 15 μL volume, and stored at −20 °C. DNA was quantified using Qubit dsDNA High Sensitivity assay at the indicated time points and expressed as a percentage of the amount measured at day 0. Three independent DNA samples were used in the experiment and DNA concentration from five tubes were measured at each time point. MaxyClear, Axygen® 1.7 mL MaxyClear Snaplock Microcentrifuge Tube; LoBind, Eppendorf DNA LoBind Snap Cap PCR Tube; Siliconized, Fisherbrand™ Siliconized Low-Retention Microcentrifuge Tube; Premium, Fisherbrand™ Premium Microcentrifuge Tube

    Techniques Used: Purification, Chromatin Immunoprecipitation, Concentration Assay, Sensitive Assay, Polymerase Chain Reaction

    Related Articles


    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: Paragraph title: Amplification and quantification of the library ... At last, the library was quantified by Qubit dsDNA HS Assay Kit (Invitrogen).

    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: After amplification, aliquots were size-separated on 2% agarose gels along with a size standard (SM0241, Thermo Fisher Scientific, Waltham, Massachusetts, USA) to check for PCR performance and correct amplicon size. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA).

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Promoter (chr2:172,950,395-172,950,785) and gene-body (chr2:172,951,180-172,951,400) regions of DLX1 , and promoter (chr2:105,470,350-10,470,850) and gene-body (105,471,850-105,472,350) regions of POU3F3 were amplified from bisulfite-treated DNA by PCR using the following program. .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Fragmentation was followed by end repair, dA tailing, and sequencing adaptor ligation by ABI 9700 PCR instrument (ABI, USA). .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA). .. Prepared library (750ng) was hybridized with 11μl hybridization block (Allwegene, China), 20μl hybridization buffer (Allwegene, China) and a mix of 5μl RNase block (Invitrogen, USA) and 2μl Probe (Allwegene, China) for overnight (at least 8-16h) at 65°C.

    Article Title: LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma Cells
    Article Snippet: The libraries were amplified by 14-15 cycles of PCR using HotStarTaq DNA Polymerase (QIAGEN), and purified with 0.9x Agencourt AMPure XP (Beckman Coulter). .. The library quality was assessed using Agilent 2100 Bioanalyzer, and the quantity was measured using Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific).

    Article Title: The Metabolic Response to a Low Amino Acid Diet is Independent of Diet-Induced Shifts in the Composition of the Gut Microbiome
    Article Snippet: Following initial amplification, reactions were cleaned using a 0.7x volume of AxyPrep Mag PCR clean-up beads (Axygen Biosciences, Union City, CA). .. Quality and quantity of the finished libraries were assessed using an Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific), respectively.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: The hybridized products were mixed with 200μl nabeads MyOne Streptavidin T1 magnetic beads (Invitrogen, USA) for 30 min at room temperature. .. After two times of washing by wash buffer (Allwegene, China), the mixture was amplified for 16 PCR cycles and quantitatively assessed using Qubit dsDNA HS Assay Kit (Invitrogen, USA). .. Captured libraries were denatured and loaded onto an Illumina cBot instrument at 12 to 16pmol/L for cluster generation according to the manufacturer’s instructions.

    Article Title: Analysis of extracellular RNA in cerebrospinal fluid
    Article Snippet: Long RNASeq was performed using 2 ng of RNA in a NuGen Ovation RNASeq FFPE system (7150) for cDNA synthesis and RNA amplification. .. The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems).

    Article Title: Digital Droplet Multiple Displacement Amplification (ddMDA) for Whole Genome Sequencing of Limited DNA Samples
    Article Snippet: The amplified DNA (60 μL of ddMDA or 20 μL of tube MDA) was cleaned using a DNA Clean & Concentrator™-5 (Zymo Research, Irvine, CA) and the control genomic DNA was prepared from 10ml of overnight culture of E.coli K-12 MG1655 using ZR Fungal/Bacterial DNA MiniPrep™ (Zymo Research) by following the manufactures’ protocols. .. After quantification using Qubit® dsDNA HS Assay Kit (Life Technologies, San Diego, CA), one nanogram each of purified DNA from the MDA samples and one nanogram of genomic DNA were prepared for a sequencing library using Nextera XT kit (Illumina, San Diego, CA) and pooled together as the manufacture’s protocol.


    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: PCR products were visualized by 0.8% agarose gel electrophoresis, excised, purified, and Sanger-sequenced as described previously [ ]. .. Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA). .. A 1ng sample (0.2 ng/μl) was index library tagged with I5 and I7 primers and fragmented at the same time (tagmented) through a 5-cycle PCR amplification using the Illumina Nextera XT kit, according to Illumina MiSec protocol.

    Blocking Assay:

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Prepared library (750ng) was hybridized with 11μl hybridization block (Allwegene, China), 20μl hybridization buffer (Allwegene, China) and a mix of 5μl RNase block (Invitrogen, USA) and 2μl Probe (Allwegene, China) for overnight (at least 8-16h) at 65°C. .. After two times of washing by wash buffer (Allwegene, China), the mixture was amplified for 16 PCR cycles and quantitatively assessed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).


    Article Title: Validation of a high resolution NGS method for detecting spinal muscular atrophy carriers among phase 3 participants in the 1000 Genomes Project
    Article Snippet: The integrity for both the saliva- and semen-extracted DNA was verified by electrophoresis in 2 % agarose gels. .. DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA).

    Article Title: Prokaryotic community shifts during soil formation on sands in the tundra zone
    Article Snippet: DNA quality was estimated by electrophoresis in agarose gels (1% w/v in TAE) with further visual DNA detection using the Gel Doc XR+ System (Bio-Rad Laboratories, USA). .. DNA quantity was estimated by Qubit 3 Fluorometer (Thermo Fisher Scientific, USA) using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, USA).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Analysis of extracellular RNA in cerebrospinal fluid
    Article Snippet: Long RNASeq was performed using 2 ng of RNA in a NuGen Ovation RNASeq FFPE system (7150) for cDNA synthesis and RNA amplification. .. The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems).

    Activity Assay:

    Article Title: LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma Cells
    Article Snippet: Sorted cells were lysed and digested with proteinase K followed by addition of 1mM Pefabloc SC (Sigma-Aldrich) to inhibit protease activity. .. The library quality was assessed using Agilent 2100 Bioanalyzer, and the quantity was measured using Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific).


    Article Title: The Metabolic Response to a Low Amino Acid Diet is Independent of Diet-Induced Shifts in the Composition of the Gut Microbiome
    Article Snippet: Region specific primers were previously described ( ; underlined sequences above), and were modified to add 3–6 random nucleotides ((N)3/6 ) and Illumina adapter overhang nucleotide sequences 5′ of the gene‐specific sequences. .. Quality and quantity of the finished libraries were assessed using an Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific), respectively.


    Article Title: The identification of novel single nucleotide polymorphisms to assist in mapping the spread of Bacillus anthracis across the Southern Caucasus
    Article Snippet: Sterility of DNA-samples was confirmed by culturing of 5% of the final DNA-volume with negative results. .. DNA concentrations were quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) according to the supplier’s protocol.


    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Prepared library (750ng) was hybridized with 11μl hybridization block (Allwegene, China), 20μl hybridization buffer (Allwegene, China) and a mix of 5μl RNase block (Invitrogen, USA) and 2μl Probe (Allwegene, China) for overnight (at least 8-16h) at 65°C. .. After two times of washing by wash buffer (Allwegene, China), the mixture was amplified for 16 PCR cycles and quantitatively assessed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).

    Countercurrent Chromatography:

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Finally, the samples were elongated at 72 °C for 10 min. Bisulfite PCR primers used for promoter (P) and gene-body (E) of DLX1 : DLX1-P-F 5′- GGGAAGTAGAGGAGAGAAAGTTTTA -3′, DLX1-P-R 5′- CTCTCCTCTCTTCTCTTTCTCTC -3′, DLX1-E-F: 5′- ATTTTTTTT GTAAAGGTAGGAGTTGAG -3′, DLX1-E-R 5′- AACACATACACACAATAACA CCC -3′. .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Gas Chromatography:

    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: Target regions were amplified in 96-well plates (AB0600, Thermo Fisher Scientific, Waltham, Massachusetts, USA) with 1 U BioThermTaq DNA Polymerase (GC-002-5000, Genecraft, Cologne, North-Rhine Westphalia, Germany) in a 30 μl PCR mix (1 x reaction buffer, 0.16 mM for each dNTP, 0.33 μM for each primer, and 18 ng BSA, 100 ng template DNA), with the following thermocycler (Labcycler, Sensoquest, Göttingen, Lower Saxony, Germany) conditions: 2 minutes at 94 °C, 60 cycles of 30 seconds at 94 °C, 30 seconds at the appropriate annealing temperature (see Supplementary Table ), 30 seconds at 72 °C, and 5 minutes at 72 °C. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA).


    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Fragmentation was followed by end repair, dA tailing, and sequencing adaptor ligation by ABI 9700 PCR instrument (ABI, USA). .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).


    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation. .. We used the software of BSMAP [ ] to align the paired-end reads to the human genome (hg19) and low-quality sequences were trimmed as the default threshold.

    Article Title: LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma Cells
    Article Snippet: Paragraph title: Library preparation for methylation analysis of plasmocytes and B cell subsets ... The library quality was assessed using Agilent 2100 Bioanalyzer, and the quantity was measured using Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific).

    Cell Culture:

    Article Title: The identification of novel single nucleotide polymorphisms to assist in mapping the spread of Bacillus anthracis across the Southern Caucasus
    Article Snippet: Vegetative cells of B. anthracis from our strain collection were cultured, inactivated and DNA isolated as described previously . .. DNA concentrations were quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) according to the supplier’s protocol.


    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA). .. Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA).


    Article Title: PVL overexpression due to genomic rearrangements and mutations in the S. aureus reference strain ATCC25923
    Article Snippet: Q32851).


    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA). .. To test if our primers are target-specific, all 41 SPRI-purified amplicons of two individuals, acquired via PCR from faecal DNA extracts, were sequenced using Sanger technology.

    Article Title: A Dual Platform Approach to Transcript Discovery for the Planarian Schmidtea Mediterranea to Establish RNAseq for Stem Cell and Regeneration Biology
    Article Snippet: Paragraph title: Preparation and sequencing of SOLiD 3 whole transcriptome libraries ... The Quant-it HS dsDNA assay kit (Invitrogen, Cat. No. Q32851) was used to measure the concentration of libraries.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Fragmentation was followed by end repair, dA tailing, and sequencing adaptor ligation by ABI 9700 PCR instrument (ABI, USA). .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).

    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: PCR products were visualized by 0.8% agarose gel electrophoresis, excised, purified, and Sanger-sequenced as described previously [ ]. .. Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA). .. A 1ng sample (0.2 ng/μl) was index library tagged with I5 and I7 primers and fragmented at the same time (tagmented) through a 5-cycle PCR amplification using the Illumina Nextera XT kit, according to Illumina MiSec protocol.

    Article Title: The Metabolic Response to a Low Amino Acid Diet is Independent of Diet-Induced Shifts in the Composition of the Gut Microbiome
    Article Snippet: Paragraph title: Construction and Sequencing of v3-v4 16S Metagenomic libraries ... Quality and quantity of the finished libraries were assessed using an Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific), respectively.

    Article Title: Digital Droplet Multiple Displacement Amplification (ddMDA) for Whole Genome Sequencing of Limited DNA Samples
    Article Snippet: The amplified DNA (60 μL of ddMDA or 20 μL of tube MDA) was cleaned using a DNA Clean & Concentrator™-5 (Zymo Research, Irvine, CA) and the control genomic DNA was prepared from 10ml of overnight culture of E.coli K-12 MG1655 using ZR Fungal/Bacterial DNA MiniPrep™ (Zymo Research) by following the manufactures’ protocols. .. After quantification using Qubit® dsDNA HS Assay Kit (Life Technologies, San Diego, CA), one nanogram each of purified DNA from the MDA samples and one nanogram of genomic DNA were prepared for a sequencing library using Nextera XT kit (Illumina, San Diego, CA) and pooled together as the manufacture’s protocol. .. Sixteen picomolar of the pooled library was loaded to MiSeq (Illumina) for a 75-cycle paired-end reads using the v3 chemistry.

    DNA Extraction:

    Article Title: Prokaryotic community shifts during soil formation on sands in the tundra zone
    Article Snippet: Paragraph title: DNA extraction ... DNA quantity was estimated by Qubit 3 Fluorometer (Thermo Fisher Scientific, USA) using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, USA).

    Sensitive Assay:

    Article Title: Unique Molecular Identifiers reveal a novel sequencing artefact with implications for RNA-Seq based gene expression analysis
    Article Snippet: 12 μ l of eluted PCR products were collected. .. 1 μ l of PCR product for each replicate was quantified using a Qubit DNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851) and the Qubit3.0 fluorometer (ThermoFisher Scientific Q33216), as specified by the manufacturer. .. To assess the size distribution of the libraries, 1 μ l of each library was run on a 2100 Bioanalyzer (Agilent G2939A) using a High Sensitivity DNA Analysis kit (Agilent 5067–4626), as specified by the manufacturers’ instructions.

    Magnetic Beads:

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA). .. Prepared library (750ng) was hybridized with 11μl hybridization block (Allwegene, China), 20μl hybridization buffer (Allwegene, China) and a mix of 5μl RNase block (Invitrogen, USA) and 2μl Probe (Allwegene, China) for overnight (at least 8-16h) at 65°C.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: The hybridized products were mixed with 200μl nabeads MyOne Streptavidin T1 magnetic beads (Invitrogen, USA) for 30 min at room temperature. .. After two times of washing by wash buffer (Allwegene, China), the mixture was amplified for 16 PCR cycles and quantitatively assessed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).

    Multiple Displacement Amplification:

    Article Title: Digital Droplet Multiple Displacement Amplification (ddMDA) for Whole Genome Sequencing of Limited DNA Samples
    Article Snippet: The amplified DNA (60 μL of ddMDA or 20 μL of tube MDA) was cleaned using a DNA Clean & Concentrator™-5 (Zymo Research, Irvine, CA) and the control genomic DNA was prepared from 10ml of overnight culture of E.coli K-12 MG1655 using ZR Fungal/Bacterial DNA MiniPrep™ (Zymo Research) by following the manufactures’ protocols. .. After quantification using Qubit® dsDNA HS Assay Kit (Life Technologies, San Diego, CA), one nanogram each of purified DNA from the MDA samples and one nanogram of genomic DNA were prepared for a sequencing library using Nextera XT kit (Illumina, San Diego, CA) and pooled together as the manufacture’s protocol. .. Sixteen picomolar of the pooled library was loaded to MiSeq (Illumina) for a 75-cycle paired-end reads using the v3 chemistry.


    Article Title: Validation of a high resolution NGS method for detecting spinal muscular atrophy carriers among phase 3 participants in the 1000 Genomes Project
    Article Snippet: DNA was extracted from the semen samples using the MasterPure Complete DNA & RNA Isolation Kit (Epicenter, Madison WI, USA) according to the manufacturer’s specifications. .. DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA).

    Article Title: Evaluation of Storage Tubes for Combined Analysis of Circulating Nucleic Acids in Liquid Biopsies
    Article Snippet: Individual miRNAs were amplified and quantified using Taqman Advanced specific primers and the Taqman Advanced Mastermix (Thermo Fischer Scientific) according to the manufacturer’s protocol on the qTOWER instrument (Analytical Jena, Germany). .. Plasma was thawed and cfDNA was isolated from 2 mL using the QIAmp circulating nucleic acid kit (Qiagen, Hilden, Germany) according to the manufacturer’s procotol. cfDNA was quantified using the Qubit dsDNA HS Assay kit and the Qubit Fluorometer 3.0 (Thermo Fisher Scientific). .. DNA size distribution was assessed on the Bioanalyzer instrument using the DNA High Sensitivity Kit (Bioanalyzer, CA, USA).

    Article Title: The identification of novel single nucleotide polymorphisms to assist in mapping the spread of Bacillus anthracis across the Southern Caucasus
    Article Snippet: Vegetative cells of B. anthracis from our strain collection were cultured, inactivated and DNA isolated as described previously . .. DNA concentrations were quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) according to the supplier’s protocol.

    Size-exclusion Chromatography:

    Article Title: Prokaryotic community shifts during soil formation on sands in the tundra zone
    Article Snippet: The homogenization step was performed with a Precellys 24 homogenizer (Bertin Technologies, France), program 5 (30 sec, 6500 rev. .. DNA quantity was estimated by Qubit 3 Fluorometer (Thermo Fisher Scientific, USA) using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, USA).


    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: PCR products were then purified with Solid Phase Reverse Immobilization (SPRI) technology using 2.5x Ampure Beads (A63881, Beckman Coulter, Brea, California, USA) and again subjected to 2% agarose gel electrophoresis to control for purification performance. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA).

    Article Title: LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma Cells
    Article Snippet: The libraries were amplified by 14-15 cycles of PCR using HotStarTaq DNA Polymerase (QIAGEN), and purified with 0.9x Agencourt AMPure XP (Beckman Coulter). .. The library quality was assessed using Agilent 2100 Bioanalyzer, and the quantity was measured using Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific).

    Article Title: Analysis of extracellular RNA in cerebrospinal fluid
    Article Snippet: The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems). .. The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems).

    Article Title: Digital Droplet Multiple Displacement Amplification (ddMDA) for Whole Genome Sequencing of Limited DNA Samples
    Article Snippet: The amplified DNA (60 μL of ddMDA or 20 μL of tube MDA) was cleaned using a DNA Clean & Concentrator™-5 (Zymo Research, Irvine, CA) and the control genomic DNA was prepared from 10ml of overnight culture of E.coli K-12 MG1655 using ZR Fungal/Bacterial DNA MiniPrep™ (Zymo Research) by following the manufactures’ protocols. .. After quantification using Qubit® dsDNA HS Assay Kit (Life Technologies, San Diego, CA), one nanogram each of purified DNA from the MDA samples and one nanogram of genomic DNA were prepared for a sequencing library using Nextera XT kit (Illumina, San Diego, CA) and pooled together as the manufacture’s protocol. .. Sixteen picomolar of the pooled library was loaded to MiSeq (Illumina) for a 75-cycle paired-end reads using the v3 chemistry.

    Polymerase Chain Reaction:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: Then we used ExoSAP-IT™ PCR Product Cleanup Reagent (Affymetrix) to remove excess primes and unincorporated nucleotides. .. At last, the library was quantified by Qubit dsDNA HS Assay Kit (Invitrogen).

    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: PCR products were then purified with Solid Phase Reverse Immobilization (SPRI) technology using 2.5x Ampure Beads (A63881, Beckman Coulter, Brea, California, USA) and again subjected to 2% agarose gel electrophoresis to control for purification performance. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA).

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Bisulfite PCR products were run in 2% agarose gel electrophoresis, excised, and extracted using a gel extraction kit (Qiagen). .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Fragmentation was followed by end repair, dA tailing, and sequencing adaptor ligation by ABI 9700 PCR instrument (ABI, USA). .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA). .. Prepared library (750ng) was hybridized with 11μl hybridization block (Allwegene, China), 20μl hybridization buffer (Allwegene, China) and a mix of 5μl RNase block (Invitrogen, USA) and 2μl Probe (Allwegene, China) for overnight (at least 8-16h) at 65°C.

    Article Title: LAG-3 Inhibitory Receptor Expression Identifies Immunosuppressive Natural Regulatory Plasma Cells
    Article Snippet: The libraries were amplified by 14-15 cycles of PCR using HotStarTaq DNA Polymerase (QIAGEN), and purified with 0.9x Agencourt AMPure XP (Beckman Coulter). .. The library quality was assessed using Agilent 2100 Bioanalyzer, and the quantity was measured using Qubit® dsDNA HS Assay Kit (Thermo Fisher Scientific).

    Article Title: The Metabolic Response to a Low Amino Acid Diet is Independent of Diet-Induced Shifts in the Composition of the Gut Microbiome
    Article Snippet: Following PCR, reactions were cleaned using a 0.7x volume of AxyPrep Mag PCR clean-up beads (Axygen Biosciences). .. Quality and quantity of the finished libraries were assessed using an Agilent DNA 1000 kit (Agilent Technologies, Santa Clara, CA) and Qubit® dsDNA HS Assay Kit (ThermoFisher Scientific), respectively.

    Article Title: Unique Molecular Identifiers reveal a novel sequencing artefact with implications for RNA-Seq based gene expression analysis
    Article Snippet: 12 μ l of eluted PCR products were collected. .. 1 μ l of PCR product for each replicate was quantified using a Qubit DNA High Sensitivity Assay Kit (ThermoFisher Scientific Q32851) and the Qubit3.0 fluorometer (ThermoFisher Scientific Q33216), as specified by the manufacturer. .. To assess the size distribution of the libraries, 1 μ l of each library was run on a 2100 Bioanalyzer (Agilent G2939A) using a High Sensitivity DNA Analysis kit (Agilent 5067–4626), as specified by the manufacturers’ instructions.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: The hybridized products were mixed with 200μl nabeads MyOne Streptavidin T1 magnetic beads (Invitrogen, USA) for 30 min at room temperature. .. After two times of washing by wash buffer (Allwegene, China), the mixture was amplified for 16 PCR cycles and quantitatively assessed using Qubit dsDNA HS Assay Kit (Invitrogen, USA). .. Captured libraries were denatured and loaded onto an Illumina cBot instrument at 12 to 16pmol/L for cluster generation according to the manufacturer’s instructions.

    Article Title: Analysis of extracellular RNA in cerebrospinal fluid
    Article Snippet: The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems). .. The samples were quantified using the Qubit dsDNA HS Assay Kit (Q3285; ThermoFisher), then moved forward to a KAPA Hyper Library Preparation Kit (KK8502; KAPA Biosystems).

    Chromatin Immunoprecipitation:

    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA). .. A 1ng sample (0.2 ng/μl) was index library tagged with I5 and I7 primers and fragmented at the same time (tagmented) through a 5-cycle PCR amplification using the Illumina Nextera XT kit, according to Illumina MiSec protocol.

    Article Title: Fast genomic ?ChIP-chip from 1,000 cells
    Article Snippet: Genes solely enriched by only one of the examined marks were selected from the entire set of genes harboring the mark (peak detection with FDR ≤ 0.05) and then removing from that set all genes also possessing a peak for the other mark. .. Because the NanoDrop spectrophotometer does not allow accurate quantification of minute amounts of non-amplified ChIP DNA, we used a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA; catalogue number Q32857) and a Quant-iT dsDNA HS kit (Invitrogen, catalogue number Q32851) for quantification. .. Ten percent of Q2 ChIP DNA samples and whole μChIP inputs were mixed with Quant-iT working solution to a final volume of 200 μl, incubated for 2 minutes and analyzed by the Quant-iT DNA HS program on a Qubit fluorometer.


    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation. .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Article Title: The Dynamic Use of EGFR Mutation Analysis in Cell-Free DNA as a Follow-Up Biomarker during Different Treatment Lines in Non-Small-Cell Lung Cancer Patients
    Article Snippet: Quantification of double-stranded cfDNA was performed using a Qubit 2.0 Fluorometer and the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. .. Concentration was reported in μ g/L and referred to the initial volume of plasma. cfDNA fragment size distribution was analyzed using the DNA High Sensitivity D1000 ScreenTape (size range: 35-1,000 bp) (Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer's instructions in the Agilent 2100 Bioanalyzer (Agilent Technologies).

    Agarose Gel Electrophoresis:

    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: PCR products were then purified with Solid Phase Reverse Immobilization (SPRI) technology using 2.5x Ampure Beads (A63881, Beckman Coulter, Brea, California, USA) and again subjected to 2% agarose gel electrophoresis to control for purification performance. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA).

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Bisulfite PCR products were run in 2% agarose gel electrophoresis, excised, and extracted using a gel extraction kit (Qiagen). .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Quantitative detection of concentration and purity of genomic DNA (gDNA) was performed by NanoDrop ND2000 (Thermo, MA, USA), while the gene integrity was tested by agarose gel electrophoresis. .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).


    Article Title: Prokaryotic community shifts during soil formation on sands in the tundra zone
    Article Snippet: The homogenization step was performed with a Precellys 24 homogenizer (Bertin Technologies, France), program 5 (30 sec, 6500 rev. .. DNA quantity was estimated by Qubit 3 Fluorometer (Thermo Fisher Scientific, USA) using Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, USA).

    Next-Generation Sequencing:

    Article Title: Validation of a high resolution NGS method for detecting spinal muscular atrophy carriers among phase 3 participants in the 1000 Genomes Project
    Article Snippet: DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA). .. DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA).

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Paragraph title: Sample collection, preparation and NGS ... The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).

    dsDNA Assay:

    Article Title: A Dual Platform Approach to Transcript Discovery for the Planarian Schmidtea Mediterranea to Establish RNAseq for Stem Cell and Regeneration Biology
    Article Snippet: Solid whole transcriptome libraries were made as outlined in the Solid Whole transcriptome kit protocol (Applied Biosystems, Cat. No. 4425680). .. The Quant-it HS dsDNA assay kit (Invitrogen, Cat. No. Q32851) was used to measure the concentration of libraries. .. Sequencing was performed on a SOLiD 3 ABi sequencer according to the manufacturers instructions to generate 50 bp reads in colour space.


    Article Title: Validation of a high resolution NGS method for detecting spinal muscular atrophy carriers among phase 3 participants in the 1000 Genomes Project
    Article Snippet: The integrity for both the saliva- and semen-extracted DNA was verified by electrophoresis in 2 % agarose gels. .. DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA). .. NanoDrop OD ratios above 1.7 for A260/280 and above 1.7 for A260/230 indicate high purity of samples.

    Article Title: Fast genomic ?ChIP-chip from 1,000 cells
    Article Snippet: Genes solely enriched by only one of the examined marks were selected from the entire set of genes harboring the mark (peak detection with FDR ≤ 0.05) and then removing from that set all genes also possessing a peak for the other mark. .. Because the NanoDrop spectrophotometer does not allow accurate quantification of minute amounts of non-amplified ChIP DNA, we used a Qubit fluorometer (Invitrogen, Carlsbad, CA, USA; catalogue number Q32857) and a Quant-iT dsDNA HS kit (Invitrogen, catalogue number Q32851) for quantification. .. Ten percent of Q2 ChIP DNA samples and whole μChIP inputs were mixed with Quant-iT working solution to a final volume of 200 μl, incubated for 2 minutes and analyzed by the Quant-iT DNA HS program on a Qubit fluorometer.

    DNA Methylation Assay:

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Paragraph title: DNA methylation analysis of targeted regions ... DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Concentration Assay:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: cDNA for each experiment was amplified by Phusion® High-Fidelity DNA Polymerase (New England BioLabs) using primers based on Illumina primers for TruSeq Small RNA Library, with a final concentration of 0.4 μM (primers were purchased from IDT and are shown in ). .. At last, the library was quantified by Qubit dsDNA HS Assay Kit (Invitrogen).

    Article Title: Non-invasive genotyping with a massively parallel sequencing panel for the detection of SNPs in HPA-axis genes
    Article Snippet: PCR products were then purified with Solid Phase Reverse Immobilization (SPRI) technology using 2.5x Ampure Beads (A63881, Beckman Coulter, Brea, California, USA) and again subjected to 2% agarose gel electrophoresis to control for purification performance. .. DNA concentration was measured with a Qubit 3.0 (Q32854, Thermo Fisher Scientific, Waltham, Massachusetts, USA). .. To test if our primers are target-specific, all 41 SPRI-purified amplicons of two individuals, acquired via PCR from faecal DNA extracts, were sequenced using Sanger technology.

    Article Title: Validation of a high resolution NGS method for detecting spinal muscular atrophy carriers among phase 3 participants in the 1000 Genomes Project
    Article Snippet: The integrity for both the saliva- and semen-extracted DNA was verified by electrophoresis in 2 % agarose gels. .. DNA concentration and quality were measured with the Qubit dsDNA HS Assay kit (Life Technologies, Grand Island NY, USA) and the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington DE, USA). .. NanoDrop OD ratios above 1.7 for A260/280 and above 1.7 for A260/230 indicate high purity of samples.

    Article Title: A Dual Platform Approach to Transcript Discovery for the Planarian Schmidtea Mediterranea to Establish RNAseq for Stem Cell and Regeneration Biology
    Article Snippet: Solid whole transcriptome libraries were made as outlined in the Solid Whole transcriptome kit protocol (Applied Biosystems, Cat. No. 4425680). .. The Quant-it HS dsDNA assay kit (Invitrogen, Cat. No. Q32851) was used to measure the concentration of libraries. .. Sequencing was performed on a SOLiD 3 ABi sequencer according to the manufacturers instructions to generate 50 bp reads in colour space.

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Bisulfite PCR products were run in 2% agarose gel electrophoresis, excised, and extracted using a gel extraction kit (Qiagen). .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation. .. Nextera libraries preparation was based on the manufacturer’s instructions (Illumina).

    Article Title: Impact of complement component 3/4/5 single nucleotide polymorphisms on renal transplant recipients with antibody-mediated rejection
    Article Snippet: Quantitative detection of concentration and purity of genomic DNA (gDNA) was performed by NanoDrop ND2000 (Thermo, MA, USA), while the gene integrity was tested by agarose gel electrophoresis. .. The adapter-ligated DNA was amplified by selective, limited-cycle PCR for 5 cycles and then quantitatively analyzed using Qubit dsDNA HS Assay Kit (Invitrogen, USA).

    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: PCR products were visualized by 0.8% agarose gel electrophoresis, excised, purified, and Sanger-sequenced as described previously [ ]. .. Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA). .. A 1ng sample (0.2 ng/μl) was index library tagged with I5 and I7 primers and fragmented at the same time (tagmented) through a 5-cycle PCR amplification using the Illumina Nextera XT kit, according to Illumina MiSec protocol.

    High Throughput Screening Assay:

    Article Title: High Prevalence of Hepatitis E Virus in Swedish Moose – A Phylogenetic Characterization and Comparison of the Virus from Different Regions
    Article Snippet: Paragraph title: Retrieving moose HEV genome with high throughput sequencing ... Triplicates of the liver sample positive for moose HEV RNA [ ], were processed for the Illumina MiSeq platform sequencing as follows: The synthesized dsDNA was diluted and prepared with Qubit dsDNA HS assay kit (Life technologies, USA) according to manufacturer’s protocol and the concentration was measured with Qubit 2.0 Fluorometer (Life technologies, USA).

    Gel Extraction:

    Article Title: Homeobox oncogene activation by pan-cancer DNA hypermethylation
    Article Snippet: Bisulfite PCR products were run in 2% agarose gel electrophoresis, excised, and extracted using a gel extraction kit (Qiagen). .. DNA concentration of gel-extracted products was measured using qubit dsDNA HS assay kit (Life Technologies) and adjusted to 0.2 ng/μL for Nextera libraries preparation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher qubit dsdna hs assay kit
    Qubit Dsdna Hs Assay Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qubit dsdna hs assay kit/product/Thermo Fisher
    Average 99 stars, based on 322 article reviews
    Price from $9.99 to $1999.99
    qubit dsdna hs assay kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results