quantitect reverse transcription kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QuantiTect Rev Transcription Kit
    Description:
    For fast cDNA synthesis enabling sensitive real time two step RT PCR for gene expression analysis Kit contents Qiagen QuantiTect Reverse Transcription Kit 10 x 20L rxns RNA Template Sample Two step cDNA Production Genomic DNA Digestion Reaction Type For Fast cDNA Synthesis Enabling Sensitive Real time Two step RT PCR for Gene Expression Analysis Includes 10 x 20L rxns 100L 7x gDNA Wipeout Buffer 10L Quantiscript Reverse Transcriptase 200L 5x Quantiscript RT Buffer 50L RT Primer Mix 1 9mL RNase free Water Benefits cDNA synthesis and gDNA removal in only 20 minutes High cDNA yields even from low abundance transcripts cDNA synthesis from 5 and 3 regions of transcripts No need to design RNA specific primers or prob
    Catalog Number:
    205310
    Price:
    101
    Category:
    QuantiTect Reverse Transcription Kit
    Buy from Supplier


    Structured Review

    Qiagen quantitect reverse transcription kit
    QuantiTect Rev Transcription Kit
    For fast cDNA synthesis enabling sensitive real time two step RT PCR for gene expression analysis Kit contents Qiagen QuantiTect Reverse Transcription Kit 10 x 20L rxns RNA Template Sample Two step cDNA Production Genomic DNA Digestion Reaction Type For Fast cDNA Synthesis Enabling Sensitive Real time Two step RT PCR for Gene Expression Analysis Includes 10 x 20L rxns 100L 7x gDNA Wipeout Buffer 10L Quantiscript Reverse Transcriptase 200L 5x Quantiscript RT Buffer 50L RT Primer Mix 1 9mL RNase free Water Benefits cDNA synthesis and gDNA removal in only 20 minutes High cDNA yields even from low abundance transcripts cDNA synthesis from 5 and 3 regions of transcripts No need to design RNA specific primers or prob
    https://www.bioz.com/result/quantitect reverse transcription kit/product/Qiagen
    Average 99 stars, based on 419 article reviews
    Price from $9.99 to $1999.99
    quantitect reverse transcription kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival, et al. Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival"

    Article Title: Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival, et al. Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival

    Journal: American Journal of Transplantation

    doi: 10.1111/ajt.14765

    RT q PCR analysis showing relative gene expression levels of IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, TNF ‐α, and IFN ‐γ in allograft skin (A – H) and muscle (I – P). For RT q PCR , a total volume of 15 μl per reaction was used containing 50 ng cDNA template, 1.5 μl QuantiTect Primer Assay (Qiagen), 7.5 μl QuantiTect SYBR green PCR kit (Qiagen), and 5 μl ddH2O. Primers for IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, IFN ‐γ, and TNF ‐α were obtained from Qiagen. Cycling conditions included a hot start activation (5 minutes, 95°C), 40 cycles of 10 seconds denaturation (95°C), and annealing and extension (30 seconds, 60°C). Amplicons were quantified with the comparative threshold cycle ( CT ) method; data acquisition was performed using the 7500 System SDS Software Version 2.0.5 (Applied Biosystems). Amplification specificity was checked using melting curve according to the manufacturer's instructions. All samples were measured in duplicate and respective results were averaged. A–P, In allograft skin (A–H) and muscle (I–P) no significant differences in relative gene expression of cytokines was observed between anti‐ IL ‐1β‐treatment groups 3 and 4 and group 2 controls. Expression levels of all markers were normalized to those of group 2
    Figure Legend Snippet: RT q PCR analysis showing relative gene expression levels of IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, TNF ‐α, and IFN ‐γ in allograft skin (A – H) and muscle (I – P). For RT q PCR , a total volume of 15 μl per reaction was used containing 50 ng cDNA template, 1.5 μl QuantiTect Primer Assay (Qiagen), 7.5 μl QuantiTect SYBR green PCR kit (Qiagen), and 5 μl ddH2O. Primers for IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, IFN ‐γ, and TNF ‐α were obtained from Qiagen. Cycling conditions included a hot start activation (5 minutes, 95°C), 40 cycles of 10 seconds denaturation (95°C), and annealing and extension (30 seconds, 60°C). Amplicons were quantified with the comparative threshold cycle ( CT ) method; data acquisition was performed using the 7500 System SDS Software Version 2.0.5 (Applied Biosystems). Amplification specificity was checked using melting curve according to the manufacturer's instructions. All samples were measured in duplicate and respective results were averaged. A–P, In allograft skin (A–H) and muscle (I–P) no significant differences in relative gene expression of cytokines was observed between anti‐ IL ‐1β‐treatment groups 3 and 4 and group 2 controls. Expression levels of all markers were normalized to those of group 2

    Techniques Used: Polymerase Chain Reaction, Expressing, SYBR Green Assay, Activation Assay, Software, Amplification

    2) Product Images from "Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties"

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0145749

    RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .
    Figure Legend Snippet: RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Agarose Gel Electrophoresis

    3) Product Images from "HU Protein Affects Transcription of Surface Polysaccharide Synthesis Genes in Porphyromonas gingivalis ▿ ▿ †"

    Article Title: HU Protein Affects Transcription of Surface Polysaccharide Synthesis Genes in Porphyromonas gingivalis ▿ ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00106-10

    RT-PCR analysis to evaluate transcriptional linkage of PG0104 to the 5′ end of the capsule operon and transcription through the hairpin region. Total RNA was isolated from the wild-type strain, and cDNA was generated as described in Materials and Methods with the QuantiTect reverse transcription kit. In the subsequent PCRs, the following primer combinations were used: RT_end104 (lane 1), RT_link104 (lane 2), RT_hairpin (lane 3), RT_link106 (lane 4), RT_start106 (lane 5). The figure demonstrates linkage of PG0104 to the hairpin, transcription of the hairpin, and linkage of the hairpin to PG0106. M, DNA size markers.
    Figure Legend Snippet: RT-PCR analysis to evaluate transcriptional linkage of PG0104 to the 5′ end of the capsule operon and transcription through the hairpin region. Total RNA was isolated from the wild-type strain, and cDNA was generated as described in Materials and Methods with the QuantiTect reverse transcription kit. In the subsequent PCRs, the following primer combinations were used: RT_end104 (lane 1), RT_link104 (lane 2), RT_hairpin (lane 3), RT_link106 (lane 4), RT_start106 (lane 5). The figure demonstrates linkage of PG0104 to the hairpin, transcription of the hairpin, and linkage of the hairpin to PG0106. M, DNA size markers.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Generated

    4) Product Images from "Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties"

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0145749

    RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .
    Figure Legend Snippet: RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Agarose Gel Electrophoresis

    5) Product Images from "FITC Conjugation Markedly Enhances Hepatic Clearance of N-Formyl Peptides"

    Article Title: FITC Conjugation Markedly Enhances Hepatic Clearance of N-Formyl Peptides

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0160602

    Expression of FPR1 mRNA and protein in liver and isolated liver cells. (A) Total RNA was isolated from pelleted cells and whole tissue. cDNA was synthesized from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit. PCR was performed in a 25 μl reaction mixture containing 2 μl of cDNA of hHeps (1), hLSECs (2), human liver (3), mHeps (4), mLSECs (5), and mouse liver (6). The house keeping genes were β-actin and GAPDH. (B) Homogenized tissue specimens and cells were lysed in a RIPA lysis buffer with protease and phosphatase inhibitor cocktails. Equal amounts of protein were loaded into NuPAGE Novex 4–12% Bis-Tris gel, then blotted onto PVDF membrane and probed with antibodies against FPR1 and β-actin.
    Figure Legend Snippet: Expression of FPR1 mRNA and protein in liver and isolated liver cells. (A) Total RNA was isolated from pelleted cells and whole tissue. cDNA was synthesized from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit. PCR was performed in a 25 μl reaction mixture containing 2 μl of cDNA of hHeps (1), hLSECs (2), human liver (3), mHeps (4), mLSECs (5), and mouse liver (6). The house keeping genes were β-actin and GAPDH. (B) Homogenized tissue specimens and cells were lysed in a RIPA lysis buffer with protease and phosphatase inhibitor cocktails. Equal amounts of protein were loaded into NuPAGE Novex 4–12% Bis-Tris gel, then blotted onto PVDF membrane and probed with antibodies against FPR1 and β-actin.

    Techniques Used: Expressing, Isolation, Synthesized, Polymerase Chain Reaction, Lysis

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Tet1 and Tet2 Protect DNA Methylation Canyons against Hypermethylation
    Article Snippet: .. RNA was extracted from frozen cell pellets using TRIzol (Invitrogen), cDNA was synthesized from 1 μg RNA (QuantiTect reverse transcription kit; Qiagen), and quantitative RT-PCRs were performed in triplicate with mouse β- actin and Gapdh as reference genes using ABsolute qPCR SYBR green Mix (Thermo Fisher) and the Lightcycler 480 system (Roche) (for primer sequences, see Table S4 in the supplemental material). .. For dot blots, 1 μg of sonicated genomic DNA was denatured and neutralized, and serial dilutions were transferred to a nylon membrane (GE Healthcare) using a dot blot apparatus (Bio-Rad).

    Synthesized:

    Article Title: Tet1 and Tet2 Protect DNA Methylation Canyons against Hypermethylation
    Article Snippet: .. RNA was extracted from frozen cell pellets using TRIzol (Invitrogen), cDNA was synthesized from 1 μg RNA (QuantiTect reverse transcription kit; Qiagen), and quantitative RT-PCRs were performed in triplicate with mouse β- actin and Gapdh as reference genes using ABsolute qPCR SYBR green Mix (Thermo Fisher) and the Lightcycler 480 system (Roche) (for primer sequences, see Table S4 in the supplemental material). .. For dot blots, 1 μg of sonicated genomic DNA was denatured and neutralized, and serial dilutions were transferred to a nylon membrane (GE Healthcare) using a dot blot apparatus (Bio-Rad).

    Article Title: FITC Conjugation Markedly Enhances Hepatic Clearance of N-Formyl Peptides
    Article Snippet: .. The quantity and quality of the extracted RNA was determined by the use of a spectrophotometer NanoDrop ND-1000 (Wilmington, DE, USA). cDNA was synthesized from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer's protocol. .. Quantitative PCR assay PCR was performed in a 25 μl reaction mixture containing 2 μl of cDNA (from isolated RNA), 12.5 μl of the JumpStart REDTaq® Ready Mix (Sigma-Aldrich), 0.5 μl of 10 μM forward and reverse primers, and 9.5 μl of ddH2 O.

    Spectrophotometry:

    Article Title: FITC Conjugation Markedly Enhances Hepatic Clearance of N-Formyl Peptides
    Article Snippet: .. The quantity and quality of the extracted RNA was determined by the use of a spectrophotometer NanoDrop ND-1000 (Wilmington, DE, USA). cDNA was synthesized from 1 μg of total RNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer's protocol. .. Quantitative PCR assay PCR was performed in a 25 μl reaction mixture containing 2 μl of cDNA (from isolated RNA), 12.5 μl of the JumpStart REDTaq® Ready Mix (Sigma-Aldrich), 0.5 μl of 10 μM forward and reverse primers, and 9.5 μl of ddH2 O.

    Article Title: Primary Macrophage Chemotaxis Induced by Cannabinoid Receptor 2 Agonists Occurs Independently of the CB2 Receptor
    Article Snippet: .. RNA concentration and quality was determined using a NanoDrop™ ND-1000 spectrophotometer. cDNA was produced from the purified RNA using the QuantiTect® Reverse Transcription kit (Qiagen) following the manufacturer’s protocol. .. Real-time PCR Expression of actin, CB2 , GPR55 and GPR18 in enriched bio-gel macrophages was determined using the following primers (5’ > 3’): Actin Fwd CCAACAGCAGACTTCCAGGATT, Actin Rev CTGGCAAGAAGGAGTGGTAACTG, CB2 Fwd GGTCCTCTCAGCATTGATTTC, CB2 Rev GCCCAGTAGGTAGTCGTTAG, GPR55 Fwd AACCTTCATCGGCTCCTCT, GPR55 Rev ATTCTTCCTGTCCCACTCCT, GPR18 Fwd CGACCAAGAAAAGAACCACAG, GPR18 Rev AATGAAAGCAAGAAGCCACA and SYBR Select PCR master mix (Life Technologies).

    Purification:

    Article Title: Primary Macrophage Chemotaxis Induced by Cannabinoid Receptor 2 Agonists Occurs Independently of the CB2 Receptor
    Article Snippet: .. RNA concentration and quality was determined using a NanoDrop™ ND-1000 spectrophotometer. cDNA was produced from the purified RNA using the QuantiTect® Reverse Transcription kit (Qiagen) following the manufacturer’s protocol. .. Real-time PCR Expression of actin, CB2 , GPR55 and GPR18 in enriched bio-gel macrophages was determined using the following primers (5’ > 3’): Actin Fwd CCAACAGCAGACTTCCAGGATT, Actin Rev CTGGCAAGAAGGAGTGGTAACTG, CB2 Fwd GGTCCTCTCAGCATTGATTTC, CB2 Rev GCCCAGTAGGTAGTCGTTAG, GPR55 Fwd AACCTTCATCGGCTCCTCT, GPR55 Rev ATTCTTCCTGTCCCACTCCT, GPR18 Fwd CGACCAAGAAAAGAACCACAG, GPR18 Rev AATGAAAGCAAGAAGCCACA and SYBR Select PCR master mix (Life Technologies).

    SYBR Green Assay:

    Article Title: Tet1 and Tet2 Protect DNA Methylation Canyons against Hypermethylation
    Article Snippet: .. RNA was extracted from frozen cell pellets using TRIzol (Invitrogen), cDNA was synthesized from 1 μg RNA (QuantiTect reverse transcription kit; Qiagen), and quantitative RT-PCRs were performed in triplicate with mouse β- actin and Gapdh as reference genes using ABsolute qPCR SYBR green Mix (Thermo Fisher) and the Lightcycler 480 system (Roche) (for primer sequences, see Table S4 in the supplemental material). .. For dot blots, 1 μg of sonicated genomic DNA was denatured and neutralized, and serial dilutions were transferred to a nylon membrane (GE Healthcare) using a dot blot apparatus (Bio-Rad).

    Concentration Assay:

    Article Title: Primary Macrophage Chemotaxis Induced by Cannabinoid Receptor 2 Agonists Occurs Independently of the CB2 Receptor
    Article Snippet: .. RNA concentration and quality was determined using a NanoDrop™ ND-1000 spectrophotometer. cDNA was produced from the purified RNA using the QuantiTect® Reverse Transcription kit (Qiagen) following the manufacturer’s protocol. .. Real-time PCR Expression of actin, CB2 , GPR55 and GPR18 in enriched bio-gel macrophages was determined using the following primers (5’ > 3’): Actin Fwd CCAACAGCAGACTTCCAGGATT, Actin Rev CTGGCAAGAAGGAGTGGTAACTG, CB2 Fwd GGTCCTCTCAGCATTGATTTC, CB2 Rev GCCCAGTAGGTAGTCGTTAG, GPR55 Fwd AACCTTCATCGGCTCCTCT, GPR55 Rev ATTCTTCCTGTCCCACTCCT, GPR18 Fwd CGACCAAGAAAAGAACCACAG, GPR18 Rev AATGAAAGCAAGAAGCCACA and SYBR Select PCR master mix (Life Technologies).

    Quantitative RT-PCR:

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties
    Article Snippet: .. Expression studies by RT-PCR and RT-qPCR Expression studies of a few representative AFL and BRL genes relevant to the study’s objectives were performed by RT-PCR and RT-qPCR using the cDNA prepared with QuantiTect Reverse-Transcription Kit (Qiagen), as described above. .. Gene-specific primers not less than 20 nt long and with Tm values no less than 59.0°C were designed using the NCBI Primer Blast software ( http://www.ncbi.nlm.nih.gov/tools/primer-blast ).

    Expressing:

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties
    Article Snippet: .. Expression studies by RT-PCR and RT-qPCR Expression studies of a few representative AFL and BRL genes relevant to the study’s objectives were performed by RT-PCR and RT-qPCR using the cDNA prepared with QuantiTect Reverse-Transcription Kit (Qiagen), as described above. .. Gene-specific primers not less than 20 nt long and with Tm values no less than 59.0°C were designed using the NCBI Primer Blast software ( http://www.ncbi.nlm.nih.gov/tools/primer-blast ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties
    Article Snippet: .. Expression studies by RT-PCR and RT-qPCR Expression studies of a few representative AFL and BRL genes relevant to the study’s objectives were performed by RT-PCR and RT-qPCR using the cDNA prepared with QuantiTect Reverse-Transcription Kit (Qiagen), as described above. .. Gene-specific primers not less than 20 nt long and with Tm values no less than 59.0°C were designed using the NCBI Primer Blast software ( http://www.ncbi.nlm.nih.gov/tools/primer-blast ).

    Produced:

    Article Title: Primary Macrophage Chemotaxis Induced by Cannabinoid Receptor 2 Agonists Occurs Independently of the CB2 Receptor
    Article Snippet: .. RNA concentration and quality was determined using a NanoDrop™ ND-1000 spectrophotometer. cDNA was produced from the purified RNA using the QuantiTect® Reverse Transcription kit (Qiagen) following the manufacturer’s protocol. .. Real-time PCR Expression of actin, CB2 , GPR55 and GPR18 in enriched bio-gel macrophages was determined using the following primers (5’ > 3’): Actin Fwd CCAACAGCAGACTTCCAGGATT, Actin Rev CTGGCAAGAAGGAGTGGTAACTG, CB2 Fwd GGTCCTCTCAGCATTGATTTC, CB2 Rev GCCCAGTAGGTAGTCGTTAG, GPR55 Fwd AACCTTCATCGGCTCCTCT, GPR55 Rev ATTCTTCCTGTCCCACTCCT, GPR18 Fwd CGACCAAGAAAAGAACCACAG, GPR18 Rev AATGAAAGCAAGAAGCCACA and SYBR Select PCR master mix (Life Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen quantitect reverse transcription kit
    RT q PCR analysis showing relative gene expression levels of IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, TNF ‐α, and IFN ‐γ in allograft skin (A – H) and muscle (I – P). For RT q PCR , a total volume of 15 μl per reaction was used containing 50 ng cDNA template, 1.5 μl <t>QuantiTect</t> Primer Assay (Qiagen), 7.5 μl QuantiTect SYBR green PCR kit (Qiagen), and 5 μl ddH2O. Primers for IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, IFN ‐γ, and TNF ‐α were obtained from Qiagen. Cycling conditions included a hot start activation (5 minutes, 95°C), 40 cycles of 10 seconds denaturation (95°C), and annealing and extension (30 seconds, 60°C). Amplicons were quantified with the comparative threshold cycle ( CT ) method; data acquisition was performed using the 7500 System SDS Software Version 2.0.5 (Applied Biosystems). Amplification specificity was checked using melting curve according to the manufacturer's instructions. All samples were measured in duplicate and respective results were averaged. A–P, In allograft skin (A–H) and muscle (I–P) no significant differences in relative gene expression of cytokines was observed between anti‐ IL ‐1β‐treatment groups 3 and 4 and group 2 controls. Expression levels of all markers were normalized to those of group 2
    Quantitect Reverse Transcription Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 419 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitect reverse transcription kit/product/Qiagen
    Average 99 stars, based on 419 article reviews
    Price from $9.99 to $1999.99
    quantitect reverse transcription kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Qiagen reverse transcription pcr
    Elevated unspliced mRNA levels in high-producing fibroblasts supports transcriptional regulation of the differential IL-6 response between synovial fibroblasts. Unspliced ( A and B ) and mature ( C ) IL-6 mRNA expression for two high IL-6–expressing (OA4, OA6) and two low-expressing (RA341, OA502) was determined by <t>qRT-PCR</t> and normalized to the housekeeping gene HPRT. Unspliced primer 1 ( A ) amplifies a region of intron 1. Unspliced primer 2 ( B ) amplifies a region of intron 2. Unspliced mRNA expression averaged 3.5 ± 1.6% of mature mRNA. Primers directed against the IL-6 proximal promoter showed low contamination with genomic DNA, averaging 1.7 ± 2.4% of unspliced mRNA.
    Reverse Transcription Pcr, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcription pcr/product/Qiagen
    Average 99 stars, based on 78 article reviews
    Price from $9.99 to $1999.99
    reverse transcription pcr - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    RT q PCR analysis showing relative gene expression levels of IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, TNF ‐α, and IFN ‐γ in allograft skin (A – H) and muscle (I – P). For RT q PCR , a total volume of 15 μl per reaction was used containing 50 ng cDNA template, 1.5 μl QuantiTect Primer Assay (Qiagen), 7.5 μl QuantiTect SYBR green PCR kit (Qiagen), and 5 μl ddH2O. Primers for IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, IFN ‐γ, and TNF ‐α were obtained from Qiagen. Cycling conditions included a hot start activation (5 minutes, 95°C), 40 cycles of 10 seconds denaturation (95°C), and annealing and extension (30 seconds, 60°C). Amplicons were quantified with the comparative threshold cycle ( CT ) method; data acquisition was performed using the 7500 System SDS Software Version 2.0.5 (Applied Biosystems). Amplification specificity was checked using melting curve according to the manufacturer's instructions. All samples were measured in duplicate and respective results were averaged. A–P, In allograft skin (A–H) and muscle (I–P) no significant differences in relative gene expression of cytokines was observed between anti‐ IL ‐1β‐treatment groups 3 and 4 and group 2 controls. Expression levels of all markers were normalized to those of group 2

    Journal: American Journal of Transplantation

    Article Title: Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival, et al. Subcutaneous administration of a neutralizing IL‐1β antibody prolongs limb allograft survival

    doi: 10.1111/ajt.14765

    Figure Lengend Snippet: RT q PCR analysis showing relative gene expression levels of IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, TNF ‐α, and IFN ‐γ in allograft skin (A – H) and muscle (I – P). For RT q PCR , a total volume of 15 μl per reaction was used containing 50 ng cDNA template, 1.5 μl QuantiTect Primer Assay (Qiagen), 7.5 μl QuantiTect SYBR green PCR kit (Qiagen), and 5 μl ddH2O. Primers for IL ‐1α, IL ‐1β, IL ‐2, IL ‐6, IL ‐10, IL ‐17A, IFN ‐γ, and TNF ‐α were obtained from Qiagen. Cycling conditions included a hot start activation (5 minutes, 95°C), 40 cycles of 10 seconds denaturation (95°C), and annealing and extension (30 seconds, 60°C). Amplicons were quantified with the comparative threshold cycle ( CT ) method; data acquisition was performed using the 7500 System SDS Software Version 2.0.5 (Applied Biosystems). Amplification specificity was checked using melting curve according to the manufacturer's instructions. All samples were measured in duplicate and respective results were averaged. A–P, In allograft skin (A–H) and muscle (I–P) no significant differences in relative gene expression of cytokines was observed between anti‐ IL ‐1β‐treatment groups 3 and 4 and group 2 controls. Expression levels of all markers were normalized to those of group 2

    Article Snippet: One micrograms of total RNA was reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen).

    Techniques: Polymerase Chain Reaction, Expressing, SYBR Green Assay, Activation Assay, Software, Amplification

    RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .

    Journal: PLoS ONE

    Article Title: Identification and Characterization of Differentially Expressed Genes in Inferior and Superior Spikelets of Rice Cultivars with Contrasting Panicle-Compactness and Grain-Filling Properties

    doi: 10.1371/journal.pone.0145749

    Figure Lengend Snippet: RT-PCR of total RNA isolated from superior (A) and inferior (B) spikelets of O. sativa cv. Mahalaxmi panicles on 0, 3 and 6 days after anthesis (DAA or simply D) for analysis of genes overexpressed in the superior compared with inferior spikelets (I) and genes overexpressed in the inferior compared with superior spikelets (II). Total RNA was isolated using TRIzol (Life Technologies) and reverse-transcribed using QuantiTect Reverse Transcription Kit (Qiagen). Each gene was amplified using gene-specific primers designed using Primer Blast. Actin and 18S rRNA were amplified for 30 and 25 cycles, respectively, as positive and loading controls. The other reactions were performed for 30 cycles, and the amplified products were separated on an agarose gel containing ETBR and visualized and photographed using a Gel Doc (Bio-Rad). The primer sequences are provided in S2 Table .

    Article Snippet: QuantiTect Reverse Transcription Kit (Qiagen), which provides an optimized mixture of random primers and oligo-dT and gDNA Wipeout Buffer, was used to convert the RNA to cDNA.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification, Agarose Gel Electrophoresis

    RT-PCR analysis to evaluate transcriptional linkage of PG0104 to the 5′ end of the capsule operon and transcription through the hairpin region. Total RNA was isolated from the wild-type strain, and cDNA was generated as described in Materials and Methods with the QuantiTect reverse transcription kit. In the subsequent PCRs, the following primer combinations were used: RT_end104 (lane 1), RT_link104 (lane 2), RT_hairpin (lane 3), RT_link106 (lane 4), RT_start106 (lane 5). The figure demonstrates linkage of PG0104 to the hairpin, transcription of the hairpin, and linkage of the hairpin to PG0106. M, DNA size markers.

    Journal: Journal of Bacteriology

    Article Title: HU Protein Affects Transcription of Surface Polysaccharide Synthesis Genes in Porphyromonas gingivalis ▿ ▿ †

    doi: 10.1128/JB.00106-10

    Figure Lengend Snippet: RT-PCR analysis to evaluate transcriptional linkage of PG0104 to the 5′ end of the capsule operon and transcription through the hairpin region. Total RNA was isolated from the wild-type strain, and cDNA was generated as described in Materials and Methods with the QuantiTect reverse transcription kit. In the subsequent PCRs, the following primer combinations were used: RT_end104 (lane 1), RT_link104 (lane 2), RT_hairpin (lane 3), RT_link106 (lane 4), RT_start106 (lane 5). The figure demonstrates linkage of PG0104 to the hairpin, transcription of the hairpin, and linkage of the hairpin to PG0106. M, DNA size markers.

    Article Snippet: For synthesis of shorter cDNA fragments, the QuantiTect reverse transcription kit (Qiagen), which provides integrated genomic DNA removal, was used.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Generated

    Elevated unspliced mRNA levels in high-producing fibroblasts supports transcriptional regulation of the differential IL-6 response between synovial fibroblasts. Unspliced ( A and B ) and mature ( C ) IL-6 mRNA expression for two high IL-6–expressing (OA4, OA6) and two low-expressing (RA341, OA502) was determined by qRT-PCR and normalized to the housekeeping gene HPRT. Unspliced primer 1 ( A ) amplifies a region of intron 1. Unspliced primer 2 ( B ) amplifies a region of intron 2. Unspliced mRNA expression averaged 3.5 ± 1.6% of mature mRNA. Primers directed against the IL-6 proximal promoter showed low contamination with genomic DNA, averaging 1.7 ± 2.4% of unspliced mRNA.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Genetic polymorphism directs IL-6 expression in fibroblasts but not selected other cell types

    doi: 10.1073/pnas.1520861112

    Figure Lengend Snippet: Elevated unspliced mRNA levels in high-producing fibroblasts supports transcriptional regulation of the differential IL-6 response between synovial fibroblasts. Unspliced ( A and B ) and mature ( C ) IL-6 mRNA expression for two high IL-6–expressing (OA4, OA6) and two low-expressing (RA341, OA502) was determined by qRT-PCR and normalized to the housekeeping gene HPRT. Unspliced primer 1 ( A ) amplifies a region of intron 1. Unspliced primer 2 ( B ) amplifies a region of intron 2. Unspliced mRNA expression averaged 3.5 ± 1.6% of mature mRNA. Primers directed against the IL-6 proximal promoter showed low contamination with genomic DNA, averaging 1.7 ± 2.4% of unspliced mRNA.

    Article Snippet: RNA was isolated by using manufacturer’s instructions (RNeasy Micro kit; Qiagen) and analyzed by quantitative reverse-transcription PCR (qRT-PCR; QuantiTect Reverse Transcription kit, Qiagen; Brilliant III Ultra-Fast SYBR Green, Agilent).

    Techniques: Expressing, Quantitative RT-PCR