quantitative polymerase chain reaction qpcr  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Roche quantitative polymerase chain reaction qpcr
    Graphical representation of quantitative <t>PCR</t> results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Quantitative Polymerase Chain Reaction Qpcr, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative polymerase chain reaction qpcr/product/Roche
    Average 92 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    quantitative polymerase chain reaction qpcr - by Bioz Stars, 2020-09
    92/100 stars

    Images

    1) Product Images from "First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression"

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression

    Journal:

    doi: 10.1007/s12192-009-0139-4

    Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Figure Legend Snippet: Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Figure Legend Snippet: Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Imprinting of Mesenchymal Stromal Cell Transcriptome Persists even after Treatment in Patients with Multiple Myeloma
    Article Snippet: .. Quantitative PCR (qPCR) was performed using the LightCycler® 480 Probes Master on a LightCycler® (Roche, Bâle, Swiss), using the Taqman probes (Thermofisher, Waltham, MA, USA) ( ). .. The expression of individual genes was normalized to GAPDH, through the ΔΔCt method.

    Article Title: Characterization of a Homozygous Deletion of Steroid Hormone Biosynthesis Genes in Horse Chromosome 29 as a Risk Factor for Disorders of Sex Development and Reproduction
    Article Snippet: .. Quantitative PCR (qPCR) experiments were performed with LightCycler® 480 (Roche Diagnostics) in triplicate assays and triplicate 20 µL reactions, each containing 50 ng of template DNA, 10 μM primers, and the Hot FirePol® EvaGreen® qPCR Mix Plus (Solis BioDyne). ..

    Article Title: Interferon γ and α Have Differential Effects on SAMHD1, a Potent Antiviral Protein, in Feline Lymphocytes
    Article Snippet: .. Quantitative PCR (qPCR) was performed using a LightCycler 480 instrument (Roche Life Science, Laval, QC, Canada). .. The reaction mixture consisted of 10 μL SYBR Green Master Mix (Roche, Mississauga, ON, Canada), 0.5 μL of forward and reverse primer (concentration 10 μM), and 2 μL of cDNA in a final volume of 20 μL of PCR grade water.

    Article Title: Defective Escape Behavior in DEAH-Box RNA Helicase Mutants Improved by Restoring Glycine Receptor Expression
    Article Snippet: .. Quantitative PCR (qPCR) was performed using a KAPA SYBR Fast qPCR Kit (Kapa Biosystems). .. The following PCR primers were used: GlyR α1: CTCTCTTCCCAAGGTCTCG, GCCTCGTCCTCCTTCAG; GlyR α2: CTGTACAGCATCAGGCTGAC, TGGTGTATCCGAAGCTCTCC; GlyR α3: GCAGCTGGAGAGTTTTGGTTAC, GCATGTGAACTTGCCTGTGTTG; GlyR α4a: GAATGTGCTTTACAGCATCAGGC, CGTTCATGGTGTAGCCAAAGC; GlyR α4b: GTATAGCATCAGACTCACGCTG, CAGATCATTCATAGTGTAGCCAAAGC; GlyR βa: CGGCCGAATTTCAAAGGAATC, GCAGGAAGATATTCACACGATAATCCATT; GlyR βb: GTTCTCATCAGCATGAGGTTGTC, GTCATCTGTGGTGTAACCAAAGC; Gephyrin a: GAGTGTTTATGAAGCCAGGTTTGC, CTGACACTGGATTACCTGGAAG; Gephyrin b: GGATGCTCTCCAGACCTG, GATGAACTGGAAGCATTCCTGTG; GlyT1: CTACAGAAATGGAGGAGGTGC, CATTCCATAGCCCACACCTTTAAAC; GlyT2: GGTCGGAATCTCTTACATTTATGG, GTACAGACTAAGTGCCAAAATGAATGTG; vesicular inhibitory amino acid transporter (VIAAT): AACGCGATCCAGGGCATG, GAGGATTTTGCCTGTGTAGCAG; and Actb1: CCTTCCTTCCTGGGTATGG, GGGGGAGCAATGATCTTGATC.

    Article Title: Role of Sortase A in Lactobacillus gasseri Kx110A1 Adhesion to Gastric Epithelial Cells and Competitive Exclusion of Helicobacter pylori
    Article Snippet: .. Quantitative PCR (qPCR) was performed using a LightCycler 480 (Roche) and a SYBR Green I Master kit (Roche). .. The PCR program was as follows: initial denaturation at 95°C for 10 min, followed by amplification for 40 cycles with denaturation at 95°C for 10 s; annealing at 54°C for 20 s; and extension at 72°C for 20 s. The expression was normalized to that of the housekeeping gene gyrB encoding DNA gyrase B ( ).

    Article Title: A genome compendium reveals diverse metabolic adaptations of Antarctic soil microorganisms
    Article Snippet: .. Quantitative PCR (qPCR) using a 96-well plate in a pre-heated LightCycler 480 Instrument II (Roche, Basel, Switzerland) was used to quantify the copy number of the 16S rRNA genes in the samples as previously described . .. For each sample, the V4 hypervariable region for 16S rRNA gene was amplified using the universal Earth Microbiome Project primer pairs F515 (Parada) and R806 (Apprill) .

    Article Title: GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer, et al. GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer
    Article Snippet: .. Quantitative PCR (qPCR) was undertaken using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) as previously described. .. The expression levels of general transcription factor 2I repeat domain‐containing protein 1 (GTF2IRD1 ) and transforming growth factor β receptor 2 (TGFβR2 ) mRNA were normalized to GAPDH mRNA as an internal control.

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Amplification:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    SYBR Green Assay:

    Article Title: Role of Sortase A in Lactobacillus gasseri Kx110A1 Adhesion to Gastric Epithelial Cells and Competitive Exclusion of Helicobacter pylori
    Article Snippet: .. Quantitative PCR (qPCR) was performed using a LightCycler 480 (Roche) and a SYBR Green I Master kit (Roche). .. The PCR program was as follows: initial denaturation at 95°C for 10 min, followed by amplification for 40 cycles with denaturation at 95°C for 10 s; annealing at 54°C for 20 s; and extension at 72°C for 20 s. The expression was normalized to that of the housekeeping gene gyrB encoding DNA gyrase B ( ).

    Article Title: GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer, et al. GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer
    Article Snippet: .. Quantitative PCR (qPCR) was undertaken using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) as previously described. .. The expression levels of general transcription factor 2I repeat domain‐containing protein 1 (GTF2IRD1 ) and transforming growth factor β receptor 2 (TGFβR2 ) mRNA were normalized to GAPDH mRNA as an internal control.

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Polymerase Chain Reaction:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Expressing:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Sequencing:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Roche qpcr assays
    Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by <t>qPCR</t> in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to <t>GAPDH</t> gene copy number. A representative experiment is shown.
    Qpcr Assays, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 571 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr assays/product/Roche
    Average 94 stars, based on 571 article reviews
    Price from $9.99 to $1999.99
    qpcr assays - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    85
    Roche arms qpcr assay
    Quantification of the m.3890G > A/MT-ND1 mutation load by <t>ARMS</t> <t>qPCR</t> (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.
    Arms Qpcr Assay, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arms qpcr assay/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    arms qpcr assay - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    90
    Roche real time quantitative reverse transcription pcr rt qpcr reactions
    Quantitative <t>RT-PCR</t> analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the <t>RT-qPCR</t> analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).
    Real Time Quantitative Reverse Transcription Pcr Rt Qpcr Reactions, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative reverse transcription pcr rt qpcr reactions/product/Roche
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time quantitative reverse transcription pcr rt qpcr reactions - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by qPCR in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to GAPDH gene copy number. A representative experiment is shown.

    Journal: Nucleic Acids Research

    Article Title: Nucleocapsid mutations turn HIV-1 into a DNA-containing virus

    doi: 10.1093/nar/gkn069

    Figure Lengend Snippet: Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by qPCR in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to GAPDH gene copy number. A representative experiment is shown.

    Article Snippet: Systematically, cellular GAPDH gene level was determined for standardization. qPCR assays were performed with SYBR Green Kit (Roche) with the RotorGene (Labgene) systems.

    Techniques: Real-time Polymerase Chain Reaction, Transfection, Polymerase Chain Reaction, Infection

    Abundance, composition, and diversity of the microbial communities from the Mackay Glacier region. (a) Boxplot showing the estimated abundance of bacterial and archaeal taxa, based on 16S rRNA copy number determined by quantitative PCR. (b) Stacked bar chart showing phylum-level community composition based on metagenomic reads of the single-copy marker gene rplP and metagenome-assembled genomes. Bacterial and archaeal taxonomy is based on Genome taxonomy database (GTDB) release 05-RS95. Phyla with less than 1% abundance in the sample were grouped to “Other phyla”. (c) Boxplot showing alpha diversity (Observed richness, Chao1, Shannon, Faith’s phylogenetic diversity) of microbial communities based on 16S rRNA gene amplicon sequence variants. (d) Beta diversity of rarefied 16S rRNA gene amplicon sequencing data based on Bray-Curtis dissimilarity and visualised by a non-metric multidimensional scaling ordination (NMDS) plot.

    Journal: bioRxiv

    Article Title: A genome compendium reveals diverse metabolic adaptations of Antarctic soil microorganisms

    doi: 10.1101/2020.08.06.239558

    Figure Lengend Snippet: Abundance, composition, and diversity of the microbial communities from the Mackay Glacier region. (a) Boxplot showing the estimated abundance of bacterial and archaeal taxa, based on 16S rRNA copy number determined by quantitative PCR. (b) Stacked bar chart showing phylum-level community composition based on metagenomic reads of the single-copy marker gene rplP and metagenome-assembled genomes. Bacterial and archaeal taxonomy is based on Genome taxonomy database (GTDB) release 05-RS95. Phyla with less than 1% abundance in the sample were grouped to “Other phyla”. (c) Boxplot showing alpha diversity (Observed richness, Chao1, Shannon, Faith’s phylogenetic diversity) of microbial communities based on 16S rRNA gene amplicon sequence variants. (d) Beta diversity of rarefied 16S rRNA gene amplicon sequencing data based on Bray-Curtis dissimilarity and visualised by a non-metric multidimensional scaling ordination (NMDS) plot.

    Article Snippet: Quantitative PCR (qPCR) using a 96-well plate in a pre-heated LightCycler 480 Instrument II (Roche, Basel, Switzerland) was used to quantify the copy number of the 16S rRNA genes in the samples as previously described .

    Techniques: Real-time Polymerase Chain Reaction, Marker, Amplification, Sequencing

    Quantification of the m.3890G > A/MT-ND1 mutation load by ARMS qPCR (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.

    Journal: Biochimica et Biophysica Acta

    Article Title: Cybrid studies establish the causal link between the mtDNA m.3890G > A/MT-ND1 mutation and optic atrophy with bilateral brainstem lesions

    doi: 10.1016/j.bbadis.2012.12.002

    Figure Lengend Snippet: Quantification of the m.3890G > A/MT-ND1 mutation load by ARMS qPCR (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.

    Article Snippet: 2.4 Quantification of the m.3890G > A/MT-ND1 mutation load by real time amplification refractory mutation system (ARMS) quantitative PCR The ARMS qPCR assay was performed with a LightCycler® 480 Real-Time PCR System (Roche) using SYBR Green chemistry, according to published procedures .

    Techniques: Mutagenesis, Real-time Polymerase Chain Reaction

    Quantitative RT-PCR analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the RT-qPCR analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).

    Journal: PLoS ONE

    Article Title: Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection

    doi: 10.1371/journal.pone.0150711

    Figure Lengend Snippet: Quantitative RT-PCR analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the RT-qPCR analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).

    Article Snippet: Three technical replicates of each three biological replicates (for infected tuber tissue only two biological replicates) were used in subsequent Real-Time Quantitative Reverse Transcription PCR (RT-qPCR) reactions using FastStart Universal Probe Master with Rox (Roche Diagnostics, Switzerland).

    Techniques: Quantitative RT-PCR, Infection, Microarray