quantitative polymerase chain reaction qpcr  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Roche quantitative polymerase chain reaction qpcr
    Graphical representation of quantitative <t>PCR</t> results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Quantitative Polymerase Chain Reaction Qpcr, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative polymerase chain reaction qpcr/product/Roche
    Average 92 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    quantitative polymerase chain reaction qpcr - by Bioz Stars, 2020-07
    92/100 stars

    Images

    1) Product Images from "First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression"

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression

    Journal:

    doi: 10.1007/s12192-009-0139-4

    Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Figure Legend Snippet: Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)
    Figure Legend Snippet: Graphical representation of quantitative PCR results. Total RNA was extracted from control and heat-shocked crustaceans, and Nrhe_Chalamont_Hsp70 mRNA expression was analysed with specific probes. Control animals ( C ; fold induction = 1)

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    2) Product Images from "Differences in Copy Number Variation between Discordant Monozygotic Twins as a Model for Exploring Chromosomal Mosaicism in Congenital Heart Defects"

    Article Title: Differences in Copy Number Variation between Discordant Monozygotic Twins as a Model for Exploring Chromosomal Mosaicism in Congenital Heart Defects

    Journal: Molecular Syndromology

    doi: 10.1159/000335284

    Quantitative PCR results of the 3 confirmed CNV differences between the members of twin pair 6. Quantitative PCR results are shown for the affected and unaffected (UA) member of twin pair 6, as well as for 3 unrelated normal controls (2 males (M), 1 female
    Figure Legend Snippet: Quantitative PCR results of the 3 confirmed CNV differences between the members of twin pair 6. Quantitative PCR results are shown for the affected and unaffected (UA) member of twin pair 6, as well as for 3 unrelated normal controls (2 males (M), 1 female

    Techniques Used: Real-time Polymerase Chain Reaction

    3) Product Images from "Cold adaptation and replicable microbial community development during long-term low-temperature anaerobic digestion treatment of synthetic sewage"

    Article Title: Cold adaptation and replicable microbial community development during long-term low-temperature anaerobic digestion treatment of synthetic sewage

    Journal: FEMS Microbiology Ecology

    doi: 10.1093/femsec/fiy095

    ( A ) qPCR data of Bacterial and Archaeal 16S copy numbers (per g biomass) on the right y-axis from biomass samples (x-axis) throughout the trial corresponding to the ratio of bacteria to archaea (expressed as a percentage) on the left y-axis. ( B ) qPCR data of Bacterial and Archaeal 16S rRNA transcripts copy numbers (per g biomass) on the right y-axis from biomass samples (x-axis) throughout the trial corresponding to the ratio of bacteria to archaea (expressed as a percentage) on the left y-axis.
    Figure Legend Snippet: ( A ) qPCR data of Bacterial and Archaeal 16S copy numbers (per g biomass) on the right y-axis from biomass samples (x-axis) throughout the trial corresponding to the ratio of bacteria to archaea (expressed as a percentage) on the left y-axis. ( B ) qPCR data of Bacterial and Archaeal 16S rRNA transcripts copy numbers (per g biomass) on the right y-axis from biomass samples (x-axis) throughout the trial corresponding to the ratio of bacteria to archaea (expressed as a percentage) on the left y-axis.

    Techniques Used: Real-time Polymerase Chain Reaction

    4) Product Images from "Regulation of c-Fos Gene Expression by NF-?B: A p65 Homodimer Binding Site in Mouse Embryonic Fibroblasts but Not Human HEK293 Cells"

    Article Title: Regulation of c-Fos Gene Expression by NF-?B: A p65 Homodimer Binding Site in Mouse Embryonic Fibroblasts but Not Human HEK293 Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0084062

    The IKK complex is involved in PMA-induced p65 phosphorylation and nuclear localization and c-Fos expression. In most experiments, WT, IKKα −/− , IKKβ −/− , IKKγ −/− , and p65 −/− MEFs were treated with TNF-α (20 ng/mL) or PMA (10 nM) for the indicated times. (A, D, F) Total cell lysates were prepared and subjected to western blotting analysis; the antibodies used are indicated. The western blots are representative of 3 independent experiments. (B) Total RNA was extracted, reverse transcribed into cDNAs, and subjected to qPCR analysis. Values were normalized relative to β-actin gene expression and expressed relative to the control sample. * P
    Figure Legend Snippet: The IKK complex is involved in PMA-induced p65 phosphorylation and nuclear localization and c-Fos expression. In most experiments, WT, IKKα −/− , IKKβ −/− , IKKγ −/− , and p65 −/− MEFs were treated with TNF-α (20 ng/mL) or PMA (10 nM) for the indicated times. (A, D, F) Total cell lysates were prepared and subjected to western blotting analysis; the antibodies used are indicated. The western blots are representative of 3 independent experiments. (B) Total RNA was extracted, reverse transcribed into cDNAs, and subjected to qPCR analysis. Values were normalized relative to β-actin gene expression and expressed relative to the control sample. * P

    Techniques Used: Expressing, Western Blot, Real-time Polymerase Chain Reaction

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: .. Quantitative PCR (qPCR) The amplified cDNA samples were diluted 10x and then used as a template for qPCR. qPCR was performed using a LightCycler® Nano system (Roche Applied Science, Penzberg, Germany) according to the manufacturer's instructions for the FastStart Essential DNA Green Master (Roche) or FastStart Essential DNA Probes Master (Roche) for 45 cycles. .. For each gene examined in this study, the DDBJ/GenBank accession number, primers, probes [selected from the Roche Universal Probe Library ( https://www.roche-applied-science.com )], and expected size were as follows: Ef1α , AB00558, forward: cgtgacatgaggcagactgt, reverse: tagaggccttctgggctgat, 100 bp; RPE65 , AB095018, forward: tgctgctggaaaggatttga, reverse: gctttctctgcatttctcttcac, probe#: 48, 95 bp; c-Myc , AB904156, forward: ctcagaagaagaacaggatgacg, reverse: atccaggcttcctgccagtag, 101 bp; Klf4 , AB904164, forward: ggtcaagggctggttagtcc, reverse: tgaggaggacacttgatggc, 101 bp; Sox2 , AB074258, forward: gtttatggaggagggcacgg, reverse: acctgagggacatgatcagc, 119 bp; Mitf , AB904165, forward: cgtagcaagatccgtgatgtc, reverse: cagcagttcatccgagcat, probe#: 25, 78 bp; and Pax6 , D88741, forward: tctgggcaggtattacgagac, reverse: cgatcttgctcaccacctc, probe#: 58, 95 bp.

    Article Title: Maintenance of cell fates and regulation of the histone variant H3.3 by TLK kinase in Caenorhabditis elegans
    Article Snippet: .. The relative enrichment levels were measured by Quantitative PCR (qPCR) using Light Cycler Nano (Roche), FastStart Essential DNA Green Master (Roche), and the following primers: ceh-22 1, attcaagccttttagcgttgc and aaaatggggagaacatggttg; ceh-22 2, aacaccttcccgtgagaacac and gcatccattcatttccgattc; ceh-22 3, ctaccaacaccttccgcctac and aaggccaccattgagtattgg; mec-3 1, gtcaccatttggagacaccag and aacaaatcacccgtcaagagc; mec-3 2, tctcctctggccgaaaagtg and ccgcacaccgatgaatactg; mec-3 3, tttgtgtggacggcatttatc and gtgcgttgtcatccatttgag; mec-3 4, ttgtcaacgccttcgtgatac and tggggaaggaaagaaaaagtg; ama-1 1, cgttgcgtatgcttctactgc and ttggctttgcacagatcgtag; ama-1 2, cgtccgtatgatgacaaaacg and gacttgttttccggtccaaag; ama-1 3, tgacacggactagaacgatgc and gggagatgagacgcagacatc; tbb-1 1, ccagctcacacactctcttgg and acctttggtgatggaacaacc; tbb-1 2, accaacccaacatacggagac and atgaagacgtgggaatggaac. ..

    Article Title: Characterization of a Homozygous Deletion of Steroid Hormone Biosynthesis Genes in Horse Chromosome 29 as a Risk Factor for Disorders of Sex Development and Reproduction
    Article Snippet: .. Quantitative PCR (qPCR) experiments were performed with LightCycler® 480 (Roche Diagnostics) in triplicate assays and triplicate 20 µL reactions, each containing 50 ng of template DNA, 10 μM primers, and the Hot FirePol® EvaGreen® qPCR Mix Plus (Solis BioDyne). ..

    Article Title: Non-referenced genome assembly from epigenomic short-read data
    Article Snippet: .. To validate the differential methylation profiles identified by our bioinformatics analysis of the P. obesus hypothalamus methylome, we used quantitative PCR (qPCR) to analyze the MBD enriched fractions with FastStart Universal SYBR Green Master (Rox) (Roche) (cat#04913914001). ..

    Article Title: PRL2 links magnesium flux and sex-dependent circadian metabolic rhythms
    Article Snippet: .. Quantitative PCR (qPCR) was performed on a LightCycler 480 (Roche Life Science) with SYBR Green Master Mix (Roche Life Science) according to manufacturer’s instructions. ..

    Article Title: Differences in Copy Number Variation between Discordant Monozygotic Twins as a Model for Exploring Chromosomal Mosaicism in Congenital Heart Defects
    Article Snippet: .. To confirm the presence of CNV differences, quantitative polymerase chain reaction (qPCR) was performed on DNA from both twin members and 3 unrelated controls (2 males and 1 female) using the LightCycler® 480 Real-Time PCR system (Roche Applied Science, Belgium, ), following the manufacturer's instructions. ..

    Article Title: GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer, et al. GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer
    Article Snippet: .. Quantitative PCR (qPCR) was undertaken using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) as previously described. .. The expression levels of general transcription factor 2I repeat domain‐containing protein 1 (GTF2IRD1 ) and transforming growth factor β receptor 2 (TGFβR2 ) mRNA were normalized to GAPDH mRNA as an internal control.

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Amplification:

    Article Title: The newt reprograms mature RPE cells into a unique multipotent state for retinal regeneration
    Article Snippet: .. Quantitative PCR (qPCR) The amplified cDNA samples were diluted 10x and then used as a template for qPCR. qPCR was performed using a LightCycler® Nano system (Roche Applied Science, Penzberg, Germany) according to the manufacturer's instructions for the FastStart Essential DNA Green Master (Roche) or FastStart Essential DNA Probes Master (Roche) for 45 cycles. .. For each gene examined in this study, the DDBJ/GenBank accession number, primers, probes [selected from the Roche Universal Probe Library ( https://www.roche-applied-science.com )], and expected size were as follows: Ef1α , AB00558, forward: cgtgacatgaggcagactgt, reverse: tagaggccttctgggctgat, 100 bp; RPE65 , AB095018, forward: tgctgctggaaaggatttga, reverse: gctttctctgcatttctcttcac, probe#: 48, 95 bp; c-Myc , AB904156, forward: ctcagaagaagaacaggatgacg, reverse: atccaggcttcctgccagtag, 101 bp; Klf4 , AB904164, forward: ggtcaagggctggttagtcc, reverse: tgaggaggacacttgatggc, 101 bp; Sox2 , AB074258, forward: gtttatggaggagggcacgg, reverse: acctgagggacatgatcagc, 119 bp; Mitf , AB904165, forward: cgtagcaagatccgtgatgtc, reverse: cagcagttcatccgagcat, probe#: 25, 78 bp; and Pax6 , D88741, forward: tctgggcaggtattacgagac, reverse: cgatcttgctcaccacctc, probe#: 58, 95 bp.

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Methylation:

    Article Title: Non-referenced genome assembly from epigenomic short-read data
    Article Snippet: .. To validate the differential methylation profiles identified by our bioinformatics analysis of the P. obesus hypothalamus methylome, we used quantitative PCR (qPCR) to analyze the MBD enriched fractions with FastStart Universal SYBR Green Master (Rox) (Roche) (cat#04913914001). ..

    SYBR Green Assay:

    Article Title: Non-referenced genome assembly from epigenomic short-read data
    Article Snippet: .. To validate the differential methylation profiles identified by our bioinformatics analysis of the P. obesus hypothalamus methylome, we used quantitative PCR (qPCR) to analyze the MBD enriched fractions with FastStart Universal SYBR Green Master (Rox) (Roche) (cat#04913914001). ..

    Article Title: PRL2 links magnesium flux and sex-dependent circadian metabolic rhythms
    Article Snippet: .. Quantitative PCR (qPCR) was performed on a LightCycler 480 (Roche Life Science) with SYBR Green Master Mix (Roche Life Science) according to manufacturer’s instructions. ..

    Article Title: GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer, et al. GTF2IRD1 on chromosome 7 is a novel oncogene regulating the tumor‐suppressor gene TGFβR2 in colorectal cancer
    Article Snippet: .. Quantitative PCR (qPCR) was undertaken using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics) as previously described. .. The expression levels of general transcription factor 2I repeat domain‐containing protein 1 (GTF2IRD1 ) and transforming growth factor β receptor 2 (TGFβR2 ) mRNA were normalized to GAPDH mRNA as an internal control.

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Sequencing:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Expressing:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Polymerase Chain Reaction:

    Article Title: First cellular approach of the effects of global warming on groundwater organisms: a study of the HSP70 gene expression
    Article Snippet: .. Quantitative real-time PCR analysis HSP70 gene expression data were quantified using quantitative polymerase chain reaction (qPCR) performed on a LightCycler® sequence analysis system (Roche Diagnostics, Basel, Switzerland) using the QuantiTect SYBR® Green PCR kit (Qiagen). qPCR amplification was performed using synthetic DNA-specific primers corresponding to the transcript of SmRNA that allowed us to determine the reverse transcription efficiency for each sample. qPCR amplification of the gene of interest, HSP70, was then performed using specific primers designed from the alignment of the eight sequences of HSP70 from Niphargus obtained in this study, forward primer F307-PCRQ 5′-GCTGCGATTGCTTACGG-3′ and reverse primer R408-PCRQ 5′-CGCCAGCAGTAGATTTCACCTC-3′. .. Amplifications of HSP70 were performed using 5 μL cDNA, 0.25 μmol of each primer and 1 X Mix (QuantiTect Master Mix; Qiagen) to a total volume of 20 μL under the following conditions: one denaturation cycle of 95°C for 15 min and 40 amplification cycles of 94°C for 15 s, 58°C for 30 s and 72°C for 6 s. At the end of each PCR, the absence of primer dimers was confirmed with the analysis of the melting curve obtained after one fusion cycle between 95°C and 68°C for 20 s and one cooling cycle of 40°C for 30 s. The specificity of the PCR products was confirmed by sequencing.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Non-referenced genome assembly from epigenomic short-read data
    Article Snippet: .. To validate the differential methylation profiles identified by our bioinformatics analysis of the P. obesus hypothalamus methylome, we used quantitative PCR (qPCR) to analyze the MBD enriched fractions with FastStart Universal SYBR Green Master (Rox) (Roche) (cat04913914001). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Roche qpcr assays
    Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by <t>qPCR</t> in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to <t>GAPDH</t> gene copy number. A representative experiment is shown.
    Qpcr Assays, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 185 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr assays/product/Roche
    Average 94 stars, based on 185 article reviews
    Price from $9.99 to $1999.99
    qpcr assays - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    94
    Roche real time qpcr
    DNA methylation of LRES regions . (A) Average MES curve for LRES regions in chromosome 12 in normal (black) and cancerous (red) tissue. (B) Average MESs for gene promoters in LRES regions in normal and cancerous tissue. (C) Correlation between gene expression levels and hypermethylation of genes within LRES regions. (D) Methylation enrichment of several selected genes within LRES regions, as assessed by <t>MIRA-qPCR.</t> (E) Methylation ratio at the target site within the upstream region of <t>MDM2</t> , as measured by pyrosequencing.
    Real Time Qpcr, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 465 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time qpcr/product/Roche
    Average 94 stars, based on 465 article reviews
    Price from $9.99 to $1999.99
    real time qpcr - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    85
    Roche arms qpcr assay
    Quantification of the m.3890G > A/MT-ND1 mutation load by <t>ARMS</t> <t>qPCR</t> (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.
    Arms Qpcr Assay, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arms qpcr assay/product/Roche
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    arms qpcr assay - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    90
    Roche real time quantitative reverse transcription pcr rt qpcr reactions
    Quantitative <t>RT-PCR</t> analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the <t>RT-qPCR</t> analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).
    Real Time Quantitative Reverse Transcription Pcr Rt Qpcr Reactions, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative reverse transcription pcr rt qpcr reactions/product/Roche
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time quantitative reverse transcription pcr rt qpcr reactions - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    Image Search Results


    Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by qPCR in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to GAPDH gene copy number. A representative experiment is shown.

    Journal: Nucleic Acids Research

    Article Title: Nucleocapsid mutations turn HIV-1 into a DNA-containing virus

    doi: 10.1093/nar/gkn069

    Figure Lengend Snippet: Large amounts of viral DNA in HIV-1 ΔZF2-producing cells. ( A ) Spliced viral cDNAs were measured by qPCR in 293T cells transfected or not with ΔZF2 or wild-type plasmids ( n = 3 ± SD). ( B ) Effects of Nevirapine (50 μM) and AZT (50 μM) treatments on spliced viral cDNA levels were measured by qPCR in 293T cells producing ΔZF2 virions ( n = 3 ± SD). ( C ) Circular DNA forms were detected by PCR with primers flanking the 2LTR junction in both the infected cells (42CD4) and transfected cells (293T). All DNA samples were normalized to GAPDH gene copy number. A representative experiment is shown.

    Article Snippet: Systematically, cellular GAPDH gene level was determined for standardization. qPCR assays were performed with SYBR Green Kit (Roche) with the RotorGene (Labgene) systems.

    Techniques: Real-time Polymerase Chain Reaction, Transfection, Polymerase Chain Reaction, Infection

    DNA methylation of LRES regions . (A) Average MES curve for LRES regions in chromosome 12 in normal (black) and cancerous (red) tissue. (B) Average MESs for gene promoters in LRES regions in normal and cancerous tissue. (C) Correlation between gene expression levels and hypermethylation of genes within LRES regions. (D) Methylation enrichment of several selected genes within LRES regions, as assessed by MIRA-qPCR. (E) Methylation ratio at the target site within the upstream region of MDM2 , as measured by pyrosequencing.

    Journal: BMC Medical Genomics

    Article Title: Identification of DNA methylation changes associated with human gastric cancer

    doi: 10.1186/1755-8794-4-82

    Figure Lengend Snippet: DNA methylation of LRES regions . (A) Average MES curve for LRES regions in chromosome 12 in normal (black) and cancerous (red) tissue. (B) Average MESs for gene promoters in LRES regions in normal and cancerous tissue. (C) Correlation between gene expression levels and hypermethylation of genes within LRES regions. (D) Methylation enrichment of several selected genes within LRES regions, as assessed by MIRA-qPCR. (E) Methylation ratio at the target site within the upstream region of MDM2 , as measured by pyrosequencing.

    Article Snippet: Supplementary Figure 10: Amplification ratio of several genes (DYRK2 , IFNG , IL26 , MDM1 , and MDM2 ) within chromosome 12q14 LRES region by real-time qPCR.

    Techniques: DNA Methylation Assay, Expressing, Methylation, Real-time Polymerase Chain Reaction

    Quantification of the m.3890G > A/MT-ND1 mutation load by ARMS qPCR (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.

    Journal: Biochimica et Biophysica Acta

    Article Title: Cybrid studies establish the causal link between the mtDNA m.3890G > A/MT-ND1 mutation and optic atrophy with bilateral brainstem lesions

    doi: 10.1016/j.bbadis.2012.12.002

    Figure Lengend Snippet: Quantification of the m.3890G > A/MT-ND1 mutation load by ARMS qPCR (A) in proband's skeletal muscle, blood cells and urinary epithelium, and in family (B) members' urinary epithelium, expressed as % of mutant 3890A compared to wild-type (wt) 3890G. The arrow indicates the proband, while asterisks indicate family members who were investigated.

    Article Snippet: 2.4 Quantification of the m.3890G > A/MT-ND1 mutation load by real time amplification refractory mutation system (ARMS) quantitative PCR The ARMS qPCR assay was performed with a LightCycler® 480 Real-Time PCR System (Roche) using SYBR Green chemistry, according to published procedures .

    Techniques: Mutagenesis, Real-time Polymerase Chain Reaction

    Quantitative RT-PCR analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the RT-qPCR analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).

    Journal: PLoS ONE

    Article Title: Insight on Genes Affecting Tuber Development in Potato upon Potato spindle tuber viroid (PSTVd) Infection

    doi: 10.1371/journal.pone.0150711

    Figure Lengend Snippet: Quantitative RT-PCR analysis of candidate genes. Mock infected plants were used to normalize fold change of early and late samples in leaf and tuber tissues as indicated. White bars represent the RT-qPCR analysis; grey bars show the microarray data. Error bars represent standard error (SE). L23 and PP2A genes were used as internal normalization controls. Asterisk indicates that the means of fold change of the mock and infected samples are significantly different (Student’s t-test).

    Article Snippet: Three technical replicates of each three biological replicates (for infected tuber tissue only two biological replicates) were used in subsequent Real-Time Quantitative Reverse Transcription PCR (RT-qPCR) reactions using FastStart Universal Probe Master with Rox (Roche Diagnostics, Switzerland).

    Techniques: Quantitative RT-PCR, Infection, Microarray