real time pcr total cellular rna  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    Deoxyribonucleic acid
    Description:
    Human placental DNA is isolated from donor placenta but will contain some maternal DNA The DNA fragments are sonicated to produce fragments of consistent size
    Catalog Number:
    d3287
    Price:
    None
    Applications:
    Sonicated Deoxyribonucleic acid, single stranded from human placenta, was used as blocking agent in Southern hybridization of DNA from human papillomavirus (HPV) positive SiHa, HeLa and CaSki cell-lines. It was used as standard in GC/MS analysis of exocyclic DNA adducts.
    Buy from Supplier


    Structured Review

    Millipore real time pcr total cellular rna
    Influenza virus increases SK1 activation, which is critical for viral replication. (A and B) HEK293 (A) or A549 (B) cells were infected with influenza A/WSN/33 virus (FLU) at an MOI of 3 for the indicated times. The levels of pSK1 or SK1 were analyzed by Western blotting. GAPDH or α-tubulin was used as internal loading control. The relative intensities for each band of pSK1 and SK1 were determined based on the control protein expression by densitometery and depicted below each blot. The relative level of protein at 0 hr was set as 1.0. (C and D) MDCK (C) or A549 (D) cells were treated with solvent (DMSO; -), DMS (5 µM), or SKI-II (10 µM) upon influenza virus infection at an MOI of 1. Cell lysates were used for Western blot analysis to detect viral proteins M1, M2, NS1, NS2, NP, and α-tubulin at 12 hpi. (E and F) MDCK cells were treated with solvent (-) or SKI-II upon influenza virus infection at an MOI of 5. The expression of (+) or (-) <t>RNA</t> of viral RNA polymerase subunit PB2 (E) or viral NP (F) was analyzed by real-time quantitative <t>PCR</t> (qPCR) at 5 hpi. Three reactions per sample were carried out. Values are means ± SEM of three reactions per sample. ***p
    Human placental DNA is isolated from donor placenta but will contain some maternal DNA The DNA fragments are sonicated to produce fragments of consistent size
    https://www.bioz.com/result/real time pcr total cellular rna/product/Millipore
    Average 92 stars, based on 4001 article reviews
    Price from $9.99 to $1999.99
    real time pcr total cellular rna - by Bioz Stars, 2020-09
    92/100 stars

    Images

    1) Product Images from "Sphingosine Kinase 1 Serves as a Pro-Viral Factor by Regulating Viral RNA Synthesis and Nuclear Export of Viral Ribonucleoprotein Complex upon Influenza Virus Infection"

    Article Title: Sphingosine Kinase 1 Serves as a Pro-Viral Factor by Regulating Viral RNA Synthesis and Nuclear Export of Viral Ribonucleoprotein Complex upon Influenza Virus Infection

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075005

    Influenza virus increases SK1 activation, which is critical for viral replication. (A and B) HEK293 (A) or A549 (B) cells were infected with influenza A/WSN/33 virus (FLU) at an MOI of 3 for the indicated times. The levels of pSK1 or SK1 were analyzed by Western blotting. GAPDH or α-tubulin was used as internal loading control. The relative intensities for each band of pSK1 and SK1 were determined based on the control protein expression by densitometery and depicted below each blot. The relative level of protein at 0 hr was set as 1.0. (C and D) MDCK (C) or A549 (D) cells were treated with solvent (DMSO; -), DMS (5 µM), or SKI-II (10 µM) upon influenza virus infection at an MOI of 1. Cell lysates were used for Western blot analysis to detect viral proteins M1, M2, NS1, NS2, NP, and α-tubulin at 12 hpi. (E and F) MDCK cells were treated with solvent (-) or SKI-II upon influenza virus infection at an MOI of 5. The expression of (+) or (-) RNA of viral RNA polymerase subunit PB2 (E) or viral NP (F) was analyzed by real-time quantitative PCR (qPCR) at 5 hpi. Three reactions per sample were carried out. Values are means ± SEM of three reactions per sample. ***p
    Figure Legend Snippet: Influenza virus increases SK1 activation, which is critical for viral replication. (A and B) HEK293 (A) or A549 (B) cells were infected with influenza A/WSN/33 virus (FLU) at an MOI of 3 for the indicated times. The levels of pSK1 or SK1 were analyzed by Western blotting. GAPDH or α-tubulin was used as internal loading control. The relative intensities for each band of pSK1 and SK1 were determined based on the control protein expression by densitometery and depicted below each blot. The relative level of protein at 0 hr was set as 1.0. (C and D) MDCK (C) or A549 (D) cells were treated with solvent (DMSO; -), DMS (5 µM), or SKI-II (10 µM) upon influenza virus infection at an MOI of 1. Cell lysates were used for Western blot analysis to detect viral proteins M1, M2, NS1, NS2, NP, and α-tubulin at 12 hpi. (E and F) MDCK cells were treated with solvent (-) or SKI-II upon influenza virus infection at an MOI of 5. The expression of (+) or (-) RNA of viral RNA polymerase subunit PB2 (E) or viral NP (F) was analyzed by real-time quantitative PCR (qPCR) at 5 hpi. Three reactions per sample were carried out. Values are means ± SEM of three reactions per sample. ***p

    Techniques Used: Activation Assay, Infection, Western Blot, Expressing, Real-time Polymerase Chain Reaction

    2) Product Images from "RAS mutations drive proliferative chronic myelomonocytic leukemia via activation of a novel KMT2A-PLK1 axis"

    Article Title: RAS mutations drive proliferative chronic myelomonocytic leukemia via activation of a novel KMT2A-PLK1 axis

    Journal: bioRxiv

    doi: 10.1101/2019.12.23.874487

    Therapeutic efficacy of targeting PLK1 in pCMML. A. Daily cell counts of CMML patient-derived MNCs after transfection with either siNT, siPLK1 (left) or siWEE1 (right). Representative Western blots depict validation of PLK1 and WEE1 knockdown. Knockdown of PLK1 and WEE1 by qPCR was ≥ 90%. B. Progenitor colony forming assays using CMML patient-derived MNCs with increasing doses of Volasertib (left) and AZD-1775 (right). Data in panels A and B are presented as mean ± SEM. C and D. Histopathologic analysis with H E staining and immunohistochemistry (IHC) of spleen (C) and BM (D) of murine patient-derived xenografts (PDX) after treatment with vehicle control or Volasertib. Magnification is 200X unless otherwise indicated. hCD45 is human CD45. E. Representative flow cytometry of spleen, BM and PB of PDXs after treatment with vehicle control (left) or Volasertib (right). The y-axis indicates hCD45 expression status while x-axis indicates murine CD45 (mCD45). Percentages indicate proportion of hCD45+ and mCD45-cells in the respective tissues. F. Flow cytometry of proportion of hCD45+ cells in spleen, BM and PB of PDX mice. Data are presented as mean ± SEM from 9 mice. G and H. Effect of vehicle versus Volasertib treatment on PDX spleen size (G) and weight (H). * indicates p value
    Figure Legend Snippet: Therapeutic efficacy of targeting PLK1 in pCMML. A. Daily cell counts of CMML patient-derived MNCs after transfection with either siNT, siPLK1 (left) or siWEE1 (right). Representative Western blots depict validation of PLK1 and WEE1 knockdown. Knockdown of PLK1 and WEE1 by qPCR was ≥ 90%. B. Progenitor colony forming assays using CMML patient-derived MNCs with increasing doses of Volasertib (left) and AZD-1775 (right). Data in panels A and B are presented as mean ± SEM. C and D. Histopathologic analysis with H E staining and immunohistochemistry (IHC) of spleen (C) and BM (D) of murine patient-derived xenografts (PDX) after treatment with vehicle control or Volasertib. Magnification is 200X unless otherwise indicated. hCD45 is human CD45. E. Representative flow cytometry of spleen, BM and PB of PDXs after treatment with vehicle control (left) or Volasertib (right). The y-axis indicates hCD45 expression status while x-axis indicates murine CD45 (mCD45). Percentages indicate proportion of hCD45+ and mCD45-cells in the respective tissues. F. Flow cytometry of proportion of hCD45+ cells in spleen, BM and PB of PDX mice. Data are presented as mean ± SEM from 9 mice. G and H. Effect of vehicle versus Volasertib treatment on PDX spleen size (G) and weight (H). * indicates p value

    Techniques Used: Derivative Assay, Transfection, Western Blot, Real-time Polymerase Chain Reaction, Staining, Immunohistochemistry, Flow Cytometry, Expressing, Mouse Assay

    Genome-wide and sequence specific elevation of the H3K4me1 histone mark in pCMML. A. ChIP-seq on PB MNCs from CMML patients assessing relative global enrichment of histone 3 lysine 4 monomethylation (H3K4me1), trimetylation (H3K4me3), and histone 3 lysine 27 trimethylation (H3K27me3). Data presented as mean ± SEM. B. Sequence-specific ChIP-seq assessing H3K4me1 occupancy at PLK1 (above) and WEE1 (below) loci. dCMML (blue) and pCMML (red) traces indicate average signals derived from 12 and 18 patient samples respectively. The third trace represents a subtraction of these signals to assess differences. Relative localization along the PLK1 and WEE1 gene bodies is depicted. C. ChIP-PCR of NRAS mutant CMML patient-derived MNCs assessing PLK1 and WEE1 promoter occupancy of H3K4me1 after transfection with siNT or siNRAS. Data presented as mean ± SEM. Western blot is representative validation of NRAS knockdown. D. ChIP-PCR of NRAS wildtype CMML patient-derived MNCs assessing PLK1 and WEE1 promoter occupancy of H3K4me1 after transfection with a Control vector of NRAS G12D . Western blot is representative validation of NRAS knockdown. Knockdown of NRAS by qPCR was ≥ 85%. ** indicates p value
    Figure Legend Snippet: Genome-wide and sequence specific elevation of the H3K4me1 histone mark in pCMML. A. ChIP-seq on PB MNCs from CMML patients assessing relative global enrichment of histone 3 lysine 4 monomethylation (H3K4me1), trimetylation (H3K4me3), and histone 3 lysine 27 trimethylation (H3K27me3). Data presented as mean ± SEM. B. Sequence-specific ChIP-seq assessing H3K4me1 occupancy at PLK1 (above) and WEE1 (below) loci. dCMML (blue) and pCMML (red) traces indicate average signals derived from 12 and 18 patient samples respectively. The third trace represents a subtraction of these signals to assess differences. Relative localization along the PLK1 and WEE1 gene bodies is depicted. C. ChIP-PCR of NRAS mutant CMML patient-derived MNCs assessing PLK1 and WEE1 promoter occupancy of H3K4me1 after transfection with siNT or siNRAS. Data presented as mean ± SEM. Western blot is representative validation of NRAS knockdown. D. ChIP-PCR of NRAS wildtype CMML patient-derived MNCs assessing PLK1 and WEE1 promoter occupancy of H3K4me1 after transfection with a Control vector of NRAS G12D . Western blot is representative validation of NRAS knockdown. Knockdown of NRAS by qPCR was ≥ 85%. ** indicates p value

    Techniques Used: Genome Wide, Sequencing, Chromatin Immunoprecipitation, Derivative Assay, Polymerase Chain Reaction, Mutagenesis, Transfection, Western Blot, Plasmid Preparation, Real-time Polymerase Chain Reaction

    RAS pathway mutations drive expression of mitotic checkpoint kinases PLK1 and WEE1 . A. Unsupervised hierarchical clustering of RNA-seq performed on peripheral blood samples from 35 CMML patients. Cluster 1 (black) with dCMML cases and Cluster 2 (red) with pCMML cases. B. Volcano plot demonstrating differentially upregulated (red) and downregulated (green) genes in pCMML (vs dCMML) expressed as log2-fold change. C. Quantitative PCR (qPCR) validation of PLK1 (left) and WEE1 (right) expression in patient-derived MNCs from pCMML and dCMML cases. * indicates p value
    Figure Legend Snippet: RAS pathway mutations drive expression of mitotic checkpoint kinases PLK1 and WEE1 . A. Unsupervised hierarchical clustering of RNA-seq performed on peripheral blood samples from 35 CMML patients. Cluster 1 (black) with dCMML cases and Cluster 2 (red) with pCMML cases. B. Volcano plot demonstrating differentially upregulated (red) and downregulated (green) genes in pCMML (vs dCMML) expressed as log2-fold change. C. Quantitative PCR (qPCR) validation of PLK1 (left) and WEE1 (right) expression in patient-derived MNCs from pCMML and dCMML cases. * indicates p value

    Techniques Used: Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Derivative Assay

    Mutant RAS regulates PLK1 and WEE1 expression through the lysine methyltransferase KMT2A (MLL1). A. RNA-seq data of expression levels of enzymes potentially involved in monomethylation in pCMML (vs dCMML and healthy volunteers). B. Representative fluorescence in situ hybridization (FISH) in two cases assessing for MLLT3-KMT2A fusion (n=500). Arrows (right) indicate presence of fusion. C. ChIP-PCR in NRAS mutant CMML patient-derived MNCs assessing KMT2A occupancy at promoters of PLK1 (left) and WEE1 (right) with immunoprecipitation of KMT2A relative to isotype control (IgG). D. ChIP-PCR assessing KMT2A occupancy at PLK1 and WEE1 promoters in NRAS mutant CMML patient-derived MNCs after transfection with siNT or siNRAS. Western blot is representative validation of NRAS knockdown. E. ChIP-PCR assessing KMT2A in NRAS wildtype CMML patient-derived MNCs after transfection with Control vector or NRAS G12D . Western blot is representative validation of NRAS knockdown. Knockdown of NRAS by qPCR was ≥ 85%. F. ChIP-PCR assessing H3K4me1 at promoters of PLK1 and WEE1 (left) and qPCR assessing levels of KMT2A, PLK1 and WEE1 in NRAS mutant CMML patient-derived MNCs after transfection with siNT or siKMT2A. Western blots are representative validation of KMT2A knockdown. Knockdown of KMT2A by qPCR was ≥ 90%. * indicates p value
    Figure Legend Snippet: Mutant RAS regulates PLK1 and WEE1 expression through the lysine methyltransferase KMT2A (MLL1). A. RNA-seq data of expression levels of enzymes potentially involved in monomethylation in pCMML (vs dCMML and healthy volunteers). B. Representative fluorescence in situ hybridization (FISH) in two cases assessing for MLLT3-KMT2A fusion (n=500). Arrows (right) indicate presence of fusion. C. ChIP-PCR in NRAS mutant CMML patient-derived MNCs assessing KMT2A occupancy at promoters of PLK1 (left) and WEE1 (right) with immunoprecipitation of KMT2A relative to isotype control (IgG). D. ChIP-PCR assessing KMT2A occupancy at PLK1 and WEE1 promoters in NRAS mutant CMML patient-derived MNCs after transfection with siNT or siNRAS. Western blot is representative validation of NRAS knockdown. E. ChIP-PCR assessing KMT2A in NRAS wildtype CMML patient-derived MNCs after transfection with Control vector or NRAS G12D . Western blot is representative validation of NRAS knockdown. Knockdown of NRAS by qPCR was ≥ 85%. F. ChIP-PCR assessing H3K4me1 at promoters of PLK1 and WEE1 (left) and qPCR assessing levels of KMT2A, PLK1 and WEE1 in NRAS mutant CMML patient-derived MNCs after transfection with siNT or siKMT2A. Western blots are representative validation of KMT2A knockdown. Knockdown of KMT2A by qPCR was ≥ 90%. * indicates p value

    Techniques Used: Mutagenesis, Expressing, RNA Sequencing Assay, Fluorescence, In Situ Hybridization, Fluorescence In Situ Hybridization, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Derivative Assay, Immunoprecipitation, Transfection, Western Blot, Plasmid Preparation, Real-time Polymerase Chain Reaction

    3) Product Images from "HIV-1 promoter is gradually silenced when integrated into BACH2"

    Article Title: HIV-1 promoter is gradually silenced when integrated into BACH2

    Journal: bioRxiv

    doi: 10.1101/2020.03.30.011395

    The mono-allelic integration of LTatCL[M] into BACH2 did not impair BACH2 mRNA nor BACH2 protein expression. ( A ) BACH2 mRNA expression was quantified by amplification of a region in the mRNA downstream of BACH2 _i5 and BACH2 _i2. The bar blot consists of two independent qPCR experiments, consisting of two replicates each. The qPCR was carried out two times independently in duplicate. The means and standard deviations are depicted. ( B )Western blot analysis of BACH2 protein expression, 110 kD BACH2 (upper panel) and 37 kD GAPDH (lower panel) are shown for an exemplary experiment. The in vivo observed preferential HIV-1 integration loci in BACH2 , BACH2_i5s, is highlighted by red boxes.
    Figure Legend Snippet: The mono-allelic integration of LTatCL[M] into BACH2 did not impair BACH2 mRNA nor BACH2 protein expression. ( A ) BACH2 mRNA expression was quantified by amplification of a region in the mRNA downstream of BACH2 _i5 and BACH2 _i2. The bar blot consists of two independent qPCR experiments, consisting of two replicates each. The qPCR was carried out two times independently in duplicate. The means and standard deviations are depicted. ( B )Western blot analysis of BACH2 protein expression, 110 kD BACH2 (upper panel) and 37 kD GAPDH (lower panel) are shown for an exemplary experiment. The in vivo observed preferential HIV-1 integration loci in BACH2 , BACH2_i5s, is highlighted by red boxes.

    Techniques Used: Expressing, Amplification, Real-time Polymerase Chain Reaction, Western Blot, In Vivo

    4) Product Images from "Transient Reversal of Episome Silencing Precedes VP16-Dependent Transcription during Reactivation of Latent HSV-1 in Neurons"

    Article Title: Transient Reversal of Episome Silencing Precedes VP16-Dependent Transcription during Reactivation of Latent HSV-1 in Neurons

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002540

    HSV-1 GFP-Us11 replication occurs in Phase II of reactivation. Latent cultures of SCG cells were induced with LY294002 as described before. (A) Viral DNA Content was determined by qPCR at different times post-reactivation (p.r.) in the absence or presence of 300 µg/ml PAA. (B) Quantitative RT-PCR analysis of VP16 and UL36 mRNA levels in the absence or presence of 300 µg/ml PAA during Phase I (15–20 h) and in Phase II (48 h). (C) Number of infectious virus particles was determined by plaque assay.
    Figure Legend Snippet: HSV-1 GFP-Us11 replication occurs in Phase II of reactivation. Latent cultures of SCG cells were induced with LY294002 as described before. (A) Viral DNA Content was determined by qPCR at different times post-reactivation (p.r.) in the absence or presence of 300 µg/ml PAA. (B) Quantitative RT-PCR analysis of VP16 and UL36 mRNA levels in the absence or presence of 300 µg/ml PAA during Phase I (15–20 h) and in Phase II (48 h). (C) Number of infectious virus particles was determined by plaque assay.

    Techniques Used: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Plaque Assay

    Acute replication of HSV-1 in SCG neurons follows the canonical ordered cascade of mRNA accumulation. (A) Primary neurons were isolated from superior cervical ganglia (SCG) of E21 rats, cultured for 7 days in the presence of 5 µM aphidicolin and 20 µM 5-fluorouracil to eliminate proliferating cells, and then infected with HSV-1 GFP-Us11 at a multiplicity of 3 plaque forming units per neuron (MOI = 3). RNA was collected at 0, 3, 6, 9, and 12 h post-infection (p.i.) and analyzed by quantitative reverse transcription PCR (qRT-PCR) to determine the relative levels of viral immediate-early (ICP27), early (UL30), γ1 leaky-late (VP16) and γ2 true-late (UL36) transcripts. Values represent the average and standard error from the mean from three independent infection experiments. (B) Neuron cultures were treated with the viral DNA polymerase inhibitor phosphonoacetic acid (PAA, 300 µg/ml) for 1 h (hatched bars) or mock treated (filled bars) and then infected with HSV-1 GFP-Us11. Total DNA was prepared at the indicated times and the relative levels of viral genomic DNA determined by quantitative (qPCR) using primers complementary to the HSV-1 UL30 gene. Input DNA was normalized by qPCR detection of the rat RPL19 gene. (C, D) Analysis of γ1 leaky-late (VP16) and γ2 true-late (UL36) transcript levels in the presence or absence of PAA.
    Figure Legend Snippet: Acute replication of HSV-1 in SCG neurons follows the canonical ordered cascade of mRNA accumulation. (A) Primary neurons were isolated from superior cervical ganglia (SCG) of E21 rats, cultured for 7 days in the presence of 5 µM aphidicolin and 20 µM 5-fluorouracil to eliminate proliferating cells, and then infected with HSV-1 GFP-Us11 at a multiplicity of 3 plaque forming units per neuron (MOI = 3). RNA was collected at 0, 3, 6, 9, and 12 h post-infection (p.i.) and analyzed by quantitative reverse transcription PCR (qRT-PCR) to determine the relative levels of viral immediate-early (ICP27), early (UL30), γ1 leaky-late (VP16) and γ2 true-late (UL36) transcripts. Values represent the average and standard error from the mean from three independent infection experiments. (B) Neuron cultures were treated with the viral DNA polymerase inhibitor phosphonoacetic acid (PAA, 300 µg/ml) for 1 h (hatched bars) or mock treated (filled bars) and then infected with HSV-1 GFP-Us11. Total DNA was prepared at the indicated times and the relative levels of viral genomic DNA determined by quantitative (qPCR) using primers complementary to the HSV-1 UL30 gene. Input DNA was normalized by qPCR detection of the rat RPL19 gene. (C, D) Analysis of γ1 leaky-late (VP16) and γ2 true-late (UL36) transcript levels in the presence or absence of PAA.

    Techniques Used: Isolation, Cell Culture, Infection, Polymerase Chain Reaction, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    5) Product Images from "Endogenous retroviruses are a source of enhancers with oncogenic potential in acute myeloid leukaemia"

    Article Title: Endogenous retroviruses are a source of enhancers with oncogenic potential in acute myeloid leukaemia

    Journal: bioRxiv

    doi: 10.1101/772954

    A-DARs bear signatures of enhancer elements. A. Number of transcriptional start sites of spliced transcripts that overlap with A-DAR elements in AML or differentiated myeloid cells. B. Example of a LTR12C element that generates an alternative promoter that drives the expression of SAGE1 in AML samples where this element is active. C. Heatmap of overlap between LTR2B elements and histone modification peaks. Colour intensity represents the percentage of AML or differentiated cell samples where overlap is observed. Dashed lines segregate clusters identified by k-means clustering. D. Average ChIP-seq profiles for LTR2B elements within specific clusters define in C. Blue boxes highlight two clusters where H3K4me1 and H3K27ac levels are higher in AML compared with differentiated cells. E. Percentage of A-DAR elements that overlap H3K27ac peaks in different cell lines, or that are classified as enhancer or promoters in ChromHMM data from K562 cells. A-DAR elements were subdivided according to the number of AML samples displaying overlap with H3K27ac. F. Example of a LTR13A element where three cell lines reproduce the AML-specific H3K27ac marking observed in AML samples. Peaks called by MACS2 are depicted underneath each track.
    Figure Legend Snippet: A-DARs bear signatures of enhancer elements. A. Number of transcriptional start sites of spliced transcripts that overlap with A-DAR elements in AML or differentiated myeloid cells. B. Example of a LTR12C element that generates an alternative promoter that drives the expression of SAGE1 in AML samples where this element is active. C. Heatmap of overlap between LTR2B elements and histone modification peaks. Colour intensity represents the percentage of AML or differentiated cell samples where overlap is observed. Dashed lines segregate clusters identified by k-means clustering. D. Average ChIP-seq profiles for LTR2B elements within specific clusters define in C. Blue boxes highlight two clusters where H3K4me1 and H3K27ac levels are higher in AML compared with differentiated cells. E. Percentage of A-DAR elements that overlap H3K27ac peaks in different cell lines, or that are classified as enhancer or promoters in ChromHMM data from K562 cells. A-DAR elements were subdivided according to the number of AML samples displaying overlap with H3K27ac. F. Example of a LTR13A element where three cell lines reproduce the AML-specific H3K27ac marking observed in AML samples. Peaks called by MACS2 are depicted underneath each track.

    Techniques Used: Expressing, Modification, Chromatin Immunoprecipitation

    CRISPRi provides robust and selective targeting of LTR2B and LTR2 elements, which led to impaired cell growth. A. Profile of dCas9 ChIP-seq signal over LTR2B and LTR2 elements in K562 cells expressing LTR2B sgRNAs or an empty vector (‘None’). B. Number of dCas9 peaks overlapping LTR2 and LTR2B elements, or other genomic features. C. Log2 ratio of the ChIP-seq signal at dCas9 peaks (1kb regions from the centre of each peak) between K562 cells expressing LTR2B sgRNAs or empty vector. Orange points highlight dCas9 peaks overlapping LTR2B or LTR2 elements. D. Two examples of LTR2B/LTR2 elements targeted by dCas9, showing decreased H3K27ac and increased H3K9me3. E. Cell proliferation assay in K562 (left) and OCI-AML3 (right) cells expressing LTR2B sgRNAs or an empty vector (2 biological replicates and at least 2 technical replicates from each biological replicate were used, ANOVA with Sidak’s multiple comparison test, ** p
    Figure Legend Snippet: CRISPRi provides robust and selective targeting of LTR2B and LTR2 elements, which led to impaired cell growth. A. Profile of dCas9 ChIP-seq signal over LTR2B and LTR2 elements in K562 cells expressing LTR2B sgRNAs or an empty vector (‘None’). B. Number of dCas9 peaks overlapping LTR2 and LTR2B elements, or other genomic features. C. Log2 ratio of the ChIP-seq signal at dCas9 peaks (1kb regions from the centre of each peak) between K562 cells expressing LTR2B sgRNAs or empty vector. Orange points highlight dCas9 peaks overlapping LTR2B or LTR2 elements. D. Two examples of LTR2B/LTR2 elements targeted by dCas9, showing decreased H3K27ac and increased H3K9me3. E. Cell proliferation assay in K562 (left) and OCI-AML3 (right) cells expressing LTR2B sgRNAs or an empty vector (2 biological replicates and at least 2 technical replicates from each biological replicate were used, ANOVA with Sidak’s multiple comparison test, ** p

    Techniques Used: Chromatin Immunoprecipitation, Expressing, Plasmid Preparation, Proliferation Assay

    A-DARs bind AML-related transcription factors (TFs). A. Heatmap of the observed/expected enrichment for TF binding sites in K562 cells. B. ChIP-seq profiles of selected TFs across all elements of each A-DAR family. For each family, elements are displayed in the same order across all TF profiles. C. Percentage of ERVs from each family bearing a binding motif for the indicated TFs. D. Location of selected TF motifs at the consensus sequences of each A-DAR family. E. TF motif frequency at LTR2B and LTR5B elements, comparing those that overlap DHSs with those that do not.
    Figure Legend Snippet: A-DARs bind AML-related transcription factors (TFs). A. Heatmap of the observed/expected enrichment for TF binding sites in K562 cells. B. ChIP-seq profiles of selected TFs across all elements of each A-DAR family. For each family, elements are displayed in the same order across all TF profiles. C. Percentage of ERVs from each family bearing a binding motif for the indicated TFs. D. Location of selected TF motifs at the consensus sequences of each A-DAR family. E. TF motif frequency at LTR2B and LTR5B elements, comparing those that overlap DHSs with those that do not.

    Techniques Used: Binding Assay, Chromatin Immunoprecipitation

    Regulatory ERVs modulate host gene expression. A. Genome browser view of three candidate ERVs, showing H3K27ac and TF ChIP-seq tracks in K562 cells. B , C , D. Expression of nearby genes (left) in the excision clones of the indicated ERVs. The error bars show standard deviation (n≥4 technical replicates for each independent clone: 2 +/+, 3 +/- (B,C,D) and 1 -/- (B,D); ANOVA with Tukey’s multiple comparison test, * p
    Figure Legend Snippet: Regulatory ERVs modulate host gene expression. A. Genome browser view of three candidate ERVs, showing H3K27ac and TF ChIP-seq tracks in K562 cells. B , C , D. Expression of nearby genes (left) in the excision clones of the indicated ERVs. The error bars show standard deviation (n≥4 technical replicates for each independent clone: 2 +/+, 3 +/- (B,C,D) and 1 -/- (B,D); ANOVA with Tukey’s multiple comparison test, * p

    Techniques Used: Expressing, Chromatin Immunoprecipitation, Clone Assay, Standard Deviation

    APOC1 -LTR2 element regulates APOC1 expression and is essential for cell proliferation. A. Genome browser snapshot for APOC1 -LTR2 element, showing TAL1, STAT5 ChIP-seq tracks for WT; H3K27ac, H3K9me3 ChIP-seq and RNA-seq tracks for no control and CRISPRi K562 cells. B. Schematic of the experimental design to genetically excise APOC1 -LTR2 element. C. qPCR and D. RT-qPCR data from cells with APOC1 -LTR2 excision. The error bars show standard deviation (n≥3 biological replicates, t-test (C) ANOVA with Tukey’s multiple comparison test (D), * p
    Figure Legend Snippet: APOC1 -LTR2 element regulates APOC1 expression and is essential for cell proliferation. A. Genome browser snapshot for APOC1 -LTR2 element, showing TAL1, STAT5 ChIP-seq tracks for WT; H3K27ac, H3K9me3 ChIP-seq and RNA-seq tracks for no control and CRISPRi K562 cells. B. Schematic of the experimental design to genetically excise APOC1 -LTR2 element. C. qPCR and D. RT-qPCR data from cells with APOC1 -LTR2 excision. The error bars show standard deviation (n≥3 biological replicates, t-test (C) ANOVA with Tukey’s multiple comparison test (D), * p

    Techniques Used: Expressing, Chromatin Immunoprecipitation, RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation

    6) Product Images from "Streptococcus Mutans Adhesin Biotypes that Match and Predict Individual Caries Development"

    Article Title: Streptococcus Mutans Adhesin Biotypes that Match and Predict Individual Caries Development

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2017.09.027

    S. mutans biotypes A, B and C with corresponding SpaP adhesin subtypes of high (B-1) and low (A-1) cariogenicity. Clustering of S. mutans isolates from 35 caries (+) or 35 caries-free (−) extremes of infected children with caries status (+, − or DeFS at 12 years of age) based on neighbor joining and clonal complex analyses of spaP and housekeeping gene sequences. The isolates grouped both into biotypes A, B, and C with distinct SpaP A, B, and C adhesin types and clonal complexes C1–C9, and into genetically related subtypes that coincided with high caries ( i.e. B-1, B-2 and C6, C7) or low caries ( i.e. A-1 and C1) cases. The high- and low-cariogenic types also differed in acid tolerance and adhesion to DMBT1 and saliva. The clonal complexes share at least six identical alleles with at least one member in the group, all reflecting housekeeping alleles except for C8 which also shared the same spaP B allele. A total of 55 sequence types (ST) occurred among the 70 children. Numbers in parentheses mark STs shared in 15 children or identical STs in 25 children from which 74 additional strains were analyzed (mean 3, range 2 to 8 isolates/child).
    Figure Legend Snippet: S. mutans biotypes A, B and C with corresponding SpaP adhesin subtypes of high (B-1) and low (A-1) cariogenicity. Clustering of S. mutans isolates from 35 caries (+) or 35 caries-free (−) extremes of infected children with caries status (+, − or DeFS at 12 years of age) based on neighbor joining and clonal complex analyses of spaP and housekeeping gene sequences. The isolates grouped both into biotypes A, B, and C with distinct SpaP A, B, and C adhesin types and clonal complexes C1–C9, and into genetically related subtypes that coincided with high caries ( i.e. B-1, B-2 and C6, C7) or low caries ( i.e. A-1 and C1) cases. The high- and low-cariogenic types also differed in acid tolerance and adhesion to DMBT1 and saliva. The clonal complexes share at least six identical alleles with at least one member in the group, all reflecting housekeeping alleles except for C8 which also shared the same spaP B allele. A total of 55 sequence types (ST) occurred among the 70 children. Numbers in parentheses mark STs shared in 15 children or identical STs in 25 children from which 74 additional strains were analyzed (mean 3, range 2 to 8 isolates/child).

    Techniques Used: Infection, Sequencing

    Determination of S. mutans adhesin types in whole saliva. Children infected (+) or not infected (−) with A) a dominant or mixed SpaP A, B or C adhesin types and B) a Cnm or Cbm adhesin type of S. mutans by quantitative PCR of whole salivas (pg DNA responses, 95% CI). C) Total colony-forming units, CFU, of S. mutans (ms counts) in whole saliva of infected children as shown by box plots (* p = 0.003, Mann-Whitney U test).
    Figure Legend Snippet: Determination of S. mutans adhesin types in whole saliva. Children infected (+) or not infected (−) with A) a dominant or mixed SpaP A, B or C adhesin types and B) a Cnm or Cbm adhesin type of S. mutans by quantitative PCR of whole salivas (pg DNA responses, 95% CI). C) Total colony-forming units, CFU, of S. mutans (ms counts) in whole saliva of infected children as shown by box plots (* p = 0.003, Mann-Whitney U test).

    Techniques Used: Infection, Real-time Polymerase Chain Reaction, Mass Spectrometry, MANN-WHITNEY

    7) Product Images from "Lung CD103+ dendritic cells restrain allergic airway inflammation through IL-12 production"

    Article Title: Lung CD103+ dendritic cells restrain allergic airway inflammation through IL-12 production

    Journal: JCI Insight

    doi: 10.1172/jci.insight.90420

    CD103 + mig-DCs are the main DC source of IL-12 in mLNs after HDM exposure. Mice were challenged with 100 μg HDM i.n., and mLNs were collected 3 days later. ( A ) IL-12p40 and ( B ) IL-6 mRNA expression was analyzed in purified CD11c + cells, and mRNA was normalized against β-actin. Data shown (mean ± SEM) is a pool of 3 independent experiments; each symbol represents 1 experiment (5–10 mice pooled per experiment); ** P
    Figure Legend Snippet: CD103 + mig-DCs are the main DC source of IL-12 in mLNs after HDM exposure. Mice were challenged with 100 μg HDM i.n., and mLNs were collected 3 days later. ( A ) IL-12p40 and ( B ) IL-6 mRNA expression was analyzed in purified CD11c + cells, and mRNA was normalized against β-actin. Data shown (mean ± SEM) is a pool of 3 independent experiments; each symbol represents 1 experiment (5–10 mice pooled per experiment); ** P

    Techniques Used: Mouse Assay, Expressing, Purification

    8) Product Images from "Lung CD103+ dendritic cells restrain allergic airway inflammation through IL-12 production"

    Article Title: Lung CD103+ dendritic cells restrain allergic airway inflammation through IL-12 production

    Journal: JCI Insight

    doi: 10.1172/jci.insight.90420

    CD103 + mig-DCs are the main DC source of IL-12 in mLNs after HDM exposure. Mice were challenged with 100 μg HDM i.n., and mLNs were collected 3 days later. ( A ) IL-12p40 and ( B ) IL-6 mRNA expression was analyzed in purified CD11c + cells, and mRNA was normalized against β-actin. Data shown (mean ± SEM) is a pool of 3 independent experiments; each symbol represents 1 experiment (5–10 mice pooled per experiment); ** P
    Figure Legend Snippet: CD103 + mig-DCs are the main DC source of IL-12 in mLNs after HDM exposure. Mice were challenged with 100 μg HDM i.n., and mLNs were collected 3 days later. ( A ) IL-12p40 and ( B ) IL-6 mRNA expression was analyzed in purified CD11c + cells, and mRNA was normalized against β-actin. Data shown (mean ± SEM) is a pool of 3 independent experiments; each symbol represents 1 experiment (5–10 mice pooled per experiment); ** P

    Techniques Used: Mouse Assay, Expressing, Purification

    9) Product Images from "PGC-1α buffers ROS-mediated removal of mitochondria during myogenesis"

    Article Title: PGC-1α buffers ROS-mediated removal of mitochondria during myogenesis

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2014.458

    FOXO1 promotes mitophagy in a ROS-dependent manner during myogenesis. C2C12 cells were transfected with scramble (scr) or PGC-1 α siRNA (PGC-1 α (−)) and differentiated in DM for the indicated days. ( a ) Twenty micrograms of total proteins were loaded for western blot analysis of FOXO1. TUBB was used as the loading control. ( b ) Twenty micrograms of nuclear and cytoplasmatic proteins were loaded for western blot analysis of FOXO1. Sp1 and LDH were used as markers of fraction purity and as the loading control. ( c , d ) At day 2 of myogenesis, ChIP assay was carried out on cross-linked nuclei using LC3II ( upper panel ) or PINK1 ( bottom panel ) antibody followed by qPCR analysis of FOXO1 consensus sequence. Data are expressed as means±S.D. ( n =4, * P
    Figure Legend Snippet: FOXO1 promotes mitophagy in a ROS-dependent manner during myogenesis. C2C12 cells were transfected with scramble (scr) or PGC-1 α siRNA (PGC-1 α (−)) and differentiated in DM for the indicated days. ( a ) Twenty micrograms of total proteins were loaded for western blot analysis of FOXO1. TUBB was used as the loading control. ( b ) Twenty micrograms of nuclear and cytoplasmatic proteins were loaded for western blot analysis of FOXO1. Sp1 and LDH were used as markers of fraction purity and as the loading control. ( c , d ) At day 2 of myogenesis, ChIP assay was carried out on cross-linked nuclei using LC3II ( upper panel ) or PINK1 ( bottom panel ) antibody followed by qPCR analysis of FOXO1 consensus sequence. Data are expressed as means±S.D. ( n =4, * P

    Techniques Used: Transfection, Pyrolysis Gas Chromatography, Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Sequencing

    PGC-1 α buffers mitophagy during myogenesis. C2C12 cells were transfected with scramble (scr) or PGC-1 α siRNA (PGC-1 α (−)), differentiated in DM for the indicated days. ( a ) C2C12 cells were treated with 5 μ M CQ and 20 μ g of total proteins extracts were loaded for western blot analysis of LC3I-II and SQSTM1. TUBB was used as the loading control. Numbers indicate the density of immunoreactive bands calculated using the Software Quantity one (Bio-Rad) and reported as the ratio of LC3II/TUBB and SQSTM1/TUBB. ( b ) C2C12 cells were treated with 5 mM 3MA and 20 μ g of total proteins extracts were loaded for western blot analysis of LC3I-II and SQSTM1. TUBB was used as the loading control. Numbers indicate the density of immunoreactive bands calculated using the Software Quantity one (Bio-Rad) and reported as the ratio of LC3II/TUBB and SQSTM1/TUBB. ( c ) Total RNA was isolated, and relative mRNA level of LC3 and BNIP3 were analyzed by RT-qPCR. Data are expressed as means±S.D. ( n =6, * P
    Figure Legend Snippet: PGC-1 α buffers mitophagy during myogenesis. C2C12 cells were transfected with scramble (scr) or PGC-1 α siRNA (PGC-1 α (−)), differentiated in DM for the indicated days. ( a ) C2C12 cells were treated with 5 μ M CQ and 20 μ g of total proteins extracts were loaded for western blot analysis of LC3I-II and SQSTM1. TUBB was used as the loading control. Numbers indicate the density of immunoreactive bands calculated using the Software Quantity one (Bio-Rad) and reported as the ratio of LC3II/TUBB and SQSTM1/TUBB. ( b ) C2C12 cells were treated with 5 mM 3MA and 20 μ g of total proteins extracts were loaded for western blot analysis of LC3I-II and SQSTM1. TUBB was used as the loading control. Numbers indicate the density of immunoreactive bands calculated using the Software Quantity one (Bio-Rad) and reported as the ratio of LC3II/TUBB and SQSTM1/TUBB. ( c ) Total RNA was isolated, and relative mRNA level of LC3 and BNIP3 were analyzed by RT-qPCR. Data are expressed as means±S.D. ( n =6, * P

    Techniques Used: Pyrolysis Gas Chromatography, Transfection, Western Blot, Software, Isolation, Quantitative RT-PCR

    Nuclear and mitochondrial PGC-1 α induction is necessary to mitochondrial functionality during myogenesis. C2C12 cells were differentiated in DM for the indicated days. ( a ) Twenty micrograms of total proteins were loaded for western blot analysis of PGC-1 α , TFAM and COX4I1. TUBB was used as the loading control. ( b ) Total RNA was isolated, and relative mRNA level of PGC-1 α was analyzed by RT-qPCR. Data are expressed as means±S.D. ( n =6, * P
    Figure Legend Snippet: Nuclear and mitochondrial PGC-1 α induction is necessary to mitochondrial functionality during myogenesis. C2C12 cells were differentiated in DM for the indicated days. ( a ) Twenty micrograms of total proteins were loaded for western blot analysis of PGC-1 α , TFAM and COX4I1. TUBB was used as the loading control. ( b ) Total RNA was isolated, and relative mRNA level of PGC-1 α was analyzed by RT-qPCR. Data are expressed as means±S.D. ( n =6, * P

    Techniques Used: Pyrolysis Gas Chromatography, Western Blot, Isolation, Quantitative RT-PCR

    10) Product Images from "GLTSCR1 Negatively Regulates BRD4‐Dependent Transcription Elongation and Inhibits CRC Metastasis, GLTSCR1 Negatively Regulates BRD4‐Dependent Transcription Elongation and Inhibits CRC Metastasis"

    Article Title: GLTSCR1 Negatively Regulates BRD4‐Dependent Transcription Elongation and Inhibits CRC Metastasis, GLTSCR1 Negatively Regulates BRD4‐Dependent Transcription Elongation and Inhibits CRC Metastasis

    Journal: Advanced Science

    doi: 10.1002/advs.201901114

    GLTSCR1 regulates transcriptional elongation and enhances CRC cell sensitivity to BET inhibitors A) Luciferase reporter assay to detect the transcriptional activity of SLC2A1 and SLC2A3 in GLTSCR1‐KO HCT116 cells. B) ChIP‐PCR to detect the DNA binding capacity of Flag‐GLTSCR1 to SLC2A1 and SLC2A3 gene in scramble + empty vector, scramble + Flag‐GLTSCR1, and shBRD4 + Flag‐GLTSCR1 cells through pull‐down by anti‐Flag. C) ChIP‐PCR to detect the DNA binding capacity of BRD4 to SLC2A1 and SLC2A3 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐BRD4. D) Detection for nascent RNA of SLC2A1 and SLC2A3 in mock and GLTSCR1‐KO cells through RNA pull‐down by anti‐BrUTP. E) Transcription efficiency of SLC2A1 and SLC2A3 in GLTSCR1‐KO HCT116 cells, as determined by RT‐qPCR. F) ChIP‐PCR to detect the RNA Pol II chromatin occupancy in multiple sites of SLC2A1 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐RNA Pol II (left) and to analyze the accumulation of RNA Pol II in gene body of SLC2A1 after releasing f rom DRB‐inhibition at 0, 20, and 40 min in mock and GLTSCR1‐KO HCT116 cells (right). The upper schematic diagram represents the primers sites of SLC2A1. G) ChIP‐PCR to detect the RNA Pol II chromatin occupancy in multiply sites of SLC2A3 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐RNA Pol II (left) and to analyze the accumulation of RNA Pol II in gene body of SLC2A3 after releasing from DRB‐inhibition at 0, 20, and 40 min in mock and GLTSCR1‐KO HCT116 cells (right). The upper schematic diagram represents the primers sites of SLC2A3. H) Relative mRNA expression (up) and Immunoblotting analysis (down) of SLC2A1 and SLC2A3 in HCT116 cells transfected with siSLC2A1 and siSLC2A3. I) Transwell assay to investigate the migratory and invasive properties of HCT116 cells transfected with siSLC2A1 and siSLC2A3. The histogram on the right shows the quantification analysis results. J) JQ1 and I‐BET inhibition efficiency in control (mock), GLTSCR1‐KO and GLTSCR1‐C7/C9 heterozygous mutated HCT116 cells. Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P
    Figure Legend Snippet: GLTSCR1 regulates transcriptional elongation and enhances CRC cell sensitivity to BET inhibitors A) Luciferase reporter assay to detect the transcriptional activity of SLC2A1 and SLC2A3 in GLTSCR1‐KO HCT116 cells. B) ChIP‐PCR to detect the DNA binding capacity of Flag‐GLTSCR1 to SLC2A1 and SLC2A3 gene in scramble + empty vector, scramble + Flag‐GLTSCR1, and shBRD4 + Flag‐GLTSCR1 cells through pull‐down by anti‐Flag. C) ChIP‐PCR to detect the DNA binding capacity of BRD4 to SLC2A1 and SLC2A3 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐BRD4. D) Detection for nascent RNA of SLC2A1 and SLC2A3 in mock and GLTSCR1‐KO cells through RNA pull‐down by anti‐BrUTP. E) Transcription efficiency of SLC2A1 and SLC2A3 in GLTSCR1‐KO HCT116 cells, as determined by RT‐qPCR. F) ChIP‐PCR to detect the RNA Pol II chromatin occupancy in multiple sites of SLC2A1 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐RNA Pol II (left) and to analyze the accumulation of RNA Pol II in gene body of SLC2A1 after releasing f rom DRB‐inhibition at 0, 20, and 40 min in mock and GLTSCR1‐KO HCT116 cells (right). The upper schematic diagram represents the primers sites of SLC2A1. G) ChIP‐PCR to detect the RNA Pol II chromatin occupancy in multiply sites of SLC2A3 gene in mock and GLTSCR1‐KO cells through pull‐down by anti‐RNA Pol II (left) and to analyze the accumulation of RNA Pol II in gene body of SLC2A3 after releasing from DRB‐inhibition at 0, 20, and 40 min in mock and GLTSCR1‐KO HCT116 cells (right). The upper schematic diagram represents the primers sites of SLC2A3. H) Relative mRNA expression (up) and Immunoblotting analysis (down) of SLC2A1 and SLC2A3 in HCT116 cells transfected with siSLC2A1 and siSLC2A3. I) Transwell assay to investigate the migratory and invasive properties of HCT116 cells transfected with siSLC2A1 and siSLC2A3. The histogram on the right shows the quantification analysis results. J) JQ1 and I‐BET inhibition efficiency in control (mock), GLTSCR1‐KO and GLTSCR1‐C7/C9 heterozygous mutated HCT116 cells. Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P

    Techniques Used: Luciferase, Reporter Assay, Activity Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Binding Assay, Plasmid Preparation, Quantitative RT-PCR, Inhibition, Expressing, Transfection, Transwell Assay

    The C‐terminus of GLTSCR1 regulates CRC metastasis through interacting with BRD4. A) Immunofluorescence staining for HA‐GLTSCR1 Del‐FS + NLS or HA‐GLTSCR1 In‐FS + NLS in HCT116 cells. Nuclei were stained with DAPI. Scale bars, 10 µm. B) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged BRD4, HA‐tagged HA‐GLTSCR1 WT HA‐GLTSCR1 Del‐FS , HA‐GLTSCR1 In‐FS , HA‐GLTSCR1 Del‐FS + NLS, and HA‐GLTSCR1 In‐FS + NLS by an anti‐Flag antibody in HEK293 cells. C) Schematic of the C‐terminus of GLTSCR1 and the GLTSCR1 deletion constructs. D) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1 with different deletion fragments and HA‐tagged BRD4 by an anti‐Flag antibody in HEK293 cells. E) Immunoblotting analysis of BRD4 protein expression in scrambled shRNA and shBRD4‐transfected HCT116 mock (upper panel) and HCT116 GLTSCR1‐KO (lower panel) cells. F) Transwell assay for investigating migration and invasion potential in scrambled shRNA‐ and shBRD4‐transfected HCT116 mock (upper panel) and HCT116 GLTSCR1‐KO (lower panel) cells. The histograms on the right show the quantification analysis results. G) Immunoblotting analysis of BRD4 and GLTSCR1 protein expression in HCT116 cells transfected with shBRD4 and shBRD4 + shGLTSCR1 (left panel); Transwell assay to investigate the migration and invasion potential (middle panel) in these cells. The histograms on the right show the quantification analysis results. Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P
    Figure Legend Snippet: The C‐terminus of GLTSCR1 regulates CRC metastasis through interacting with BRD4. A) Immunofluorescence staining for HA‐GLTSCR1 Del‐FS + NLS or HA‐GLTSCR1 In‐FS + NLS in HCT116 cells. Nuclei were stained with DAPI. Scale bars, 10 µm. B) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged BRD4, HA‐tagged HA‐GLTSCR1 WT HA‐GLTSCR1 Del‐FS , HA‐GLTSCR1 In‐FS , HA‐GLTSCR1 Del‐FS + NLS, and HA‐GLTSCR1 In‐FS + NLS by an anti‐Flag antibody in HEK293 cells. C) Schematic of the C‐terminus of GLTSCR1 and the GLTSCR1 deletion constructs. D) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1 with different deletion fragments and HA‐tagged BRD4 by an anti‐Flag antibody in HEK293 cells. E) Immunoblotting analysis of BRD4 protein expression in scrambled shRNA and shBRD4‐transfected HCT116 mock (upper panel) and HCT116 GLTSCR1‐KO (lower panel) cells. F) Transwell assay for investigating migration and invasion potential in scrambled shRNA‐ and shBRD4‐transfected HCT116 mock (upper panel) and HCT116 GLTSCR1‐KO (lower panel) cells. The histograms on the right show the quantification analysis results. G) Immunoblotting analysis of BRD4 and GLTSCR1 protein expression in HCT116 cells transfected with shBRD4 and shBRD4 + shGLTSCR1 (left panel); Transwell assay to investigate the migration and invasion potential (middle panel) in these cells. The histograms on the right show the quantification analysis results. Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P

    Techniques Used: Immunofluorescence, Staining, Immunoprecipitation, Construct, Expressing, shRNA, Transfection, Transwell Assay, Migration

    Truncated GLTSCR1 FS loses its antimetastatic function. A) Immunoblotting analysis of GLTSCR1 protein expression in GLTSCR1‐KO HCT116 cells with re‐expression of Flag‐GLTSCR1 WT , GLTSCR1 Del‐FS , and GLTSCR1 In‐FS . B) Transwell assay to investigate the migration and invasion potential of GLTSCR1‐KO HCT116 cells with re‐expression of Flag‐GLTSCR1 WT , GLTSCR1 Del‐FS , and GLTSCR1 In‐FS . The histogram on the right shows the quantification analysis results. C) DNA sequence of the GLTSCR1 C8 microsatellite site in CRISPR‐mediated heterozygous‐mutated HCT116 cell lines (the arrows indicate the mutation site). D) Transwell assay to investigate the migration and invasion potential of control (mock) and CRISPR‐mediated heterozygous‐mutated HCT116 cell lines (GLTSCR1‐KO2 for positive control). The histogram on the right shows the quantification analysis results. E) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1, HA‐tagged BRD4, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. F) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged BRD4, HA‐tagged GLTSCR1, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. G) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1 WT , GLTSCR1 Del‐FS or GLTSCR1 In‐FS , HA‐tagged BRD4, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. H) Immunofluorescence staining for exogenous Flag‐tagged BRD4 and HA‐tagged GLTSCR1 WT , GLTSCR1 Del‐FS or GLTSCR1 In‐FS in HCT116 cells. Nuclei were stained with DAPI. Scale bars, 10 µm. The Y ‐axis represents measurements of fluorescent intensity and the X ‐axis represents the drawn distances for colocalization analysis (the Pearson's coefficient in colocalized volume for the colocalization index). Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P
    Figure Legend Snippet: Truncated GLTSCR1 FS loses its antimetastatic function. A) Immunoblotting analysis of GLTSCR1 protein expression in GLTSCR1‐KO HCT116 cells with re‐expression of Flag‐GLTSCR1 WT , GLTSCR1 Del‐FS , and GLTSCR1 In‐FS . B) Transwell assay to investigate the migration and invasion potential of GLTSCR1‐KO HCT116 cells with re‐expression of Flag‐GLTSCR1 WT , GLTSCR1 Del‐FS , and GLTSCR1 In‐FS . The histogram on the right shows the quantification analysis results. C) DNA sequence of the GLTSCR1 C8 microsatellite site in CRISPR‐mediated heterozygous‐mutated HCT116 cell lines (the arrows indicate the mutation site). D) Transwell assay to investigate the migration and invasion potential of control (mock) and CRISPR‐mediated heterozygous‐mutated HCT116 cell lines (GLTSCR1‐KO2 for positive control). The histogram on the right shows the quantification analysis results. E) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1, HA‐tagged BRD4, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. F) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged BRD4, HA‐tagged GLTSCR1, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. G) Immunoblotting to detect the immunoprecipitation of exogenous Flag‐tagged GLTSCR1 WT , GLTSCR1 Del‐FS or GLTSCR1 In‐FS , HA‐tagged BRD4, CT1 and CK9 by an anti‐Flag antibody in HEK293 cells. H) Immunofluorescence staining for exogenous Flag‐tagged BRD4 and HA‐tagged GLTSCR1 WT , GLTSCR1 Del‐FS or GLTSCR1 In‐FS in HCT116 cells. Nuclei were stained with DAPI. Scale bars, 10 µm. The Y ‐axis represents measurements of fluorescent intensity and the X ‐axis represents the drawn distances for colocalization analysis (the Pearson's coefficient in colocalized volume for the colocalization index). Data are presented as the mean ± SD; statistical significance was assessed by an unpaired t ‐test. * P

    Techniques Used: Expressing, Transwell Assay, Migration, Sequencing, CRISPR, Mutagenesis, Positive Control, Immunoprecipitation, Immunofluorescence, Staining

    Identification of genes and pathways coregulated by GLTSCR1 and BRD4. A) Heat map of DEGs in HCT116 mock versus GLTSCR1‐KO1 and GLTSCR1‐KO2 cells identified via RNA‐seq. B) Top upregulated biological process terms regulated by GLTSCR1 identified via gene ontology enrichment analysis of the DEGs based on DAVID online tools ( P
    Figure Legend Snippet: Identification of genes and pathways coregulated by GLTSCR1 and BRD4. A) Heat map of DEGs in HCT116 mock versus GLTSCR1‐KO1 and GLTSCR1‐KO2 cells identified via RNA‐seq. B) Top upregulated biological process terms regulated by GLTSCR1 identified via gene ontology enrichment analysis of the DEGs based on DAVID online tools ( P

    Techniques Used: RNA Sequencing Assay

    GLTSCR1 inhibits CRC metastasis both in vitro and in vivo. A) Immunoblotting analysis of GLTSCR1 protein expression in HCT116 (upper) and SW480 (lower) cells transfected with scrambled shRNA and shGLTSCR1. B) Transwell assay to investigate the migratory and invasive properties of HCT116 (upper) and SW480 (lower) cells transfected with scrambled shRNA and shGLTSCR1. The histograms on the right show the quantification analysis results. C) Immunoblotting analysis of GLTSCR1 protein expression in control (mock) and GLTSCR1‐KO (GLTSCR1‐KO1 and KO2) HCT116 cells. D) Transwell assay to investigate the migratory and invasive properties of control (mock) and GLTSCR1‐KO (GLTSCR1‐KO1 and KO2) HCT116 cells. The histogram on the right shows the quantification analysis results. E) Representative bioluminescence images of the lung metastasis model established by tail vein injection of control (mock) and GLTSCR1‐KO HCT116 cells in NOD/SCID mice. F) Quantification of the photon flux in pulmonary metastatic luciferase foci. Data are presented as the mean ± standard deviation (SD); statistical significance was assessed by an unpaired t ‐test. * P
    Figure Legend Snippet: GLTSCR1 inhibits CRC metastasis both in vitro and in vivo. A) Immunoblotting analysis of GLTSCR1 protein expression in HCT116 (upper) and SW480 (lower) cells transfected with scrambled shRNA and shGLTSCR1. B) Transwell assay to investigate the migratory and invasive properties of HCT116 (upper) and SW480 (lower) cells transfected with scrambled shRNA and shGLTSCR1. The histograms on the right show the quantification analysis results. C) Immunoblotting analysis of GLTSCR1 protein expression in control (mock) and GLTSCR1‐KO (GLTSCR1‐KO1 and KO2) HCT116 cells. D) Transwell assay to investigate the migratory and invasive properties of control (mock) and GLTSCR1‐KO (GLTSCR1‐KO1 and KO2) HCT116 cells. The histogram on the right shows the quantification analysis results. E) Representative bioluminescence images of the lung metastasis model established by tail vein injection of control (mock) and GLTSCR1‐KO HCT116 cells in NOD/SCID mice. F) Quantification of the photon flux in pulmonary metastatic luciferase foci. Data are presented as the mean ± standard deviation (SD); statistical significance was assessed by an unpaired t ‐test. * P

    Techniques Used: In Vitro, In Vivo, Expressing, Transfection, shRNA, Transwell Assay, Injection, Mouse Assay, Luciferase, Standard Deviation

    11) Product Images from "C13 Megastigmane Derivatives From Epipremnum pinnatum: β-Damascenone Inhibits the Expression of Pro-Inflammatory Cytokines and Leukocyte Adhesion Molecules as Well as NF-κB Signaling"

    Article Title: C13 Megastigmane Derivatives From Epipremnum pinnatum: β-Damascenone Inhibits the Expression of Pro-Inflammatory Cytokines and Leukocyte Adhesion Molecules as Well as NF-κB Signaling

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2019.01351

    Inhibition of (A) E-selectin mRNA expression in HUVECtert and (B) TNF-α mRNA expression in THP-1 cells stimulated with different agonists of NF-κB pathway. Cells were pretreated with β-damascenone ( 10 ) for 30 min followed by stimulation with LPS (30 ng/ml), TNF-α (0.3 ng/ml) or IL-1β (1 ng/ml) for 4 hours. Basal values refer to vehicle-stimulated cells. Isolation of total RNA, cDNA synthesis and real-time PCR were performed as described in materials and methods section. Results are normalized to β2-microglobulin. Data are presented as mean ± SE (n=4). P-Values are shown as **
    Figure Legend Snippet: Inhibition of (A) E-selectin mRNA expression in HUVECtert and (B) TNF-α mRNA expression in THP-1 cells stimulated with different agonists of NF-κB pathway. Cells were pretreated with β-damascenone ( 10 ) for 30 min followed by stimulation with LPS (30 ng/ml), TNF-α (0.3 ng/ml) or IL-1β (1 ng/ml) for 4 hours. Basal values refer to vehicle-stimulated cells. Isolation of total RNA, cDNA synthesis and real-time PCR were performed as described in materials and methods section. Results are normalized to β2-microglobulin. Data are presented as mean ± SE (n=4). P-Values are shown as **

    Techniques Used: Inhibition, Expressing, Isolation, Real-time Polymerase Chain Reaction

    β-Damascenone at tested concentrations is not toxic. HUVECtert. (A , B) and differentiated THP-1 (C , D) cells were treated with different concentrations of β-damascenone. 0.2% DMSO served as vehicle control. After 24 h, confluence (B , D) and metabolic activity (XTT assay, A and C ) were determined. The Figure presents mean values ± SD of two independent experiments with six biological replicates each.
    Figure Legend Snippet: β-Damascenone at tested concentrations is not toxic. HUVECtert. (A , B) and differentiated THP-1 (C , D) cells were treated with different concentrations of β-damascenone. 0.2% DMSO served as vehicle control. After 24 h, confluence (B , D) and metabolic activity (XTT assay, A and C ) were determined. The Figure presents mean values ± SD of two independent experiments with six biological replicates each.

    Techniques Used: Activity Assay, XTT Assay

    12) Product Images from "Cloning and Characterization of a P2X Receptor Expressed in the Central Nervous System of Lymnaea stagnalis"

    Article Title: Cloning and Characterization of a P2X Receptor Expressed in the Central Nervous System of Lymnaea stagnalis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050487

    Lym P2X is widely expressed in Lymnaea CNS. (A) RT-PCR using primers for Lym P2X (primer pair 8 ( Table 1 ) and β-tubulin (primer pair 9).+indicates PCR reactions on cDNA samples reverse transcribed from RNA prepared from the various ganglia indicated. – indicates negative control reactions where reverse transcriptase had been omitted from the cDNA synthesis reaction to control for genomic DNA contamination. M = molecular mass ladder (size in kb). (B) Quantitative PCR data showing the relative expression levels of Lym P2X in various ganglia (normalised to pleural ganglia), n = 3 independent reactions for each sample.
    Figure Legend Snippet: Lym P2X is widely expressed in Lymnaea CNS. (A) RT-PCR using primers for Lym P2X (primer pair 8 ( Table 1 ) and β-tubulin (primer pair 9).+indicates PCR reactions on cDNA samples reverse transcribed from RNA prepared from the various ganglia indicated. – indicates negative control reactions where reverse transcriptase had been omitted from the cDNA synthesis reaction to control for genomic DNA contamination. M = molecular mass ladder (size in kb). (B) Quantitative PCR data showing the relative expression levels of Lym P2X in various ganglia (normalised to pleural ganglia), n = 3 independent reactions for each sample.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Negative Control, Real-time Polymerase Chain Reaction, Expressing

    13) Product Images from "Gene silencing by RNA interference in the ectoparasitic mite, Psoroptes ovis"

    Article Title: Gene silencing by RNA interference in the ectoparasitic mite, Psoroptes ovis

    Journal: Veterinary Research

    doi: 10.1186/s13567-018-0608-9

    Gene silencing in Psoroptes ovis by RNAi. Mean expression levels of transcripts encoding Pso o 2, Po GST-mu1 and Po βtub normalised to Po βactin (copies/µL) determined by qPCR compared to control mites immersed in dsRNA encoding lacZ are shown for adult male mites immersed overnight at 4 °C in dsRNA representing Pso o 2 ( A ), Po GST-mu1 ( C ) and Po βtub ( E ), or immersed in dsRNA representing Pso o 2 ( B ), Po GST-mu1 ( D ) and Po βtub ( F ) overnight at 4 °C followed by 48 h in a humidity incubator (25 °C, 75% RH). n = 5 for each treatment group with the exception of the lacZ control group in the Po βtub overnight incubation only experiment where n = 4, error bars indicate mean ± SEM.
    Figure Legend Snippet: Gene silencing in Psoroptes ovis by RNAi. Mean expression levels of transcripts encoding Pso o 2, Po GST-mu1 and Po βtub normalised to Po βactin (copies/µL) determined by qPCR compared to control mites immersed in dsRNA encoding lacZ are shown for adult male mites immersed overnight at 4 °C in dsRNA representing Pso o 2 ( A ), Po GST-mu1 ( C ) and Po βtub ( E ), or immersed in dsRNA representing Pso o 2 ( B ), Po GST-mu1 ( D ) and Po βtub ( F ) overnight at 4 °C followed by 48 h in a humidity incubator (25 °C, 75% RH). n = 5 for each treatment group with the exception of the lacZ control group in the Po βtub overnight incubation only experiment where n = 4, error bars indicate mean ± SEM.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Incubation

    14) Product Images from "Association between circadian gene CLOCK and cisplatin resistance in ovarian cancer cells: A preliminary study"

    Article Title: Association between circadian gene CLOCK and cisplatin resistance in ovarian cancer cells: A preliminary study

    Journal: Oncology Letters

    doi: 10.3892/ol.2018.8488

    Effects of cisplatin on CLOCK protein expression in A2780 and CP70 cells. CLOCK, clock circadian regulator. *P
    Figure Legend Snippet: Effects of cisplatin on CLOCK protein expression in A2780 and CP70 cells. CLOCK, clock circadian regulator. *P

    Techniques Used: Expressing

    Proliferation and apoptosis of CP70 cells following CLOCK knockdown, as detected by MTT assay. DDP, cisplatin. *P
    Figure Legend Snippet: Proliferation and apoptosis of CP70 cells following CLOCK knockdown, as detected by MTT assay. DDP, cisplatin. *P

    Techniques Used: MTT Assay

    15) Product Images from "Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression"

    Article Title: Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression

    Journal: Biology Open

    doi: 10.1242/bio.031229

    Med12 is required for expression of avp , crh and trh and modulates expression of prl and tsh . A-E′ are all dorsal views of WISH in 48 hpf embryos magnified ×100. (A,B,C,D,E) wild-type siblings. (A′,B′,C′,D′,E′) med12 mutants. (A,A′) avp expression in the PO and vH. (B,B′) crh expression in the PO, PT and Lc. (C,C′) trh expression in the PO, vH and Lc. (D,D′) prl expression in the pituitary. (E,E′) tsh expression in the pituitary. (F,G) Expression of prl (F) and tsh (G) were measured in 48 hpf embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 ( actb2 ), and are expressed as fold changes relative to wild-type sibling controls. ** P
    Figure Legend Snippet: Med12 is required for expression of avp , crh and trh and modulates expression of prl and tsh . A-E′ are all dorsal views of WISH in 48 hpf embryos magnified ×100. (A,B,C,D,E) wild-type siblings. (A′,B′,C′,D′,E′) med12 mutants. (A,A′) avp expression in the PO and vH. (B,B′) crh expression in the PO, PT and Lc. (C,C′) trh expression in the PO, vH and Lc. (D,D′) prl expression in the pituitary. (E,E′) tsh expression in the pituitary. (F,G) Expression of prl (F) and tsh (G) were measured in 48 hpf embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 ( actb2 ), and are expressed as fold changes relative to wild-type sibling controls. ** P

    Techniques Used: Expressing, Quantitative RT-PCR

    16) Product Images from "Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression"

    Article Title: Separate roles for Med12 and Wnt signaling in regulation of oxytocin expression

    Journal: Biology Open

    doi: 10.1242/bio.031229

    Med12 is required for expression of avp , crh and trh and modulates expression of prl and tsh . A-E′ are all dorsal views of WISH in 48 hpf embryos magnified ×100. (A,B,C,D,E) wild-type siblings. (A′,B′,C′,D′,E′) med12 mutants. (A,A′) avp expression in the PO and vH. (B,B′) crh expression in the PO, PT and Lc. (C,C′) trh expression in the PO, vH and Lc. (D,D′) prl expression in the pituitary. (E,E′) tsh expression in the pituitary. (F,G) Expression of prl (F) and tsh (G) were measured in 48 hpf embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 ( actb2 ), and are expressed as fold changes relative to wild-type sibling controls. ** P
    Figure Legend Snippet: Med12 is required for expression of avp , crh and trh and modulates expression of prl and tsh . A-E′ are all dorsal views of WISH in 48 hpf embryos magnified ×100. (A,B,C,D,E) wild-type siblings. (A′,B′,C′,D′,E′) med12 mutants. (A,A′) avp expression in the PO and vH. (B,B′) crh expression in the PO, PT and Lc. (C,C′) trh expression in the PO, vH and Lc. (D,D′) prl expression in the pituitary. (E,E′) tsh expression in the pituitary. (F,G) Expression of prl (F) and tsh (G) were measured in 48 hpf embryos using RT-qPCR. Gene expression values were normalized to an endogenous control, beta actin 2 ( actb2 ), and are expressed as fold changes relative to wild-type sibling controls. ** P

    Techniques Used: Expressing, Quantitative RT-PCR

    17) Product Images from "Wnt/β-catenin signaling stimulates the expression and synaptic clustering of the autism-associated Neuroligin 3 gene"

    Article Title: Wnt/β-catenin signaling stimulates the expression and synaptic clustering of the autism-associated Neuroligin 3 gene

    Journal: Translational Psychiatry

    doi: 10.1038/s41398-018-0093-y

    Functional β-catenin responsive element in the Nlgn3 promoter. a Top panel: Representation of the 1.4 kb mouse Nlng3 promoter construct depicting the five TBE sites analyzed by ChIP assays. Bottom panel: Endogenous β-catenin binding to TBE Sites in the mouse Nlgn3 promoter examined in HT22 cells after treatment with either Wnt3a-CM for 4 h (left) or 20 mM LiCl for 24 h (right). Data represent mean ± s.e.m., ** P
    Figure Legend Snippet: Functional β-catenin responsive element in the Nlgn3 promoter. a Top panel: Representation of the 1.4 kb mouse Nlng3 promoter construct depicting the five TBE sites analyzed by ChIP assays. Bottom panel: Endogenous β-catenin binding to TBE Sites in the mouse Nlgn3 promoter examined in HT22 cells after treatment with either Wnt3a-CM for 4 h (left) or 20 mM LiCl for 24 h (right). Data represent mean ± s.e.m., ** P

    Techniques Used: Functional Assay, Construct, Chromatin Immunoprecipitation, Binding Assay

    Wnt/β-catenin signaling activates Nlgn3 transcriptional program in hippocampal cells. a Top: Genomic context of human NLGN3 in the long arm of chromosome X and schematic exon-intron boundaries of the gene. White and gray boxes: 5′ and 3′ UTR and exons, respectively. Middle: Conservation profile of the human NLGN3 promoter sequence compared with similar genomic regions in Mus musculus and Rattus norvegicus (50–100%). Bottom: Schematic representation of potential TCF/LEF sites (TBE: CTTTG, circles) found in these species. ECR: Evolutionary conserved region. b Early expression levels of Nlgn3 and cMyc genes after 2 h treatment with increasing doses of either purified Wnt3a protein or LiCl in HT22 hippocampal cells or rat primary hippocampal neurons (RHN). Rpl13a was used as a reference gene. c Quantitative determination of Nlgn3 and cMyc mRNA levels after 2 h treatment with Wnt3a (200–400 ng/ml) protein or LiCl (10–20 mM) in HT22 hippocampal cells and RHNs. d TOP: protein levels of β-catenin after 48 h treatment with β-catenin-shRNA. shRNA of GFP was used as control and β-actin as a loading control. Bottom: expression levels of Nlgn3 and β- catenin. e Nlgn3 and β-catenin protein levels in HT22 cells and RHNs after 6 h treatment with 200 and 400 ng/ml of purified Wnt3a protein. β-actin was used as a loading control. In ( c ) and ( d ), data represent mean ± s.e.m., * P
    Figure Legend Snippet: Wnt/β-catenin signaling activates Nlgn3 transcriptional program in hippocampal cells. a Top: Genomic context of human NLGN3 in the long arm of chromosome X and schematic exon-intron boundaries of the gene. White and gray boxes: 5′ and 3′ UTR and exons, respectively. Middle: Conservation profile of the human NLGN3 promoter sequence compared with similar genomic regions in Mus musculus and Rattus norvegicus (50–100%). Bottom: Schematic representation of potential TCF/LEF sites (TBE: CTTTG, circles) found in these species. ECR: Evolutionary conserved region. b Early expression levels of Nlgn3 and cMyc genes after 2 h treatment with increasing doses of either purified Wnt3a protein or LiCl in HT22 hippocampal cells or rat primary hippocampal neurons (RHN). Rpl13a was used as a reference gene. c Quantitative determination of Nlgn3 and cMyc mRNA levels after 2 h treatment with Wnt3a (200–400 ng/ml) protein or LiCl (10–20 mM) in HT22 hippocampal cells and RHNs. d TOP: protein levels of β-catenin after 48 h treatment with β-catenin-shRNA. shRNA of GFP was used as control and β-actin as a loading control. Bottom: expression levels of Nlgn3 and β- catenin. e Nlgn3 and β-catenin protein levels in HT22 cells and RHNs after 6 h treatment with 200 and 400 ng/ml of purified Wnt3a protein. β-actin was used as a loading control. In ( c ) and ( d ), data represent mean ± s.e.m., * P

    Techniques Used: Sequencing, Expressing, Purification, shRNA

    18) Product Images from "A Novel Combined Scientific and Artistic Approach for the Advanced Characterization of Interactomes: The Akirin/Subolesin Model"

    Article Title: A Novel Combined Scientific and Artistic Approach for the Advanced Characterization of Interactomes: The Akirin/Subolesin Model

    Journal: Vaccines

    doi: 10.3390/vaccines8010077

    AKR2 interactome differentially regulated the NF-κB pathway. ( A ) Protein transfection was confirmed in FITC-antibody positive control-transfected cells and untreated negative control cells by fluorescence microscopy. Host cell nucleus was stained with DAPI (blue). Image of negative control cells was also collected by phase contrast microscopy and superimposed to FITC/DAPI merged image. Bar: 20 µm. ( B ) The expression of IFN-β was characterized in human placenta cells after gene knockdown by qRT-PCR. The IFN-β mRNA levels were normalized against human β-actin , and normalized Ct values were compared between test siRNA-treated placenta cells and controls treated with non-targeting siRNA (C-) by Student’s t -test with unequal variance (* p
    Figure Legend Snippet: AKR2 interactome differentially regulated the NF-κB pathway. ( A ) Protein transfection was confirmed in FITC-antibody positive control-transfected cells and untreated negative control cells by fluorescence microscopy. Host cell nucleus was stained with DAPI (blue). Image of negative control cells was also collected by phase contrast microscopy and superimposed to FITC/DAPI merged image. Bar: 20 µm. ( B ) The expression of IFN-β was characterized in human placenta cells after gene knockdown by qRT-PCR. The IFN-β mRNA levels were normalized against human β-actin , and normalized Ct values were compared between test siRNA-treated placenta cells and controls treated with non-targeting siRNA (C-) by Student’s t -test with unequal variance (* p

    Techniques Used: Transfection, Positive Control, Negative Control, Fluorescence, Microscopy, Staining, Expressing, Quantitative RT-PCR

    19) Product Images from "Novel association of DJ-1 with HER3 potentiates HER3 activation and signaling in cancer"

    Article Title: Novel association of DJ-1 with HER3 potentiates HER3 activation and signaling in cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.11613

    DJ-1 overexpressing cancer cells are more sensitive to anti-HER3 antibody treatment A. Inhibition of HER3 signaling by anti-HER3 antibody (HER3mAb) in DJ-1 overexpressing T47-D and MCF-7 cells. B. DJ-1 overexpressing T47-D and MCF-7 cells showed increased sensitivity to inhibition of cell proliferation by HER3mAb treatment. The numbers on the top of the bar graph indicate the % of inhibition by HER3mAb treatment, n=4, **P
    Figure Legend Snippet: DJ-1 overexpressing cancer cells are more sensitive to anti-HER3 antibody treatment A. Inhibition of HER3 signaling by anti-HER3 antibody (HER3mAb) in DJ-1 overexpressing T47-D and MCF-7 cells. B. DJ-1 overexpressing T47-D and MCF-7 cells showed increased sensitivity to inhibition of cell proliferation by HER3mAb treatment. The numbers on the top of the bar graph indicate the % of inhibition by HER3mAb treatment, n=4, **P

    Techniques Used: Inhibition

    NRG-1 reduces the association of HER3 and DJ-1 A. Co-IP was performed with T47-D cells using DJ-1 Ab to pull down the associated HER3 and HER3 Ab to pull down associated DJ-1, and detected by WB. B. WB detection of remaining free HER3 or DJ-1 in the supernatants collected from the co-IP study in A. The bar graphs below the WB indicate the signal levels of un-associated HER3 and DJ-1 on the WB. C. Co-IP was performed in MCF-7 cells using DJ-1 and HER3 antibodies to detect the association between HER3 and DJ-1. D. WB detection of remaining free HER3 or DJ-1 in the supernatants collected from the co-IP study in C using co-IP supernatants of MCF-7 cells. E. Effects of NRG-1 on the association of HER3 and DJ-1 by PLA detection. The association of DJ-1 and HER3 (the red fluorescence dots) was quantified. All experiments were repeated at least three time (n=3) and representative images are shown.
    Figure Legend Snippet: NRG-1 reduces the association of HER3 and DJ-1 A. Co-IP was performed with T47-D cells using DJ-1 Ab to pull down the associated HER3 and HER3 Ab to pull down associated DJ-1, and detected by WB. B. WB detection of remaining free HER3 or DJ-1 in the supernatants collected from the co-IP study in A. The bar graphs below the WB indicate the signal levels of un-associated HER3 and DJ-1 on the WB. C. Co-IP was performed in MCF-7 cells using DJ-1 and HER3 antibodies to detect the association between HER3 and DJ-1. D. WB detection of remaining free HER3 or DJ-1 in the supernatants collected from the co-IP study in C using co-IP supernatants of MCF-7 cells. E. Effects of NRG-1 on the association of HER3 and DJ-1 by PLA detection. The association of DJ-1 and HER3 (the red fluorescence dots) was quantified. All experiments were repeated at least three time (n=3) and representative images are shown.

    Techniques Used: Co-Immunoprecipitation Assay, Western Blot, Proximity Ligation Assay, Fluorescence

    The effect of DJ-1 on HER3 mRNA, protein expression, and protein stability in breast cancer cells A. shDJ-1 knockdown in T47-D and MCF-7 cells decreased HER3 mRNA levels. B. Stable shDJ-1 knockdown in T47-D and MCF-7 cell lines decreased HER3 protein levels. The bar graphs below the WB image indicate the quantification of WB by ImageJ. C. Increased HER3 mRNA levels in T47-D and MCF-7 cell lines with DJ-1 overexpression as determined by qPCR. D. DJ-1 overexpression in T47-D and MCF-7 cell lines increased HER3 protein levels by WB and bar graph below the WB image indicates the quantification of WB by imageJ. E. DJ-1 shRNA cancer cells had decreased half-life of HER3 protein. Cells were cultured in the presence or absence of cycloheximide (CHX), and cell lysates were collected at indicated times. WB images show the levels of HER3 and DJ-1 and quantitation of the signals by ImageJ is shown in the graphs on the right side. F. Increased ubiquitination of HER3 in DJ-1 shRNA cancer cells in the presence or absence of proteasome inhibitor MG132. Cancer cell lysates were subjected to IP using anti-HER3 antibody, and ubiquitinated HER3 was detected with an anti-ubiquitin antibody (P4D1). All experiments were repeated three times, n=3. * indicates p
    Figure Legend Snippet: The effect of DJ-1 on HER3 mRNA, protein expression, and protein stability in breast cancer cells A. shDJ-1 knockdown in T47-D and MCF-7 cells decreased HER3 mRNA levels. B. Stable shDJ-1 knockdown in T47-D and MCF-7 cell lines decreased HER3 protein levels. The bar graphs below the WB image indicate the quantification of WB by ImageJ. C. Increased HER3 mRNA levels in T47-D and MCF-7 cell lines with DJ-1 overexpression as determined by qPCR. D. DJ-1 overexpression in T47-D and MCF-7 cell lines increased HER3 protein levels by WB and bar graph below the WB image indicates the quantification of WB by imageJ. E. DJ-1 shRNA cancer cells had decreased half-life of HER3 protein. Cells were cultured in the presence or absence of cycloheximide (CHX), and cell lysates were collected at indicated times. WB images show the levels of HER3 and DJ-1 and quantitation of the signals by ImageJ is shown in the graphs on the right side. F. Increased ubiquitination of HER3 in DJ-1 shRNA cancer cells in the presence or absence of proteasome inhibitor MG132. Cancer cell lysates were subjected to IP using anti-HER3 antibody, and ubiquitinated HER3 was detected with an anti-ubiquitin antibody (P4D1). All experiments were repeated three times, n=3. * indicates p

    Techniques Used: Expressing, Western Blot, Over Expression, Real-time Polymerase Chain Reaction, shRNA, Cell Culture, Quantitation Assay

    DJ-1 knockdown decreases HER3-mediated signaling, cell proliferation, 3D spheroid growth and migration A. WB detection of total HER3, pHER3, AKT, pAKT, ERK1/2, and pERK1/2 in DJ-1 knockdown (shDJ-1) T47-D and MCF-7 cells. B. Decreased cell proliferation and stimulation by NRG-1 in shDJ-1 knockdown T47-D or MCF-7 cells. The number on the top of the bars indicates percentage of cell proliferation with NRG-1 by normalizing with the no NRG-1 control as 100%. C. Decreased tumor growth in 3D culture in shDJ-1 MCF-7 and shDJ-1 T47-D cells. Scale bars, 100 μm. The sizes of MCF-7 and T47-D 3D spheres were quantified by measuring the diameter of 100 spheres from 10 random fields, n=100. D. Reduced cell migration in shDJ-1 T47-D and sh DJ-1 MCF-7 cells. Migrated cells from five random fields were counted. Experiments were repeated at least three times (n=3), ** indicates P
    Figure Legend Snippet: DJ-1 knockdown decreases HER3-mediated signaling, cell proliferation, 3D spheroid growth and migration A. WB detection of total HER3, pHER3, AKT, pAKT, ERK1/2, and pERK1/2 in DJ-1 knockdown (shDJ-1) T47-D and MCF-7 cells. B. Decreased cell proliferation and stimulation by NRG-1 in shDJ-1 knockdown T47-D or MCF-7 cells. The number on the top of the bars indicates percentage of cell proliferation with NRG-1 by normalizing with the no NRG-1 control as 100%. C. Decreased tumor growth in 3D culture in shDJ-1 MCF-7 and shDJ-1 T47-D cells. Scale bars, 100 μm. The sizes of MCF-7 and T47-D 3D spheres were quantified by measuring the diameter of 100 spheres from 10 random fields, n=100. D. Reduced cell migration in shDJ-1 T47-D and sh DJ-1 MCF-7 cells. Migrated cells from five random fields were counted. Experiments were repeated at least three times (n=3), ** indicates P

    Techniques Used: Migration, Western Blot

    DJ-1 knockdown decreased tumor growth and DJ-1 overexpression increased sensitivity of tumors to anti-HER3 antibody treatment in vivo A-B. DJ-1 KD MCF-7 cells showed significantly reduced tumor growth, p
    Figure Legend Snippet: DJ-1 knockdown decreased tumor growth and DJ-1 overexpression increased sensitivity of tumors to anti-HER3 antibody treatment in vivo A-B. DJ-1 KD MCF-7 cells showed significantly reduced tumor growth, p

    Techniques Used: Over Expression, In Vivo

    DJ-1 interacts with HER3 A. The interaction between HER3 and DJ-1 was examined by co-IP and followed by WB detection. B. T47-D and MCF-7 cells were subjected to immunostaining using anti-HER3 (red) and anti-DJ-1 (green) antibodies and fluorescence images were overlapped. Blue indicates the nuclei staining by DAPI and the yellowish color indicates co-localization of HER3 and DJ-1. C. The interaction between DJ-1 and HER3 was probed by proximity ligation assay (PLA) in T47-D and MCF-7 cells using anti-DJ-1 and anti-HER3 antibodies. Red fluorescence dots indicate that DJ-1 and HER3 are located in proximity. D. CHO cells overexpressing full length human HER3 and two engineered HER2/HER3 chimeras were used for co-IP and WB detection. Antibody against extracellular domains of HER3 is named anti-N-HER3. All experiments were repeated at least three time and representatives are shown.
    Figure Legend Snippet: DJ-1 interacts with HER3 A. The interaction between HER3 and DJ-1 was examined by co-IP and followed by WB detection. B. T47-D and MCF-7 cells were subjected to immunostaining using anti-HER3 (red) and anti-DJ-1 (green) antibodies and fluorescence images were overlapped. Blue indicates the nuclei staining by DAPI and the yellowish color indicates co-localization of HER3 and DJ-1. C. The interaction between DJ-1 and HER3 was probed by proximity ligation assay (PLA) in T47-D and MCF-7 cells using anti-DJ-1 and anti-HER3 antibodies. Red fluorescence dots indicate that DJ-1 and HER3 are located in proximity. D. CHO cells overexpressing full length human HER3 and two engineered HER2/HER3 chimeras were used for co-IP and WB detection. Antibody against extracellular domains of HER3 is named anti-N-HER3. All experiments were repeated at least three time and representatives are shown.

    Techniques Used: Co-Immunoprecipitation Assay, Western Blot, Immunostaining, Fluorescence, Staining, Proximity Ligation Assay

    20) Product Images from "A highly effective and versatile technology for the isolation of RNAs from grapevines and other woody perennials for use in virus diagnostics"

    Article Title: A highly effective and versatile technology for the isolation of RNAs from grapevines and other woody perennials for use in virus diagnostics

    Journal: Virology Journal

    doi: 10.1186/s12985-015-0376-3

    RT-qPCR detection of GRSPaV from total RNA isolated from grapevine leaves. Total RNA was isolated from V. vinifera var. Chardonnay using Spectrum™ Plant Total RNA kit (Sigma), Plant/fungi total RNA kit (Norgen) and AccuPrep viral RNA extraction kit (Bioneer). cDNA prepared with oligo d(T) on 2 μg of total RNA were subjected to SYBR Green quantitative real-time PCR with primers targeting GRSPaV capsid protein gene, grape actin1 and the gene encoding ubiquitin-60S ribosomal protein L40-2 (Additional file 1 : Table S1). Shown is the amplification plot ( a ) and melt curve ( b ) from cDNAs prepared from RNAs isolated with Sigma (blue), Norgen (purple) and Bioneer (green). The C q and melting temperature (T m ) of two technical replicates for all the samples and genes are given in the table below
    Figure Legend Snippet: RT-qPCR detection of GRSPaV from total RNA isolated from grapevine leaves. Total RNA was isolated from V. vinifera var. Chardonnay using Spectrum™ Plant Total RNA kit (Sigma), Plant/fungi total RNA kit (Norgen) and AccuPrep viral RNA extraction kit (Bioneer). cDNA prepared with oligo d(T) on 2 μg of total RNA were subjected to SYBR Green quantitative real-time PCR with primers targeting GRSPaV capsid protein gene, grape actin1 and the gene encoding ubiquitin-60S ribosomal protein L40-2 (Additional file 1 : Table S1). Shown is the amplification plot ( a ) and melt curve ( b ) from cDNAs prepared from RNAs isolated with Sigma (blue), Norgen (purple) and Bioneer (green). The C q and melting temperature (T m ) of two technical replicates for all the samples and genes are given in the table below

    Techniques Used: Quantitative RT-PCR, Isolation, RNA Extraction, SYBR Green Assay, Real-time Polymerase Chain Reaction, Amplification

    RT-qPCR detection of GRSPaV from total RNA isolated from grapevine leaves. Total RNA was isolated from V. vinifera var. Chardonnay using Spectrum™ Plant Total RNA kit (Sigma), Plant/fungi total RNA kit (Norgen) and AccuPrep viral RNA extraction kit (Bioneer). cDNA prepared with oligo d(T) on 2 μg of total RNA were subjected to SYBR Green quantitative real-time PCR with primers targeting GRSPaV capsid protein gene, grape actin1 and the gene encoding ubiquitin-60S ribosomal protein L40-2 (Additional file 1 : Table S1). Shown is the amplification plot ( a ) and melt curve ( b ) from cDNAs prepared from RNAs isolated with Sigma (blue), Norgen (purple) and Bioneer (green). The C q and melting temperature (T m ) of two technical replicates for all the samples and genes are given in the table below
    Figure Legend Snippet: RT-qPCR detection of GRSPaV from total RNA isolated from grapevine leaves. Total RNA was isolated from V. vinifera var. Chardonnay using Spectrum™ Plant Total RNA kit (Sigma), Plant/fungi total RNA kit (Norgen) and AccuPrep viral RNA extraction kit (Bioneer). cDNA prepared with oligo d(T) on 2 μg of total RNA were subjected to SYBR Green quantitative real-time PCR with primers targeting GRSPaV capsid protein gene, grape actin1 and the gene encoding ubiquitin-60S ribosomal protein L40-2 (Additional file 1 : Table S1). Shown is the amplification plot ( a ) and melt curve ( b ) from cDNAs prepared from RNAs isolated with Sigma (blue), Norgen (purple) and Bioneer (green). The C q and melting temperature (T m ) of two technical replicates for all the samples and genes are given in the table below

    Techniques Used: Quantitative RT-PCR, Isolation, RNA Extraction, SYBR Green Assay, Real-time Polymerase Chain Reaction, Amplification

    21) Product Images from "Comparison of vaginal microbiota sampling techniques: cytobrush versus swab"

    Article Title: Comparison of vaginal microbiota sampling techniques: cytobrush versus swab

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-09844-4

    qPCR results. ( A ) Cytobrushes collected a greater total bacterial load compared to swabs (swabs: mean 4.75 log 10 16S rRNA gene copies, range 2.56–6.35 log 10 ; cytobrushes: mean 6.41 log 10 , range 3.72–8.75 log 10 ; p
    Figure Legend Snippet: qPCR results. ( A ) Cytobrushes collected a greater total bacterial load compared to swabs (swabs: mean 4.75 log 10 16S rRNA gene copies, range 2.56–6.35 log 10 ; cytobrushes: mean 6.41 log 10 , range 3.72–8.75 log 10 ; p

    Techniques Used: Real-time Polymerase Chain Reaction

    22) Product Images from "Oleanolic Acid Suppresses Migration and Invasion of Malignant Glioma Cells by Inactivating MAPK/ERK Signaling Pathway"

    Article Title: Oleanolic Acid Suppresses Migration and Invasion of Malignant Glioma Cells by Inactivating MAPK/ERK Signaling Pathway

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0072079

    Lentivirus-based MAPK/ERK pathway activation abolished the effect of OA on EMT of glioma cells. ( A ) 10 MOI of Lv-MEK or Lv-GFP was added to the cultures of U-87 MG and GT-1 # as well as 25 µg/mL (50 µM) of OA. 48 h later, total RNA was extracted from the cells and expression level of MEK mRNA was determined by qPCR. The experiments were performed for three times. GAPDH was selected as endogenous control. Their relative expression levels in OA-treated cells to untreated ones were shown as mean ± SD. ( B ) Under the same conditions, MAPK/ERK-responsive luciferase plasmids were transfected into U-87 MG and GT-1 # cells and Firefly luciferase activity was normalized by that of Renilla luciferase. The luciferase activity in untreated cells was selected as standards. These experiments were repeated for three times and the values were shown as mean ± SD. ( C ) Immunoblotting assay was perfermed to detect MEK and ERK proteins as well as their phosphorylated forms were also determined in 10 MOI of Lv-MEK or Lv-GFP-infected U-87 MG and GT-1 # cells under 25 µg/mL (50 µM) of OA treatment and GAPDH was selected as endogenous control. ( D ) 10 MOI of Lv-MEK or Lv-GFP was used to infect U-87 MG cells with or without 25 µg/mL (50 µM) of OA. 48 h later, transcripts of E-cadherin, N-cadherin, Vimentin and Twist1 were quantified. The experiments were performed for three times. GAPDH was selected as endogenous control. Their relative expression levels in the tested cells to ones treated by 25 µg/mL (50 µM) of OA and 10 MOI of Lv-GFP were shown as log 2 (mean ± SD). ( E ) E-cadherin, N-cadherin, Vimentin and Twist1 proteins were also determined in the cells treated simultaneously by lentivirus and 25 µg/mL (50 µM) of OA and GAPDH was selected as endogenous control.
    Figure Legend Snippet: Lentivirus-based MAPK/ERK pathway activation abolished the effect of OA on EMT of glioma cells. ( A ) 10 MOI of Lv-MEK or Lv-GFP was added to the cultures of U-87 MG and GT-1 # as well as 25 µg/mL (50 µM) of OA. 48 h later, total RNA was extracted from the cells and expression level of MEK mRNA was determined by qPCR. The experiments were performed for three times. GAPDH was selected as endogenous control. Their relative expression levels in OA-treated cells to untreated ones were shown as mean ± SD. ( B ) Under the same conditions, MAPK/ERK-responsive luciferase plasmids were transfected into U-87 MG and GT-1 # cells and Firefly luciferase activity was normalized by that of Renilla luciferase. The luciferase activity in untreated cells was selected as standards. These experiments were repeated for three times and the values were shown as mean ± SD. ( C ) Immunoblotting assay was perfermed to detect MEK and ERK proteins as well as their phosphorylated forms were also determined in 10 MOI of Lv-MEK or Lv-GFP-infected U-87 MG and GT-1 # cells under 25 µg/mL (50 µM) of OA treatment and GAPDH was selected as endogenous control. ( D ) 10 MOI of Lv-MEK or Lv-GFP was used to infect U-87 MG cells with or without 25 µg/mL (50 µM) of OA. 48 h later, transcripts of E-cadherin, N-cadherin, Vimentin and Twist1 were quantified. The experiments were performed for three times. GAPDH was selected as endogenous control. Their relative expression levels in the tested cells to ones treated by 25 µg/mL (50 µM) of OA and 10 MOI of Lv-GFP were shown as log 2 (mean ± SD). ( E ) E-cadherin, N-cadherin, Vimentin and Twist1 proteins were also determined in the cells treated simultaneously by lentivirus and 25 µg/mL (50 µM) of OA and GAPDH was selected as endogenous control.

    Techniques Used: Activation Assay, Expressing, Real-time Polymerase Chain Reaction, Luciferase, Transfection, Activity Assay, Infection

    23) Product Images from "Gene silencing by RNA interference in the ectoparasitic mite, Psoroptes ovis"

    Article Title: Gene silencing by RNA interference in the ectoparasitic mite, Psoroptes ovis

    Journal: Veterinary Research

    doi: 10.1186/s13567-018-0608-9

    Gene silencing in Psoroptes ovis by RNAi. Mean expression levels of transcripts encoding Pso o 2, Po GST-mu1 and Po βtub normalised to Po βactin (copies/µL) determined by qPCR compared to control mites immersed in dsRNA encoding lacZ are shown for adult male mites immersed overnight at 4 °C in dsRNA representing Pso o 2 ( A ), Po GST-mu1 ( C ) and Po βtub ( E ), or immersed in dsRNA representing Pso o 2 ( B ), Po GST-mu1 ( D ) and Po βtub ( F ) overnight at 4 °C followed by 48 h in a humidity incubator (25 °C, 75% RH). n = 5 for each treatment group with the exception of the lacZ control group in the Po βtub overnight incubation only experiment where n = 4, error bars indicate mean ± SEM.
    Figure Legend Snippet: Gene silencing in Psoroptes ovis by RNAi. Mean expression levels of transcripts encoding Pso o 2, Po GST-mu1 and Po βtub normalised to Po βactin (copies/µL) determined by qPCR compared to control mites immersed in dsRNA encoding lacZ are shown for adult male mites immersed overnight at 4 °C in dsRNA representing Pso o 2 ( A ), Po GST-mu1 ( C ) and Po βtub ( E ), or immersed in dsRNA representing Pso o 2 ( B ), Po GST-mu1 ( D ) and Po βtub ( F ) overnight at 4 °C followed by 48 h in a humidity incubator (25 °C, 75% RH). n = 5 for each treatment group with the exception of the lacZ control group in the Po βtub overnight incubation only experiment where n = 4, error bars indicate mean ± SEM.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Incubation

    24) Product Images from "Characterizing ZC3H18, a Multi-domain Protein at the Interface of RNA Production and Destruction Decisions"

    Article Title: Characterizing ZC3H18, a Multi-domain Protein at the Interface of RNA Production and Destruction Decisions

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2017.12.037

    ZC3H18 Depletion Affects Transcription of a Subset of Protein-Coding Genes (A) RNA-seq-derived differential expression changes of exonic reads between ZC3H18 depletion and control (EGFP) libraries. The y axis displays the log 2 fold change of read counts, and the x axis displays the log 10 ). All individual genes are shown in gray and significantly called transcripts (p adj = FDR
    Figure Legend Snippet: ZC3H18 Depletion Affects Transcription of a Subset of Protein-Coding Genes (A) RNA-seq-derived differential expression changes of exonic reads between ZC3H18 depletion and control (EGFP) libraries. The y axis displays the log 2 fold change of read counts, and the x axis displays the log 10 ). All individual genes are shown in gray and significantly called transcripts (p adj = FDR

    Techniques Used: RNA Sequencing Assay, Derivative Assay, Expressing

    Functional Impact of ZC3H18 Protein Interaction Domains (A) Schematic representation of rescue experiments performed in HEK293 cell lines containing stably integrated and inducible ZC3H18-3xF FL and mutant variants. Endogenous ZC3H18 depletion was subjected to possible suppression by exogenous expression of ZC3H18-3xF variants. (B) qRT-PCR analysis of indicated mRNA levels in total RNA samples from HEK293 cells depleted for endogenous ZC3H18 and expressing the indicated exogenous and ZC3H18-3′ UTR siRNA-resistant variants. Data are displayed as mean ± SD of at least three biological replicates normalized to the control (EGFP) sample and GAPDH mRNA. Significance levels between the mean values of mRNA levels in ZC3H18 depletion versus rescued samples were calculated using a two-way ANOVA test and are denoted with asterisks corresponding to the following p value ranges: ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001, and ∗∗∗∗ p ≤ 0.0001. (C) qRT-PCR analysis as in (B) but using primers detecting U11 and U12 snRNA 3′ extended regions.
    Figure Legend Snippet: Functional Impact of ZC3H18 Protein Interaction Domains (A) Schematic representation of rescue experiments performed in HEK293 cell lines containing stably integrated and inducible ZC3H18-3xF FL and mutant variants. Endogenous ZC3H18 depletion was subjected to possible suppression by exogenous expression of ZC3H18-3xF variants. (B) qRT-PCR analysis of indicated mRNA levels in total RNA samples from HEK293 cells depleted for endogenous ZC3H18 and expressing the indicated exogenous and ZC3H18-3′ UTR siRNA-resistant variants. Data are displayed as mean ± SD of at least three biological replicates normalized to the control (EGFP) sample and GAPDH mRNA. Significance levels between the mean values of mRNA levels in ZC3H18 depletion versus rescued samples were calculated using a two-way ANOVA test and are denoted with asterisks corresponding to the following p value ranges: ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001, and ∗∗∗∗ p ≤ 0.0001. (C) qRT-PCR analysis as in (B) but using primers detecting U11 and U12 snRNA 3′ extended regions.

    Techniques Used: Functional Assay, Stable Transfection, Mutagenesis, Expressing, Quantitative RT-PCR

    ZC3H18 Binding to Histones Is Specific and Phosphorylation Dependent (A) SDS-PAGE gel of proteins co-precipitating with color-coded ZC3H18, PABPN1, NUP88, and NUP98 proteins expressed with a 3xF tag from HEK293 Flip-In T-Rex cell lines. As a control the HEK293 parental cell line was also used. AC was carried out in three different NaCl buffers (20 mM HEPES [pH 7.4], 0.5% Triton X-100 and 100, 300, or 500 mM NaCl, respectively) as indicated. 3xF-tagged proteins are indicated, based on their expected molecular weights, with color-coded dots and corresponding arrows. Only the ZC3H18-3xF construct co-purified histones in the 500 mM NaCl buffer (indicated by black vertical line in lane 3). (B) SDS-PAGE gel showing the ZC3H18 isoforms and co-precipitating proteins after a two-step ZC3H18-3xF AC in 100 and 600 mM-NaCl conditions (see main text for details). Migration of ZC3H18-3xF fast- and slow-migrating forms as well as CBCN complex components are indicated as in (A). Note that histones are bound only by the slow-migrating form of ZC3H18-3xF. (C) SDS-PAGE gel of proteins co-precipitating with ZC3H18-3xF in 100, 300, and 600 mM-NaCl containing buffers supplemented (+) or not (−) with PPI. ZC3H18-3xF isoforms denoted as in (A). (D) ChIP-PCR analysis of ZC3H18 occupancy along the MYC gene and MYC PROMPT using amplicons from top schematics. IgG ChIP was used to assess background binding. Data are displayed as mean ± SD of two biological replicates. Significance levels between the ZC3H18 and IgG samples were assessed by a two-way ANOVA test with obtained p values presented above the bars. (E) ChIP-PCR analysis of ZC3H18 occupancy at promoters of transcriptionally active ( GAPDH , U12 , BRCA1 , PSMD3 , MRPS15 , PALB2 , ZNHIT3 , KRAS , and SNRPB2 ) and repressed ( IFRG28 , MYT1 , and KCNA1 ) genes. IgG ChIP was used to assess background binding. Data are displayed as mean ± SD of two technical replicates of the representative experiment. Significance levels between the ZC3H18 and IgG samples were calculated using a two-way ANOVA test and are denoted with asterisks corresponding to the following p value ranges: ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001, and ∗∗∗∗ p ≤ 0.0001.
    Figure Legend Snippet: ZC3H18 Binding to Histones Is Specific and Phosphorylation Dependent (A) SDS-PAGE gel of proteins co-precipitating with color-coded ZC3H18, PABPN1, NUP88, and NUP98 proteins expressed with a 3xF tag from HEK293 Flip-In T-Rex cell lines. As a control the HEK293 parental cell line was also used. AC was carried out in three different NaCl buffers (20 mM HEPES [pH 7.4], 0.5% Triton X-100 and 100, 300, or 500 mM NaCl, respectively) as indicated. 3xF-tagged proteins are indicated, based on their expected molecular weights, with color-coded dots and corresponding arrows. Only the ZC3H18-3xF construct co-purified histones in the 500 mM NaCl buffer (indicated by black vertical line in lane 3). (B) SDS-PAGE gel showing the ZC3H18 isoforms and co-precipitating proteins after a two-step ZC3H18-3xF AC in 100 and 600 mM-NaCl conditions (see main text for details). Migration of ZC3H18-3xF fast- and slow-migrating forms as well as CBCN complex components are indicated as in (A). Note that histones are bound only by the slow-migrating form of ZC3H18-3xF. (C) SDS-PAGE gel of proteins co-precipitating with ZC3H18-3xF in 100, 300, and 600 mM-NaCl containing buffers supplemented (+) or not (−) with PPI. ZC3H18-3xF isoforms denoted as in (A). (D) ChIP-PCR analysis of ZC3H18 occupancy along the MYC gene and MYC PROMPT using amplicons from top schematics. IgG ChIP was used to assess background binding. Data are displayed as mean ± SD of two biological replicates. Significance levels between the ZC3H18 and IgG samples were assessed by a two-way ANOVA test with obtained p values presented above the bars. (E) ChIP-PCR analysis of ZC3H18 occupancy at promoters of transcriptionally active ( GAPDH , U12 , BRCA1 , PSMD3 , MRPS15 , PALB2 , ZNHIT3 , KRAS , and SNRPB2 ) and repressed ( IFRG28 , MYT1 , and KCNA1 ) genes. IgG ChIP was used to assess background binding. Data are displayed as mean ± SD of two technical replicates of the representative experiment. Significance levels between the ZC3H18 and IgG samples were calculated using a two-way ANOVA test and are denoted with asterisks corresponding to the following p value ranges: ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001, and ∗∗∗∗ p ≤ 0.0001.

    Techniques Used: Binding Assay, SDS Page, Construct, Purification, Migration, Chromatin Immunoprecipitation, Polymerase Chain Reaction

    Interaction Profiling of ZC3H18 Identifies Histones (A) SDS-PAGE gel of proteins co-precipitating with ZC3H18-3xF at the indicated buffer compositions. Two major isoforms of the ZC3H18-3xF bait protein are indicated with red and green dots for the fast- and slow-migrating forms, respectively. Denoted with color code are also CBCN complex components MTR4, ARS2, ZCCHC8, and CBP80 as well as histones. The identity of the indicated bands was established by MS analysis. (B and C) Scatterplots presenting MS analysis of co-purified CBCN components (B) and core histones (C) in the ZC3H18-3xF AC experiments performed in 100, 300, and 500 mM NaCl-containing buffers (indicated by red, blue, and green dots, respectively). Exact buffer compositions are shown below the plots. The y axes display protein abundances estimated as the ratio between a protein’s mean peptide intensity from two biological experiments and its molecular weight and normalized to the abundance of ZC3H18-3xF bait protein. The x axes display RNase A/T1 resistance calculated as the ratio between protein abundances in RNase A/T1-treated versus untreated samples.
    Figure Legend Snippet: Interaction Profiling of ZC3H18 Identifies Histones (A) SDS-PAGE gel of proteins co-precipitating with ZC3H18-3xF at the indicated buffer compositions. Two major isoforms of the ZC3H18-3xF bait protein are indicated with red and green dots for the fast- and slow-migrating forms, respectively. Denoted with color code are also CBCN complex components MTR4, ARS2, ZCCHC8, and CBP80 as well as histones. The identity of the indicated bands was established by MS analysis. (B and C) Scatterplots presenting MS analysis of co-purified CBCN components (B) and core histones (C) in the ZC3H18-3xF AC experiments performed in 100, 300, and 500 mM NaCl-containing buffers (indicated by red, blue, and green dots, respectively). Exact buffer compositions are shown below the plots. The y axes display protein abundances estimated as the ratio between a protein’s mean peptide intensity from two biological experiments and its molecular weight and normalized to the abundance of ZC3H18-3xF bait protein. The x axes display RNase A/T1 resistance calculated as the ratio between protein abundances in RNase A/T1-treated versus untreated samples.

    Techniques Used: SDS Page, Mass Spectrometry, Purification, Molecular Weight

    Dual Roles of ZC3H18 in Nuclear RNA Metabolism Schematic representation of the dual engagement of ZC3H18 in RNA transcription and decay processes. Left: the C terminus of ZC3H18 interacts with the CBCA complex to regulate protein-coding gene transcription directly or indirectly. Right: short non-coding RNAs, such as 3′ extended snRNAs, are targeted ZC3H18 dependently in a process requiring both CBCA and NEXT interaction of ZC3H18. Such RNA decay can also occur ZC3H18 independently via direct NEXT exosome targeting. See the main text for details. C, CBCA-interacting domain; H, histone-interacting domain; N, NEXT-interacting domain. Question mark indicates the elusive role of the histone-interacting domain and its modification in modifying the functionality of ZC3H18.
    Figure Legend Snippet: Dual Roles of ZC3H18 in Nuclear RNA Metabolism Schematic representation of the dual engagement of ZC3H18 in RNA transcription and decay processes. Left: the C terminus of ZC3H18 interacts with the CBCA complex to regulate protein-coding gene transcription directly or indirectly. Right: short non-coding RNAs, such as 3′ extended snRNAs, are targeted ZC3H18 dependently in a process requiring both CBCA and NEXT interaction of ZC3H18. Such RNA decay can also occur ZC3H18 independently via direct NEXT exosome targeting. See the main text for details. C, CBCA-interacting domain; H, histone-interacting domain; N, NEXT-interacting domain. Question mark indicates the elusive role of the histone-interacting domain and its modification in modifying the functionality of ZC3H18.

    Techniques Used: Modification

    25) Product Images from "Regulatory dynamics of 11p13 suggest a role for EHF in modifying CF lung disease severity"

    Article Title: Regulatory dynamics of 11p13 suggest a role for EHF in modifying CF lung disease severity

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx482

    The topologically associating domain encompassing the 11p13 CF modifier region. ( A ) 4C-seq data are presented as described in Figure 3 . Viewpoints are from the HB11.1485 (I) and APIP intron 3 (II) elements. ( B ) ChIP-qPCR for CTCF enrichment across the 11p13 locus in Calu3 cells. Amplicons are at 11.2512 ( EHF -55kb), HB11.1485 (I), DHS 11.2516, EHF intron 6, 11.2521, APIP +84kb, APIP intron 2 (II), and APIP intron 1. Data are shown as percent recovery over input for CTCF (black bars) and IgG control (gray bars). Arrows denote CTCF motif orientation. n = 3. **** P
    Figure Legend Snippet: The topologically associating domain encompassing the 11p13 CF modifier region. ( A ) 4C-seq data are presented as described in Figure 3 . Viewpoints are from the HB11.1485 (I) and APIP intron 3 (II) elements. ( B ) ChIP-qPCR for CTCF enrichment across the 11p13 locus in Calu3 cells. Amplicons are at 11.2512 ( EHF -55kb), HB11.1485 (I), DHS 11.2516, EHF intron 6, 11.2521, APIP +84kb, APIP intron 2 (II), and APIP intron 1. Data are shown as percent recovery over input for CTCF (black bars) and IgG control (gray bars). Arrows denote CTCF motif orientation. n = 3. **** P

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    26) Product Images from "P-TEFb Activation by RBM7 Shapes a Pro-survival Transcriptional Response to Genotoxic Stress"

    Article Title: P-TEFb Activation by RBM7 Shapes a Pro-survival Transcriptional Response to Genotoxic Stress

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2019.01.033

    Active P-TEFb Is Vital for the Pol II Transcriptional Response to Genotoxic Stress (A) (Top) Schematic depicting major steps in the generation of 4sU-labeled transcripts (4sU RNA) for 4sU-seq. (Bottom) Pie charts showing the fractions of DE protein-coding genes (mRNA) in 4-NQO-treated HeLa cells as assessed by 4sU-seq (n = 2). (B) Bar charts showing the number of DE classes of transcripts in HeLa cells as assessed by 4sU-seq (n = 2). The degrees of differential expression are presented according to the legend. Conditions with (in hours) and without (−) 4-NQO or FP are shown. (C) Boxplots indicating the distribution of gene lengths for upregulated and downregulated protein-coding genes. Median gene length for each group is shown. (D) Top Molecular and Cellular Functions categories of the 4FP gene set as identified by IPA. The number of affected genes per category is shown on the right. (E) RT-qPCR of the indicated DNA damage-induced unspliced (pre-mRNA), uaRNA, and eRNA transcripts. HeLa cells were treated as indicated by the legend. Results were normalized to the DMSO control and are presented as the mean ± SEM (n = 3). ∗ p
    Figure Legend Snippet: Active P-TEFb Is Vital for the Pol II Transcriptional Response to Genotoxic Stress (A) (Top) Schematic depicting major steps in the generation of 4sU-labeled transcripts (4sU RNA) for 4sU-seq. (Bottom) Pie charts showing the fractions of DE protein-coding genes (mRNA) in 4-NQO-treated HeLa cells as assessed by 4sU-seq (n = 2). (B) Bar charts showing the number of DE classes of transcripts in HeLa cells as assessed by 4sU-seq (n = 2). The degrees of differential expression are presented according to the legend. Conditions with (in hours) and without (−) 4-NQO or FP are shown. (C) Boxplots indicating the distribution of gene lengths for upregulated and downregulated protein-coding genes. Median gene length for each group is shown. (D) Top Molecular and Cellular Functions categories of the 4FP gene set as identified by IPA. The number of affected genes per category is shown on the right. (E) RT-qPCR of the indicated DNA damage-induced unspliced (pre-mRNA), uaRNA, and eRNA transcripts. HeLa cells were treated as indicated by the legend. Results were normalized to the DMSO control and are presented as the mean ± SEM (n = 3). ∗ p

    Techniques Used: Labeling, Expressing, Indirect Immunoperoxidase Assay, Quantitative RT-PCR

    Genotoxic Stress Induces the Interaction of RBM7 with 7SK (A) Distribution charts of unique tags derived from the F-RBM7 libraries based on percentages of the total iCLIP reads and mapped to the indicated RNA classes. Charts on the right show distribution of the indicated types of ncRNA. (B) F-RBM7 iCLIP reads mapped to 7SK. Positions of the four stem-loops (SL1–4) are shown below the iCLIP reads and on a 7SK secondary structure model. (C) RIP-qPCR of 7SK in wild-type and mRNP1 F-RBM7 IP from whole-cell extracts (WCEs) of HEK293 cells. RBM7 with RRM (in pink) and the position of RNP1 (white stripe) is shown on top. (D) RIP-qPCR of 7SK in F-RBM7 IP from WCE of HEK293 cells. Conditions with (red bars; in hours) and without (blue bars) 4-NQO are shown. Results in (C) and (D) are presented as the mean ± SEM (n = 3). ∗∗ A–S1C.
    Figure Legend Snippet: Genotoxic Stress Induces the Interaction of RBM7 with 7SK (A) Distribution charts of unique tags derived from the F-RBM7 libraries based on percentages of the total iCLIP reads and mapped to the indicated RNA classes. Charts on the right show distribution of the indicated types of ncRNA. (B) F-RBM7 iCLIP reads mapped to 7SK. Positions of the four stem-loops (SL1–4) are shown below the iCLIP reads and on a 7SK secondary structure model. (C) RIP-qPCR of 7SK in wild-type and mRNP1 F-RBM7 IP from whole-cell extracts (WCEs) of HEK293 cells. RBM7 with RRM (in pink) and the position of RNP1 (white stripe) is shown on top. (D) RIP-qPCR of 7SK in F-RBM7 IP from WCE of HEK293 cells. Conditions with (red bars; in hours) and without (blue bars) 4-NQO are shown. Results in (C) and (D) are presented as the mean ± SEM (n = 3). ∗∗ A–S1C.

    Techniques Used: Derivative Assay, Real-time Polymerase Chain Reaction

    27) Product Images from "Regulation of Reduced Folate Carrier (RFC) by Vitamin D Receptor at the Blood-Brain Barrier"

    Article Title: Regulation of Reduced Folate Carrier (RFC) by Vitamin D Receptor at the Blood-Brain Barrier

    Journal: Molecular pharmaceutics

    doi: 10.1021/acs.molpharmaceut.7b00572

    Relative expression of major folate transport systems in various in vitro and ex vivo models of the BBB. (A) mRNA expression of human, rat, or mouse SLC19A1 / Slc19a1 (RFC), SLC46A1 / Slc46a1 (PCFT), and FOLR1 / Folr1 (FR α ) genes were determined in immortalized (hCMEC/D3) and primary (hBMEC) cultures of human brain microvessel endothelial cells, immortalized cultures of rat brain microvessel endothelial cells (RBE4), and rodent brain capillaries using TaqMan gene expression assay. Results are presented as mean relative mRNA expression ± SEM normalized to the housekeeping human/rat/mouse cyclophilin B gene from n = 3 independent experiments. (B) Immunoblot analysis of RFC and PCFT protein expression was performed in the same BBB model systems. HEK293 and HeLa cells served as positive controls, while actin was used as a loading control. Multiple protein bands for RFC and PCFT are indicative of differential glycosylation of these transmembrane proteins. A representative blot is shown from n = 3 independent experiments.
    Figure Legend Snippet: Relative expression of major folate transport systems in various in vitro and ex vivo models of the BBB. (A) mRNA expression of human, rat, or mouse SLC19A1 / Slc19a1 (RFC), SLC46A1 / Slc46a1 (PCFT), and FOLR1 / Folr1 (FR α ) genes were determined in immortalized (hCMEC/D3) and primary (hBMEC) cultures of human brain microvessel endothelial cells, immortalized cultures of rat brain microvessel endothelial cells (RBE4), and rodent brain capillaries using TaqMan gene expression assay. Results are presented as mean relative mRNA expression ± SEM normalized to the housekeeping human/rat/mouse cyclophilin B gene from n = 3 independent experiments. (B) Immunoblot analysis of RFC and PCFT protein expression was performed in the same BBB model systems. HEK293 and HeLa cells served as positive controls, while actin was used as a loading control. Multiple protein bands for RFC and PCFT are indicative of differential glycosylation of these transmembrane proteins. A representative blot is shown from n = 3 independent experiments.

    Techniques Used: Expressing, In Vitro, Ex Vivo

    Effect of calcitriol treatment on RFC expression in hCMEC/D3 cells. (A) mRNA expression of human NRI1I /rodent Nri1i gene was determined in immortalized cultures of human brain microvessel endothelial (hCMEC/D3) cells and isolated mouse brain capillaries using TaqMan gene expression assay. Results are presented as mean relative mRNA expression ± SEM normalized to the housekeeping human cyclophilin B gene from n = 3 independent experiments. Significant increases in SLC19A1 mRNA (B) and RFC protein (C) expression were observed in hCMEC/D3 cells treated with calcitriol (50–500 nM) for 6 or 24 h compared to vehicle (ethanol) control. Multiple protein bands for RFC (63–75 kDa) are indicative of differential glycosylation of the transmembrane protein. Rat kidney lysates served as positive control, while actin was used as a loading control. Results are presented as mean ± SEM for n = 3–4 independent experiments. *, p
    Figure Legend Snippet: Effect of calcitriol treatment on RFC expression in hCMEC/D3 cells. (A) mRNA expression of human NRI1I /rodent Nri1i gene was determined in immortalized cultures of human brain microvessel endothelial (hCMEC/D3) cells and isolated mouse brain capillaries using TaqMan gene expression assay. Results are presented as mean relative mRNA expression ± SEM normalized to the housekeeping human cyclophilin B gene from n = 3 independent experiments. Significant increases in SLC19A1 mRNA (B) and RFC protein (C) expression were observed in hCMEC/D3 cells treated with calcitriol (50–500 nM) for 6 or 24 h compared to vehicle (ethanol) control. Multiple protein bands for RFC (63–75 kDa) are indicative of differential glycosylation of the transmembrane protein. Rat kidney lysates served as positive control, while actin was used as a loading control. Results are presented as mean ± SEM for n = 3–4 independent experiments. *, p

    Techniques Used: Expressing, Isolation, Positive Control

    Effect of calcitriol treatment on RFC expression in isolated mouse brain capillaries. Significant increases in SLC19A1 mRNA (A) and RFC protein (B) expression were observed in mouse brain capillaries treated with 100 nM calcitriol for 4 h compared to vehicle (ethanol) control. Results are presented as mean ± SEM for n = 3 independent experiments, where each experiment contained pooled brain tissues from 3 to 4 animals per group. *, p
    Figure Legend Snippet: Effect of calcitriol treatment on RFC expression in isolated mouse brain capillaries. Significant increases in SLC19A1 mRNA (A) and RFC protein (B) expression were observed in mouse brain capillaries treated with 100 nM calcitriol for 4 h compared to vehicle (ethanol) control. Results are presented as mean ± SEM for n = 3 independent experiments, where each experiment contained pooled brain tissues from 3 to 4 animals per group. *, p

    Techniques Used: Expressing, Isolation

    28) Product Images from "Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma"

    Article Title: Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2013.376

    PDCD4 regulated the expression of miR-184 via PI3K/AKT/JNK pathway in NPC. ( a ) siRNAs were used to suppress the C-JUN expression by western blot examination. ( b ) Knocking down C-JUN expression by siRNA stimulated the expression of miR-184 in NPC SUNE1 and 5-8F cells. ( c ) From mock and pcDNA3.1-C-JUN-transfected SUNE1 cells was immunoprecipitated with anti-C-JUN and a normal rabbit IgG. The AP-1 binding sites on the immunoprecipitated DNA was determined by quantitative RT-PCR. Amplification of input chromatin (input) before immunoprecipitation was served as positive controls for chromatin extraction and PCR amplification. Chromatin immunoprecipitation using a non-specific antibody (normal human IgG) served as negative controls. QPCR analysis indicated that C-Jun could bind more miR-184 promoter region than that in control group in NPC SUNE1 cells. (d) Suppressing the expression of PI3K by its specific inhibitor Ly294002 (50 nM) reduced pPI3K, pAKT and C-JUN expression in NPC SUNE1 and 5-8F cells, but did not induce AKT expression change. (e) Knocking down JNK1 suppressed the expression of C-Jun in NPC SUNE1 and 5-8F cells. ( f ) Specific inhibition of JNK1 by siRNA decreased the expression of JNK and C-Jun in NPC cells. Data are presented as mean±S.D. of three independent experiments (* P
    Figure Legend Snippet: PDCD4 regulated the expression of miR-184 via PI3K/AKT/JNK pathway in NPC. ( a ) siRNAs were used to suppress the C-JUN expression by western blot examination. ( b ) Knocking down C-JUN expression by siRNA stimulated the expression of miR-184 in NPC SUNE1 and 5-8F cells. ( c ) From mock and pcDNA3.1-C-JUN-transfected SUNE1 cells was immunoprecipitated with anti-C-JUN and a normal rabbit IgG. The AP-1 binding sites on the immunoprecipitated DNA was determined by quantitative RT-PCR. Amplification of input chromatin (input) before immunoprecipitation was served as positive controls for chromatin extraction and PCR amplification. Chromatin immunoprecipitation using a non-specific antibody (normal human IgG) served as negative controls. QPCR analysis indicated that C-Jun could bind more miR-184 promoter region than that in control group in NPC SUNE1 cells. (d) Suppressing the expression of PI3K by its specific inhibitor Ly294002 (50 nM) reduced pPI3K, pAKT and C-JUN expression in NPC SUNE1 and 5-8F cells, but did not induce AKT expression change. (e) Knocking down JNK1 suppressed the expression of C-Jun in NPC SUNE1 and 5-8F cells. ( f ) Specific inhibition of JNK1 by siRNA decreased the expression of JNK and C-Jun in NPC cells. Data are presented as mean±S.D. of three independent experiments (* P

    Techniques Used: Expressing, Western Blot, Transfection, Immunoprecipitation, Binding Assay, Quantitative RT-PCR, Amplification, Polymerase Chain Reaction, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Inhibition

    29) Product Images from "Poly(ADP-Ribose) Polymerase 1 Promotes the Human Heat Shock Response by Facilitating Heat Shock Transcription Factor 1 Binding to DNA"

    Article Title: Poly(ADP-Ribose) Polymerase 1 Promotes the Human Heat Shock Response by Facilitating Heat Shock Transcription Factor 1 Binding to DNA

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00051-18

    PARylation of chromatin at the pHSE in the HSP70 promoter is robustly induced during heat shock. (A) Schematic view of the human HSP70-1 locus. Shaded boxes indicate DNA regions amplified by ChIP-qPCR. (B) Occupancy of PARP1 and PARP13 on the HSP70 locus in control HeLa cells (Cont.) and in cells treated with a heat shock (HS) at 42°C for 5, 10, 20, or 30 min. ChIP-qPCR was performed on each of the 10 DNA regions ( x axes) indicated in panel A ( n = 3). (C) Occupancy of PAR on the HSP70 locus in control cells and in cells treated with a heat shock for the indicated periods ( n = 3). (D) Cells in which PARP1, PARP13, or both (double-KD) had been knocked down were either left untreated (Cont.) or treated with a heat shock for 30 min. ChIP-qPCR of PARP1 and PARP13 on the pHSE, pausing region, and region 7 was performed ( n = 3). (E) ChIP-qPCR of PAR was performed using control and heat-shocked (10 min) cells in which PARP1, PARP13, or both (double-KD) had been knocked down ( n = 3). (F) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 were either left untreated (Cont.) or treated with a heat shock for 30 min. ChIP-qPCR of PARP1 on the pHSE and region 7 was performed ( n = 3). (G) ChIP-qPCR of PAR was performed using control and heat-shocked (10 min) cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 ( n = 3). Analysis for statistically significant differences was performed using Student's t test.
    Figure Legend Snippet: PARylation of chromatin at the pHSE in the HSP70 promoter is robustly induced during heat shock. (A) Schematic view of the human HSP70-1 locus. Shaded boxes indicate DNA regions amplified by ChIP-qPCR. (B) Occupancy of PARP1 and PARP13 on the HSP70 locus in control HeLa cells (Cont.) and in cells treated with a heat shock (HS) at 42°C for 5, 10, 20, or 30 min. ChIP-qPCR was performed on each of the 10 DNA regions ( x axes) indicated in panel A ( n = 3). (C) Occupancy of PAR on the HSP70 locus in control cells and in cells treated with a heat shock for the indicated periods ( n = 3). (D) Cells in which PARP1, PARP13, or both (double-KD) had been knocked down were either left untreated (Cont.) or treated with a heat shock for 30 min. ChIP-qPCR of PARP1 and PARP13 on the pHSE, pausing region, and region 7 was performed ( n = 3). (E) ChIP-qPCR of PAR was performed using control and heat-shocked (10 min) cells in which PARP1, PARP13, or both (double-KD) had been knocked down ( n = 3). (F) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 were either left untreated (Cont.) or treated with a heat shock for 30 min. ChIP-qPCR of PARP1 on the pHSE and region 7 was performed ( n = 3). (G) ChIP-qPCR of PAR was performed using control and heat-shocked (10 min) cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 ( n = 3). Analysis for statistically significant differences was performed using Student's t test.

    Techniques Used: Amplification, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    PARP1 and PARP13 facilitate the binding of HSF1 to the HSEs during heat shock. (A) HeLa cells in which PARP1 or PARP13 had been knocked down were treated with a heat shock for the indicated periods. (Top) Whole-cell extracts were prepared and were subjected to an electrophoretic mobility shift assay using a 32 P-labeled ideal HSE oligonucleotide. HSF, bands of HSE–HSF1 complex; ns, nonspecific bands; free probe, unbound HSE oligonucleotides. (Bottom) Western blotting (IB) was performed. (B) Cells were treated as described for panel A, and ChIP-qPCR of HSF1 on the pHSE, the dHSE, and an intergenic region (Inter.) was performed ( n = 3). (C) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 were heat shocked (42°C for 30 min). ChIP-qPCR of HSF1 was performed ( n = 3). (D) Cells were treated, and ChIP-qPCR of BRG1 was performed, as described for panel C ( n = 3). Analysis for statistically significant differences was performed using Student's t test.
    Figure Legend Snippet: PARP1 and PARP13 facilitate the binding of HSF1 to the HSEs during heat shock. (A) HeLa cells in which PARP1 or PARP13 had been knocked down were treated with a heat shock for the indicated periods. (Top) Whole-cell extracts were prepared and were subjected to an electrophoretic mobility shift assay using a 32 P-labeled ideal HSE oligonucleotide. HSF, bands of HSE–HSF1 complex; ns, nonspecific bands; free probe, unbound HSE oligonucleotides. (Bottom) Western blotting (IB) was performed. (B) Cells were treated as described for panel A, and ChIP-qPCR of HSF1 on the pHSE, the dHSE, and an intergenic region (Inter.) was performed ( n = 3). (C) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, or mutated hHSF1 were heat shocked (42°C for 30 min). ChIP-qPCR of HSF1 was performed ( n = 3). (D) Cells were treated, and ChIP-qPCR of BRG1 was performed, as described for panel C ( n = 3). Analysis for statistically significant differences was performed using Student's t test.

    Techniques Used: Binding Assay, Electrophoretic Mobility Shift Assay, Labeling, Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    Regulatory mechanisms of the HSR in mammalian cells. Prior to heat shock, a small amount of HSF1 binds to the pHSE in the HSP70 promoter and allows for the establishment of paused Pol II and an open chromatin environment (unstressed condition). HSF1 also recruits PARP1 through a scaffold protein, PARP13. In response to a heat shock, activated and auto-PARylated PARP1 dissociates from HSF1-PARP13 and is redistributed throughout the HSP70 locus. It PARylates chromatin around the pHSE initially (heat shock, early time point) and around the gene body afterward (heat shock, 30 min). Heat shock-activated HSF1 binds efficiently to the pHSE and dHSE, whose chromatin is decondensed by PARylation, and robustly induces HSP70 transcription. PARP13 also dissociates from HSF1 in a manner dependent on the phosphorylation of HSF1-Ser121.
    Figure Legend Snippet: Regulatory mechanisms of the HSR in mammalian cells. Prior to heat shock, a small amount of HSF1 binds to the pHSE in the HSP70 promoter and allows for the establishment of paused Pol II and an open chromatin environment (unstressed condition). HSF1 also recruits PARP1 through a scaffold protein, PARP13. In response to a heat shock, activated and auto-PARylated PARP1 dissociates from HSF1-PARP13 and is redistributed throughout the HSP70 locus. It PARylates chromatin around the pHSE initially (heat shock, early time point) and around the gene body afterward (heat shock, 30 min). Heat shock-activated HSF1 binds efficiently to the pHSE and dHSE, whose chromatin is decondensed by PARylation, and robustly induces HSP70 transcription. PARP13 also dissociates from HSF1 in a manner dependent on the phosphorylation of HSF1-Ser121.

    Techniques Used:

    Heat shock-induced PARP1 activity promotes HSF1 binding to the HSP70 promoter. (A) Denatured extracts of HeLa cells treated with either a heat shock at 42°C for 30 min (HS), 10 μM MG132 for 6 h, or 5 mM AZC for 6 h in the presence or absence of PJ34 or olaparib were subjected first to PARP1 immunoprecipitation (IP) and then to immunoblotting (IB) using a PAR antibody. (B) Extracts of HeLa cells treated as described for panel A were subjected first to PARP1 immunoprecipitation and then to immunoblotting. (C) Cells treated as described for panel A were subjected first to HSF1 immunoprecipitation and then to immunoblotting. (D) Cells in which PARP1 had been knocked down were pretreated with PJ34 (20 μM) for 2 h and were then heat shocked at 42°C for 10 min. ChIP-qPCR of PARP1, PARP13, and PAR on the pHSE and pausing regions was performed ( n = 3). (E) Extracts of cells in which endogenous PARP1 had been replaced with GFP, wild-type hPARP1, or its inactive mutant (HYA or AAA) were subjected to immunoblotting. (F) Cells were treated as described for panel E, and ChIP-qPCR of PARP1, PARP13, and PAR on the pHSE and pausing region was performed ( n = 3). (G) Cells were treated as described for panel D, and ChIP-qPCR of HSF1 on the dHSE and pHSE was performed ( n = 3). (H) Cells were treated as described for panel F, and ChIP-qPCR of HSF1 on the dHSE and pHSE was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test.
    Figure Legend Snippet: Heat shock-induced PARP1 activity promotes HSF1 binding to the HSP70 promoter. (A) Denatured extracts of HeLa cells treated with either a heat shock at 42°C for 30 min (HS), 10 μM MG132 for 6 h, or 5 mM AZC for 6 h in the presence or absence of PJ34 or olaparib were subjected first to PARP1 immunoprecipitation (IP) and then to immunoblotting (IB) using a PAR antibody. (B) Extracts of HeLa cells treated as described for panel A were subjected first to PARP1 immunoprecipitation and then to immunoblotting. (C) Cells treated as described for panel A were subjected first to HSF1 immunoprecipitation and then to immunoblotting. (D) Cells in which PARP1 had been knocked down were pretreated with PJ34 (20 μM) for 2 h and were then heat shocked at 42°C for 10 min. ChIP-qPCR of PARP1, PARP13, and PAR on the pHSE and pausing regions was performed ( n = 3). (E) Extracts of cells in which endogenous PARP1 had been replaced with GFP, wild-type hPARP1, or its inactive mutant (HYA or AAA) were subjected to immunoblotting. (F) Cells were treated as described for panel E, and ChIP-qPCR of PARP1, PARP13, and PAR on the pHSE and pausing region was performed ( n = 3). (G) Cells were treated as described for panel D, and ChIP-qPCR of HSF1 on the dHSE and pHSE was performed ( n = 3). (H) Cells were treated as described for panel F, and ChIP-qPCR of HSF1 on the dHSE and pHSE was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test.

    Techniques Used: Activity Assay, Binding Assay, Immunoprecipitation, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Mutagenesis

    HSF1-PARP13-PARP1 enhances HSP70 expression during heat shock. (A) PARP1, PARP13, or both PARP1 and PARP13 (double-KD) were knocked down by infection of HeLa cells with adenoviruses expressing the corresponding shRNAs. As a control, cells were infected with an adenovirus expressing scrambled RNA (SCR). (Left) The cells were treated with a heat shock at 42°C for the periods indicated, and HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (Right) Extracts from cells before heat shock treatment were subjected to immunoblotting (IB). Full-length and truncated forms of PARP13 were detected. (B) Cells in which PARP1, PARP13, or both had been knocked down were treated with 5 mM AZC (left) or 20 μM sodium arsenite (right) for 6 h. HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Cont., control. (C) RT-PCR analysis of a set of HSP and β-actin genes was performed using control and heat-shocked (HS) (42°C for 40 min) cells in which PARP1, PARP13, or both (double-KD) had been knocked down. (D) Cells in which PARP1, PARP13, or both had been knocked down were heat shocked (42°C for 40 min). HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (E) Cells in which endogenous HSF1 had been replaced with either GFP, wild-type hHSF1, or mutated hHSF1 were heat shocked (42°C for 40 min). (Top) HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (Bottom) Extracts from cells were subjected to immunoblotting. (F) Cells in which endogenous PARP13 had been replaced with either GFP, wild-type hPARP13, or mutated hPARP13 were heat shocked (42°C for 40 min). (Left) HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (Right) Extracts from cells were subjected to immunoblotting. Analysis for statistically significant differences was performed using Student's t test.
    Figure Legend Snippet: HSF1-PARP13-PARP1 enhances HSP70 expression during heat shock. (A) PARP1, PARP13, or both PARP1 and PARP13 (double-KD) were knocked down by infection of HeLa cells with adenoviruses expressing the corresponding shRNAs. As a control, cells were infected with an adenovirus expressing scrambled RNA (SCR). (Left) The cells were treated with a heat shock at 42°C for the periods indicated, and HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (Right) Extracts from cells before heat shock treatment were subjected to immunoblotting (IB). Full-length and truncated forms of PARP13 were detected. (B) Cells in which PARP1, PARP13, or both had been knocked down were treated with 5 mM AZC (left) or 20 μM sodium arsenite (right) for 6 h. HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Cont., control. (C) RT-PCR analysis of a set of HSP and β-actin genes was performed using control and heat-shocked (HS) (42°C for 40 min) cells in which PARP1, PARP13, or both (double-KD) had been knocked down. (D) Cells in which PARP1, PARP13, or both had been knocked down were heat shocked (42°C for 40 min). HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (E) Cells in which endogenous HSF1 had been replaced with either GFP, wild-type hHSF1, or mutated hHSF1 were heat shocked (42°C for 40 min). (Top) HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (Bottom) Extracts from cells were subjected to immunoblotting. (F) Cells in which endogenous PARP13 had been replaced with either GFP, wild-type hPARP13, or mutated hPARP13 were heat shocked (42°C for 40 min). (Left) HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (Right) Extracts from cells were subjected to immunoblotting. Analysis for statistically significant differences was performed using Student's t test.

    Techniques Used: Expressing, Infection, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction

    DNA damage inhibits the HSR and proteostasis capacity. (A) HeLa cells in which endogenous HSF1 had been replaced with its mutants were heat shocked at 45°C (HS) for the indicated periods. Viable cells excluding trypan blue were counted ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (B) Cells expressing hHSF1 mutants were treated with a heat shock at 45°C for 3 h. (Left) MTT assays were performed ( n = 3). (Right) Cell extracts were subjected to immunoblotting (IB). Analysis for statistically significant differences was performed using Student's t test. (C) Cells expressing hHSF1 mutants were heat shocked at 45°C for 3 h. The accumulation of insoluble ubiquitylated proteins was examined by Western blotting using an anti-Ub antibody (left) and was quantified (right) ( n = 3). β-Actin levels in the soluble fraction are also shown. Analysis for statistically significant differences was performed using Student's t test. (D) Cells expressing hHSF1 mutants were heat shocked at 45°C for 3 h. Cell extracts were prepared and were subjected to immunoblotting. (E) HeLa cells either were treated with DOX for 6 h or were treated with IR or UV and were allowed to recover for 1 h. Then ChIP-qPCR of PARP1, PARP13, and HSF1 on the pHSE was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test. (F) DNA damage reduced heat shock-induced HSP70 expression. Cells were treated with DOX, IR, or UV as described for panel E. The cells were then heat shocked at 42°C for 3 h, and HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (G) Cells were treated with DOX, IR, or UV as described for panel E. These cells were heat shocked at 45°C for the indicated periods, and viable cells were counted ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (H) Cells were treated as described for panel G, and the accumulation of insoluble ubiquitylated proteins was examined by Western blotting. β-Actin levels in the soluble fraction are also shown. (I) Extracts were prepared from cells treated as described for panel G and were subjected to immunoblotting.
    Figure Legend Snippet: DNA damage inhibits the HSR and proteostasis capacity. (A) HeLa cells in which endogenous HSF1 had been replaced with its mutants were heat shocked at 45°C (HS) for the indicated periods. Viable cells excluding trypan blue were counted ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (B) Cells expressing hHSF1 mutants were treated with a heat shock at 45°C for 3 h. (Left) MTT assays were performed ( n = 3). (Right) Cell extracts were subjected to immunoblotting (IB). Analysis for statistically significant differences was performed using Student's t test. (C) Cells expressing hHSF1 mutants were heat shocked at 45°C for 3 h. The accumulation of insoluble ubiquitylated proteins was examined by Western blotting using an anti-Ub antibody (left) and was quantified (right) ( n = 3). β-Actin levels in the soluble fraction are also shown. Analysis for statistically significant differences was performed using Student's t test. (D) Cells expressing hHSF1 mutants were heat shocked at 45°C for 3 h. Cell extracts were prepared and were subjected to immunoblotting. (E) HeLa cells either were treated with DOX for 6 h or were treated with IR or UV and were allowed to recover for 1 h. Then ChIP-qPCR of PARP1, PARP13, and HSF1 on the pHSE was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test. (F) DNA damage reduced heat shock-induced HSP70 expression. Cells were treated with DOX, IR, or UV as described for panel E. The cells were then heat shocked at 42°C for 3 h, and HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). (G) Cells were treated with DOX, IR, or UV as described for panel E. These cells were heat shocked at 45°C for the indicated periods, and viable cells were counted ( n = 3). Analysis for statistically significant differences was performed by ANOVA. (H) Cells were treated as described for panel G, and the accumulation of insoluble ubiquitylated proteins was examined by Western blotting. β-Actin levels in the soluble fraction are also shown. (I) Extracts were prepared from cells treated as described for panel G and were subjected to immunoblotting.

    Techniques Used: Expressing, MTT Assay, Western Blot, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    PARP13 dissociation facilitates PARylation and HSF1 binding to the HSP70 promoter. (A) hHSF1-His (1 μg) was incubated at 37°C for 30 min with wild-type hPARP1-His (0.1 μg) or mutant hPARP1-His (AAA) (0.1 μg) in the presence of 100 μM NAD. The reaction product was immunoblotted (IB) with an anti-HSF1, anti-PARP1, or anti-PAR antibody. hPARP1 was auto-PARylated, whereas hHSF1 was not PARylated. (B) HeLa cells were treated with either a heat shock (HS) at 42°C for 30 min, 20 mM sodium salicylate for 1 h (SA), or 0.5 mM indomethacin for 1 h (Indo). Cell extracts were prepared and were subjected to HSF1 immunoprecipitation (IP) and immunoblotting. (C) Schematic representation of heat-induced phosphorylation sites in hHSF1 and of hHSF1 mutants lacking these phosphorylation sites. (D) HSF1-null MEFs were infected with an adenovirus expressing wild-type hHSF1 or mutated hHSF1 and were then either left untreated (Cont.) or heat shocked. Cell extracts were prepared and were subjected to HSF1 immunoprecipitation and immunoblotting. (E) HeLa cells were treated with a heat shock at 42°C for the indicated periods, and cell extracts were immunoblotted. (F) HeLa cells were treated with 10 μM MG132, 5 mM AZC, or 10 μM metformin for the indicated periods, and cell extracts were immunoblotted. (G) HeLa cells were first infected with an adenovirus expressing HA-tagged hHSF1, hHSF1-S121A, or hHSF1-S121G and then either left untreated (Cont.) or heat shocked at 42°C for 5 min. Cell extracts were prepared and were subjected to immunoprecipitation and immunoblotting. (H) Cells in which endogenous HSF1 or PARP1 had been replaced with GFP, wild-type hHSF1, hHSF1 mutants (S121A, S121G), or an inactive PARP1 mutant (AAA) were heat shocked at 42°C for the indicated periods. HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Analysis for statistically significant differences was performed using ANOVA (*) or Student's t test (**). (I) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, hHSF1-S121A, or hHSF1-S121G were either left untreated (Cont.) or heat shocked for 30 min (PARP1, PARP13, and HSF1 ChIP) or 10 min (PAR ChIP). ChIP-qPCR of PARP1, PARP13, PAR, and HSF1 on the pHSE, pausing region, or region 7 was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test.
    Figure Legend Snippet: PARP13 dissociation facilitates PARylation and HSF1 binding to the HSP70 promoter. (A) hHSF1-His (1 μg) was incubated at 37°C for 30 min with wild-type hPARP1-His (0.1 μg) or mutant hPARP1-His (AAA) (0.1 μg) in the presence of 100 μM NAD. The reaction product was immunoblotted (IB) with an anti-HSF1, anti-PARP1, or anti-PAR antibody. hPARP1 was auto-PARylated, whereas hHSF1 was not PARylated. (B) HeLa cells were treated with either a heat shock (HS) at 42°C for 30 min, 20 mM sodium salicylate for 1 h (SA), or 0.5 mM indomethacin for 1 h (Indo). Cell extracts were prepared and were subjected to HSF1 immunoprecipitation (IP) and immunoblotting. (C) Schematic representation of heat-induced phosphorylation sites in hHSF1 and of hHSF1 mutants lacking these phosphorylation sites. (D) HSF1-null MEFs were infected with an adenovirus expressing wild-type hHSF1 or mutated hHSF1 and were then either left untreated (Cont.) or heat shocked. Cell extracts were prepared and were subjected to HSF1 immunoprecipitation and immunoblotting. (E) HeLa cells were treated with a heat shock at 42°C for the indicated periods, and cell extracts were immunoblotted. (F) HeLa cells were treated with 10 μM MG132, 5 mM AZC, or 10 μM metformin for the indicated periods, and cell extracts were immunoblotted. (G) HeLa cells were first infected with an adenovirus expressing HA-tagged hHSF1, hHSF1-S121A, or hHSF1-S121G and then either left untreated (Cont.) or heat shocked at 42°C for 5 min. Cell extracts were prepared and were subjected to immunoprecipitation and immunoblotting. (H) Cells in which endogenous HSF1 or PARP1 had been replaced with GFP, wild-type hHSF1, hHSF1 mutants (S121A, S121G), or an inactive PARP1 mutant (AAA) were heat shocked at 42°C for the indicated periods. HSP70 mRNA levels were quantified by RT-qPCR ( n = 3). Analysis for statistically significant differences was performed using ANOVA (*) or Student's t test (**). (I) Cells in which endogenous HSF1 had been replaced with GFP, wild-type hHSF1, hHSF1-S121A, or hHSF1-S121G were either left untreated (Cont.) or heat shocked for 30 min (PARP1, PARP13, and HSF1 ChIP) or 10 min (PAR ChIP). ChIP-qPCR of PARP1, PARP13, PAR, and HSF1 on the pHSE, pausing region, or region 7 was performed ( n = 3). Analysis for statistically significant differences was performed using Student's t test.

    Techniques Used: Binding Assay, Incubation, Mutagenesis, Immunoprecipitation, Infection, Expressing, Quantitative RT-PCR, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    30) Product Images from "Fibronectin Promotes the Malignancy of Glioma Stem-Like Cells Via Modulation of Cell Adhesion, Differentiation, Proliferation and Chemoresistance"

    Article Title: Fibronectin Promotes the Malignancy of Glioma Stem-Like Cells Via Modulation of Cell Adhesion, Differentiation, Proliferation and Chemoresistance

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2018.00130

    FN upregulated proliferation of GSCs. (A) After U87-GSCs were cultured for 72 h, cells were shown to proliferate when grown on 5 or 10 μg/mL FN. (B) Immunofluorescence staining revealed FN at 5 or 10 μg/mL induced increased expression of Ki-67 by primary-GSCs, indicating FN promoted cell proliferation. Whereas primary-GSCs were detached by cilengitide and Ki67 were decreased markedly comparing to that in the 10 μg/mL FN group. Images were taken at the same exposure settings. Cells grown without FN and stained with isotype control Mouse IG1 were used as a negative control. (C–E) Western blots showed the marked upregulation of p-ERK1/2 and cyclin D1 by U87-GSCs grown on 5 or 10 μg/mL FN. Primary-GSCs showed markedly higher expression of these two proteins when grown on 10 μg/mL FN, with or without carmustine treatment. Cilengitide significantly suppressed both p -ERK1/2 and cyclin D1 expression of U87-GSCs. However, cilengitide only suppressed cyclin D1 expression in primary-GSCs. * p
    Figure Legend Snippet: FN upregulated proliferation of GSCs. (A) After U87-GSCs were cultured for 72 h, cells were shown to proliferate when grown on 5 or 10 μg/mL FN. (B) Immunofluorescence staining revealed FN at 5 or 10 μg/mL induced increased expression of Ki-67 by primary-GSCs, indicating FN promoted cell proliferation. Whereas primary-GSCs were detached by cilengitide and Ki67 were decreased markedly comparing to that in the 10 μg/mL FN group. Images were taken at the same exposure settings. Cells grown without FN and stained with isotype control Mouse IG1 were used as a negative control. (C–E) Western blots showed the marked upregulation of p-ERK1/2 and cyclin D1 by U87-GSCs grown on 5 or 10 μg/mL FN. Primary-GSCs showed markedly higher expression of these two proteins when grown on 10 μg/mL FN, with or without carmustine treatment. Cilengitide significantly suppressed both p -ERK1/2 and cyclin D1 expression of U87-GSCs. However, cilengitide only suppressed cyclin D1 expression in primary-GSCs. * p

    Techniques Used: Cell Culture, Immunofluorescence, Staining, Expressing, Negative Control, Western Blot

    31) Product Images from "Differential expression of PMCA2 mRNA isoforms in a cohort of Spanish patients with breast tumor types"

    Article Title: Differential expression of PMCA2 mRNA isoforms in a cohort of Spanish patients with breast tumor types

    Journal: Oncology Letters

    doi: 10.3892/ol.2018.9540

    Nested PCR for plasma membrane calcium ATPase 2 using specific RT-qPCR oligos revealed single bands of the expected size, confirming the specificity of the PCR products: 2w, 152 bp; 2w, 104 bp; 2×, 80 bp; 2z, 73 bp. RT-PCR was performed using total RNA isolated from tissue adjacent to the tumor (N). For electrophoresis, PCR products were run on 3% agarose gel. The sizes of a number of DNA molecular weight markers are depicted. bp, base pairs; +, with cDNA; -, without cDNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
    Figure Legend Snippet: Nested PCR for plasma membrane calcium ATPase 2 using specific RT-qPCR oligos revealed single bands of the expected size, confirming the specificity of the PCR products: 2w, 152 bp; 2w, 104 bp; 2×, 80 bp; 2z, 73 bp. RT-PCR was performed using total RNA isolated from tissue adjacent to the tumor (N). For electrophoresis, PCR products were run on 3% agarose gel. The sizes of a number of DNA molecular weight markers are depicted. bp, base pairs; +, with cDNA; -, without cDNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

    Techniques Used: Nested PCR, Quantitative RT-PCR, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Isolation, Electrophoresis, Agarose Gel Electrophoresis, Molecular Weight, Real-time Polymerase Chain Reaction

    32) Product Images from "Translational Physiology: Zinc ameliorates intestinal barrier dysfunctions in shigellosis by reinstating claudin-2 and -4 on the membranes"

    Article Title: Translational Physiology: Zinc ameliorates intestinal barrier dysfunctions in shigellosis by reinstating claudin-2 and -4 on the membranes

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    doi: 10.1152/ajpgi.00092.2018

    Zn 2+ prevents reduction of secretagogue-stimulated Cl − and paracellular water transport in intestinal epithelial cells of Shigella (NY962/92) infection. A : summarized effects of Zn 2+ on paracellular water transport ( serosal-to-mucosal) in human colonic T84 cell monolayers infected with Shigella . Top : illustration of the cell indicates the direction of osmotic gradient and water transport. Water transport is reflected by the change in polyethylene glycol (PEG) concentration ratio indicating volume in the mucosal side relative to volume in the serosal side. During water secretion to the mucosal side, PEG F falls and the ratio becomes greater than 1. B : representative current recording of Cl − transport of the effect of calcium and cAMP in mouse intestine and T84 monolayers ( C and E ). FSK, forskolin; CCH, carbachol. Inset figures represent data pooled from 3 monolayers and expressed means ± SE; n = 6. D : bar graph showing quantification of basal short-circuit current ( I sc ) changes elicited by Shigella infection alone and Shigella infection in presence of Zn 2+ . Data are pooled from 3 monolayers in each condition and results are expressed as means ± SE. * P
    Figure Legend Snippet: Zn 2+ prevents reduction of secretagogue-stimulated Cl − and paracellular water transport in intestinal epithelial cells of Shigella (NY962/92) infection. A : summarized effects of Zn 2+ on paracellular water transport ( serosal-to-mucosal) in human colonic T84 cell monolayers infected with Shigella . Top : illustration of the cell indicates the direction of osmotic gradient and water transport. Water transport is reflected by the change in polyethylene glycol (PEG) concentration ratio indicating volume in the mucosal side relative to volume in the serosal side. During water secretion to the mucosal side, PEG F falls and the ratio becomes greater than 1. B : representative current recording of Cl − transport of the effect of calcium and cAMP in mouse intestine and T84 monolayers ( C and E ). FSK, forskolin; CCH, carbachol. Inset figures represent data pooled from 3 monolayers and expressed means ± SE; n = 6. D : bar graph showing quantification of basal short-circuit current ( I sc ) changes elicited by Shigella infection alone and Shigella infection in presence of Zn 2+ . Data are pooled from 3 monolayers in each condition and results are expressed as means ± SE. * P

    Techniques Used: Infection, Concentration Assay

    Apical Zn 2+ rescues claudin-4 relocalization to restore Shigella -mediated barrier defects. A : mRNA expression profile of tight junction (TJ) proteins in T84 cells. Expression of claudin-1 ( B ), tricellulin ( C ), and claudin-4 ( D ) with or without Shigella (NY962/92) infection and in presence or absence of Zn 2+ . Data are plotted means ± SE; n = 4–6 independent experiments. E : effect of Shigella infection in presence or absence of Zn 2+ on claudin-4 protein level in cytosolic and membrane fractions of T84 cells, Na + -K + -ATPase and GAPDH were used as loading control. Representative blots are shown from 3 independent experiments. Top : representative Western blot for claudin-4 abundance in presence or absence of Zn 2+ without Shigella infection. F : immunofluorescence images ( XY ) of T84 cells stained with anti-claudin-4 (red), apical membrane marker wheat germ agglutinin (green), and nuclear marker DAPI (blue). Claudin-4 staining at cell-cell contact ( left ) were disturbed by Shigella infection ( middle ), but in presence of Zn 2+ , claudin-4 is efficiently concentrated into cell-cell borders ( right ). Typical image represents 3 separate duplicate experiments. Bar graph represents quantification of multiple images based on continuity of claudin-4 stain (broken vs. unbroken) to illustrate reproducible changes of claudin-4 in uninfected (Control) and Shigella -infected T84 cell monolayers in presence and absence of Zn 2+ . Three fields from 2 independent experiments for each condition, ~75 cells were scored. Details of boxed areas are zoomed, showing arrangement of claudin-4 ( bottom ). G : effect of Shigella infection in presence or absence of Zn 2+ on claudin-1 level in cytosolic and membrane fraction of T84 cells, representative Western blot from 2 independent experiments. Na + -K + -ATPase and GAPDH were used as loading control.
    Figure Legend Snippet: Apical Zn 2+ rescues claudin-4 relocalization to restore Shigella -mediated barrier defects. A : mRNA expression profile of tight junction (TJ) proteins in T84 cells. Expression of claudin-1 ( B ), tricellulin ( C ), and claudin-4 ( D ) with or without Shigella (NY962/92) infection and in presence or absence of Zn 2+ . Data are plotted means ± SE; n = 4–6 independent experiments. E : effect of Shigella infection in presence or absence of Zn 2+ on claudin-4 protein level in cytosolic and membrane fractions of T84 cells, Na + -K + -ATPase and GAPDH were used as loading control. Representative blots are shown from 3 independent experiments. Top : representative Western blot for claudin-4 abundance in presence or absence of Zn 2+ without Shigella infection. F : immunofluorescence images ( XY ) of T84 cells stained with anti-claudin-4 (red), apical membrane marker wheat germ agglutinin (green), and nuclear marker DAPI (blue). Claudin-4 staining at cell-cell contact ( left ) were disturbed by Shigella infection ( middle ), but in presence of Zn 2+ , claudin-4 is efficiently concentrated into cell-cell borders ( right ). Typical image represents 3 separate duplicate experiments. Bar graph represents quantification of multiple images based on continuity of claudin-4 stain (broken vs. unbroken) to illustrate reproducible changes of claudin-4 in uninfected (Control) and Shigella -infected T84 cell monolayers in presence and absence of Zn 2+ . Three fields from 2 independent experiments for each condition, ~75 cells were scored. Details of boxed areas are zoomed, showing arrangement of claudin-4 ( bottom ). G : effect of Shigella infection in presence or absence of Zn 2+ on claudin-1 level in cytosolic and membrane fraction of T84 cells, representative Western blot from 2 independent experiments. Na + -K + -ATPase and GAPDH were used as loading control.

    Techniques Used: Expressing, Infection, Western Blot, Immunofluorescence, Staining, Marker

    Tight junction barrier defect in T84 cells due to Shigella infection is regulated by extracellular signal-regulated kinase (ERK) signaling pathway for claudin-2 and -4 phosphorylation status. Effects of apical (Ap) Zn 2+ and basolateral (Bl) PD98059 (MAPK inhibitor) on transepithelial electrical resistance (TER; A ), 4-kDa FITC-dextran flux ( B ) in uninfected (Control) and Shigella -infected (NY962/92) T84 monolayers. Anthrapyrazolone (SP600125, 10 μM) failed to inhibit Shigella -mediated decrease in TER and increase permeability of 4-kDa FITC dextran in T84 monolayers ( top A and B , respectively). C : claudin-2 ( top ) and -4 ( bottom ) localization in uninfected and Shigella -infected T84 monolayers treated with or without PD98059 or SP600125. Bar graph represents quantification of multiple images based on continuity of claudin-2 and -4 stains (broken vs. unbroken) in uninfected (Control) and Shigella -infected T84 cell monolayers in presence of PD98059 and SP600125. D : effect of PD98059 on Shigella adhesion ( top ) and invasion ( bottom ) in infected T84 cell monolayers. Both adhesion and invasion of Shigella are not inhibited by PD98059 in T84 cell monolayers. Data are means ± SE of 3 independent experiments. NS, not significant. E : effect of Shigella infection on ERK phosphorylation in presence or absence of Zn 2+ in T84 cell monolayers as assessed by Western blot of phospho (p)-ERK. Densitometric quantification (ratio of ratios) of p-ERK levels relative to total GAPDH [(p-ERK/GAPDH)/(total ERK/GAPDH)]in triplicate experiments. F : immunoprecipated (IP) proteins with anti-claudin-2 ( top ) and anti-claudin-4 ( bottom ) antibody from T84 cell lysate of uninfected and Shigella -infected in presence or absence of Zn 2+ were examined for Ser/Thr phosphorylation by Western blotting using phosphor-antibody. Whole cell lysate was used as loading control. Representative blots represent 3 independent experiments. G : effects of PD98059 on IL-6 and IL-8 production in uninfected (Control) and Shigella -infected T84 monlayers in presence (NY962/92 + PD98059) or absence (NY962/92) of PD98059. Results are expressed as means ± SE. NS, P > 0.05, which is considered not statistically significant.
    Figure Legend Snippet: Tight junction barrier defect in T84 cells due to Shigella infection is regulated by extracellular signal-regulated kinase (ERK) signaling pathway for claudin-2 and -4 phosphorylation status. Effects of apical (Ap) Zn 2+ and basolateral (Bl) PD98059 (MAPK inhibitor) on transepithelial electrical resistance (TER; A ), 4-kDa FITC-dextran flux ( B ) in uninfected (Control) and Shigella -infected (NY962/92) T84 monolayers. Anthrapyrazolone (SP600125, 10 μM) failed to inhibit Shigella -mediated decrease in TER and increase permeability of 4-kDa FITC dextran in T84 monolayers ( top A and B , respectively). C : claudin-2 ( top ) and -4 ( bottom ) localization in uninfected and Shigella -infected T84 monolayers treated with or without PD98059 or SP600125. Bar graph represents quantification of multiple images based on continuity of claudin-2 and -4 stains (broken vs. unbroken) in uninfected (Control) and Shigella -infected T84 cell monolayers in presence of PD98059 and SP600125. D : effect of PD98059 on Shigella adhesion ( top ) and invasion ( bottom ) in infected T84 cell monolayers. Both adhesion and invasion of Shigella are not inhibited by PD98059 in T84 cell monolayers. Data are means ± SE of 3 independent experiments. NS, not significant. E : effect of Shigella infection on ERK phosphorylation in presence or absence of Zn 2+ in T84 cell monolayers as assessed by Western blot of phospho (p)-ERK. Densitometric quantification (ratio of ratios) of p-ERK levels relative to total GAPDH [(p-ERK/GAPDH)/(total ERK/GAPDH)]in triplicate experiments. F : immunoprecipated (IP) proteins with anti-claudin-2 ( top ) and anti-claudin-4 ( bottom ) antibody from T84 cell lysate of uninfected and Shigella -infected in presence or absence of Zn 2+ were examined for Ser/Thr phosphorylation by Western blotting using phosphor-antibody. Whole cell lysate was used as loading control. Representative blots represent 3 independent experiments. G : effects of PD98059 on IL-6 and IL-8 production in uninfected (Control) and Shigella -infected T84 monlayers in presence (NY962/92 + PD98059) or absence (NY962/92) of PD98059. Results are expressed as means ± SE. NS, P > 0.05, which is considered not statistically significant.

    Techniques Used: Infection, Permeability, Western Blot

    Effects of Shigella (NY962/92) infection on interleukin (IL) production by human intestinal T84 cells Interleukin assessment of transforming growth factor-β (TGFβ; A ), IL-10 ( B ), IL-4 ( C ), IL-17 ( D ), IL-6 ( E ), and IL-8 ( F ) secreted by uninfected (control) and Shigella -infected T84 monolayers for 6 h in the presence (NY962/92 + Zn) and absence (NY962/92 – Zn) of Zn 2+ . Zn 2+ reversed IL-6 and IL-8 secretion to basal level. Data presented represent means ± SE of 3 independent experiments per group. ND, not determined.
    Figure Legend Snippet: Effects of Shigella (NY962/92) infection on interleukin (IL) production by human intestinal T84 cells Interleukin assessment of transforming growth factor-β (TGFβ; A ), IL-10 ( B ), IL-4 ( C ), IL-17 ( D ), IL-6 ( E ), and IL-8 ( F ) secreted by uninfected (control) and Shigella -infected T84 monolayers for 6 h in the presence (NY962/92 + Zn) and absence (NY962/92 – Zn) of Zn 2+ . Zn 2+ reversed IL-6 and IL-8 secretion to basal level. Data presented represent means ± SE of 3 independent experiments per group. ND, not determined.

    Techniques Used: Infection

    Altered distribution of claudin-2 is rescued by Zn 2+ for restoration of paracellular permeability and barrier tightens. A : representative images of claudin-2 (red) and apical membrane marker wheat germ agglutinin (blue) in control (uninfected) and Shigella infected in the presence (NY962/92 + zinc) and absence (NY962/92 – zinc) of Zn 2+ in T84 monolayer. Claudin-2 staining at cell-cell contacts is shown diminished by Shigella infection ( XY ). X-Z images showed that claudin-2-positive red strip in the apical region between neighboring cells were disturbed (NY962/92 – zinc) but relocalization of claudin-2 occurs in the presence of Zn 2+ (NY962/92 + zinc). Bar graph represents quantification of multiple images based on continuity of claudin-2 stain (broken vs. unbroken). Three fields of view from 2 independent experiments for each condition, ~75 cells were scored. B : qRT-PCR showed that claudin-2 mRNA is markedly elevated by Zn 2+ application in T84 cells. Data are means ± SE; n = 3 per group. C : effect of Shigella infection in presence or absence of Zn 2+ on claudin-2 level in cytosolic and membrane fractions of T84 cells. Representative Western blot presented represent 3 independent experiments. Na + -K + -ATPase and GAPDH were used as loading control. Top : representative Western blot for claudin-2 abundance in presence and absence of Zn 2+ without Shigella infection. D : T84 monolayers ( top ) and mouse distal colon ( bottom ); uninfected ( left ) or Shigella infected ( right ) were immunolabeled with anti-cystic fibrosis transmembrane conductance regulator (CFTR) antibody. Each image is representative of 3 separate experiments performed in duplicate.
    Figure Legend Snippet: Altered distribution of claudin-2 is rescued by Zn 2+ for restoration of paracellular permeability and barrier tightens. A : representative images of claudin-2 (red) and apical membrane marker wheat germ agglutinin (blue) in control (uninfected) and Shigella infected in the presence (NY962/92 + zinc) and absence (NY962/92 – zinc) of Zn 2+ in T84 monolayer. Claudin-2 staining at cell-cell contacts is shown diminished by Shigella infection ( XY ). X-Z images showed that claudin-2-positive red strip in the apical region between neighboring cells were disturbed (NY962/92 – zinc) but relocalization of claudin-2 occurs in the presence of Zn 2+ (NY962/92 + zinc). Bar graph represents quantification of multiple images based on continuity of claudin-2 stain (broken vs. unbroken). Three fields of view from 2 independent experiments for each condition, ~75 cells were scored. B : qRT-PCR showed that claudin-2 mRNA is markedly elevated by Zn 2+ application in T84 cells. Data are means ± SE; n = 3 per group. C : effect of Shigella infection in presence or absence of Zn 2+ on claudin-2 level in cytosolic and membrane fractions of T84 cells. Representative Western blot presented represent 3 independent experiments. Na + -K + -ATPase and GAPDH were used as loading control. Top : representative Western blot for claudin-2 abundance in presence and absence of Zn 2+ without Shigella infection. D : T84 monolayers ( top ) and mouse distal colon ( bottom ); uninfected ( left ) or Shigella infected ( right ) were immunolabeled with anti-cystic fibrosis transmembrane conductance regulator (CFTR) antibody. Each image is representative of 3 separate experiments performed in duplicate.

    Techniques Used: Permeability, Marker, Infection, Staining, Stripping Membranes, Quantitative RT-PCR, Western Blot, Immunolabeling

    33) Product Images from "Fibronectin Promotes the Malignancy of Glioma Stem-Like Cells Via Modulation of Cell Adhesion, Differentiation, Proliferation and Chemoresistance"

    Article Title: Fibronectin Promotes the Malignancy of Glioma Stem-Like Cells Via Modulation of Cell Adhesion, Differentiation, Proliferation and Chemoresistance

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2018.00130

    FN upregulated proliferation of GSCs. (A) After U87-GSCs were cultured for 72 h, cells were shown to proliferate when grown on 5 or 10 μg/mL FN. (B) Immunofluorescence staining revealed FN at 5 or 10 μg/mL induced increased expression of Ki-67 by primary-GSCs, indicating FN promoted cell proliferation. Whereas primary-GSCs were detached by cilengitide and Ki67 were decreased markedly comparing to that in the 10 μg/mL FN group. Images were taken at the same exposure settings. Cells grown without FN and stained with isotype control Mouse IG1 were used as a negative control. (C–E) Western blots showed the marked upregulation of p-ERK1/2 and cyclin D1 by U87-GSCs grown on 5 or 10 μg/mL FN. Primary-GSCs showed markedly higher expression of these two proteins when grown on 10 μg/mL FN, with or without carmustine treatment. Cilengitide significantly suppressed both p -ERK1/2 and cyclin D1 expression of U87-GSCs. However, cilengitide only suppressed cyclin D1 expression in primary-GSCs. * p
    Figure Legend Snippet: FN upregulated proliferation of GSCs. (A) After U87-GSCs were cultured for 72 h, cells were shown to proliferate when grown on 5 or 10 μg/mL FN. (B) Immunofluorescence staining revealed FN at 5 or 10 μg/mL induced increased expression of Ki-67 by primary-GSCs, indicating FN promoted cell proliferation. Whereas primary-GSCs were detached by cilengitide and Ki67 were decreased markedly comparing to that in the 10 μg/mL FN group. Images were taken at the same exposure settings. Cells grown without FN and stained with isotype control Mouse IG1 were used as a negative control. (C–E) Western blots showed the marked upregulation of p-ERK1/2 and cyclin D1 by U87-GSCs grown on 5 or 10 μg/mL FN. Primary-GSCs showed markedly higher expression of these two proteins when grown on 10 μg/mL FN, with or without carmustine treatment. Cilengitide significantly suppressed both p -ERK1/2 and cyclin D1 expression of U87-GSCs. However, cilengitide only suppressed cyclin D1 expression in primary-GSCs. * p

    Techniques Used: Cell Culture, Immunofluorescence, Staining, Expressing, Negative Control, Western Blot

    34) Product Images from "Recruitment of coregulator G9a by Runx2 for selective enhancement or suppression of transcription"

    Article Title: Recruitment of coregulator G9a by Runx2 for selective enhancement or suppression of transcription

    Journal: Journal of Cellular Biochemistry

    doi: 10.1002/jcb.24114

    Selective positive and negative coregulator effects by G9a on Runx2 target genes C4-2B/Rx2 dox cells were infected with lentiviral vectors encoding shRNA targeting G9a mRNA (shG9a) or a non-specific sequence (shNS), and the infected populations were selected with puromycin. The two infected cell populations were cultured in medium supplemented with charcoal-stripped serum (CSS) containing dox (250 ng/ml) to induce Runx2 expression or equal volume of vehicle (distilled water) for 24 h before harvest. A: Immunoblots ( left ) were performed using antibodies against G9a, FLAG epitope (to detect Runx2), and actin as a control. mRNA levels were assessed by qRT-PCR ( right ). B C: The mRNA levels for the indicated target genes of Runx2 were analyzed by qRT-PCR as described in Materials and Methods. All experiments were repeated at least three times and the representative results are shown. Abbreviations used: PIP, Prolactin-induced protein; MMP13 and MMP9, Matrix metalloproteinsase-13 and -9, respectively; PGC, Progastricsin-C; CSF-2, Colony-stimulating factor-2; SDF-1, Stromal differentiating factor-1; CST7, Cystatin-7.
    Figure Legend Snippet: Selective positive and negative coregulator effects by G9a on Runx2 target genes C4-2B/Rx2 dox cells were infected with lentiviral vectors encoding shRNA targeting G9a mRNA (shG9a) or a non-specific sequence (shNS), and the infected populations were selected with puromycin. The two infected cell populations were cultured in medium supplemented with charcoal-stripped serum (CSS) containing dox (250 ng/ml) to induce Runx2 expression or equal volume of vehicle (distilled water) for 24 h before harvest. A: Immunoblots ( left ) were performed using antibodies against G9a, FLAG epitope (to detect Runx2), and actin as a control. mRNA levels were assessed by qRT-PCR ( right ). B C: The mRNA levels for the indicated target genes of Runx2 were analyzed by qRT-PCR as described in Materials and Methods. All experiments were repeated at least three times and the representative results are shown. Abbreviations used: PIP, Prolactin-induced protein; MMP13 and MMP9, Matrix metalloproteinsase-13 and -9, respectively; PGC, Progastricsin-C; CSF-2, Colony-stimulating factor-2; SDF-1, Stromal differentiating factor-1; CST7, Cystatin-7.

    Techniques Used: Infection, shRNA, Sequencing, Cell Culture, Expressing, Western Blot, FLAG-tag, Quantitative RT-PCR, Pyrolysis Gas Chromatography

    G9a associates with Runx2 A: Cos-7 cells were transfected with expression vectors for FLAG-Runx2 and HA-G9a (500 ng each in 6-well dishes). Cell extracts were immunoprecipitated with FLAG antibodies, and the immunoprecipitates were analyzed by immunoblotting using antibodies against HA epitope. B: GST or GST-G9a on glutathione agarose beads was incubated with in vitro transcribed and translated 35 S-labeled Runx2. The bound protein fraction was analyzed by SDS-PAGE and autoradiography.
    Figure Legend Snippet: G9a associates with Runx2 A: Cos-7 cells were transfected with expression vectors for FLAG-Runx2 and HA-G9a (500 ng each in 6-well dishes). Cell extracts were immunoprecipitated with FLAG antibodies, and the immunoprecipitates were analyzed by immunoblotting using antibodies against HA epitope. B: GST or GST-G9a on glutathione agarose beads was incubated with in vitro transcribed and translated 35 S-labeled Runx2. The bound protein fraction was analyzed by SDS-PAGE and autoradiography.

    Techniques Used: Transfection, Expressing, Immunoprecipitation, Incubation, In Vitro, Labeling, SDS Page, Autoradiography

    Runx2 colocalizes with G9a and enhances its intranuclear mobility A: C4-2B/Rx2 dox cells were treated for 24 h with dox to induce Runx2 expression or vehicle (veh) as control, and immunofluorescence analysis was performed to detect G9a (green) or Runx2 (red) proteins. DAPI staining (blue) indicates dense chromatin organization in the cell nuclei. Runx2/G9a, overlay of red and green images (yellow) indicates overlap; Runx2/G9a/dapi, overlay of red, green, and blue images. B: Fluorescence recovery after photobleaching of G9a-GFP was assessed as described in Materials and Methods in Cos7 cells transfected with plasmid encoding GFP-G9a alone (blue curve) or together with plasmid encoding Runx2 (red curve).
    Figure Legend Snippet: Runx2 colocalizes with G9a and enhances its intranuclear mobility A: C4-2B/Rx2 dox cells were treated for 24 h with dox to induce Runx2 expression or vehicle (veh) as control, and immunofluorescence analysis was performed to detect G9a (green) or Runx2 (red) proteins. DAPI staining (blue) indicates dense chromatin organization in the cell nuclei. Runx2/G9a, overlay of red and green images (yellow) indicates overlap; Runx2/G9a/dapi, overlay of red, green, and blue images. B: Fluorescence recovery after photobleaching of G9a-GFP was assessed as described in Materials and Methods in Cos7 cells transfected with plasmid encoding GFP-G9a alone (blue curve) or together with plasmid encoding Runx2 (red curve).

    Techniques Used: Expressing, Immunofluorescence, Staining, Fluorescence, Transfection, Plasmid Preparation

    Enhancement of Runx2-mediated transcription by G9a in a transient reporter assay CV1 cells in 12-well plates were transfected with the 6XOSE2-Luciferase reporter plasmid illustrated in A (200 ng/well) alone or together with expression vectors for Runx2 (1 ng) and either HA-tagged G9a full length (G9a) or HA-G9a(H/K) methyltransferase-deficient mutant (H/K) (50, 100 and 200 ng). After transfection the cells were grown for 48 h before they were subjected to luciferase assays (B) and immunoblot analysis using antibodies against HA and actin (C).
    Figure Legend Snippet: Enhancement of Runx2-mediated transcription by G9a in a transient reporter assay CV1 cells in 12-well plates were transfected with the 6XOSE2-Luciferase reporter plasmid illustrated in A (200 ng/well) alone or together with expression vectors for Runx2 (1 ng) and either HA-tagged G9a full length (G9a) or HA-G9a(H/K) methyltransferase-deficient mutant (H/K) (50, 100 and 200 ng). After transfection the cells were grown for 48 h before they were subjected to luciferase assays (B) and immunoblot analysis using antibodies against HA and actin (C).

    Techniques Used: Reporter Assay, Transfection, Luciferase, Plasmid Preparation, Expressing, Mutagenesis

    35) Product Images from "Repurposing of Miglustat to inhibit the coronavirus Severe Acquired Respiratory Syndrome SARS-CoV-2"

    Article Title: Repurposing of Miglustat to inhibit the coronavirus Severe Acquired Respiratory Syndrome SARS-CoV-2

    Journal: bioRxiv

    doi: 10.1101/2020.05.18.101691

    A) Time-of-addition experiment: SARS-CoV-2 genomic RNA. Huh7 cells were infected at moi = 0.1 and incubated with Miglustat before infection (pre-treatment), during infection (co-treatment) and after infection (post-treatment) as described in the text. At the indicated time points, total RNA was extracted from the infected cells and analyzed by RT PCR. Data are shown as fold-change normalized to their respective T0 values. B) Time-of-addition experiment: SARS-CoV-2 proteins. Protein extracts from Huh7 cells treated as in (A) were immunoblotted with a COVID-19 convalescent human serum. The N protein is indicated, with Vimentin as loading control. C-D) Time-of-addition experiment: SARS-CoV-2 infectious virus. The infectious virus produced in the experiment was measured as PFU/ml on Vero E6 cells as indicated. E-F) Time-of-addition experiment: SARS-CoV-2 secreted genomes. The SARS-CoV-2 genomes in the supernatant of infected cells were quantified by RT PCR as indicated. G) Time-of-addition experiment: SARS-CoV-2 secreted virions. The virion protein N of secreted SARS-CoV-2 was detected with a convalescent human serum. H) Secretion of SARS-CoV-2 Spike RBD. The his-tagged Spike-RBD was expressed in HEK 293T cells in the presence of Miglustat and protein detected by immunoblot for the his-tag both in supernatant and cell extracts with β-actin as loading control. J-K) Surface expression of SARS-CoV-2 Spike. Full-length SARS-CoV-2 Spike was expressed in HEK-293T cells in the presence of Miglustat and its expression and correct folding on the cell surface was detected with the mSIP-3022 antibody.
    Figure Legend Snippet: A) Time-of-addition experiment: SARS-CoV-2 genomic RNA. Huh7 cells were infected at moi = 0.1 and incubated with Miglustat before infection (pre-treatment), during infection (co-treatment) and after infection (post-treatment) as described in the text. At the indicated time points, total RNA was extracted from the infected cells and analyzed by RT PCR. Data are shown as fold-change normalized to their respective T0 values. B) Time-of-addition experiment: SARS-CoV-2 proteins. Protein extracts from Huh7 cells treated as in (A) were immunoblotted with a COVID-19 convalescent human serum. The N protein is indicated, with Vimentin as loading control. C-D) Time-of-addition experiment: SARS-CoV-2 infectious virus. The infectious virus produced in the experiment was measured as PFU/ml on Vero E6 cells as indicated. E-F) Time-of-addition experiment: SARS-CoV-2 secreted genomes. The SARS-CoV-2 genomes in the supernatant of infected cells were quantified by RT PCR as indicated. G) Time-of-addition experiment: SARS-CoV-2 secreted virions. The virion protein N of secreted SARS-CoV-2 was detected with a convalescent human serum. H) Secretion of SARS-CoV-2 Spike RBD. The his-tagged Spike-RBD was expressed in HEK 293T cells in the presence of Miglustat and protein detected by immunoblot for the his-tag both in supernatant and cell extracts with β-actin as loading control. J-K) Surface expression of SARS-CoV-2 Spike. Full-length SARS-CoV-2 Spike was expressed in HEK-293T cells in the presence of Miglustat and its expression and correct folding on the cell surface was detected with the mSIP-3022 antibody.

    Techniques Used: Infection, Incubation, Reverse Transcription Polymerase Chain Reaction, Produced, Expressing

    A) SARS-CoV-2 infectivity. Vero E6 and Huh7 cells were infected in parallel with SARS-CoV-2 at moi 0.1. At the indicated time points RNA was extracted from the cells and measured by RT PCR for SARS-CoV-2 genomes. Data are plotted as fold change over T0. B) Immunofluorecence assay. Vero E6 and Huh7 cells were infected with SARS-CoV-2 moi = 0.1 for 24 hours. Cells were then fixed and stained with mSIP-3022 antibody against Spike (red) to acquire confocal images. Nuclei are stained by DAPI. Bar corresponds to 20 µM.
    Figure Legend Snippet: A) SARS-CoV-2 infectivity. Vero E6 and Huh7 cells were infected in parallel with SARS-CoV-2 at moi 0.1. At the indicated time points RNA was extracted from the cells and measured by RT PCR for SARS-CoV-2 genomes. Data are plotted as fold change over T0. B) Immunofluorecence assay. Vero E6 and Huh7 cells were infected with SARS-CoV-2 moi = 0.1 for 24 hours. Cells were then fixed and stained with mSIP-3022 antibody against Spike (red) to acquire confocal images. Nuclei are stained by DAPI. Bar corresponds to 20 µM.

    Techniques Used: Infection, Reverse Transcription Polymerase Chain Reaction, Staining

    36) Product Images from "A Minimally-invasive Blood-derived Biomarker of Oligodendrocyte Cell-loss in Multiple Sclerosis"

    Article Title: A Minimally-invasive Blood-derived Biomarker of Oligodendrocyte Cell-loss in Multiple Sclerosis

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2016.06.031

    Methylation-specific primers display high specificity and sensitivity and can detect demethylated MOG-DNA in human brain and liver. A. A depiction of MOG gene region utilized for human methylation-specific qPCR analysis; cytosines at bps + 2410 and + 2430 from MOG transcription start site inco rporated into reverse primer sequence. B. Sanger sequencing results of bisulfite treated DNA from human tissues. Arrows point toward CpG sites where cytosines (C) are preserved in the methylated sample (Liver), or converted to thymines (T) in a sample containing demethylated CpGs, leading to a mixed population of C′s and T's (Brain). Red arrows indicate CpGs incorporated into reverse primers. C. DNA from the brain is differentially methylated in the MOG gene compared to DNA from the liver. Sequence analysis was performed on first-step PCR product of each sample, 13 clones of liver and 23 clones of brain DNA are shown (○ represent demethylated cytosines; ●, methylated cytosines). Locations in relation to the MOG transcription start site are listed; methylation-specific human primers incorporate the CpG sites at bp + 2410 and + 2430. D. Methylation-specific primers tested using plasmids containing methylated and demethylated human MOG-DNA inserts over a wide range of serial dilutions (R 2 = 0.992, p
    Figure Legend Snippet: Methylation-specific primers display high specificity and sensitivity and can detect demethylated MOG-DNA in human brain and liver. A. A depiction of MOG gene region utilized for human methylation-specific qPCR analysis; cytosines at bps + 2410 and + 2430 from MOG transcription start site inco rporated into reverse primer sequence. B. Sanger sequencing results of bisulfite treated DNA from human tissues. Arrows point toward CpG sites where cytosines (C) are preserved in the methylated sample (Liver), or converted to thymines (T) in a sample containing demethylated CpGs, leading to a mixed population of C′s and T's (Brain). Red arrows indicate CpGs incorporated into reverse primers. C. DNA from the brain is differentially methylated in the MOG gene compared to DNA from the liver. Sequence analysis was performed on first-step PCR product of each sample, 13 clones of liver and 23 clones of brain DNA are shown (○ represent demethylated cytosines; ●, methylated cytosines). Locations in relation to the MOG transcription start site are listed; methylation-specific human primers incorporate the CpG sites at bp + 2410 and + 2430. D. Methylation-specific primers tested using plasmids containing methylated and demethylated human MOG-DNA inserts over a wide range of serial dilutions (R 2 = 0.992, p

    Techniques Used: Methylation, Real-time Polymerase Chain Reaction, Sequencing, Polymerase Chain Reaction, Clone Assay

    Illustrative representation of biomarker assay used to detect oligodendrocyte death in multiple sclerosis. Myelin-producing oligodendrocytes die and release genomic DNA into circulation. Blood is collected from the patient, DNA is purified, and bisulfite converted. Post-bisulfite conversion, samples are run on first-step PCR using methylation-unspecific primers and loaded onto an agarose gel. First-step PCR product is extracted and used as a template for qPCR utilizing methylation-specific primers.
    Figure Legend Snippet: Illustrative representation of biomarker assay used to detect oligodendrocyte death in multiple sclerosis. Myelin-producing oligodendrocytes die and release genomic DNA into circulation. Blood is collected from the patient, DNA is purified, and bisulfite converted. Post-bisulfite conversion, samples are run on first-step PCR using methylation-unspecific primers and loaded onto an agarose gel. First-step PCR product is extracted and used as a template for qPCR utilizing methylation-specific primers.

    Techniques Used: Biomarker Assay, Purification, Polymerase Chain Reaction, Methylation, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction

    Murine brain and spinal cord show differential methylation in the MOG gene, due to their O4 + cell population. A. Sanger sequencing results of bisulfite treated DNA from murine tissues. Arrows point toward CpG sites where cytosines (C) are preserved in methylated samples (Liver, Kidney), or converted to thymines (T) in samples containing demethylated CpGs, leading to a mixed population of C′s and T's (Brain, Spinal Cord). B. Methylation-sensitive DNA digestion was performed on the magnetically spinal cord of liver derived-DNA using the McrBC enzyme. Digested DNA was subjected to semi-quantitative PCR (cycles 32 and 35) and run on agarose gel. UnTx—untreated DNA receiving all reaction components except McrBC enzyme. Pos—positive control using cloned native MOG DNA. NTC—no template control. C and D. O4 + and O4 − cells were separated from four separate murine brains by magnetic beads. FACS analysis showed > 92.6 ± 3.9% enrichment of O4 + cells among four independent preparations when compared to O4 − fractions. E. DNA from murine O4 + cells is differentially methylated in the MOG gene compared to DNA from O4 − cells, the SW10 Schwann cell line, and liver. Sequence analysis was performed on first-step PCR product of each sample, 10 clones from each are shown (○ represent demethylated cytosines; ●, methylated cytosines). Locations in relation to the MOG transcription start site are listed, methylation-specific murine primers incorporate the CpG site at bp + 2752.
    Figure Legend Snippet: Murine brain and spinal cord show differential methylation in the MOG gene, due to their O4 + cell population. A. Sanger sequencing results of bisulfite treated DNA from murine tissues. Arrows point toward CpG sites where cytosines (C) are preserved in methylated samples (Liver, Kidney), or converted to thymines (T) in samples containing demethylated CpGs, leading to a mixed population of C′s and T's (Brain, Spinal Cord). B. Methylation-sensitive DNA digestion was performed on the magnetically spinal cord of liver derived-DNA using the McrBC enzyme. Digested DNA was subjected to semi-quantitative PCR (cycles 32 and 35) and run on agarose gel. UnTx—untreated DNA receiving all reaction components except McrBC enzyme. Pos—positive control using cloned native MOG DNA. NTC—no template control. C and D. O4 + and O4 − cells were separated from four separate murine brains by magnetic beads. FACS analysis showed > 92.6 ± 3.9% enrichment of O4 + cells among four independent preparations when compared to O4 − fractions. E. DNA from murine O4 + cells is differentially methylated in the MOG gene compared to DNA from O4 − cells, the SW10 Schwann cell line, and liver. Sequence analysis was performed on first-step PCR product of each sample, 10 clones from each are shown (○ represent demethylated cytosines; ●, methylated cytosines). Locations in relation to the MOG transcription start site are listed, methylation-specific murine primers incorporate the CpG site at bp + 2752.

    Techniques Used: Methylation, Sequencing, Derivative Assay, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Positive Control, Clone Assay, Magnetic Beads, FACS, Polymerase Chain Reaction

    37) Product Images from "Decoding critical long non-coding RNA in ovarian cancer epithelial-to-mesenchymal transition"

    Article Title: Decoding critical long non-coding RNA in ovarian cancer epithelial-to-mesenchymal transition

    Journal: Nature Communications

    doi: 10.1038/s41467-017-01781-0

    DNM3OS is a potential regulator of ovarian cancer EMT genes. a Interactions between EMT-linked genes and DNM3OS predicted by sequence complementarity and a minimum energy (MinEnergy) score ≤−15 kcal/mol. b Subcellular fractionation of RNA followed by RT-PCR (representative of two independent experiments). Nuclear 45S rRNA and cytoplasmic 7SL served as controls. Base pairs (bp) indicated on left side
    Figure Legend Snippet: DNM3OS is a potential regulator of ovarian cancer EMT genes. a Interactions between EMT-linked genes and DNM3OS predicted by sequence complementarity and a minimum energy (MinEnergy) score ≤−15 kcal/mol. b Subcellular fractionation of RNA followed by RT-PCR (representative of two independent experiments). Nuclear 45S rRNA and cytoplasmic 7SL served as controls. Base pairs (bp) indicated on left side

    Techniques Used: Sequencing, Fractionation, Reverse Transcription Polymerase Chain Reaction

    Reduced expression of DNM3OS favors mesenchymal-to-epithelial transition by deregulating critical genes/pathways. SMARTpool siRNA-specific DNM3OS or non-targeting (NT) control were transfected into SKOV3 cells. a qRT-PCR was performed. Values are relative to β -ACTIN and the mean of 3 experiments; * P = 0.039; one-tailed t -test. b , c RNA sequencing was performed (triplicates). GSEA on pooled samples considering curated data from KEGG and Hallmark data set b ; normalized enrichment score (NES), nominal (Nom.) P- value, false discovery rate (FDR). ** P
    Figure Legend Snippet: Reduced expression of DNM3OS favors mesenchymal-to-epithelial transition by deregulating critical genes/pathways. SMARTpool siRNA-specific DNM3OS or non-targeting (NT) control were transfected into SKOV3 cells. a qRT-PCR was performed. Values are relative to β -ACTIN and the mean of 3 experiments; * P = 0.039; one-tailed t -test. b , c RNA sequencing was performed (triplicates). GSEA on pooled samples considering curated data from KEGG and Hallmark data set b ; normalized enrichment score (NES), nominal (Nom.) P- value, false discovery rate (FDR). ** P

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR, One-tailed Test, RNA Sequencing Assay

    38) Product Images from "Functional divergence of chloroplast Cpn60α subunits during Arabidopsis embryo development"

    Article Title: Functional divergence of chloroplast Cpn60α subunits during Arabidopsis embryo development

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007036

    Structural analysis of the CPNA2 protein. (A) 3D structural models of GroEL, CPNA1, and CPNA2. The predicted structural models of CPNA1 and CPNA2 were generated with SWISS-MODEL, and the structural model of GroEL (PDB 1AON, Chain A) was used as the template. (B) 3D structural models of BnaC02g08340D, LOC100257653, and L484_018489. BnaC02g08340D, LOC100257653 and L484_018489 are the orthologs of CPNA2 in Brassica napus , Vitis vinifera and Morus notabilis , respectively. The structural model of GroEL (PDB 1AON, Chain A) was used as the template. (C) Sequence alignment of the chaperonin subunits in Arabidopsis . Amino acid residues in position 259 and 267 are included in the red frames. Sequences were aligned in DNAMAN 6.0. (D) Complementation of the cpna2-2 /+ plants with the CPNA2pro : CPNA2 , CPNA2pro : CPNA2 E259A , CPNA2pro : CPNA2 Q267R or CPNA2pro : CPNA2 E259A/Q267R construct. Bars = 1 mm.
    Figure Legend Snippet: Structural analysis of the CPNA2 protein. (A) 3D structural models of GroEL, CPNA1, and CPNA2. The predicted structural models of CPNA1 and CPNA2 were generated with SWISS-MODEL, and the structural model of GroEL (PDB 1AON, Chain A) was used as the template. (B) 3D structural models of BnaC02g08340D, LOC100257653, and L484_018489. BnaC02g08340D, LOC100257653 and L484_018489 are the orthologs of CPNA2 in Brassica napus , Vitis vinifera and Morus notabilis , respectively. The structural model of GroEL (PDB 1AON, Chain A) was used as the template. (C) Sequence alignment of the chaperonin subunits in Arabidopsis . Amino acid residues in position 259 and 267 are included in the red frames. Sequences were aligned in DNAMAN 6.0. (D) Complementation of the cpna2-2 /+ plants with the CPNA2pro : CPNA2 , CPNA2pro : CPNA2 E259A , CPNA2pro : CPNA2 Q267R or CPNA2pro : CPNA2 E259A/Q267R construct. Bars = 1 mm.

    Techniques Used: Generated, Sequencing, Construct

    39) Product Images from "EspR-dependent ESAT-6 Protein Secretion of Mycobacterium tuberculosis Requires the Presence of Virulence Regulator PhoP *"

    Article Title: EspR-dependent ESAT-6 Protein Secretion of Mycobacterium tuberculosis Requires the Presence of Virulence Regulator PhoP *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M116.746289

    Recruitment of EspR at the espACD promoter requires the presence of PhoP. A, ChIP-qPCR was carried out to assess EspR recruitment to the espACD promoter of WT, Δ phoP, and the complemented mutant. Fold PCR enrichment due to EspR binding was determined
    Figure Legend Snippet: Recruitment of EspR at the espACD promoter requires the presence of PhoP. A, ChIP-qPCR was carried out to assess EspR recruitment to the espACD promoter of WT, Δ phoP, and the complemented mutant. Fold PCR enrichment due to EspR binding was determined

    Techniques Used: Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Mutagenesis, Polymerase Chain Reaction, Binding Assay

    40) Product Images from "Chd7 is indispensable for mammalian brain development through activation of a neuronal differentiation programme"

    Article Title: Chd7 is indispensable for mammalian brain development through activation of a neuronal differentiation programme

    Journal: Nature Communications

    doi: 10.1038/ncomms14758

    Chd7 is required for activation of neuronal genes during GNP differentiation. ( a ) qRT–PCR analysis of Chd7 transcripts in P7 Chd7 WT [ Chd7 f/f ], heterozygous [ Atoh1-Cre::Chd7 f/+ ] and homozygous [ Atoh1-Cre::Chd7 f/f ] mutant GNPs. The level of Gapdh transcripts was used for normalization. Bars represent normalized mean value ± s.d. from three samples for each group. Paired two-tailed t -test with equal variance was performed, P =0.0034 (for Het.); P =0.001 (for Hom.). ( b ) Heatmap shows significantly downregulated genes ( P
    Figure Legend Snippet: Chd7 is required for activation of neuronal genes during GNP differentiation. ( a ) qRT–PCR analysis of Chd7 transcripts in P7 Chd7 WT [ Chd7 f/f ], heterozygous [ Atoh1-Cre::Chd7 f/+ ] and homozygous [ Atoh1-Cre::Chd7 f/f ] mutant GNPs. The level of Gapdh transcripts was used for normalization. Bars represent normalized mean value ± s.d. from three samples for each group. Paired two-tailed t -test with equal variance was performed, P =0.0034 (for Het.); P =0.001 (for Hom.). ( b ) Heatmap shows significantly downregulated genes ( P

    Techniques Used: Activation Assay, Quantitative RT-PCR, Mutagenesis, Two Tailed Test

    Related Articles

    TUNEL Assay:

    Article Title: Necrosis Is the Dominant Cell Death Pathway in Uropathogenic Escherichia coli Elicited Epididymo-Orchitis and Is Responsible for Damage of Rat Testis
    Article Snippet: .. TUNEL Assay DNA fragmentation of the testis was assessed semi-quantitatively with terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay using the ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Millipore, MA, USA) following the manufacture’s instruction. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Epigenetic engineering shows H3K4me2 is required for HJURP targeting and CENP-A assembly on a synthetic human kinetochore
    Article Snippet: .. ChIP'ed and input DNA was subject to real-time PCR analysis using a SYBR Green Mastermix (Sigma) on a LightCycler480 system (Roche). ..

    Flow Cytometry:

    Article Title: The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing
    Article Snippet: .. For flow cytometry to determine DNA content, HeLa cells were fixed with 70% ethanol and stained with 0.5 mg/mL propidium iodide and 20 μg/mL RNAse A (Sigma). .. Propidium iodide-stained cells were analyzed using a FACSCalibur flow cytometer (Beckton-Dickinson), and the cell cycle phase distributions were determined with ModFit software (Verity).

    In Situ:

    Article Title: Necrosis Is the Dominant Cell Death Pathway in Uropathogenic Escherichia coli Elicited Epididymo-Orchitis and Is Responsible for Damage of Rat Testis
    Article Snippet: .. TUNEL Assay DNA fragmentation of the testis was assessed semi-quantitatively with terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay using the ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Millipore, MA, USA) following the manufacture’s instruction. ..

    Chromatin Immunoprecipitation:

    Article Title: Epigenetic engineering shows H3K4me2 is required for HJURP targeting and CENP-A assembly on a synthetic human kinetochore
    Article Snippet: .. ChIP'ed and input DNA was subject to real-time PCR analysis using a SYBR Green Mastermix (Sigma) on a LightCycler480 system (Roche). ..

    Article Title: A directly negative interaction of miR-203 and ZEB2 modulates tumor stemness and chemotherapy resistance in nasopharyngeal carcinoma
    Article Snippet: .. DNA–protein complexes were immunoprecipitated from SUNE1 cells after ZEB2 cDNA transfection using the Chromatin Immunoprecipitation Kit (Millipore, Billerica, MA, USA), according to the manufacturer's protocol with 1 mg polyclonal ZEB2 antibody or 1mg normal mouse IgG (Millipore). .. Precipitated DNA was subjected to qPCR analysis using spcific primers (−547-Forward: 5′GCTGGTCCTCACCTGTTCC3′;-547-Reverse: 5′CCAGCCTCCAGCGCC3′; -1146-Forward:5′CGGCCCATGTGGAAATGTCT3′, -1146-Reverse:5′GCAGGGTGGTGACCATTCAT3′) to amplify across the miR-203 promoter region [ ].

    Transfection:

    Article Title: A directly negative interaction of miR-203 and ZEB2 modulates tumor stemness and chemotherapy resistance in nasopharyngeal carcinoma
    Article Snippet: .. DNA–protein complexes were immunoprecipitated from SUNE1 cells after ZEB2 cDNA transfection using the Chromatin Immunoprecipitation Kit (Millipore, Billerica, MA, USA), according to the manufacturer's protocol with 1 mg polyclonal ZEB2 antibody or 1mg normal mouse IgG (Millipore). .. Precipitated DNA was subjected to qPCR analysis using spcific primers (−547-Forward: 5′GCTGGTCCTCACCTGTTCC3′;-547-Reverse: 5′CCAGCCTCCAGCGCC3′; -1146-Forward:5′CGGCCCATGTGGAAATGTCT3′, -1146-Reverse:5′GCAGGGTGGTGACCATTCAT3′) to amplify across the miR-203 promoter region [ ].

    Cytometry:

    Article Title: The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing
    Article Snippet: .. For flow cytometry to determine DNA content, HeLa cells were fixed with 70% ethanol and stained with 0.5 mg/mL propidium iodide and 20 μg/mL RNAse A (Sigma). .. Propidium iodide-stained cells were analyzed using a FACSCalibur flow cytometer (Beckton-Dickinson), and the cell cycle phase distributions were determined with ModFit software (Verity).

    SYBR Green Assay:

    Article Title: Epigenetic engineering shows H3K4me2 is required for HJURP targeting and CENP-A assembly on a synthetic human kinetochore
    Article Snippet: .. ChIP'ed and input DNA was subject to real-time PCR analysis using a SYBR Green Mastermix (Sigma) on a LightCycler480 system (Roche). ..

    Immunoprecipitation:

    Article Title: A directly negative interaction of miR-203 and ZEB2 modulates tumor stemness and chemotherapy resistance in nasopharyngeal carcinoma
    Article Snippet: .. DNA–protein complexes were immunoprecipitated from SUNE1 cells after ZEB2 cDNA transfection using the Chromatin Immunoprecipitation Kit (Millipore, Billerica, MA, USA), according to the manufacturer's protocol with 1 mg polyclonal ZEB2 antibody or 1mg normal mouse IgG (Millipore). .. Precipitated DNA was subjected to qPCR analysis using spcific primers (−547-Forward: 5′GCTGGTCCTCACCTGTTCC3′;-547-Reverse: 5′CCAGCCTCCAGCGCC3′; -1146-Forward:5′CGGCCCATGTGGAAATGTCT3′, -1146-Reverse:5′GCAGGGTGGTGACCATTCAT3′) to amplify across the miR-203 promoter region [ ].

    Incubation:

    Article Title: Precise binding of single-stranded DNA termini by human RAD52 protein
    Article Snippet: .. In some reactions containing 5′-biotinylated poly(dT)100 , the 3′-32 P-end-labelled DNA was incubated for 5 min at 37°C with 10 ng of streptavidin (Sigma) prior to the addition of RAD52. .. 32 P-labelled poly(dT)40 was incubated with or without RAD52 in binding buffer for 20 min at 37°C.

    Article Title: Inhibition of double-strand break non-homologous end-joining by cisplatin adducts in human cell extracts
    Article Snippet: .. To determine the dependence of DNA joining on DNA-PK or Ku, Wortmannin (10 μM; Sigma, UK) or anti-Ku70 antibody (1:20 dilution; ab87, Abcam, UK), respectively, was included in the reaction mixture in the absence of DNA for 10 min on ice before the addition of DNA and incubation at 37°C. .. NHEJ of cisplatinated plasmid DNA The effect of cisplatin adducts on NHEJ was initially examined using a linear double-stranded 3.2 kb DNA substrate with cohesive 3′ four base overhangs produced by PstI digestion where the entire DNA molecule had been exposed to a range of cisplatin concentrations.

    other:

    Article Title: Distinct signaling events promote resistance to mitoxantrone and etoposide in pediatric AML: a Children’s Oncology Group report
    Article Snippet: Reagents Etoposide, mitoxantrone, and the selective DNA-PK inhibitor V were obtained from Sigma-Aldrich (St. Louis, MO, USA).

    Staining:

    Article Title: The CRL4Cdt2 ubiquitin ligase targets the degradation of p21Cip1 to control replication licensing
    Article Snippet: .. For flow cytometry to determine DNA content, HeLa cells were fixed with 70% ethanol and stained with 0.5 mg/mL propidium iodide and 20 μg/mL RNAse A (Sigma). .. Propidium iodide-stained cells were analyzed using a FACSCalibur flow cytometer (Beckton-Dickinson), and the cell cycle phase distributions were determined with ModFit software (Verity).

    Fluorescence In Situ Hybridization:

    Article Title: Dynamic plasticity of large-scale chromatin structure revealed by self-assembly of engineered chromosome regions
    Article Snippet: .. RNA and DNA FISH ES and 3T3 cells were grown overnight on coverslips coated for 4 h with 0.1% fibronectin (Sigma-Aldrich). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore taq dna polymerase
    Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 577 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Millipore
    Average 99 stars, based on 577 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Millipore qpcr primers
    Qpcr Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qpcr primers/product/Millipore
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qpcr primers - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    90
    Millipore kicqstart probe qpcr readymix
    Kicqstart Probe Qpcr Readymix, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kicqstart probe qpcr readymix/product/Millipore
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    kicqstart probe qpcr readymix - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results