Structured Review

TaKaRa mrna
The <t>mRNA</t> expression levels of <t>TXNIP</t> gene of peripheral leucocytes in patients and healthy controls. The mRNA levels of TXNIP gene were normalized to β-actin , which was used as an internal control. Data were expressed as means ± SD. ∗ P
Mrna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 18474 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mrna/product/TaKaRa
Average 94 stars, based on 18474 article reviews
Price from $9.99 to $1999.99
mrna - by Bioz Stars, 2020-09
94/100 stars

Images

1) Product Images from "Altered Expression of TXNIP in the peripheral leukocytes of patients with coronary atherosclerotic heart disease"

Article Title: Altered Expression of TXNIP in the peripheral leukocytes of patients with coronary atherosclerotic heart disease

Journal: Medicine

doi: 10.1097/MD.0000000000009108

The mRNA expression levels of TXNIP gene of peripheral leucocytes in patients and healthy controls. The mRNA levels of TXNIP gene were normalized to β-actin , which was used as an internal control. Data were expressed as means ± SD. ∗ P
Figure Legend Snippet: The mRNA expression levels of TXNIP gene of peripheral leucocytes in patients and healthy controls. The mRNA levels of TXNIP gene were normalized to β-actin , which was used as an internal control. Data were expressed as means ± SD. ∗ P

Techniques Used: Expressing

The sensitivity and specificity of the RT-qPCR and western blot were compared using the receiver operating characteristic (ROC) curves. Area under the curve (AUC) for the level of thioredoxin interacting protein (TXNIP) mRNA was significantly higher than protein levels (AUCmRNA = 0.791, AUCProtein = 0.656, P
Figure Legend Snippet: The sensitivity and specificity of the RT-qPCR and western blot were compared using the receiver operating characteristic (ROC) curves. Area under the curve (AUC) for the level of thioredoxin interacting protein (TXNIP) mRNA was significantly higher than protein levels (AUCmRNA = 0.791, AUCProtein = 0.656, P

Techniques Used: Quantitative RT-PCR, Western Blot

2) Product Images from "Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock"

Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/jcmm.12756

PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P
Figure Legend Snippet: PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

Techniques Used: Injection, Enzyme-linked Immunosorbent Assay, Western Blot, RNA Binding Assay, Mouse Assay, Staining, Quantitative RT-PCR

3) Product Images from "Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus"

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0110911

Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).
Figure Legend Snippet: Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Fluorescence, Cell Culture

4) Product Images from "Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice"

Article Title: Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19123884

IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p
Figure Legend Snippet: IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

Techniques Used: Mouse Assay, Injection, Activity Assay, Staining, Synthesized, Real-time Polymerase Chain Reaction, Amplification, SYBR Green Assay, Polymerase Chain Reaction

5) Product Images from "Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression"

Article Title: Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2018.9760

3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P
Figure Legend Snippet: 3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P

Techniques Used: Western Blot, Expressing, Real-time Polymerase Chain Reaction

6) Product Images from "Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy"

Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy

Journal: Oncology Letters

doi: 10.3892/ol.2019.10047

pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.
Figure Legend Snippet: pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

Techniques Used: Expressing, Plasmid Preparation, RNA Extraction, Gel Extraction, Marker, Polymerase Chain Reaction, Recombinant

7) Product Images from "Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice"

Article Title: Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice

Journal: Immunology letters

doi: 10.1016/j.imlet.2010.09.009

Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.
Figure Legend Snippet: Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.

Techniques Used: Selection, Mouse Assay, Magnetic Beads, Polymerase Chain Reaction, Produced, Real-time Polymerase Chain Reaction, Expressing

8) Product Images from "Obesity and p16INK4A Downregulation Activate Breast Adipocytes and Promote Their Protumorigenicity"

Article Title: Obesity and p16INK4A Downregulation Activate Breast Adipocytes and Promote Their Protumorigenicity

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.00101-17

Breast adipocytes from obese females promote EMT and tumor growth. LeaL-10 cells were exposed to SFM or SFCM from four Obadi and four Leadi cells for 24 h. (A) The migration/invasion and proliferation capabilities were assessed. The graphs are representative of different experiments. (B) Cell lysates were prepared and used for immunoblotting. (C) Total RNA was prepared from LeaL-10 cells grown in 3D cultures and used to assess the level of the indicated transcripts by qRT-PCR. Error bars represent means ± SD of values from three different experiments. *, P ≤ 2.33 × 10 −5 . (D and E) LeaL-10 cells were exposed to SFM, SFCM from Obadi-1 cells containing either antileptin or anti-IgG antibodies, or SFCM from Leadi-1 cells containing the human leptin protein for 24 h and then were utilized to assess the migration/invasion and proliferation capabilities (the graphs are representative of different experiments) or the levels of the indicated proteins by immunoblotting.
Figure Legend Snippet: Breast adipocytes from obese females promote EMT and tumor growth. LeaL-10 cells were exposed to SFM or SFCM from four Obadi and four Leadi cells for 24 h. (A) The migration/invasion and proliferation capabilities were assessed. The graphs are representative of different experiments. (B) Cell lysates were prepared and used for immunoblotting. (C) Total RNA was prepared from LeaL-10 cells grown in 3D cultures and used to assess the level of the indicated transcripts by qRT-PCR. Error bars represent means ± SD of values from three different experiments. *, P ≤ 2.33 × 10 −5 . (D and E) LeaL-10 cells were exposed to SFM, SFCM from Obadi-1 cells containing either antileptin or anti-IgG antibodies, or SFCM from Leadi-1 cells containing the human leptin protein for 24 h and then were utilized to assess the migration/invasion and proliferation capabilities (the graphs are representative of different experiments) or the levels of the indicated proteins by immunoblotting.

Techniques Used: Migration, Quantitative RT-PCR

Obesity promotes EMT in breast epithelium. (A and B) Immunofluorescence for the indicated FFPE breast tissues. Scale bar, 50 μm. (C and E) Normal breast luminal cells were subjected to cytospins and used for immunofluorescence. Scale bars, 50 μm. The histogram shows the mean Ki-67 labeling index for three ObeL and three LeaL cells. Error bars represent means ± SD of values from three independent experiments. **, P ≤ 0.000457. (D) Total RNA from three LeaL and three ObeL luminal cells was utilized to assess the level of the indicated genes by qRT-PCR. Values are the means ± SEM ( n = 3). Error bars represent means ± SD of values from three independent experiments. **, P = 0.000174. (F) Three ObeL and three LeaL cells were seeded in complete medium in the E-plate, and the proliferation rate was assessed. The graph is representative of different experiments.
Figure Legend Snippet: Obesity promotes EMT in breast epithelium. (A and B) Immunofluorescence for the indicated FFPE breast tissues. Scale bar, 50 μm. (C and E) Normal breast luminal cells were subjected to cytospins and used for immunofluorescence. Scale bars, 50 μm. The histogram shows the mean Ki-67 labeling index for three ObeL and three LeaL cells. Error bars represent means ± SD of values from three independent experiments. **, P ≤ 0.000457. (D) Total RNA from three LeaL and three ObeL luminal cells was utilized to assess the level of the indicated genes by qRT-PCR. Values are the means ± SEM ( n = 3). Error bars represent means ± SD of values from three independent experiments. **, P = 0.000174. (F) Three ObeL and three LeaL cells were seeded in complete medium in the E-plate, and the proliferation rate was assessed. The graph is representative of different experiments.

Techniques Used: Immunofluorescence, Formalin-fixed Paraffin-Embedded, Labeling, Quantitative RT-PCR

p16 suppresses the expression and secretion of leptin through targeting miR-141 and miR-146b-5p. (A and C to F) Total RNA from Leadi-sh and Leadi-C cells expressing the indicated constructs was utilized to assess the indicated transcripts by qRT-PCR. (B) SFCM from the indicated cells was used to assess the level of the secreted leptin by ELISA. Error bars represent means ± SD of values from three independent experiments. *, P ≤ 0.0002; **, P ≤ 0.000022.
Figure Legend Snippet: p16 suppresses the expression and secretion of leptin through targeting miR-141 and miR-146b-5p. (A and C to F) Total RNA from Leadi-sh and Leadi-C cells expressing the indicated constructs was utilized to assess the indicated transcripts by qRT-PCR. (B) SFCM from the indicated cells was used to assess the level of the secreted leptin by ELISA. Error bars represent means ± SD of values from three independent experiments. *, P ≤ 0.0002; **, P ≤ 0.000022.

Techniques Used: Expressing, Construct, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Breast adipocytes from obese females express low levels of p16 and high levels of leptin. (A) Mature adipocytes were subjected to cytospins, stained with Oil Red O or fixed with 4% paraformaldehyde, and then used for immunofluorescence utilizing the indicated antibodies. (B) Cell extracts were prepared from the indicated adipocytes and used for immunoblotting. (C) Immunohistochemistry for the indicated FFPE adipose tissues using antibodies against the indicated proteins. Scale bars, 50 μm. (D) Total RNA was prepared from the indicated adipocytes and utilized to assess the level of the indicated genes by qRT-PCR (upper panels) and the mean values of all Obadi and all Leadi cells (lower panels). Error bars represent means ± SD from three independent experiments. (E) Breast adipocytes from three lean and three obese females were treated with actinomycin D for the indicated periods of time. Total RNA was prepared, and the remaining amount of the CDKN2A mRNA was assessed by qRT-PCR. The values at time zero were considered 100%. The dashed lines reveal the half-life (50% mRNA remaining) using regression analysis. Error bars represent means ± SD from three independent experiments.
Figure Legend Snippet: Breast adipocytes from obese females express low levels of p16 and high levels of leptin. (A) Mature adipocytes were subjected to cytospins, stained with Oil Red O or fixed with 4% paraformaldehyde, and then used for immunofluorescence utilizing the indicated antibodies. (B) Cell extracts were prepared from the indicated adipocytes and used for immunoblotting. (C) Immunohistochemistry for the indicated FFPE adipose tissues using antibodies against the indicated proteins. Scale bars, 50 μm. (D) Total RNA was prepared from the indicated adipocytes and utilized to assess the level of the indicated genes by qRT-PCR (upper panels) and the mean values of all Obadi and all Leadi cells (lower panels). Error bars represent means ± SD from three independent experiments. (E) Breast adipocytes from three lean and three obese females were treated with actinomycin D for the indicated periods of time. Total RNA was prepared, and the remaining amount of the CDKN2A mRNA was assessed by qRT-PCR. The values at time zero were considered 100%. The dashed lines reveal the half-life (50% mRNA remaining) using regression analysis. Error bars represent means ± SD from three independent experiments.

Techniques Used: Staining, Immunofluorescence, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Quantitative RT-PCR

9) Product Images from "Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *"

Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.262154

Effects of TGF-β1 on cell morphology, E-cadherin expression, and changes in N -glycans in GE11 cells. GE11 cells were grown in 6-well (2 × 10 5 ) or bottom dishes (2 × 10 4 ) for 24 h and then replaced with fresh complete medium with or without TGF-β1 (5 ng/ml) for another 4 days of incubation. A, cell morphology of the indicated cells was photographed. Photographs were taken of living cells using a ×10 objective. Scale bar, 100 μm. B, E-cadherin expressed on the cell surface was stained with anti-E-cadherin primary antibody, followed by incubation with Alexa Fluor-conjugated secondary antibody. Scale bar, 25 μm. C, total expression levels of E-cadherin were analyzed using Western blotting. Cell lysates from those cells were immunoblotted with anti-E-cadherin antibody. D, equal amounts of cell lysate proteins (20 μg) were used as the enzymatic source for the examination of GnT-III activities. S, substrate; P, product. E, mRNA expression of GnT-III . Quantitative RT-PCR was performed by monitoring in real time the increase in fluorescence of the SYBR Green dye on an ABI StepOnePlus. The mean number of cycles to the threshold ( CT ) of fluorescence detection was calculated for each sample, and the results were normalized to the mean CT of GAPDH for each sample tested. The changes in N -glycans were detected by E4-PHA ( F ) and concanavalin A ( ConA ) ( G ) lectin blot. α-Tubulin was used as a load control. H, N -glycans of GE11 cells cultured under normal conditions and treated with ( bottom ) or without ( top ) TGF-β for 4 days were released with peptide: N -glycosidase F ( PNGaseF ), as described under “Experimental Procedures,” digested with sialidase, and subjected to reversed-phase HPLC. The elution times for those PA-bisected N -glycans were compared with standard PA- N -glycans.
Figure Legend Snippet: Effects of TGF-β1 on cell morphology, E-cadherin expression, and changes in N -glycans in GE11 cells. GE11 cells were grown in 6-well (2 × 10 5 ) or bottom dishes (2 × 10 4 ) for 24 h and then replaced with fresh complete medium with or without TGF-β1 (5 ng/ml) for another 4 days of incubation. A, cell morphology of the indicated cells was photographed. Photographs were taken of living cells using a ×10 objective. Scale bar, 100 μm. B, E-cadherin expressed on the cell surface was stained with anti-E-cadherin primary antibody, followed by incubation with Alexa Fluor-conjugated secondary antibody. Scale bar, 25 μm. C, total expression levels of E-cadherin were analyzed using Western blotting. Cell lysates from those cells were immunoblotted with anti-E-cadherin antibody. D, equal amounts of cell lysate proteins (20 μg) were used as the enzymatic source for the examination of GnT-III activities. S, substrate; P, product. E, mRNA expression of GnT-III . Quantitative RT-PCR was performed by monitoring in real time the increase in fluorescence of the SYBR Green dye on an ABI StepOnePlus. The mean number of cycles to the threshold ( CT ) of fluorescence detection was calculated for each sample, and the results were normalized to the mean CT of GAPDH for each sample tested. The changes in N -glycans were detected by E4-PHA ( F ) and concanavalin A ( ConA ) ( G ) lectin blot. α-Tubulin was used as a load control. H, N -glycans of GE11 cells cultured under normal conditions and treated with ( bottom ) or without ( top ) TGF-β for 4 days were released with peptide: N -glycosidase F ( PNGaseF ), as described under “Experimental Procedures,” digested with sialidase, and subjected to reversed-phase HPLC. The elution times for those PA-bisected N -glycans were compared with standard PA- N -glycans.

Techniques Used: Expressing, Incubation, Staining, Western Blot, Quantitative RT-PCR, Fluorescence, SYBR Green Assay, Cell Culture, High Performance Liquid Chromatography

10) Product Images from "Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer"

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer

Journal: Cell Death & Disease

doi: 10.1038/s41419-018-1210-9

LncATB functions by binding to miR-200 family members. a RNA pull-down followed by microRNA qRT-PCR assays to detect miR-200 family members endogenously associated with lncATB. b MCF-7 cell lysates were incubated with biotin-labelled lncATB; after the pull-down, miR-200 miRNAs were extracted and assessed by qRT-PCR assays. c − g Relative luciferase activity in MCF-7 cells transfected with specific miR-200 luciferase reporters in the presence of pcDNA3.1-ATB alone or with the cotransfection of c miR-200a mimics, d miR-200b mimics, e miR-200c mimics, f miR-141 mimics, or g miR-429 mimics. h − l Relative luciferase activity in BT-549 cells cotransfected with specific miR-200 luciferase reporters and shATB-#1/2. For each specific reporter, h miR-200a inhibitor, i miR-200b inhibitor, j miR-200c inhibitor, k miR-141 inhibitor, or l miR-429 inhibitor was also added. * P
Figure Legend Snippet: LncATB functions by binding to miR-200 family members. a RNA pull-down followed by microRNA qRT-PCR assays to detect miR-200 family members endogenously associated with lncATB. b MCF-7 cell lysates were incubated with biotin-labelled lncATB; after the pull-down, miR-200 miRNAs were extracted and assessed by qRT-PCR assays. c − g Relative luciferase activity in MCF-7 cells transfected with specific miR-200 luciferase reporters in the presence of pcDNA3.1-ATB alone or with the cotransfection of c miR-200a mimics, d miR-200b mimics, e miR-200c mimics, f miR-141 mimics, or g miR-429 mimics. h − l Relative luciferase activity in BT-549 cells cotransfected with specific miR-200 luciferase reporters and shATB-#1/2. For each specific reporter, h miR-200a inhibitor, i miR-200b inhibitor, j miR-200c inhibitor, k miR-141 inhibitor, or l miR-429 inhibitor was also added. * P

Techniques Used: Binding Assay, Quantitative RT-PCR, Incubation, Luciferase, Activity Assay, Transfection, Cotransfection

11) Product Images from "Characterization of microRNA profiles in the mammary gland tissue of dairy goats at the late lactation, dry period and late gestation stages"

Article Title: Characterization of microRNA profiles in the mammary gland tissue of dairy goats at the late lactation, dry period and late gestation stages

Journal: PLoS ONE

doi: 10.1371/journal.pone.0234427

Validation of 15 randomly selected miRNAs by qRT-PCR. A shows the expression levels of 15 randomly selected miRNAs calculated by RNA-Seq. B shows the expression levels of 15 randomly selected miRNAs calculated by qRT-PCR. C Correlation between RNA-seq and qRT-PCR data. Fifteen miRNAs were randomly selected for validation.
Figure Legend Snippet: Validation of 15 randomly selected miRNAs by qRT-PCR. A shows the expression levels of 15 randomly selected miRNAs calculated by RNA-Seq. B shows the expression levels of 15 randomly selected miRNAs calculated by qRT-PCR. C Correlation between RNA-seq and qRT-PCR data. Fifteen miRNAs were randomly selected for validation.

Techniques Used: Quantitative RT-PCR, Expressing, RNA Sequencing Assay

12) Product Images from "Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis"

Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis

Journal: 3 Biotech

doi: 10.1007/s13205-019-1811-8

The expression level of 3D8 scFv protein in recombinant L. reuteri and recombinant L. paracasei ATCC 334 strains. The expression level of 3D8 scFv in transformed L. reuteri was determined with SYBR Premix Ex Taq by real-time RT-PCR
Figure Legend Snippet: The expression level of 3D8 scFv protein in recombinant L. reuteri and recombinant L. paracasei ATCC 334 strains. The expression level of 3D8 scFv in transformed L. reuteri was determined with SYBR Premix Ex Taq by real-time RT-PCR

Techniques Used: Expressing, Recombinant, Transformation Assay, Quantitative RT-PCR

13) Product Images from "CsrB, a noncoding regulatory RNA, is required for BarA-dependent expression of biocontrol traits in Rahnella aquatilis HX2"

Article Title: CsrB, a noncoding regulatory RNA, is required for BarA-dependent expression of biocontrol traits in Rahnella aquatilis HX2

Journal: PLoS ONE

doi: 10.1371/journal.pone.0187492

The ncRNA CsrB is controlled by BarA at the posttranscriptional level in Rahnella aquatilis HX2. (A) Activation of csrB transcription by BarA. β-galactosidase activities of a transcriptional rsmB - lacZ fusion carried by pMLcsrBlac were determined in the wild type (HX2; circles) and a barA mutant (MR57; squares). (B) The relative level of ncRNA CsrB in Rahnella aquatilis MR57 with or without pRKbarA grown for 12 h in PDB medium. The amount of mRNA was determined by qPCR. Three replicates were used in this experiment. Data with the different letters are significantly different ( P
Figure Legend Snippet: The ncRNA CsrB is controlled by BarA at the posttranscriptional level in Rahnella aquatilis HX2. (A) Activation of csrB transcription by BarA. β-galactosidase activities of a transcriptional rsmB - lacZ fusion carried by pMLcsrBlac were determined in the wild type (HX2; circles) and a barA mutant (MR57; squares). (B) The relative level of ncRNA CsrB in Rahnella aquatilis MR57 with or without pRKbarA grown for 12 h in PDB medium. The amount of mRNA was determined by qPCR. Three replicates were used in this experiment. Data with the different letters are significantly different ( P

Techniques Used: Activation Assay, Mutagenesis, Real-time Polymerase Chain Reaction

14) Product Images from "Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4"

Article Title: Transdifferentiation of Human Hair Follicle Mesenchymal Stem Cells into Red Blood Cells by OCT4

Journal: Stem Cells International

doi: 10.1155/2015/389628

hHFMSCs were transduced with lentivirus encoding OCT4. (a) Flow cytometric plot of GFP expression in hHFMSCs after 12 days of transduction (hHFMSCs OCT4 ). (b) Semiquantitative RT-PCR results for expression of total RNA OCT4 in hHFMSC OCT4 . (c) Western blot results for expression of total proteins of OCT4 in hHFMSCs OCT4 . (d) Cell morphologies were changed between 0 and 14 days after OCT4 transduction.
Figure Legend Snippet: hHFMSCs were transduced with lentivirus encoding OCT4. (a) Flow cytometric plot of GFP expression in hHFMSCs after 12 days of transduction (hHFMSCs OCT4 ). (b) Semiquantitative RT-PCR results for expression of total RNA OCT4 in hHFMSC OCT4 . (c) Western blot results for expression of total proteins of OCT4 in hHFMSCs OCT4 . (d) Cell morphologies were changed between 0 and 14 days after OCT4 transduction.

Techniques Used: Transduction, Flow Cytometry, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

15) Product Images from "Enhanced Upregulation of CRH mRNA Expression in the Nucleus Accumbens of Male Rats after a Second Injection of Methamphetamine Given Thirty Days Later"

Article Title: Enhanced Upregulation of CRH mRNA Expression in the Nucleus Accumbens of Male Rats after a Second Injection of Methamphetamine Given Thirty Days Later

Journal: PLoS ONE

doi: 10.1371/journal.pone.0084665

qPCR validation of METH-induced changes identified by microarray analysis. There is a significant correlation between METH-induced changes in the expression of genes identified by microarray analysis and validated by qRT-PCR.
Figure Legend Snippet: qPCR validation of METH-induced changes identified by microarray analysis. There is a significant correlation between METH-induced changes in the expression of genes identified by microarray analysis and validated by qRT-PCR.

Techniques Used: Real-time Polymerase Chain Reaction, Microarray, Expressing, Quantitative RT-PCR

16) Product Images from "Role of CRD-BP in the growth of human Basal Cell Carcinoma Cells"

Article Title: Role of CRD-BP in the growth of human Basal Cell Carcinoma Cells

Journal: The Journal of investigative dermatology

doi: 10.1038/jid.2014.17

Analysis of the expression of CRD-BP and the activity of Wnt and Hh signaling pathways in BCC a. Relative expression of CRD-BP, GLI1, β-TrCP1, and c-myc in mRNA isolated from 13 superficial BCCs, determined by quantitative RT-PCR. Each value represents the ratio between the expression of each mRNA in BCC and its expression in matching normal skin. b. Relative expression of Tcf1, Axin, PTCH1, and PTCH2 in mRNA isolated from 12 superficial BCCs, determined by quantitative RT-PCR. Each value represents the ratio between the expression of each mRNA in BCC and its expression in matching normal skin.
Figure Legend Snippet: Analysis of the expression of CRD-BP and the activity of Wnt and Hh signaling pathways in BCC a. Relative expression of CRD-BP, GLI1, β-TrCP1, and c-myc in mRNA isolated from 13 superficial BCCs, determined by quantitative RT-PCR. Each value represents the ratio between the expression of each mRNA in BCC and its expression in matching normal skin. b. Relative expression of Tcf1, Axin, PTCH1, and PTCH2 in mRNA isolated from 12 superficial BCCs, determined by quantitative RT-PCR. Each value represents the ratio between the expression of each mRNA in BCC and its expression in matching normal skin.

Techniques Used: Expressing, Activity Assay, Isolation, Quantitative RT-PCR

Characterization of a human BCC cell line (UW-BCC1) a. UW-BCC1 in culture at passage 11 and at passage 73. A BCC sample was sequentially trypsinized for 6, 12 and 18 hrs in a humidified cell culture incubator with 5% CO 2 and grown in low calcium media as described in the supplemental information . Scale bar = 30 μm. b. Protein expression of CRD-BP and GLI1 in UW-BCC1 determined by immunoblot analyses. β-actin was used as internal control. This is a representative of three independent experiments. c. Protein expression of keratin 5 and keratin 14 in UW-BCC1 determined by immunoblot analyses. β-actin was used as internal control. This is a representative of three independent experiments. d. Relative expression of CRD-BP, GLI1, PTCH1, and PTCH2 in mRNA isolated from UW-BCC1 and other cell lines determined by quantitative RT-PCR. e. UW-BCC1 and other cells as indicated were grown in 6 well plates and co-transfected with 8×3′GLI BS-LucII reporter plasmid and pSV-40 -galactosidase plasmid. 48 hrs after transfection, the luciferase activity was estimated using luciferase reporter assay reagent (Promega). β-galactosidase was used for normalization and estimated using β-galactosidase assay reagent (Pierce). Each experiment was done at least twice and in triplicates. Each value represents Mean+/-SD. *P≤0.05 f. UW-BCC1 was grown in two 100 mm plates and transfected with pTK-puro plasmid. Equal number of cells from each plate was seeded in five 100 mm plates. One set of plates was treated with Vismodegib (100 nM) for 72 hrs and puromycin (5 μg) for 10 days. The other set of plates was treated with puromycin (5 μg) alone for 10 days. Colonies were counted under the microscope. Each experiment was done at least twice and in triplicates. Each value represents Mean+/-SD. *P≤0.05.
Figure Legend Snippet: Characterization of a human BCC cell line (UW-BCC1) a. UW-BCC1 in culture at passage 11 and at passage 73. A BCC sample was sequentially trypsinized for 6, 12 and 18 hrs in a humidified cell culture incubator with 5% CO 2 and grown in low calcium media as described in the supplemental information . Scale bar = 30 μm. b. Protein expression of CRD-BP and GLI1 in UW-BCC1 determined by immunoblot analyses. β-actin was used as internal control. This is a representative of three independent experiments. c. Protein expression of keratin 5 and keratin 14 in UW-BCC1 determined by immunoblot analyses. β-actin was used as internal control. This is a representative of three independent experiments. d. Relative expression of CRD-BP, GLI1, PTCH1, and PTCH2 in mRNA isolated from UW-BCC1 and other cell lines determined by quantitative RT-PCR. e. UW-BCC1 and other cells as indicated were grown in 6 well plates and co-transfected with 8×3′GLI BS-LucII reporter plasmid and pSV-40 -galactosidase plasmid. 48 hrs after transfection, the luciferase activity was estimated using luciferase reporter assay reagent (Promega). β-galactosidase was used for normalization and estimated using β-galactosidase assay reagent (Pierce). Each experiment was done at least twice and in triplicates. Each value represents Mean+/-SD. *P≤0.05 f. UW-BCC1 was grown in two 100 mm plates and transfected with pTK-puro plasmid. Equal number of cells from each plate was seeded in five 100 mm plates. One set of plates was treated with Vismodegib (100 nM) for 72 hrs and puromycin (5 μg) for 10 days. The other set of plates was treated with puromycin (5 μg) alone for 10 days. Colonies were counted under the microscope. Each experiment was done at least twice and in triplicates. Each value represents Mean+/-SD. *P≤0.05.

Techniques Used: Cell Culture, Expressing, Isolation, Quantitative RT-PCR, Transfection, Plasmid Preparation, Luciferase, Activity Assay, Reporter Assay, Microscopy

17) Product Images from "Aberrant amino acid signaling promotes growth and metastasis of hepatocellular carcinomas through Rab1A-dependent activation of mTORC1 by Rab1A"

Article Title: Aberrant amino acid signaling promotes growth and metastasis of hepatocellular carcinomas through Rab1A-dependent activation of mTORC1 by Rab1A

Journal: Oncotarget

doi:

Rab1A is overexpressed in HCC due to copy number increase A. Correlation plot of the Rab1A copy number and mRNA level in 187 HCC samples in the TCGA cancer genome database. B. Rab1A mRNA expression in a panel of immortalized liver and HCC cell lines as determined by RT-qPCR. C. Rab1A protein expression in the same panel of immortalized liver and HCC cell lines as determined by immunoblot analysis. GAPDH served as a loading control. D. Correlation plot of Rab1A protein and mRNA expression in the above panel of cell lines. E. MSP results for HCC (MHCC97H and PLC/PRF/5) and immortalized liver (LO2 and QSG-7701) cell lines. M, methylated products of MSP; U, unmethylated products of MSP. F. Upper panel shows the CpG island used for designing primers to detect methylation status of Rab1A locus. Lower panel shows the atlas of PCR fragments for BGS. Arrows indicate potential methylated sites in the LO2 and MHCC97H cell lines. TSS, transcription start site.
Figure Legend Snippet: Rab1A is overexpressed in HCC due to copy number increase A. Correlation plot of the Rab1A copy number and mRNA level in 187 HCC samples in the TCGA cancer genome database. B. Rab1A mRNA expression in a panel of immortalized liver and HCC cell lines as determined by RT-qPCR. C. Rab1A protein expression in the same panel of immortalized liver and HCC cell lines as determined by immunoblot analysis. GAPDH served as a loading control. D. Correlation plot of Rab1A protein and mRNA expression in the above panel of cell lines. E. MSP results for HCC (MHCC97H and PLC/PRF/5) and immortalized liver (LO2 and QSG-7701) cell lines. M, methylated products of MSP; U, unmethylated products of MSP. F. Upper panel shows the CpG island used for designing primers to detect methylation status of Rab1A locus. Lower panel shows the atlas of PCR fragments for BGS. Arrows indicate potential methylated sites in the LO2 and MHCC97H cell lines. TSS, transcription start site.

Techniques Used: Expressing, Quantitative RT-PCR, Planar Chromatography, Methylation, Polymerase Chain Reaction

18) Product Images from "Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation"

Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation

Journal: Oncology Letters

doi: 10.3892/ol.2018.8291

Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.
Figure Legend Snippet: Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.

Techniques Used: Expressing, Quantitative RT-PCR, SYBR Green Assay, Amplification, Activity Assay, Real-time Polymerase Chain Reaction, Concentration Assay

19) Product Images from "Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis"

Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis

Journal: Molecular Cancer

doi: 10.1186/s12943-019-0948-8

LOXL4 expression is upregulated in HCC tissues and predicts a poor clinical outcome. a The mRNA expression level of LOXL4 in HCC tissues compared with the normal liver tissues (N) revealed using the GSE6764 dataset. b-c The mRNA expression level of LOXL4 in the non-tumorous liver (NT) and HCC tissues revealed using the GSE36376 ( b ) and GSE84402 ( c ) datasets. d The mRNA expression level of LOXL4 in 42 matched NT and HCC tissues derived from Ren Ji cohort detected by qRT-PCR. e IHC staining performed using an antibody against LOXL4 and representative photographs of the LOXL4 staining in NT and HCC tissues. (Scale bar: 100 μm). f LOXL4 expression was upregulated in 175 HCC tissues compared with NT tissues (T > N). g Comparison of overall survival of HCC patients with different LOXL4 protein expression. h Comparison of disease-free survival of HCC patients with different LOXL4 protein expression. i Overall survival analysis of HCC patients in TCGA cohort. j-k Forest plot showing the association between LOXL4 expression and HCC survival using univariate ( j ) and multivariate ( k ) analyses. (HR, hazard ratio; CI, confidence interval)
Figure Legend Snippet: LOXL4 expression is upregulated in HCC tissues and predicts a poor clinical outcome. a The mRNA expression level of LOXL4 in HCC tissues compared with the normal liver tissues (N) revealed using the GSE6764 dataset. b-c The mRNA expression level of LOXL4 in the non-tumorous liver (NT) and HCC tissues revealed using the GSE36376 ( b ) and GSE84402 ( c ) datasets. d The mRNA expression level of LOXL4 in 42 matched NT and HCC tissues derived from Ren Ji cohort detected by qRT-PCR. e IHC staining performed using an antibody against LOXL4 and representative photographs of the LOXL4 staining in NT and HCC tissues. (Scale bar: 100 μm). f LOXL4 expression was upregulated in 175 HCC tissues compared with NT tissues (T > N). g Comparison of overall survival of HCC patients with different LOXL4 protein expression. h Comparison of disease-free survival of HCC patients with different LOXL4 protein expression. i Overall survival analysis of HCC patients in TCGA cohort. j-k Forest plot showing the association between LOXL4 expression and HCC survival using univariate ( j ) and multivariate ( k ) analyses. (HR, hazard ratio; CI, confidence interval)

Techniques Used: Expressing, Derivative Assay, Quantitative RT-PCR, Immunohistochemistry, Staining

20) Product Images from "Di (2-ethylhexyl) Phthalate Exposure Impairs the microRNAs Expression Profile During Primordial Follicle Assembly"

Article Title: Di (2-ethylhexyl) Phthalate Exposure Impairs the microRNAs Expression Profile During Primordial Follicle Assembly

Journal: Frontiers in Endocrinology

doi: 10.3389/fendo.2019.00877

Verification of miRNAs expression by qRT-PCR. (A) miRNA expression of miR-32-5p, (B) miRNA expression of miR-19a-3p, (C) miRNA expression of miR-141-3p. The results are presented as mean ± SD of at least three independent experiments. ** P
Figure Legend Snippet: Verification of miRNAs expression by qRT-PCR. (A) miRNA expression of miR-32-5p, (B) miRNA expression of miR-19a-3p, (C) miRNA expression of miR-141-3p. The results are presented as mean ± SD of at least three independent experiments. ** P

Techniques Used: Expressing, Quantitative RT-PCR

21) Product Images from "MAZ mediates the cross-talk between CT-1 and NOTCH1 signaling during gliogenesis"

Article Title: MAZ mediates the cross-talk between CT-1 and NOTCH1 signaling during gliogenesis

Journal: Scientific Reports

doi: 10.1038/srep21534

CT-1 induces ADAM10 transcription through MAZ. (A) NIH3T3 cells were treated with CT-1 at different time points. Adam10 mRNA levels were determined by qRT-PCR. (B) Luciferase reporter constructs with different regions of Adam10 promoter were transfected into NIH3T3 cells. Relative luciferase activities were determined after stimulation with CT-1 or control buffer for 12 hrs. (C) After incubation with CT-1 for 24 hrs, nuclei of NIH3T3 cells were extracted and ChIP were performed with anti-MAZ antibody or IgG control followed by amplification with primers targeting the −526 to −410 bp of Adam10 promoter region. An adjacent fragment of Adam10 intron1 was included as a negative control. ‘Input’ indicates PCR amplification of total DNA. (D) The relative amount of Adam10 promoter fragments by CHIP assay in ( D ) were determined by qRT-PCR. All data represent means ± SEM (one-way ANOVA). N = 4, * p
Figure Legend Snippet: CT-1 induces ADAM10 transcription through MAZ. (A) NIH3T3 cells were treated with CT-1 at different time points. Adam10 mRNA levels were determined by qRT-PCR. (B) Luciferase reporter constructs with different regions of Adam10 promoter were transfected into NIH3T3 cells. Relative luciferase activities were determined after stimulation with CT-1 or control buffer for 12 hrs. (C) After incubation with CT-1 for 24 hrs, nuclei of NIH3T3 cells were extracted and ChIP were performed with anti-MAZ antibody or IgG control followed by amplification with primers targeting the −526 to −410 bp of Adam10 promoter region. An adjacent fragment of Adam10 intron1 was included as a negative control. ‘Input’ indicates PCR amplification of total DNA. (D) The relative amount of Adam10 promoter fragments by CHIP assay in ( D ) were determined by qRT-PCR. All data represent means ± SEM (one-way ANOVA). N = 4, * p

Techniques Used: Quantitative RT-PCR, Luciferase, Construct, Transfection, Incubation, Chromatin Immunoprecipitation, Amplification, Negative Control, Polymerase Chain Reaction

CT-1 up-regulates ADAM10 and NICD levels in NPCs and NIH3T3 cells. NPCs isolated from E11.5–13.5 mouse embryonic cortex were stimulated with CT-1 (100 ng/ml) or buffer (control, Cont) for 72 hrs, and NIH3T3 cells were stimulated with CT-1 (100 ng/ml) or buffer (control, Cont) for 24 hrs. Cell lysates were subjected to Western Blot analysis for both NICD (A) and full length NOTCH1 receptor (B) and two S2 enzymes ADAM10 (C) and ADAM17 (D) . GAPDH was used as loading control. Representative blots and statistical analysis are shown in the upper and lower panels respectively. Two downstream effectors of NOTCH1 pathway, Hes1 Hes5 were examined by qRT-PCR after CT-1 stimulation for 24 hrs in NIH3T3 cells (E) or 48 hrs in NPCs (F) . The blots were cropped to improve the clarity and conciseness and full-length blots are presented in Supplementary Fig. S3 . All data represent means ± SEM (one-way ANOVA). N ≥ 5, * p
Figure Legend Snippet: CT-1 up-regulates ADAM10 and NICD levels in NPCs and NIH3T3 cells. NPCs isolated from E11.5–13.5 mouse embryonic cortex were stimulated with CT-1 (100 ng/ml) or buffer (control, Cont) for 72 hrs, and NIH3T3 cells were stimulated with CT-1 (100 ng/ml) or buffer (control, Cont) for 24 hrs. Cell lysates were subjected to Western Blot analysis for both NICD (A) and full length NOTCH1 receptor (B) and two S2 enzymes ADAM10 (C) and ADAM17 (D) . GAPDH was used as loading control. Representative blots and statistical analysis are shown in the upper and lower panels respectively. Two downstream effectors of NOTCH1 pathway, Hes1 Hes5 were examined by qRT-PCR after CT-1 stimulation for 24 hrs in NIH3T3 cells (E) or 48 hrs in NPCs (F) . The blots were cropped to improve the clarity and conciseness and full-length blots are presented in Supplementary Fig. S3 . All data represent means ± SEM (one-way ANOVA). N ≥ 5, * p

Techniques Used: Isolation, Western Blot, Quantitative RT-PCR

22) Product Images from "Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14"

Article Title: Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14

Journal: Nucleic Acids Research

doi: 10.1093/nar/gku1382

Effect of jmj14 and NAC050/052-RNAi on H3K4me3 as determined by ChIP-seq. (A and B) Venn diagrams showing the overlap between the H3K4me3 hypermethylated genes in jmj14 and the upregulated (A) or downregulated genes (B) in jmj14 and NAC050/052-RNAi plants. (C) Box plot showing the effect of jmj14 and NAC050/052-RNAi on gene expression for 494 co-upregulated genes in jmj14 and nac050/052-RNAi . (D) H3K4me3 of the 494 overlapping upregulated genes in jmj14 and NAC050/052-RNAi plants was plotted for the transcription regions along with the 1-kb upstream and downstream flanking regions. The y -axis indicates the normalized reads number. (E) H3K4me3 hypermethylated genes identified by ChIP-seq were confirmed by ChIP-PCR in the WT, jmj14 and NAC050/052-RNAi plants. Diagrams show positions of all DNA fragments amplified in the ChIP-PCR assay. The hypermethylated sites include AT1G11540-A, AT2G18193-A and AT5G27940-A . The sites that are adjacent to the H3K4me3 hypermethylated regions were used as negative controls. These sites are AT1G11540-B, AT2G18193-B, AT5G27940-B and AT5G27940-C . Two-week-old seedlings were used for ChIP-seq and ChIP-PCR.
Figure Legend Snippet: Effect of jmj14 and NAC050/052-RNAi on H3K4me3 as determined by ChIP-seq. (A and B) Venn diagrams showing the overlap between the H3K4me3 hypermethylated genes in jmj14 and the upregulated (A) or downregulated genes (B) in jmj14 and NAC050/052-RNAi plants. (C) Box plot showing the effect of jmj14 and NAC050/052-RNAi on gene expression for 494 co-upregulated genes in jmj14 and nac050/052-RNAi . (D) H3K4me3 of the 494 overlapping upregulated genes in jmj14 and NAC050/052-RNAi plants was plotted for the transcription regions along with the 1-kb upstream and downstream flanking regions. The y -axis indicates the normalized reads number. (E) H3K4me3 hypermethylated genes identified by ChIP-seq were confirmed by ChIP-PCR in the WT, jmj14 and NAC050/052-RNAi plants. Diagrams show positions of all DNA fragments amplified in the ChIP-PCR assay. The hypermethylated sites include AT1G11540-A, AT2G18193-A and AT5G27940-A . The sites that are adjacent to the H3K4me3 hypermethylated regions were used as negative controls. These sites are AT1G11540-B, AT2G18193-B, AT5G27940-B and AT5G27940-C . Two-week-old seedlings were used for ChIP-seq and ChIP-PCR.

Techniques Used: Chromatin Immunoprecipitation, Expressing, Polymerase Chain Reaction, Amplification

JMJ14 and NAC050 bind to their common target genes. (A) JMJ14-Flag ChIP-PCR was performed to determine the occupancy of JMJ14-Flag at the common targets of JMJ14 and NAC050/052. The JMJ14–3xFlag construct was transformed and stably expressed in the WT as well as in NAC050/052-RNAi plants. (B) NAC050-Myc ChIP-PCR was performed to examine the occupancy of NAC050–3xMyc at the common targets of JMJ14 and NAC050/052. The NAC050–3xMyc construct was introduced into the WT and jmj14 plants. The expression levels of NAC050–3xMyc in the WT and jmj14 plants are equivalent. Two-week-old seedlings of each genotype were used in the ChIP-PCR assay for JMJ14-Flag and NAC-Myc. (C) The transcriptional repression activity of NAC050 was determined by the transient expression of the luciferase reporter in protoplast cells. The luciferase reporter gene was driven by the promoter sequences of AT2G18720, AT2G21640 , AT5G16020 and AT1G02580 . The 35S-NAC050 construct was transformed to determine whether the overexpression of NAC050 represses the luciferase activity. (D) The luciferase reporter gene was driven by the minimal 35S promoter with the upstream GAL4-binding site. In the effector construct, the transcriptional activator VP16 fused to the GAL4 DNA-binding domain activates the transcription of the reporter gene. Either the full-length NAC050 or truncated NAC sequences were ligated in frame with the GAL4-VP16 fusion sequence in the effector construct. The reporter construct and each of the effector constructs were co-transformed into protoplast cells for the luciferase activity assay. The experiments in this figure were biologically repeated and the same results were obtained. Showing is the results of three technical replicates from a representative experiment.
Figure Legend Snippet: JMJ14 and NAC050 bind to their common target genes. (A) JMJ14-Flag ChIP-PCR was performed to determine the occupancy of JMJ14-Flag at the common targets of JMJ14 and NAC050/052. The JMJ14–3xFlag construct was transformed and stably expressed in the WT as well as in NAC050/052-RNAi plants. (B) NAC050-Myc ChIP-PCR was performed to examine the occupancy of NAC050–3xMyc at the common targets of JMJ14 and NAC050/052. The NAC050–3xMyc construct was introduced into the WT and jmj14 plants. The expression levels of NAC050–3xMyc in the WT and jmj14 plants are equivalent. Two-week-old seedlings of each genotype were used in the ChIP-PCR assay for JMJ14-Flag and NAC-Myc. (C) The transcriptional repression activity of NAC050 was determined by the transient expression of the luciferase reporter in protoplast cells. The luciferase reporter gene was driven by the promoter sequences of AT2G18720, AT2G21640 , AT5G16020 and AT1G02580 . The 35S-NAC050 construct was transformed to determine whether the overexpression of NAC050 represses the luciferase activity. (D) The luciferase reporter gene was driven by the minimal 35S promoter with the upstream GAL4-binding site. In the effector construct, the transcriptional activator VP16 fused to the GAL4 DNA-binding domain activates the transcription of the reporter gene. Either the full-length NAC050 or truncated NAC sequences were ligated in frame with the GAL4-VP16 fusion sequence in the effector construct. The reporter construct and each of the effector constructs were co-transformed into protoplast cells for the luciferase activity assay. The experiments in this figure were biologically repeated and the same results were obtained. Showing is the results of three technical replicates from a representative experiment.

Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Construct, Transformation Assay, Stable Transfection, Expressing, Activity Assay, Luciferase, Over Expression, Binding Assay, Sequencing

23) Product Images from "Study on the expression of p53 and MMP-2 in patients with lung cancer after interventional therapy"

Article Title: Study on the expression of p53 and MMP-2 in patients with lung cancer after interventional therapy

Journal: Oncology Letters

doi: 10.3892/ol.2018.9185

Detection of mRNA expression of p53 and MMP-2 in tissue specimens of elderly patients with lung cancer before and after chemotherapy via RT-PCR. Compared with those before chemotherapy, the mRNA expression of (A) p53 and (B) MMP-2 in tissues of elderly patients with lung cancer after chemotherapy are significantly decreased; **p
Figure Legend Snippet: Detection of mRNA expression of p53 and MMP-2 in tissue specimens of elderly patients with lung cancer before and after chemotherapy via RT-PCR. Compared with those before chemotherapy, the mRNA expression of (A) p53 and (B) MMP-2 in tissues of elderly patients with lung cancer after chemotherapy are significantly decreased; **p

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

24) Product Images from "The Long Non-coding RNA MEG3/miR-let-7c-5p Axis Regulates Ethanol-Induced Hepatic Steatosis and Apoptosis by Targeting NLRC5"

Article Title: The Long Non-coding RNA MEG3/miR-let-7c-5p Axis Regulates Ethanol-Induced Hepatic Steatosis and Apoptosis by Targeting NLRC5

Journal: Frontiers in Pharmacology

doi: 10.3389/fphar.2018.00302

miR-let-7c-5p directly targets the NLRC5 gene in EtOH-induced liver injury. (A) Bioinformatics predicted miR-let-7c-5p binding sites in NLRC5 3′UTR. (B) Relative level of NLRC5 mRNA in primary hepatocytes by real-time PCR. (C) Immunohistochemical staining for NLRC5 in liver tissues 400×. (D) Luciferase reporter assay in 293T cells were co-transfected with the NLRC5-WT or mutant reporter vector in the miR-let-7c-5p binding sites and miR-let-7c-5p mimics. (E) Western blot analyses was performed to test NLRC5 expression after AML-12 cells were transfected with miR-let-7c-5p inhibitor NC, inhibitor, mimics NC or mimics. (F) Western blot analyses was performed to test NLRC5 expression. AML-12 cells were transfected with miR-let-7c-5p inhibitor or co-transfected with miR-let7c-5p inhibitor and the MEG3 siRNA. β-actin served as a loading control. Data shown are the mean ± SD from three independent experiments. ∗ P
Figure Legend Snippet: miR-let-7c-5p directly targets the NLRC5 gene in EtOH-induced liver injury. (A) Bioinformatics predicted miR-let-7c-5p binding sites in NLRC5 3′UTR. (B) Relative level of NLRC5 mRNA in primary hepatocytes by real-time PCR. (C) Immunohistochemical staining for NLRC5 in liver tissues 400×. (D) Luciferase reporter assay in 293T cells were co-transfected with the NLRC5-WT or mutant reporter vector in the miR-let-7c-5p binding sites and miR-let-7c-5p mimics. (E) Western blot analyses was performed to test NLRC5 expression after AML-12 cells were transfected with miR-let-7c-5p inhibitor NC, inhibitor, mimics NC or mimics. (F) Western blot analyses was performed to test NLRC5 expression. AML-12 cells were transfected with miR-let-7c-5p inhibitor or co-transfected with miR-let7c-5p inhibitor and the MEG3 siRNA. β-actin served as a loading control. Data shown are the mean ± SD from three independent experiments. ∗ P

Techniques Used: Binding Assay, Real-time Polymerase Chain Reaction, Immunohistochemistry, Staining, Luciferase, Reporter Assay, Transfection, Mutagenesis, Plasmid Preparation, Western Blot, Expressing

25) Product Images from "Propofol protects against endotoxin-induced myocardial injury by inhibiting NF-κB-mediated inflammation"

Article Title: Propofol protects against endotoxin-induced myocardial injury by inhibiting NF-κB-mediated inflammation

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2017.5605

Graphic representation of NF-κB mRNA expression levels via qRT-PCR in the three groups. NF-κB mRNA expression levels in the model and propofol groups are significantly increased compared with those in the control group (**P
Figure Legend Snippet: Graphic representation of NF-κB mRNA expression levels via qRT-PCR in the three groups. NF-κB mRNA expression levels in the model and propofol groups are significantly increased compared with those in the control group (**P

Techniques Used: Expressing, Quantitative RT-PCR

26) Product Images from "Genome-wide analysis of RNAs associated with Populus euphratica Oliv. heterophyll morphogenesis"

Article Title: Genome-wide analysis of RNAs associated with Populus euphratica Oliv. heterophyll morphogenesis

Journal: Scientific Reports

doi: 10.1038/s41598-018-35371-x

qPCR validation and RNase R resistance test. ( a ) Sequencing results. *P
Figure Legend Snippet: qPCR validation and RNase R resistance test. ( a ) Sequencing results. *P

Techniques Used: Real-time Polymerase Chain Reaction, Sequencing

27) Product Images from "Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression"

Article Title: Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2018.9760

3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P
Figure Legend Snippet: 3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P

Techniques Used: Western Blot, Expressing, Real-time Polymerase Chain Reaction

28) Product Images from "Long noncoding RNA H19 promotes transforming growth factor-β-induced epithelial–mesenchymal transition by acting as a competing endogenous RNA of miR-370-3p in ovarian cancer cells"

Article Title: Long noncoding RNA H19 promotes transforming growth factor-β-induced epithelial–mesenchymal transition by acting as a competing endogenous RNA of miR-370-3p in ovarian cancer cells

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S149908

The effects of the miR-370-3p knockdown or overexpression on the role of H19 in TGF-β1-induced EMT. SKOV-3 and OVCAR3 cells were pretransfected with H19 siRNA plus the NC inhibitor, H19 siRNA plus the miR-370-3p inhibitor, H19 overexpression vector pcDNA-H19 plus the NC miRNA mimic, or pcDNA-H19 plus the miR-370-3p mimic, followed by treatment with 5 ng/mL of TGF-β1 for 48 h. The morphological change of SKOV-3 ( A ) and OVCAR3 cells ( B ) was detected under a light microscope (100× and 400×). The mRNA expression profiles of Snail, E-cadherin, and vimentin in SKOV-3 ( C ) and OVCAR3 cells ( D ) were determined by qRT-PCR. The expression profiles of Snail, E-cadherin, and vimentin in SKOV-3 ( E ) and OVCAR3 cells ( F ) were characterized by Western blotting (left: a representative graph, right: statistical results of Western blot quantification). The qRT-PCR and Western blot assays were performed in triplicate, and data are expressed as mean ± SD, * P
Figure Legend Snippet: The effects of the miR-370-3p knockdown or overexpression on the role of H19 in TGF-β1-induced EMT. SKOV-3 and OVCAR3 cells were pretransfected with H19 siRNA plus the NC inhibitor, H19 siRNA plus the miR-370-3p inhibitor, H19 overexpression vector pcDNA-H19 plus the NC miRNA mimic, or pcDNA-H19 plus the miR-370-3p mimic, followed by treatment with 5 ng/mL of TGF-β1 for 48 h. The morphological change of SKOV-3 ( A ) and OVCAR3 cells ( B ) was detected under a light microscope (100× and 400×). The mRNA expression profiles of Snail, E-cadherin, and vimentin in SKOV-3 ( C ) and OVCAR3 cells ( D ) were determined by qRT-PCR. The expression profiles of Snail, E-cadherin, and vimentin in SKOV-3 ( E ) and OVCAR3 cells ( F ) were characterized by Western blotting (left: a representative graph, right: statistical results of Western blot quantification). The qRT-PCR and Western blot assays were performed in triplicate, and data are expressed as mean ± SD, * P

Techniques Used: Over Expression, Plasmid Preparation, Light Microscopy, Expressing, Quantitative RT-PCR, Western Blot

29) Product Images from "HOTAIR regulates HK2 expression by binding endogenous miR-125 and miR-143 in oesophageal squamous cell carcinoma progression"

Article Title: HOTAIR regulates HK2 expression by binding endogenous miR-125 and miR-143 in oesophageal squamous cell carcinoma progression

Journal: Oncotarget

doi: 10.18632/oncotarget.21195

Identification of potential HOTAIR-targeting miRNAs (A) Schematic representation of the binding sites between the miRNAs and HOTAIR. (B) Luciferase activity in HEK293T cells cotransfected with miR-let7g/130a/143/145*/203/125 mimics and luciferase reporters containing control vector and HOTAIR. (C) The relative RNA level was detected in the substrate of a RIP assay by qRT-PCR. Triplicate experiments were analysed, and the mean±SD is shown; * p
Figure Legend Snippet: Identification of potential HOTAIR-targeting miRNAs (A) Schematic representation of the binding sites between the miRNAs and HOTAIR. (B) Luciferase activity in HEK293T cells cotransfected with miR-let7g/130a/143/145*/203/125 mimics and luciferase reporters containing control vector and HOTAIR. (C) The relative RNA level was detected in the substrate of a RIP assay by qRT-PCR. Triplicate experiments were analysed, and the mean±SD is shown; * p

Techniques Used: Binding Assay, Luciferase, Activity Assay, Plasmid Preparation, Quantitative RT-PCR

30) Product Images from "Epstein-Barr Virus MicroRNA miR-BART20-5p Suppresses Lytic Induction by Inhibiting BAD-Mediated caspase-3-Dependent Apoptosis"

Article Title: Epstein-Barr Virus MicroRNA miR-BART20-5p Suppresses Lytic Induction by Inhibiting BAD-Mediated caspase-3-Dependent Apoptosis

Journal: Journal of Virology

doi: 10.1128/JVI.02794-15

Effect of LNA-miR-BART20-5p(i) and siBAD on BRLF1 , BZLF1 , and BAD expression. AGS-EBV cells were transfected with 50 nM control LNA, LNA-miR-BART20-5p(i), or LNA-miR-BART20-5p(i) plus siBAD. After 24 h, the cells were treated with 5 nM TPA for 48 h and then harvested for RNA and protein preparation. (A) Real-time RT-PCR analysis of BRLF1 , BZLF1 , and BAD was carried out by using a SYBR green qPCR kit. The RT-PCR results from three independent experiments were normalized to GAPDH levels and are expressed as ratios relative to the values obtained from control LNA-transfected cells. (B) BRLF1, BZLF1, and BAD protein levels were analyzed by Western blot analysis. (C) Western blot results similar to those shown in panel B were obtained by using two additional sets of independently transfected AGS-EBV cells. Western blot results were normalized to α- tubulin values and are expressed as ratios relative to the values obtained from control LNA-transfected cells. Mean values from all three experiments are plotted. Error bars indicate SD ( n = 3). *, P
Figure Legend Snippet: Effect of LNA-miR-BART20-5p(i) and siBAD on BRLF1 , BZLF1 , and BAD expression. AGS-EBV cells were transfected with 50 nM control LNA, LNA-miR-BART20-5p(i), or LNA-miR-BART20-5p(i) plus siBAD. After 24 h, the cells were treated with 5 nM TPA for 48 h and then harvested for RNA and protein preparation. (A) Real-time RT-PCR analysis of BRLF1 , BZLF1 , and BAD was carried out by using a SYBR green qPCR kit. The RT-PCR results from three independent experiments were normalized to GAPDH levels and are expressed as ratios relative to the values obtained from control LNA-transfected cells. (B) BRLF1, BZLF1, and BAD protein levels were analyzed by Western blot analysis. (C) Western blot results similar to those shown in panel B were obtained by using two additional sets of independently transfected AGS-EBV cells. Western blot results were normalized to α- tubulin values and are expressed as ratios relative to the values obtained from control LNA-transfected cells. Mean values from all three experiments are plotted. Error bars indicate SD ( n = 3). *, P

Techniques Used: Expressing, Transfection, Quantitative RT-PCR, SYBR Green Assay, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot

31) Product Images from "Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells"

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0031708

QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.
Figure Legend Snippet: QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

32) Product Images from "MicroRNA-24 inhibits the proliferation and migration of endothelial cells in patients with atherosclerosis by targeting importin-α3 and regulating inflammatory responses"

Article Title: MicroRNA-24 inhibits the proliferation and migration of endothelial cells in patients with atherosclerosis by targeting importin-α3 and regulating inflammatory responses

Journal: Experimental and Therapeutic Medicine

doi: 10.3892/etm.2017.5355

Effect of miR-24 on the expression of importin-α3 in HUVECs. (A) Relative expression of miR-24, (B) importin-α3 mRNA and (C and D) importin-α3 protein in HUVECs from the negative control and miR-24 mimic groups. Reverse transcription-quantitative polymerase chain reaction was used to determine the expression of miR-24 and importin-α3 mRNA, and western blotting was employed to measure importin-α3 protein expression. *P
Figure Legend Snippet: Effect of miR-24 on the expression of importin-α3 in HUVECs. (A) Relative expression of miR-24, (B) importin-α3 mRNA and (C and D) importin-α3 protein in HUVECs from the negative control and miR-24 mimic groups. Reverse transcription-quantitative polymerase chain reaction was used to determine the expression of miR-24 and importin-α3 mRNA, and western blotting was employed to measure importin-α3 protein expression. *P

Techniques Used: Expressing, Negative Control, Real-time Polymerase Chain Reaction, Western Blot

Effect of miR-24 on the expression of TNF-α in HUVECs. (A) Relative expression of TNF-α mRNA in HUVECs of negative control and miR-24 mimic groups. (B and C) Relative expression of TNF-α protein in HUVECs of negative control and miR-24 mimic groups. Reverse transcription-quantitative polymerase chain reaction was used to determine the expression of TNF-α mRNA, and western blotting was employed to measure TNF-α protein expression. *P
Figure Legend Snippet: Effect of miR-24 on the expression of TNF-α in HUVECs. (A) Relative expression of TNF-α mRNA in HUVECs of negative control and miR-24 mimic groups. (B and C) Relative expression of TNF-α protein in HUVECs of negative control and miR-24 mimic groups. Reverse transcription-quantitative polymerase chain reaction was used to determine the expression of TNF-α mRNA, and western blotting was employed to measure TNF-α protein expression. *P

Techniques Used: Expressing, Negative Control, Real-time Polymerase Chain Reaction, Western Blot

Expression of miR-24 in peripheral blood from healthy control subjects and patients with atherosclerosis. Expression of miR-24 was determined by reverse transcription-quantitative polymerase chain reaction. *P
Figure Legend Snippet: Expression of miR-24 in peripheral blood from healthy control subjects and patients with atherosclerosis. Expression of miR-24 was determined by reverse transcription-quantitative polymerase chain reaction. *P

Techniques Used: Expressing, Real-time Polymerase Chain Reaction

33) Product Images from "Profiling of Differentially Expressed Genes Using Suppression Subtractive Hybridization in an Equine Model of Chronic Asthma"

Article Title: Profiling of Differentially Expressed Genes Using Suppression Subtractive Hybridization in an Equine Model of Chronic Asthma

Journal: PLoS ONE

doi: 10.1371/journal.pone.0029440

Evaluation of subtraction efficiency. A: Reduction of GAPDH cDNA following subtraction in the SH-Ctls sample. PCR was performed on SH-Ctls subtracted and SH unsubtracted samples. GAPDH PCR products (760 pb) were detectable 10 cycles earlier in the unsubtracted sample (18 cycles) than in the subtracted sample (28 cycles). B: Enrichment of LCN2 cDNA following subtraction in the SH-Ctls sample. PCR was performed on SH-Ctls and Ctls-SH subtracted samples as well as SH and Ctls unsubtracted samples. LCN2 PCR products (210 pb) were detected after 20 cycles for both SH unsubtracted and SH-Ctls subtracted samples, the difference in the intensity of the 2 bands indicate the enrichment compare to Ctls unsubtracted and Ctls-SH subtracted samples.
Figure Legend Snippet: Evaluation of subtraction efficiency. A: Reduction of GAPDH cDNA following subtraction in the SH-Ctls sample. PCR was performed on SH-Ctls subtracted and SH unsubtracted samples. GAPDH PCR products (760 pb) were detectable 10 cycles earlier in the unsubtracted sample (18 cycles) than in the subtracted sample (28 cycles). B: Enrichment of LCN2 cDNA following subtraction in the SH-Ctls sample. PCR was performed on SH-Ctls and Ctls-SH subtracted samples as well as SH and Ctls unsubtracted samples. LCN2 PCR products (210 pb) were detected after 20 cycles for both SH unsubtracted and SH-Ctls subtracted samples, the difference in the intensity of the 2 bands indicate the enrichment compare to Ctls unsubtracted and Ctls-SH subtracted samples.

Techniques Used: Polymerase Chain Reaction

34) Product Images from "P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression"

Article Title: P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression

Journal: Cell Death & Disease

doi: 10.1038/cddis.2014.201

The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P

Techniques Used: In Vivo, Transfection, Injection, Mouse Assay, Quantitative RT-PCR, Expressing, Histopathology, Staining, Immunohistochemistry

TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P

Techniques Used: Binding Assay, Quantitative RT-PCR, Expressing, Transfection, Western Blot, Immunohistochemistry, Positive Control, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitation Assay

p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P

Techniques Used: Expressing, Quantitative RT-PCR, Mutagenesis, Chromatin Immunoprecipitation, Western Blot, Over Expression, Activity Assay, Binding Assay

Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P
Figure Legend Snippet: Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P

Techniques Used: Expressing, Quantitative RT-PCR

TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P

Techniques Used: MTT Assay, Cotransfection, Transfection, Flow Cytometry, Cytometry, Quantitative RT-PCR, Expressing, Over Expression, Western Blot, Immunostaining

35) Product Images from "Single-cell landscape of immunological responses in COVID-19 patients"

Article Title: Single-cell landscape of immunological responses in COVID-19 patients

Journal: bioRxiv

doi: 10.1101/2020.07.23.217703

Study design and single-cell transcriptional profiling of PBMCs from healthy donors and COVID-19 patients. a , A schematic showing the overall study design. Single-cell RNA sequencing was applied to peripheral blood mononuclear cells across four conditions, and the output data were used for TCR and BCR profiling and expression analyses. b , Timeline of the course of disease for 13 SARS-CoV-2 infected patients enrolled in our study. RT-qPCR indicates polymerase chain reaction test for SARS-CoV-2 nucleic acids. RT-qPCR positive indicate nasopharyngeal or sputum samples positive for SARS-CoV-2 nucleic acids. The color bars in the most left representing conditions with the same color in ( a ). c , Cellular populations identified. The UMAP projection of 122,542 single cells from HD (n=5), Moderate (n=7), Severe (n=4) and Conv (n=6) samples, showing the formation of 14 clusters with the respective labels. Each dot corresponds to a single cell, colored according to cell types. d , Canonical cell markers were used to label clusters by cell identity as represented in the UMAP plot. Colored according to expression levels and legend labeled in log scale. e , Violin plots showing the expression distribution of selected canonical cell markers in the 14 clusters. Row representing selected marker genes and column representing clusters with the same color in ( c ).
Figure Legend Snippet: Study design and single-cell transcriptional profiling of PBMCs from healthy donors and COVID-19 patients. a , A schematic showing the overall study design. Single-cell RNA sequencing was applied to peripheral blood mononuclear cells across four conditions, and the output data were used for TCR and BCR profiling and expression analyses. b , Timeline of the course of disease for 13 SARS-CoV-2 infected patients enrolled in our study. RT-qPCR indicates polymerase chain reaction test for SARS-CoV-2 nucleic acids. RT-qPCR positive indicate nasopharyngeal or sputum samples positive for SARS-CoV-2 nucleic acids. The color bars in the most left representing conditions with the same color in ( a ). c , Cellular populations identified. The UMAP projection of 122,542 single cells from HD (n=5), Moderate (n=7), Severe (n=4) and Conv (n=6) samples, showing the formation of 14 clusters with the respective labels. Each dot corresponds to a single cell, colored according to cell types. d , Canonical cell markers were used to label clusters by cell identity as represented in the UMAP plot. Colored according to expression levels and legend labeled in log scale. e , Violin plots showing the expression distribution of selected canonical cell markers in the 14 clusters. Row representing selected marker genes and column representing clusters with the same color in ( c ).

Techniques Used: RNA Sequencing Assay, Expressing, Infection, Quantitative RT-PCR, Polymerase Chain Reaction, Labeling, Marker

36) Product Images from "Long non-coding RNA CCAT1 promotes gallbladder cancer development via negative modulation of miRNA-218-5p"

Article Title: Long non-coding RNA CCAT1 promotes gallbladder cancer development via negative modulation of miRNA-218-5p

Journal: Cell Death & Disease

doi: 10.1038/cddis.2014.541

The underlying mechanism of the negative regulation of miRNA-218-5p by CCAT1. ( a ) Effect of CCAT1 on mature miRNA-218-5p, pri-miRNA-218-5p and pre-miRNA-218-5p. ( b ) NOZ cells were transfected with pcDNA3.1 or pcDNA3.1-Dicer, or si-NC or si-CCAT1 for 48 h, and western blot analysis was performed. ( c and d ) NOZ cells were cotransfected with pcDNA3.1-Dicer and pcDNA3.1-CCAT1 or si-CCAT1. Forty-eight hours after transfection, cells were collected. Mature miRNA-218-5p ( c ) and pre-miRNA-218-5p ( d ) were analyzed by qRT-PCR. ( e ) Pull-down of Ago2 by biotin-labeled CCAT1 or loc285194 RNA probe, as detected by western blotting. The loc285194 lane was composed from the same gel with the same contrast. Empty vector (Beads) was used as a negative control. Loc285194 was used as a positive control. ( f and g ) RIP followed by microRNA qRT-PCR to detect microRNAs endogenously associated with CCAT1 and loc285194. The expression level of miRNA was normalized to that in empty vector (Beads). Error bars represent the mean±S.D. of triplicate experiments. * P
Figure Legend Snippet: The underlying mechanism of the negative regulation of miRNA-218-5p by CCAT1. ( a ) Effect of CCAT1 on mature miRNA-218-5p, pri-miRNA-218-5p and pre-miRNA-218-5p. ( b ) NOZ cells were transfected with pcDNA3.1 or pcDNA3.1-Dicer, or si-NC or si-CCAT1 for 48 h, and western blot analysis was performed. ( c and d ) NOZ cells were cotransfected with pcDNA3.1-Dicer and pcDNA3.1-CCAT1 or si-CCAT1. Forty-eight hours after transfection, cells were collected. Mature miRNA-218-5p ( c ) and pre-miRNA-218-5p ( d ) were analyzed by qRT-PCR. ( e ) Pull-down of Ago2 by biotin-labeled CCAT1 or loc285194 RNA probe, as detected by western blotting. The loc285194 lane was composed from the same gel with the same contrast. Empty vector (Beads) was used as a negative control. Loc285194 was used as a positive control. ( f and g ) RIP followed by microRNA qRT-PCR to detect microRNAs endogenously associated with CCAT1 and loc285194. The expression level of miRNA was normalized to that in empty vector (Beads). Error bars represent the mean±S.D. of triplicate experiments. * P

Techniques Used: Transfection, Western Blot, Quantitative RT-PCR, Labeling, Plasmid Preparation, Negative Control, Positive Control, Expressing

37) Product Images from "Bacillus subtilis and surfactin inhibit the transmissible gastroenteritis virus from entering the intestinal epithelial cells"

Article Title: Bacillus subtilis and surfactin inhibit the transmissible gastroenteritis virus from entering the intestinal epithelial cells

Journal: Bioscience Reports

doi: 10.1042/BSR20170082

Suppress activity of B.subtilis or surfactin. Cells were exposed to B. subtilis 168, OKB105 and surfactin in different treatments as described above. For the indicated time points, cells were collected and the yield of virus was determined by qRT-PCR ( A ) and Western blotting ( B ). (B) Lane 1, TGEV control; lane 2, virus from cells treated with 0.002 mg/ml surfactin; lane 3, virus from cells treated with 1.00E + 07 cfu/ml B. subtilis 168; lane 4, virus from cells treated with 1.00E + 07 cfu/ml B. subtilis OKB105; lane 5, mock. ( C ) Mean relative protein ratio of TGEV-N. Blots were reported with antibody to GAPDH as a loading control. The mean ± S.D. from three independent experiments are shown. Significance levels for the differences between B. subtilis and surfactin treatments and virus control from untreated cells are given above the bar: * P
Figure Legend Snippet: Suppress activity of B.subtilis or surfactin. Cells were exposed to B. subtilis 168, OKB105 and surfactin in different treatments as described above. For the indicated time points, cells were collected and the yield of virus was determined by qRT-PCR ( A ) and Western blotting ( B ). (B) Lane 1, TGEV control; lane 2, virus from cells treated with 0.002 mg/ml surfactin; lane 3, virus from cells treated with 1.00E + 07 cfu/ml B. subtilis 168; lane 4, virus from cells treated with 1.00E + 07 cfu/ml B. subtilis OKB105; lane 5, mock. ( C ) Mean relative protein ratio of TGEV-N. Blots were reported with antibody to GAPDH as a loading control. The mean ± S.D. from three independent experiments are shown. Significance levels for the differences between B. subtilis and surfactin treatments and virus control from untreated cells are given above the bar: * P

Techniques Used: Activity Assay, Quantitative RT-PCR, Western Blot

38) Product Images from "Effects of Gui Zhi Ma Huang Ge Ban Tang on the TLR7 Pathway in Influenza Virus Infected Mouse Lungs in a Cold Environment"

Article Title: Effects of Gui Zhi Ma Huang Ge Ban Tang on the TLR7 Pathway in Influenza Virus Infected Mouse Lungs in a Cold Environment

Journal: Evidence-based Complementary and Alternative Medicine : eCAM

doi: 10.1155/2018/5939720

Relative protein expression of TLR7, NF- κ B p65, and MyD88 (a): A: normal control, B: virus control; C: oseltamivir, D: yinqiaosan, E: Gui Zhi Ma Huang Ge Ban Tang, and F: xinjiaxiangruyin. Protein expression of TLR7 (b), MyD88 (c), and NF- κ B p65 (d). ∗∗ p
Figure Legend Snippet: Relative protein expression of TLR7, NF- κ B p65, and MyD88 (a): A: normal control, B: virus control; C: oseltamivir, D: yinqiaosan, E: Gui Zhi Ma Huang Ge Ban Tang, and F: xinjiaxiangruyin. Protein expression of TLR7 (b), MyD88 (c), and NF- κ B p65 (d). ∗∗ p

Techniques Used: Expressing

mRNA expression of TLR7 (a), NF- κ B p65 (b), and MyD88 (c) in the mouse lung tissue. ∗∗ p
Figure Legend Snippet: mRNA expression of TLR7 (a), NF- κ B p65 (b), and MyD88 (c) in the mouse lung tissue. ∗∗ p

Techniques Used: Expressing

39) Product Images from "Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells"

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0031708

QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.
Figure Legend Snippet: QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

40) Product Images from "Roles of Long Non-Coding RNA CCAT2 in Cervical Cancer Cell Growth and Apoptosis"

Article Title: Roles of Long Non-Coding RNA CCAT2 in Cervical Cancer Cell Growth and Apoptosis

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.897754

Relative expression of CCAT2 in 3 cervical cancer cell lines was carried out by qRT-PCR ( A ). Knockdown effects of siRNA CCAT2 in HeLa cell line ( B ). CCK8 assay to test the function of lncRNA CCAT2. Downregulation of CCAT2 inhibited HeLa cells growth ( C ). Statistical analyses were performed with the independent samples t test. All data are shown as the mean ±SD.
Figure Legend Snippet: Relative expression of CCAT2 in 3 cervical cancer cell lines was carried out by qRT-PCR ( A ). Knockdown effects of siRNA CCAT2 in HeLa cell line ( B ). CCK8 assay to test the function of lncRNA CCAT2. Downregulation of CCAT2 inhibited HeLa cells growth ( C ). Statistical analyses were performed with the independent samples t test. All data are shown as the mean ±SD.

Techniques Used: Expressing, Quantitative RT-PCR, CCK-8 Assay

Related Articles

Clone Assay:

Article Title: Immunogenicity evaluation of MS2 phage-mediated chimeric nanoparticle displaying an immunodominant B cell epitope of foot-and-mouth disease virus
Article Snippet: .. The cDNA of encoding AP and CP sequences of MS2 were reversely transcribed from MS2 genome mRNAs (purchased from Sigma) by primers MS2-F and MS2-R using a One-Step RT-PCR Kit (TaKaRa, Shiga, Japan) and cloned into T-Vector pMD™ 19 (Simple). .. The recombinant plasmid was named as T-MS2.

Amplification:

Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways
Article Snippet: .. Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan). .. The following PCR conditions were applied: Nrf2 and HO-1, 35 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 15 s extending at 72°C for 1 min, and β -actin, 25 cycles of denaturation at 94°C for 30 s and annealing at 60°C for 30 s extending at 72°C for 30 s. The PCR products were subjected to horizontal electrophoresis on 0.8% agarose gels, and images were captured in a Bio-Rad ChemiDoc imaging system (Hercules, CA, USA).

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Isolation:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Infection:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways
Article Snippet: .. Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan). .. The following PCR conditions were applied: Nrf2 and HO-1, 35 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 15 s extending at 72°C for 1 min, and β -actin, 25 cycles of denaturation at 94°C for 30 s and annealing at 60°C for 30 s extending at 72°C for 30 s. The PCR products were subjected to horizontal electrophoresis on 0.8% agarose gels, and images were captured in a Bio-Rad ChemiDoc imaging system (Hercules, CA, USA).

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock
Article Snippet: .. Then, 1 μg of DNA‐free total RNA was reverse transcribed by use of a one‐step RT‐PCR kit (TaKaRa Bio, Shiga, Japan). .. The following sequence‐specific primers were synthesized: 5′‐GGTTGATGGTTCGTGGGGATGTTG‐3′ and 5′‐AAGGCAAAGACACTGCCCTGTTGG‐3′ for mouse PGRN; 5′‐GAAAAGCAAGCAGCCAACCA‐3′ and 5′‐CGGATCATGCTTTCTGTGCTC‐3′ for mouse tumour necrosis factor α (TNF‐α); 5′‐CTGCAGCTGGAGAGTGTGG‐3′ and 5′‐GGGGAACTCTGCAGACTCAA‐3′ for mouse IL‐1β; 5′‐AGTTGCCTTCTTGGGACTGA‐3′ and 5′‐TCCACGATTTCCCAGAGAAC‐3′ for mouse IL‐6; 5′‐GGTTGCCAAGCCTTATCGGA‐3′ and 5′‐ACCTGCTCCACTGCCTTGCT‐3′ for mouse IL‐10; 5′‐GGCTGTATTCCCCTCCATCG‐3′ and 5′‐CCAGTTGGTAACAATGCCATGT‐3′ for mouse β‐actin; 5′‐CCTCTCTCTAATCAGCCCTCTG‐3′ and 5′‐GAGGACCTGGGAGTAGATGAG‐3′ for human TNF‐α; 5′‐ATGATGGCTTATTACAGTGGCAA‐3′ and 5′‐GTCGGAGATTCGTAGCTGGA‐3′ for human IL‐1β; 5′‐ACTCACCTCTTCAGAACGAATTG‐3′ and 5′‐CCATCTTTGGAAGGTTCAGGTTG‐3′ for human IL‐6; 5′‐CAGCCAGATGCAATCAATGCC‐3′ and 5′‐TGGAATCCTGAACCCACTTCT‐3′ for human monocyte chemoattractant protein 1 (MCP‐1); and 5′‐GAAGTGTGACGTGGACATCC‐3′ and 5′‐CCGATCCACACGGAGTACTT‐3′ for human β‐actin.

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus
Article Snippet: .. One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China). .. The reaction mixture includes: 2 × one-step RT-PCR Buffer III, 12.5 µl; TaKaRa Ex Taq HS (5 U/µl), 0.5 µl; Prime Script RT Enzyme Mix II, 0.5 µl; PCR forward primer (10 µM), 0.5 µl; PCR reverse primer (10 µM), 0.5 µl; probe (10 µM), 0.5 µl; total RNA, 2 µg; RNase free H2 O, added to 20 µl.

Article Title: Immunogenicity evaluation of MS2 phage-mediated chimeric nanoparticle displaying an immunodominant B cell epitope of foot-and-mouth disease virus
Article Snippet: .. The cDNA of encoding AP and CP sequences of MS2 were reversely transcribed from MS2 genome mRNAs (purchased from Sigma) by primers MS2-F and MS2-R using a One-Step RT-PCR Kit (TaKaRa, Shiga, Japan) and cloned into T-Vector pMD™ 19 (Simple). .. The recombinant plasmid was named as T-MS2.

Article Title: Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14
Article Snippet: .. The RNA was treated with DNase to remove DNA contamination and subjected to quantitative RT-PCR using a one-step RT-PCR kit (Takara, RR018A). ..

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Article Title: Development of a low resource RNA extraction cassette based on surface tension valves
Article Snippet: .. Reactions were performed in a 25 μL volume using 5 μL of RNA template and the Clontech one-step RT-PCR kit according to manufacturer’s instructions. .. Thermal cycling consisted of 48 °C for 20 minutes to synthesize cDNA, 95 °C for 3 minutes to inactivate the reverse transcriptase and activate QTaq DNA polymerase, and 40 cycles of 95 °C for 15 s and 60 °C for 60 s using a Rotor-Gene Q thermal cycler (Qiagen, Germantown, MD).

Quantitative RT-PCR:

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus
Article Snippet: .. One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China). .. The reaction mixture includes: 2 × one-step RT-PCR Buffer III, 12.5 µl; TaKaRa Ex Taq HS (5 U/µl), 0.5 µl; Prime Script RT Enzyme Mix II, 0.5 µl; PCR forward primer (10 µM), 0.5 µl; PCR reverse primer (10 µM), 0.5 µl; probe (10 µM), 0.5 µl; total RNA, 2 µg; RNase free H2 O, added to 20 µl.

Article Title: Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14
Article Snippet: .. The RNA was treated with DNase to remove DNA contamination and subjected to quantitative RT-PCR using a one-step RT-PCR kit (Takara, RR018A). ..

Expressing:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Polymerase Chain Reaction:

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa one step rt pcr kit
    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible <t>RNA</t> ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ <t>PCR</t> analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P
    One Step Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr kit/product/TaKaRa
    Average 99 stars, based on 286 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    90
    TaKaRa rt qpcr kits
    Expression of <t>mdig</t> mRNA in NCI-H1650 cells detected via <t>RT-qPCR.</t> In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p
    Rt Qpcr Kits, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt qpcr kits/product/TaKaRa
    Average 90 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    rt qpcr kits - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock

    doi: 10.1111/jcmm.12756

    Figure Lengend Snippet: PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Article Snippet: Then, 1 μg of DNA‐free total RNA was reverse transcribed by use of a one‐step RT‐PCR kit (TaKaRa Bio, Shiga, Japan).

    Techniques: Injection, Enzyme-linked Immunosorbent Assay, Western Blot, RNA Binding Assay, Mouse Assay, Staining, Quantitative RT-PCR

    Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways

    doi: 10.1155/2017/3159358

    Figure Lengend Snippet: Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Article Snippet: Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan).

    Techniques: Polymerase Chain Reaction

    Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Journal: PLoS ONE

    Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus

    doi: 10.1371/journal.pone.0110911

    Figure Lengend Snippet: Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Article Snippet: One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China).

    Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Fluorescence, Cell Culture

    Expression of mdig mRNA in NCI-H1650 cells detected via RT-qPCR. In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p

    Journal: Oncology Letters

    Article Title: Effects of mdig on proliferation and apoptosis of lung cancer cells

    doi: 10.3892/ol.2018.9528

    Figure Lengend Snippet: Expression of mdig mRNA in NCI-H1650 cells detected via RT-qPCR. In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p

    Article Snippet: Materials Materials used in the study were: NCI-H1650 human lung cancer cells (Cell Bank of the Chinese Academy of Sciences, Shanghai, China); Dulbecco's modified Eagle's medium (DMEM) and fetal bovine serum (Hyclone, Logan, UT, USA); TRIzol kits and Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA); bicinchoninic acid (BCA) protein quantification kits and cell lysis buffer (Beyotime Biotechnology, Nantong, China); reverse transcription kits, RT-qPCR kits, primer syntheses, mdig siRNA, and negative control siRNA (N-siRNA) (Takara, Dalian, China); mdig, cleaved caspase-3, cleaved poly (ADP-ribose) polymerase 1 (PARP1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primary antibodies, and horseradish peroxidase (HRP)-labeled secondary antibodies (Proteintech Group, Inc., Wuhan, China); cycle detection kits and Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kits (Beyotime Biotechnology, Nantong, China).

    Techniques: Expressing, Quantitative RT-PCR