Structured Review

TaKaRa plasma mir 149
Plasma expression levels of <t>miR-149,</t> miR-424 and miR-765 in non-CAD patients, stable CAD patients and unstable CAD patients.
Plasma Mir 149, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 4204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasma mir 149/product/TaKaRa
Average 88 stars, based on 4204 article reviews
Price from $9.99 to $1999.99
plasma mir 149 - by Bioz Stars, 2020-09
88/100 stars

Images

1) Product Images from "The diagnostic value of circulating microRNAs for middle-aged (40–60-year-old) coronary artery disease patients"

Article Title: The diagnostic value of circulating microRNAs for middle-aged (40–60-year-old) coronary artery disease patients

Journal: Clinics

doi: 10.6061/clinics/2015(04)07

Plasma expression levels of miR-149, miR-424 and miR-765 in non-CAD patients, stable CAD patients and unstable CAD patients.
Figure Legend Snippet: Plasma expression levels of miR-149, miR-424 and miR-765 in non-CAD patients, stable CAD patients and unstable CAD patients.

Techniques Used: Expressing

Diagnostic accuracy of circulating miR-149, miR-424 and miR-765 were analyzed by ROC curve. A) ROC curve of miR-149, non-CAD patients vs. CAD. B) ROC curve of miR-149, non-CAD patients vs. unstable CAD patients. C) ROC curve of miR-149, CAD vs. unstable CAD patients. D) ROC curve of miR-424, non-CAD patients vs. CAD. E) ROC curve of miR-424, non-CAD patients vs. unstable CAD patients. F) ROC curve of miR-424, CAD vs. unstable CAD patients. G) ROC curve of miR-765, non-CAD patients vs. CAD. H) ROC curve of miR-765, non-CAD patients vs. unstable CAD patients. I) ROC curve of miR-765, CAD vs. unstable CAD patients.
Figure Legend Snippet: Diagnostic accuracy of circulating miR-149, miR-424 and miR-765 were analyzed by ROC curve. A) ROC curve of miR-149, non-CAD patients vs. CAD. B) ROC curve of miR-149, non-CAD patients vs. unstable CAD patients. C) ROC curve of miR-149, CAD vs. unstable CAD patients. D) ROC curve of miR-424, non-CAD patients vs. CAD. E) ROC curve of miR-424, non-CAD patients vs. unstable CAD patients. F) ROC curve of miR-424, CAD vs. unstable CAD patients. G) ROC curve of miR-765, non-CAD patients vs. CAD. H) ROC curve of miR-765, non-CAD patients vs. unstable CAD patients. I) ROC curve of miR-765, CAD vs. unstable CAD patients.

Techniques Used: Diagnostic Assay

2) Product Images from "Bisphenol A Exposure Enhances Atherosclerosis in WHHL Rabbits"

Article Title: Bisphenol A Exposure Enhances Atherosclerosis in WHHL Rabbits

Journal: PLoS ONE

doi: 10.1371/journal.pone.0110977

ELISA analysis of serum cytokines levels in WHHL rabbits. (A) TNF-α serum concentrations at 0 and 12 weeks. (B) IL-6 serum concentrations at 0 and 12 weeks. Data are expressed as the means ± SD, n = 6 for each group. * p
Figure Legend Snippet: ELISA analysis of serum cytokines levels in WHHL rabbits. (A) TNF-α serum concentrations at 0 and 12 weeks. (B) IL-6 serum concentrations at 0 and 12 weeks. Data are expressed as the means ± SD, n = 6 for each group. * p

Techniques Used: Enzyme-linked Immunosorbent Assay

3) Product Images from "Down-regulation of microRNA-216b inhibits IL-1β-induced chondrocyte injury by up-regulation of Smad3"

Article Title: Down-regulation of microRNA-216b inhibits IL-1β-induced chondrocyte injury by up-regulation of Smad3

Journal: Bioscience Reports

doi: 10.1042/BSR20160588

Effects of miR-216 on IL-1β-induced inhibition of aggrecan and type II collagen synthesis in SW1353 cells SW1353 cells were treated with IL-1β (5 ng/ml) for 24 h after transfection with miR-216b mimic or inhibitor. The mRNA levels of aggrecan and type II collagen were determined by qRT-PCR. The data shown are mean ± S.E.M., n =4; ** P
Figure Legend Snippet: Effects of miR-216 on IL-1β-induced inhibition of aggrecan and type II collagen synthesis in SW1353 cells SW1353 cells were treated with IL-1β (5 ng/ml) for 24 h after transfection with miR-216b mimic or inhibitor. The mRNA levels of aggrecan and type II collagen were determined by qRT-PCR. The data shown are mean ± S.E.M., n =4; ** P

Techniques Used: Inhibition, Transfection, Quantitative RT-PCR

Smad3 was involved in the effects of miR-216b on IL-1β-induced cartilage degradation in SW1353 cells SW1353 cells were transfected with either miR-216b inhibitor or si-Smad3, and then treated with IL-1β (5 ng/ml) for 24 h. ( A ) The mRNA and protein levels of Smad3 were determined by qRT-PCR or Western blot respectively. Smad3 expression was normalized to β-actin. ( B ) Cell proliferation was assessed by BrdU-ELISA assay. ( C ) The mRNA levels of aggrecan, type II collagen, and MMP-13 were determined by qRT-PCR. β-Actin was detected as a loading control. All data are presented as mean ± S.E.M., n =4; ** P
Figure Legend Snippet: Smad3 was involved in the effects of miR-216b on IL-1β-induced cartilage degradation in SW1353 cells SW1353 cells were transfected with either miR-216b inhibitor or si-Smad3, and then treated with IL-1β (5 ng/ml) for 24 h. ( A ) The mRNA and protein levels of Smad3 were determined by qRT-PCR or Western blot respectively. Smad3 expression was normalized to β-actin. ( B ) Cell proliferation was assessed by BrdU-ELISA assay. ( C ) The mRNA levels of aggrecan, type II collagen, and MMP-13 were determined by qRT-PCR. β-Actin was detected as a loading control. All data are presented as mean ± S.E.M., n =4; ** P

Techniques Used: Transfection, Quantitative RT-PCR, Western Blot, Expressing, Enzyme-linked Immunosorbent Assay

4) Product Images from "Overexpression of DUSP6 enhances chemotherapy-resistance of ovarian epithelial cancer by regulating the ERK signaling pathway"

Article Title: Overexpression of DUSP6 enhances chemotherapy-resistance of ovarian epithelial cancer by regulating the ERK signaling pathway

Journal: Journal of Cancer

doi: 10.7150/jca.37267

DUSP6 increases cell viability when treated with cisplatin. (a) MTS was used to measure cell viability and determine the IC50 value of cisplatin in SKOV3, OVCAR8 and HO8910 cell lines. (b) Expression level of DUSP6 mRNA. *** and ** indicate statistically significant differences, P
Figure Legend Snippet: DUSP6 increases cell viability when treated with cisplatin. (a) MTS was used to measure cell viability and determine the IC50 value of cisplatin in SKOV3, OVCAR8 and HO8910 cell lines. (b) Expression level of DUSP6 mRNA. *** and ** indicate statistically significant differences, P

Techniques Used: Expressing

Differential expression of DUSP6 and G0/G1 cell cycle checkpoint regulating protein (CyclinD1, CyclinD3, CyclinE2) in SP and NSP cells. qRT-PCR was used to assess the expression level of DUSP6 (a), CyclinD1 (b,left) and CyclinD3 (b,right). Both SKOV3 and OVCAR8 cells, left and right panels in (a) respectively, were tested for DUSP6. Expression was assessed in SP, NSP, and original populations. *** indicates statistically significant difference (P
Figure Legend Snippet: Differential expression of DUSP6 and G0/G1 cell cycle checkpoint regulating protein (CyclinD1, CyclinD3, CyclinE2) in SP and NSP cells. qRT-PCR was used to assess the expression level of DUSP6 (a), CyclinD1 (b,left) and CyclinD3 (b,right). Both SKOV3 and OVCAR8 cells, left and right panels in (a) respectively, were tested for DUSP6. Expression was assessed in SP, NSP, and original populations. *** indicates statistically significant difference (P

Techniques Used: Expressing, Quantitative RT-PCR

5) Product Images from "A retrospective study of NENs and miR-224 promotes apoptosis of BON-1 cells by targeting PCSK9 inhibition"

Article Title: A retrospective study of NENs and miR-224 promotes apoptosis of BON-1 cells by targeting PCSK9 inhibition

Journal: Oncotarget

doi: 10.18632/oncotarget.14322

miR-224 down-regulates PCSK9 expression by directly targeting its 3′-UTR A . PCSK9 expression was increased in tissue samples of p-NENs. Immunohistochemistry of PCSK9 in tumor and para-tumor samples from patients with NENs (n=6, 3 males and 3 females). There was almost non-staining of PCSK9 in the para-tumor samples, while strong staining of PCSK9 in tumor samples. B . RNA sequence alignment showed the 3′-UTR of PCSK9 mRNA contains a complementary site for miR-224. Dual luciferase reporter assay was performed to confirm the miR-224 binding target. C, D . RT-PCR analysis showed that the miR-224 expression was up-regulated and PCSK9 expression was down-regulated in BON-1 cells upon miR-224 transfection at mRNA levels. E . western blot analysis showed that the endogenous PCSK9 expression was significantly reduced at protein level followed by increased expression of cleaved caspase-3 upon miR-224 agomir or siPCSK9 transfection.
Figure Legend Snippet: miR-224 down-regulates PCSK9 expression by directly targeting its 3′-UTR A . PCSK9 expression was increased in tissue samples of p-NENs. Immunohistochemistry of PCSK9 in tumor and para-tumor samples from patients with NENs (n=6, 3 males and 3 females). There was almost non-staining of PCSK9 in the para-tumor samples, while strong staining of PCSK9 in tumor samples. B . RNA sequence alignment showed the 3′-UTR of PCSK9 mRNA contains a complementary site for miR-224. Dual luciferase reporter assay was performed to confirm the miR-224 binding target. C, D . RT-PCR analysis showed that the miR-224 expression was up-regulated and PCSK9 expression was down-regulated in BON-1 cells upon miR-224 transfection at mRNA levels. E . western blot analysis showed that the endogenous PCSK9 expression was significantly reduced at protein level followed by increased expression of cleaved caspase-3 upon miR-224 agomir or siPCSK9 transfection.

Techniques Used: Expressing, Immunohistochemistry, Staining, Sequencing, Luciferase, Reporter Assay, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Transfection, Western Blot

6) Product Images from "Altered Expression of TXNIP in the peripheral leukocytes of patients with coronary atherosclerotic heart disease"

Article Title: Altered Expression of TXNIP in the peripheral leukocytes of patients with coronary atherosclerotic heart disease

Journal: Medicine

doi: 10.1097/MD.0000000000009108

The mRNA expression levels of TXNIP gene of peripheral leucocytes in patients and healthy controls. The mRNA levels of TXNIP gene were normalized to β-actin , which was used as an internal control. Data were expressed as means ± SD. ∗ P
Figure Legend Snippet: The mRNA expression levels of TXNIP gene of peripheral leucocytes in patients and healthy controls. The mRNA levels of TXNIP gene were normalized to β-actin , which was used as an internal control. Data were expressed as means ± SD. ∗ P

Techniques Used: Expressing

The sensitivity and specificity of the RT-qPCR and western blot were compared using the receiver operating characteristic (ROC) curves. Area under the curve (AUC) for the level of thioredoxin interacting protein (TXNIP) mRNA was significantly higher than protein levels (AUCmRNA = 0.791, AUCProtein = 0.656, P
Figure Legend Snippet: The sensitivity and specificity of the RT-qPCR and western blot were compared using the receiver operating characteristic (ROC) curves. Area under the curve (AUC) for the level of thioredoxin interacting protein (TXNIP) mRNA was significantly higher than protein levels (AUCmRNA = 0.791, AUCProtein = 0.656, P

Techniques Used: Quantitative RT-PCR, Western Blot

7) Product Images from "Tomato leaf curl Yunnan virus-encoded C4 induces cell division through enhancing stability of Cyclin D 1.1 via impairing NbSKη -mediated phosphorylation in Nicotiana benthamiana"

Article Title: Tomato leaf curl Yunnan virus-encoded C4 induces cell division through enhancing stability of Cyclin D 1.1 via impairing NbSKη -mediated phosphorylation in Nicotiana benthamiana

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1006789

NbSKη- silenced N . benthamiana plants display the phenotype similar to N . benthamiana plants infected by PVX-C4. (A and B) qRT-PCR (A) and western blot (B) assays of NbSKη gene expression in wild-type (WT) and NbSKη -silenced plants. Relative accumulation level of NbSKη transcripts is normalized against the amount of actin transcript. Error bar denotes the standard deviation of three biological replicates. (C) Growth of the wild-type (WT), mock (TRV-GFP) and NbSKη -silenced (TRV- NbSKη ) N . benthamiana plants at 35 dpi. (D) The leaf petioles of NbSKη- silenced N . benthamiana leave mimics that of N . benthamiana leave inoculated with PVX-C4. The phenotype of 1st-5th leaves of plants under different treatments was shown. (E) The petiole length of the 3rd leaf of plants under different treatments. Each treatment had fifteen plants at the same developmental stage. ** represent significant difference (P value
Figure Legend Snippet: NbSKη- silenced N . benthamiana plants display the phenotype similar to N . benthamiana plants infected by PVX-C4. (A and B) qRT-PCR (A) and western blot (B) assays of NbSKη gene expression in wild-type (WT) and NbSKη -silenced plants. Relative accumulation level of NbSKη transcripts is normalized against the amount of actin transcript. Error bar denotes the standard deviation of three biological replicates. (C) Growth of the wild-type (WT), mock (TRV-GFP) and NbSKη -silenced (TRV- NbSKη ) N . benthamiana plants at 35 dpi. (D) The leaf petioles of NbSKη- silenced N . benthamiana leave mimics that of N . benthamiana leave inoculated with PVX-C4. The phenotype of 1st-5th leaves of plants under different treatments was shown. (E) The petiole length of the 3rd leaf of plants under different treatments. Each treatment had fifteen plants at the same developmental stage. ** represent significant difference (P value

Techniques Used: Infection, Quantitative RT-PCR, Western Blot, Expressing, Standard Deviation, Significance Assay

Key sites of TLCYnV C4 vital for its interaction with NbSKη. (A) Schematic representation of the truncated mutants of TLCYnV C4 and the C4 mini-domain associated with the interaction. Yeast strain Gold co-transformed with the indicated plasmids were subjected to 10-fold serial dilutions, and grown on a SD/-Leu/-Trp/-His/-Ade medium. (B) Key points of TLCYnV C4 important for the interaction. Yeast strain Gold co-transformed with the indicated plasmids were subjected to 10-fold serial dilutions, and grown on a SD/-Leu/-Trp/-His/-Ade medium. (C) Western blot analysis of C4 wild-type and mutant proteins in systemic leaves of the infected plants. C4 and PVX CP proteins were detected using TLCYnV C4 and PVX-CP specific polyclonal antibodies. Rubisco was the loading control. (D) Symptoms in N . benthamiana plants infected with PVX-based vector harboring C4 or C4 mutant (P32A, P33A, N34A, T35A or T36A). Photographs were taken at 8 dpi. Arrowheads indicate the symptoms induced by PVX-C4.
Figure Legend Snippet: Key sites of TLCYnV C4 vital for its interaction with NbSKη. (A) Schematic representation of the truncated mutants of TLCYnV C4 and the C4 mini-domain associated with the interaction. Yeast strain Gold co-transformed with the indicated plasmids were subjected to 10-fold serial dilutions, and grown on a SD/-Leu/-Trp/-His/-Ade medium. (B) Key points of TLCYnV C4 important for the interaction. Yeast strain Gold co-transformed with the indicated plasmids were subjected to 10-fold serial dilutions, and grown on a SD/-Leu/-Trp/-His/-Ade medium. (C) Western blot analysis of C4 wild-type and mutant proteins in systemic leaves of the infected plants. C4 and PVX CP proteins were detected using TLCYnV C4 and PVX-CP specific polyclonal antibodies. Rubisco was the loading control. (D) Symptoms in N . benthamiana plants infected with PVX-based vector harboring C4 or C4 mutant (P32A, P33A, N34A, T35A or T36A). Photographs were taken at 8 dpi. Arrowheads indicate the symptoms induced by PVX-C4.

Techniques Used: Transformation Assay, Western Blot, Mutagenesis, Infection, Plasmid Preparation

TLCYnV directs NbSKη to cytoplasmic membrane. (A) Subcellular localization of C4-GFP or GFP-NbSKη fusion protein in N . benthamiana epidermal cells. GFP-tagged proteins were expressed in the transgenic N . benthamiana plants expressing the nucleus marker H2B-RFP (2–4 rows), or in the N . benthamiana plants expressing the cytoplasmic membrane marker (first row). Scale bar = 50 μm. (B) Subcellular fractionation of C4-GFP, GFP, and PIP2A-DsRed. Plant tissues expressing C4-GFP, GFP, or PIP2A-DsRed were fractionated into soluble (S) and membrane-enriched (P) fractions. GFP and PIP2A-DsRed acted as the markers of soluble fraction and membrane-enriched fraction, respectively. 3K, the extracts following centrifugation at 3,000 g ; 30K, the extracts following centrifugation at 30,000 g . (C) Membrane flotation assays of GFP-NbSKη, GFP, and PIP2A-DsRed. GFP-NbSKη and PIP2A-DsRed were detected using monoclonal antibodies specifically against GFP and RFP, respectively. (D) BiFC analysis of C4/NbSKη interaction position in epidermal cells of H2B-RFP transgenic N . benthamiana plants. Scale bar = 50 μm. (E) Distribution patterns of GFP-NbSKη in the presence of CFP or C4-CFP expressed in the H2B-RFP transgenic N . benthamiana epidermal cells. Scale bar = 50 μm. (F) Membrane flotation assays of plant extracts expressing CFP alone or co-expressing GFP-NbSKη with CFP or C4-CFP. CFP, C4-CFP, and GFP-NbSKη were detected using a rabbit monoclonal antibody raised against GFP. (G) Subcellular fractionation of plant tissues prepared from N . benthamiana plants expressing GFP-NbSKη with CFP or C4-CFP.
Figure Legend Snippet: TLCYnV directs NbSKη to cytoplasmic membrane. (A) Subcellular localization of C4-GFP or GFP-NbSKη fusion protein in N . benthamiana epidermal cells. GFP-tagged proteins were expressed in the transgenic N . benthamiana plants expressing the nucleus marker H2B-RFP (2–4 rows), or in the N . benthamiana plants expressing the cytoplasmic membrane marker (first row). Scale bar = 50 μm. (B) Subcellular fractionation of C4-GFP, GFP, and PIP2A-DsRed. Plant tissues expressing C4-GFP, GFP, or PIP2A-DsRed were fractionated into soluble (S) and membrane-enriched (P) fractions. GFP and PIP2A-DsRed acted as the markers of soluble fraction and membrane-enriched fraction, respectively. 3K, the extracts following centrifugation at 3,000 g ; 30K, the extracts following centrifugation at 30,000 g . (C) Membrane flotation assays of GFP-NbSKη, GFP, and PIP2A-DsRed. GFP-NbSKη and PIP2A-DsRed were detected using monoclonal antibodies specifically against GFP and RFP, respectively. (D) BiFC analysis of C4/NbSKη interaction position in epidermal cells of H2B-RFP transgenic N . benthamiana plants. Scale bar = 50 μm. (E) Distribution patterns of GFP-NbSKη in the presence of CFP or C4-CFP expressed in the H2B-RFP transgenic N . benthamiana epidermal cells. Scale bar = 50 μm. (F) Membrane flotation assays of plant extracts expressing CFP alone or co-expressing GFP-NbSKη with CFP or C4-CFP. CFP, C4-CFP, and GFP-NbSKη were detected using a rabbit monoclonal antibody raised against GFP. (G) Subcellular fractionation of plant tissues prepared from N . benthamiana plants expressing GFP-NbSKη with CFP or C4-CFP.

Techniques Used: Transgenic Assay, Expressing, Marker, Fractionation, Centrifugation, Bimolecular Fluorescence Complementation Assay

TLCYnV C4 induces the abnormal cell division through NbSKη-mediated BR pathway in N . benthamiana . (A) The phenotype of 35S :: TLCYnV C4 transgenic A . thaliana (left panel) or N . benthamiana (right panel) plants. (B) Callus-like tissues could be found on the stem of 35S :: TLCYnV C4 transgenic N . benthamiana plants. (C) Root and leaf callus formation in wild-type (WT) and 35S :: TLCYnV C4 ( 35S :: C4 ) transgenic N . benthamiana plants. The leaves of 14-day-old plants and the roots of 12-day-old plants were cut off and transferred on MS medium containing 100 ng/L 2,4-D and 300 ng/L kinetin (KT). Photographs were taken 14 days later. (D) The influence of BL or BRZ on the average number of callus-like tissue per leaf. (E) Leaf phenotype of WT, TRV-GFP inoculated, or TRV- NbSKη inoculated ( NbSKη- silenced) plants. Arrows indicate the callus-like tissues. (F) Leaf phenotype of WT, 35S :: C4 , or NbSKη -RNAi transgenic N . benthamiana plants. Arrows indicate the callus-like tissues. (G) Root phenotype of WT, 35S :: C4 , or NbSKη -RNAi transgenic N . benthamiana plants. Circles indicate the callus-like tissues. The plants were grown on MS medium, photographs were taken at 14 days after sowing. (H) Meristem size of 14-day-old WT, 35S :: C4 transgenic, or NbSKη -RNAi transgenic N . benthamiana plants. Arrowheads indicate the boundary between the proximal meristem and the elongation zone of the root. Scale bar = 50 μm. (I) The phenotype of N . benthamiana mature leaves inoculated with PVX, PVX-C4, or PVX-C4 mutants at 21 dpi. Arrows indicate the callus-like tissues. (J) Flow cytometric analysis of the cell ploidy under different treatments. (K) The cell percentage of different phase distribution in 35S :: C4 transgenic N . benthamiana plants, or N . benthamiana plants inoculated with TLCYnV. * represents significant difference (P value
Figure Legend Snippet: TLCYnV C4 induces the abnormal cell division through NbSKη-mediated BR pathway in N . benthamiana . (A) The phenotype of 35S :: TLCYnV C4 transgenic A . thaliana (left panel) or N . benthamiana (right panel) plants. (B) Callus-like tissues could be found on the stem of 35S :: TLCYnV C4 transgenic N . benthamiana plants. (C) Root and leaf callus formation in wild-type (WT) and 35S :: TLCYnV C4 ( 35S :: C4 ) transgenic N . benthamiana plants. The leaves of 14-day-old plants and the roots of 12-day-old plants were cut off and transferred on MS medium containing 100 ng/L 2,4-D and 300 ng/L kinetin (KT). Photographs were taken 14 days later. (D) The influence of BL or BRZ on the average number of callus-like tissue per leaf. (E) Leaf phenotype of WT, TRV-GFP inoculated, or TRV- NbSKη inoculated ( NbSKη- silenced) plants. Arrows indicate the callus-like tissues. (F) Leaf phenotype of WT, 35S :: C4 , or NbSKη -RNAi transgenic N . benthamiana plants. Arrows indicate the callus-like tissues. (G) Root phenotype of WT, 35S :: C4 , or NbSKη -RNAi transgenic N . benthamiana plants. Circles indicate the callus-like tissues. The plants were grown on MS medium, photographs were taken at 14 days after sowing. (H) Meristem size of 14-day-old WT, 35S :: C4 transgenic, or NbSKη -RNAi transgenic N . benthamiana plants. Arrowheads indicate the boundary between the proximal meristem and the elongation zone of the root. Scale bar = 50 μm. (I) The phenotype of N . benthamiana mature leaves inoculated with PVX, PVX-C4, or PVX-C4 mutants at 21 dpi. Arrows indicate the callus-like tissues. (J) Flow cytometric analysis of the cell ploidy under different treatments. (K) The cell percentage of different phase distribution in 35S :: C4 transgenic N . benthamiana plants, or N . benthamiana plants inoculated with TLCYnV. * represents significant difference (P value

Techniques Used: Transgenic Assay, Mass Spectrometry, Flow Cytometry, Significance Assay

TLCYnV C4 inhibits proteasomal degradation of NbCycD1;1 by interacting with NbSKη. (A) The protein and transcript levels of NbCycD1;1 in wild-type (WT) and 35S :: C4 transgenic N . benthamiana plants. Upper panel shows the protein level of NbCycD1;1 and lower panel shows transcript level of NbCycD1;1 in wild-type and 35S :: C4 transgenic N . benthamiana plants. (B) Time-course analysis of the NbCycD1;1 protein level in N . benthamiana plants inoculated with PVX or PVX-C4 at different time points. (C) Time-course analysis of the NbCycD1;1 transcript level in N . benthamiana plants inoculated with PVX or PVX-C4 at different time points. (D) Western blot analysis of the stability of GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants by semi- in vivo assays. (E) Tricine SDS-PAGE analysis of the accumulation of phosphorylated/nonphosphorylated GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants with or without NbSKη. (F) Tricine SDS-PAGE analysis of the stability of GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants. (G) Western blot analysis of the satbility of GFP-NbCycD1;1 in N . benthamiana tissues co-expressing GFP-NbCycD1;1 with GFP or C4-GFP by semi- in vivo assays. (H) Western blot analysis of the stability of GFP-NbCycD1;1 in N . benthamiana tissues co-expressing GFP-NbCycD1;1 with C4-GFP or C4(T35A)-GFP by semi- in vivo assays.
Figure Legend Snippet: TLCYnV C4 inhibits proteasomal degradation of NbCycD1;1 by interacting with NbSKη. (A) The protein and transcript levels of NbCycD1;1 in wild-type (WT) and 35S :: C4 transgenic N . benthamiana plants. Upper panel shows the protein level of NbCycD1;1 and lower panel shows transcript level of NbCycD1;1 in wild-type and 35S :: C4 transgenic N . benthamiana plants. (B) Time-course analysis of the NbCycD1;1 protein level in N . benthamiana plants inoculated with PVX or PVX-C4 at different time points. (C) Time-course analysis of the NbCycD1;1 transcript level in N . benthamiana plants inoculated with PVX or PVX-C4 at different time points. (D) Western blot analysis of the stability of GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants by semi- in vivo assays. (E) Tricine SDS-PAGE analysis of the accumulation of phosphorylated/nonphosphorylated GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants with or without NbSKη. (F) Tricine SDS-PAGE analysis of the stability of GFP-NbCycD1;1 in WT and 35S :: C4 transgenic N . benthamiana plants. (G) Western blot analysis of the satbility of GFP-NbCycD1;1 in N . benthamiana tissues co-expressing GFP-NbCycD1;1 with GFP or C4-GFP by semi- in vivo assays. (H) Western blot analysis of the stability of GFP-NbCycD1;1 in N . benthamiana tissues co-expressing GFP-NbCycD1;1 with C4-GFP or C4(T35A)-GFP by semi- in vivo assays.

Techniques Used: Transgenic Assay, Western Blot, In Vivo, SDS Page, Expressing

Phosphorylation of NbCycD1;1 mediated by NbSKη promotes NbCycD1;1 degradation via 26S proteasome. (A) Detection of the stability of GFP or GFP-NbCycD1;1 protein by semi- in vivo assays. GFP or GFP-NbCycD1;1 protein was analyzed with anti-GFP antibody at different time points after CHX treatment in the presence or absence of ATP. (B) Detection of the stability of GST or GST-NbCycD1;1 protein by in vitro assays. Purified GST or GST-NbCycD1;1 was mixed with additive volumes of fresh plant extract and then diminishing volumes of elution buffer were added for the identical concentration of fusion proteins at 25°C for 2h. GST or GST-NbCycD1;1 protein level was analyzed with anti-GST antibody. (C and D) Tris SDS-PAGE (C) or Tricine SDS-PAGE (D) analysis of the influence of NbCycD1;1 phosphorylation mediated by NbSKη on NbCycD1;1 stability by semi- in vivo assays. (E) Detection of the influence of NbCycD1;1 phosphorylation mediated by NbSKη on NbCycD1;1 stability by in vitro assays. (F) The phosphorylation level of NbCycD1;1 or NbCycD1;1 (T328A) by NbSKη in vitro . ** indicates His-NbSKη. * represents the substrate of NbSKη. (G) Western blot analysis of stability of GFP-NbCycD1;1, GFP-NbCycD1;1 (T328A), or GFP by semi- in vivo assays. (H) Western blot analysis of the protein level of NbSKη in wild-type (WT) or NbSKη- RNAi plants. (I) Western blot analysis of the stability of GFP-NbCycD1;1 in WT or NbSKη- RNAi N . benthamiana plants by semi- in vivo assays. (J) Effect of MG132 on the stability of GFP-NbCycD1;1 protein by semi- in vivo assays. GFP-NbCycD1;1 protein levels were analyzed with anti-GFP antibody at different time points after 100 μM CHX and 20 mM ATP treatments in the presence of 100 μM MG132 or an equal volume of DMSO (control). (K) Effect of BL on the stability of GFP-NbCycD1;1 protein in semi- in vivo assays.
Figure Legend Snippet: Phosphorylation of NbCycD1;1 mediated by NbSKη promotes NbCycD1;1 degradation via 26S proteasome. (A) Detection of the stability of GFP or GFP-NbCycD1;1 protein by semi- in vivo assays. GFP or GFP-NbCycD1;1 protein was analyzed with anti-GFP antibody at different time points after CHX treatment in the presence or absence of ATP. (B) Detection of the stability of GST or GST-NbCycD1;1 protein by in vitro assays. Purified GST or GST-NbCycD1;1 was mixed with additive volumes of fresh plant extract and then diminishing volumes of elution buffer were added for the identical concentration of fusion proteins at 25°C for 2h. GST or GST-NbCycD1;1 protein level was analyzed with anti-GST antibody. (C and D) Tris SDS-PAGE (C) or Tricine SDS-PAGE (D) analysis of the influence of NbCycD1;1 phosphorylation mediated by NbSKη on NbCycD1;1 stability by semi- in vivo assays. (E) Detection of the influence of NbCycD1;1 phosphorylation mediated by NbSKη on NbCycD1;1 stability by in vitro assays. (F) The phosphorylation level of NbCycD1;1 or NbCycD1;1 (T328A) by NbSKη in vitro . ** indicates His-NbSKη. * represents the substrate of NbSKη. (G) Western blot analysis of stability of GFP-NbCycD1;1, GFP-NbCycD1;1 (T328A), or GFP by semi- in vivo assays. (H) Western blot analysis of the protein level of NbSKη in wild-type (WT) or NbSKη- RNAi plants. (I) Western blot analysis of the stability of GFP-NbCycD1;1 in WT or NbSKη- RNAi N . benthamiana plants by semi- in vivo assays. (J) Effect of MG132 on the stability of GFP-NbCycD1;1 protein by semi- in vivo assays. GFP-NbCycD1;1 protein levels were analyzed with anti-GFP antibody at different time points after 100 μM CHX and 20 mM ATP treatments in the presence of 100 μM MG132 or an equal volume of DMSO (control). (K) Effect of BL on the stability of GFP-NbCycD1;1 protein in semi- in vivo assays.

Techniques Used: In Vivo, In Vitro, Purification, Concentration Assay, SDS Page, Western Blot

Immuno-cytochemistry and immunoblot analysis of the nuclear-localized accumulation of NbSKη under different treatments. (A) Analysis of nuclear-localized NbSKη accumulation through immuno-cytochemistry and electron microscopy. Thin sections were prepared from N . benthamiana leaf tissues under different treatments. All the sections were probed with anti-GSK3β polyclonal antibody followed by a protein A-gold conjugate. Scale bar = 0.2 μm. (B) Average number of gold particles per 0.25 um 2 in three randomly selected nuclei in sections from various treatments. ** represents significant difference (P value
Figure Legend Snippet: Immuno-cytochemistry and immunoblot analysis of the nuclear-localized accumulation of NbSKη under different treatments. (A) Analysis of nuclear-localized NbSKη accumulation through immuno-cytochemistry and electron microscopy. Thin sections were prepared from N . benthamiana leaf tissues under different treatments. All the sections were probed with anti-GSK3β polyclonal antibody followed by a protein A-gold conjugate. Scale bar = 0.2 μm. (B) Average number of gold particles per 0.25 um 2 in three randomly selected nuclei in sections from various treatments. ** represents significant difference (P value

Techniques Used: Immunocytochemistry, Electron Microscopy, Significance Assay

8) Product Images from "TM4SF1 Promotes Metastasis of Pancreatic Cancer via Regulating the Expression of DDR1"

Article Title: TM4SF1 Promotes Metastasis of Pancreatic Cancer via Regulating the Expression of DDR1

Journal: Scientific Reports

doi: 10.1038/srep45895

TM4SF1 regulates DDR1 expression and interacts with DDR1. ( A , B ) the mRNA and protein expression levels of TM4SF1 and DDR1 were detected by qRT-PCR and western bolt analysis. The mRNA and protein expression levels of DDR1 decreased significantly in PANC-1 and AsPC-1 after transfected with siTM4SF1. **P
Figure Legend Snippet: TM4SF1 regulates DDR1 expression and interacts with DDR1. ( A , B ) the mRNA and protein expression levels of TM4SF1 and DDR1 were detected by qRT-PCR and western bolt analysis. The mRNA and protein expression levels of DDR1 decreased significantly in PANC-1 and AsPC-1 after transfected with siTM4SF1. **P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Transfection

TM4SF1 is necessary for invadopodia formation and function. ( A , B ) qRT-PCR and Western blot were used to detect the expression of TM4SF1 when PANC-1 and AsPC-1 cells were transfected with siCtrl or siTM4SF1. ( C ) PANC-1 cells transfected with siCtrl or siTM4SF1 were stained with DAPI, phalloidin, and cortactin. Quantification of percentage of cells with invadopodia decreased after silencing TM4SF1 in PANC-1. *P
Figure Legend Snippet: TM4SF1 is necessary for invadopodia formation and function. ( A , B ) qRT-PCR and Western blot were used to detect the expression of TM4SF1 when PANC-1 and AsPC-1 cells were transfected with siCtrl or siTM4SF1. ( C ) PANC-1 cells transfected with siCtrl or siTM4SF1 were stained with DAPI, phalloidin, and cortactin. Quantification of percentage of cells with invadopodia decreased after silencing TM4SF1 in PANC-1. *P

Techniques Used: Quantitative RT-PCR, Western Blot, Expressing, Transfection, Staining

TM4SF1 correlates with DDR1 expression in specimens of pancreatic cancer. ( A , B ) TM4SF1 and DDR1 expression levels in twenty pairs of pancreatic cancer tissue samples were detected by qRT-PCR. TM4SF1 and DDR1 mRNA expression levels were both higher expressed in pancreatic cancer tissues compared with adjacent non-tumor samples. ( C ) scatter plots showed a positive correlation between TM4SF1 and DDR1 at mRNA expression level in pancreatic cancer.
Figure Legend Snippet: TM4SF1 correlates with DDR1 expression in specimens of pancreatic cancer. ( A , B ) TM4SF1 and DDR1 expression levels in twenty pairs of pancreatic cancer tissue samples were detected by qRT-PCR. TM4SF1 and DDR1 mRNA expression levels were both higher expressed in pancreatic cancer tissues compared with adjacent non-tumor samples. ( C ) scatter plots showed a positive correlation between TM4SF1 and DDR1 at mRNA expression level in pancreatic cancer.

Techniques Used: Expressing, Quantitative RT-PCR

9) Product Images from "Homocysteine activates autophagy by inhibition of CFTR expression via interaction between DNA methylation and H3K27me3 in mouse liver"

Article Title: Homocysteine activates autophagy by inhibition of CFTR expression via interaction between DNA methylation and H3K27me3 in mouse liver

Journal: Cell Death & Disease

doi: 10.1038/s41419-017-0216-z

Hcy-induced elevation of EZH2 is responsible for CFTR promoter H3K27me3. Eight to 10 weeks old cystathionine b-synthase ( CBS ) heterozygous knockout mice ( CBS +/− ) were fed with regular mice chow and water ad libitum. Human hepatocytes HL-7702 were treated with L-Hcy and adenovirus harboring EZH2 small interfering RNA (si-EZH2) respectively for 24 h. a The H3K27me1, 2, 3 levels on the CFTR promoter were examined in liver of mice by ChIP-PCR. b The levels of H3K27me3 on the CFTR promoter were examined by ChIP-PCR in hepatocytes treated with 100μmol/L Hcy and 100 μmol/L Hcy plus 10 μmol/L EPZ005687. c The H3K27me3 levels in the CFTR promoter of hepatocytes treated with different concentration of agonist of H3K27me3 (1, 5, 10 μmol/L EPZ005687). d , e qRT-PCR and western blot were used to detect the mRNA and protein expression of CFTR in the hepatic cells treated with 10 μmol/L EPZ005687 and 100 μmol/L Hcy plus 10 μmol/L EPZ005687. f , g The mRNA and protein expression of EZH2 were detected by qRT-PCR and western blot in HL-7702 cells exposed to 100μmol/L Hcy for 24 h. ( H - I ) The mRNA and protein expression of EZH2 were detected by qRT-PCR and western blot in hepatic cells infected with adenovirus si-EZH2. ( J ) The level of H3K27me3 on CFTR promoter were detected by ChIP-PCR in hepatic cells infected with adenovirus si-EZH2. ( K ) The mRNA and protein expression of CFTR were detected by western blot in hepatic cells infected with adenovirus si-EZH2. ( L ) The protein expression of autophagy related protein factors p62, BECN1, LC3 and Atg12 were detected by western blot in hepatocytes infected with adenovirus (Ad-CFTR, si-EZH2, Ad-CFTR and si-EZH2). Mean ± SD of three experiments performed in triplicate. * P
Figure Legend Snippet: Hcy-induced elevation of EZH2 is responsible for CFTR promoter H3K27me3. Eight to 10 weeks old cystathionine b-synthase ( CBS ) heterozygous knockout mice ( CBS +/− ) were fed with regular mice chow and water ad libitum. Human hepatocytes HL-7702 were treated with L-Hcy and adenovirus harboring EZH2 small interfering RNA (si-EZH2) respectively for 24 h. a The H3K27me1, 2, 3 levels on the CFTR promoter were examined in liver of mice by ChIP-PCR. b The levels of H3K27me3 on the CFTR promoter were examined by ChIP-PCR in hepatocytes treated with 100μmol/L Hcy and 100 μmol/L Hcy plus 10 μmol/L EPZ005687. c The H3K27me3 levels in the CFTR promoter of hepatocytes treated with different concentration of agonist of H3K27me3 (1, 5, 10 μmol/L EPZ005687). d , e qRT-PCR and western blot were used to detect the mRNA and protein expression of CFTR in the hepatic cells treated with 10 μmol/L EPZ005687 and 100 μmol/L Hcy plus 10 μmol/L EPZ005687. f , g The mRNA and protein expression of EZH2 were detected by qRT-PCR and western blot in HL-7702 cells exposed to 100μmol/L Hcy for 24 h. ( H - I ) The mRNA and protein expression of EZH2 were detected by qRT-PCR and western blot in hepatic cells infected with adenovirus si-EZH2. ( J ) The level of H3K27me3 on CFTR promoter were detected by ChIP-PCR in hepatic cells infected with adenovirus si-EZH2. ( K ) The mRNA and protein expression of CFTR were detected by western blot in hepatic cells infected with adenovirus si-EZH2. ( L ) The protein expression of autophagy related protein factors p62, BECN1, LC3 and Atg12 were detected by western blot in hepatocytes infected with adenovirus (Ad-CFTR, si-EZH2, Ad-CFTR and si-EZH2). Mean ± SD of three experiments performed in triplicate. * P

Techniques Used: Knock-Out, Mouse Assay, Small Interfering RNA, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Concentration Assay, Quantitative RT-PCR, Western Blot, Expressing, Infection

Interaction between DNA methylation and histone methylation in CFTR promoter. Human hepatocytes HL-7702 were treated with Hcy or infected with adenovirus vector (si-DNMT1 and si-EZH2) for 24 h. a – c The DNA methylation of CFTR was detected by BSP after the hepatocytes were treated with 5-azacytidine, an inhibitor of DNA methyltransferase, and EPZ005687 (EPZ), an inhibitor of histone lysine methyltransferase, or infected with adenovirus vector EZH2 RNAi (si-EZH2) and adenovirus vector DNMT1 RNAi (si-DNMT1). d , e ChIP-PCR were used to detect the H3K27me3 levels in the CFTR promoter in hepatocytes treated with 5-azacytidine, an inhibitor of DNA methyltransferase, and EPZ005687 (EPZ), an inhibitor of histone lysine methyltransferase or infected with si-EZH2 and si-DNMT1. f The protein levels of CFTR and autophagy-related protein factors p62, BECN1, LC3, and Atg12 were detected by western blot in hepatocytes treated with si-EZH2 and si-DNMT1. Mean ± s.d. of three experiments performed in triplicate. * P
Figure Legend Snippet: Interaction between DNA methylation and histone methylation in CFTR promoter. Human hepatocytes HL-7702 were treated with Hcy or infected with adenovirus vector (si-DNMT1 and si-EZH2) for 24 h. a – c The DNA methylation of CFTR was detected by BSP after the hepatocytes were treated with 5-azacytidine, an inhibitor of DNA methyltransferase, and EPZ005687 (EPZ), an inhibitor of histone lysine methyltransferase, or infected with adenovirus vector EZH2 RNAi (si-EZH2) and adenovirus vector DNMT1 RNAi (si-DNMT1). d , e ChIP-PCR were used to detect the H3K27me3 levels in the CFTR promoter in hepatocytes treated with 5-azacytidine, an inhibitor of DNA methyltransferase, and EPZ005687 (EPZ), an inhibitor of histone lysine methyltransferase or infected with si-EZH2 and si-DNMT1. f The protein levels of CFTR and autophagy-related protein factors p62, BECN1, LC3, and Atg12 were detected by western blot in hepatocytes treated with si-EZH2 and si-DNMT1. Mean ± s.d. of three experiments performed in triplicate. * P

Techniques Used: DNA Methylation Assay, Methylation, Infection, Plasmid Preparation, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Western Blot

10) Product Images from "The long non-coding RNA FOXD2-AS1 promotes bladder cancer progression and recurrence through a positive feedback loop with Akt and E2F1"

Article Title: The long non-coding RNA FOXD2-AS1 promotes bladder cancer progression and recurrence through a positive feedback loop with Akt and E2F1

Journal: Cell Death & Disease

doi: 10.1038/s41419-018-0275-9

hnRNP L is responsible for FOXD2-AS1 -mediated regulation of TRIB3. a TRIB3 promoter contians three latent binding site with FOXD2-AS1 . b and c FOXD2-AS1 targeted probes and negative Laz probes were used for ChIRP assay. Purified DNA and RNA was analyzed by qPCR and qRT-PCR respectively. The results showed that FOXD2-AS1 bound to TRIB3-promoter3 and FOXD2-AS1 probes specifically pulled down FOXD2-AS1 . Error bars represent the mean ± S.D. from three independent experiments. ** p
Figure Legend Snippet: hnRNP L is responsible for FOXD2-AS1 -mediated regulation of TRIB3. a TRIB3 promoter contians three latent binding site with FOXD2-AS1 . b and c FOXD2-AS1 targeted probes and negative Laz probes were used for ChIRP assay. Purified DNA and RNA was analyzed by qPCR and qRT-PCR respectively. The results showed that FOXD2-AS1 bound to TRIB3-promoter3 and FOXD2-AS1 probes specifically pulled down FOXD2-AS1 . Error bars represent the mean ± S.D. from three independent experiments. ** p

Techniques Used: Binding Assay, Purification, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

Mutual regulation between FOXD2-AS1 and E2F1. a Western blotting revealed that FOXD2-AS1 silencing obviously decreased p-MDM2 and E2F1 expression. Immunoblots is the representative image from three independent experiments. b LY294002 was used in FOXD2-AS1 overexpression bladder cancer cells, and the levels of E2F1, p-MDM2 and MDM2 were measured by western blotting after 72 h. FOXD2-AS1 -mediated p-MDM2 and E2F1 expression could be restored by LY294002. Immunoblots is the representative image from three independent experiments. c and d Ectopic expression of FOXD2-AS1 increased MDM2 expression LY294002 significantly restored expression of MDM2 in nucleus in FOXD2-AS1 overexpression bladder cancer cells. e Cells were transfected with FOXD2-AS1 or corresponding empty vectors, and then exposure to protein synthesis inhibitor CHX (20 μg/ml) for defferent times. E2F1 was detected by western blotting. f and g FOXD2-AS1 is positively correlated with E2F1 in bladder cancer tissues which was proved by TCGA data and our own qRT-PCR data. h and i qRT-PCR showed that E2F1 depletion reduce expression of FOXD2-AS1 in both T24 and UM-U3 cells. Error bars represent the mean ± S.D. from three independent experiments. ** p
Figure Legend Snippet: Mutual regulation between FOXD2-AS1 and E2F1. a Western blotting revealed that FOXD2-AS1 silencing obviously decreased p-MDM2 and E2F1 expression. Immunoblots is the representative image from three independent experiments. b LY294002 was used in FOXD2-AS1 overexpression bladder cancer cells, and the levels of E2F1, p-MDM2 and MDM2 were measured by western blotting after 72 h. FOXD2-AS1 -mediated p-MDM2 and E2F1 expression could be restored by LY294002. Immunoblots is the representative image from three independent experiments. c and d Ectopic expression of FOXD2-AS1 increased MDM2 expression LY294002 significantly restored expression of MDM2 in nucleus in FOXD2-AS1 overexpression bladder cancer cells. e Cells were transfected with FOXD2-AS1 or corresponding empty vectors, and then exposure to protein synthesis inhibitor CHX (20 μg/ml) for defferent times. E2F1 was detected by western blotting. f and g FOXD2-AS1 is positively correlated with E2F1 in bladder cancer tissues which was proved by TCGA data and our own qRT-PCR data. h and i qRT-PCR showed that E2F1 depletion reduce expression of FOXD2-AS1 in both T24 and UM-U3 cells. Error bars represent the mean ± S.D. from three independent experiments. ** p

Techniques Used: Western Blot, Expressing, Over Expression, Transfection, Quantitative RT-PCR

Expression and clinical value of FOXD2-AS1 in bladder cancer. a Expression of FOXD2-AS1 in 19 pairs of TCGA cancer and adjacent noncancerous samples indicated that FOXD2-AS1 is obviously up-regulated in bladder cancer. b The location of FOXD2-AS1 on chromosome. c qRT-PCR performed in 84 cases showed that FOXD2-AS1 expression was significantly increased in bladder cacer tissues compared to adjacent noncancerous tissues ( p
Figure Legend Snippet: Expression and clinical value of FOXD2-AS1 in bladder cancer. a Expression of FOXD2-AS1 in 19 pairs of TCGA cancer and adjacent noncancerous samples indicated that FOXD2-AS1 is obviously up-regulated in bladder cancer. b The location of FOXD2-AS1 on chromosome. c qRT-PCR performed in 84 cases showed that FOXD2-AS1 expression was significantly increased in bladder cacer tissues compared to adjacent noncancerous tissues ( p

Techniques Used: Expressing, Quantitative RT-PCR

FOXD2-AS1 promotes proliferation and migration/invasion of bladder cancer cells. a Expression alteration of FOXD2-AS1 was shown in FOXD2-AS1 overexpression bladder cancer cells. b qRT-PCR was used to evaluate expression of FOXD2-AS1 in two independent siRNAs transfected bladder cancer cells. The figures in A and B showed representative results of three independent experiments. c and d MTT assays were performed to determine the T24 and UM-UC-3 cell growth capacities after silencing of FOXD2-AS1 via specific siRNAs transfections. The representative figure of three independent experiments showed that FOXD2-AS1 obviously promoted bladder cancer cell growth. * p
Figure Legend Snippet: FOXD2-AS1 promotes proliferation and migration/invasion of bladder cancer cells. a Expression alteration of FOXD2-AS1 was shown in FOXD2-AS1 overexpression bladder cancer cells. b qRT-PCR was used to evaluate expression of FOXD2-AS1 in two independent siRNAs transfected bladder cancer cells. The figures in A and B showed representative results of three independent experiments. c and d MTT assays were performed to determine the T24 and UM-UC-3 cell growth capacities after silencing of FOXD2-AS1 via specific siRNAs transfections. The representative figure of three independent experiments showed that FOXD2-AS1 obviously promoted bladder cancer cell growth. * p

Techniques Used: Migration, Expressing, Over Expression, Quantitative RT-PCR, Transfection, MTT Assay

FOXD2-AS1 promotes bladder cancer cell proliferation, migration and invasion by regulating the Akt signaling pathway. a The heatmap showed the differentially expressed genes between the NC and siRNAs groups. b Left: Venn diagram showed Co-altered genes of two independent siRNAs targeted to FOXD2-AS1 . Right: Obviously changed genes involved in phosphatidylinositol 3-kinase signaling were listed. c The GO analysis shows that FOXD2-AS1 is involved in regulation of phosphatidylinositol 3-kinase signaling. d and e qRT-PCR was employed to verify the results of the microarray analysis in UM-UC-3 and T24 cells. Error bars represent the mean ± S.D. from three independent experiments. * p
Figure Legend Snippet: FOXD2-AS1 promotes bladder cancer cell proliferation, migration and invasion by regulating the Akt signaling pathway. a The heatmap showed the differentially expressed genes between the NC and siRNAs groups. b Left: Venn diagram showed Co-altered genes of two independent siRNAs targeted to FOXD2-AS1 . Right: Obviously changed genes involved in phosphatidylinositol 3-kinase signaling were listed. c The GO analysis shows that FOXD2-AS1 is involved in regulation of phosphatidylinositol 3-kinase signaling. d and e qRT-PCR was employed to verify the results of the microarray analysis in UM-UC-3 and T24 cells. Error bars represent the mean ± S.D. from three independent experiments. * p

Techniques Used: Migration, Quantitative RT-PCR, Microarray

11) Product Images from "Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock"

Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/jcmm.12756

PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P
Figure Legend Snippet: PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

Techniques Used: Injection, Enzyme-linked Immunosorbent Assay, Western Blot, RNA Binding Assay, Mouse Assay, Staining, Quantitative RT-PCR

12) Product Images from "Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus"

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus

Journal: PLoS ONE

doi: 10.1371/journal.pone.0110911

Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).
Figure Legend Snippet: Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Fluorescence, Cell Culture

13) Product Images from "PR-10, defensin and cold dehydrin genes are among those over expressed in Oxytropis (Fabaceae) species adapted to the arctic"

Article Title: PR-10, defensin and cold dehydrin genes are among those over expressed in Oxytropis (Fabaceae) species adapted to the arctic

Journal: Functional & Integrative Genomics

doi: 10.1007/s10142-011-0223-6

Expression of selected genes compared in transcriptomes of two arctic Oxytropis species ( O. arctobia and O. maydelliana ) and two temperate species ( O. campestris subsp. johannensis and O. splendens ) under two climatic conditions. Real-time RT-PCR was used to measure gene expression in cDNA. Values on the Y -axis are the mean ratio of the selected gene relative to actin expression. Actin was used as a normalizing gene ±1 standard deviation of three biological replicates and two technical replicates. a Expression of arctic.contig47 (cold dehydrin); b arctic.contig61 (PR-10); c arctic.contig13/36 (PR-10); d temperate.contig98 (light harvesting protein I, lhcbI). Abbreviations: oa, O. arctobia ; om, O. maydelliana ; ocj, O. campestris subsp. johannensis ; os O. splendens . The white bars represent expression of plantlets from the arctic conditions, and the dark grey bars from the temperate conditions. Small letters a or b above bars denote values that are significantly different at the 0.05 level (one-way ANOVA-GLM with SNK)
Figure Legend Snippet: Expression of selected genes compared in transcriptomes of two arctic Oxytropis species ( O. arctobia and O. maydelliana ) and two temperate species ( O. campestris subsp. johannensis and O. splendens ) under two climatic conditions. Real-time RT-PCR was used to measure gene expression in cDNA. Values on the Y -axis are the mean ratio of the selected gene relative to actin expression. Actin was used as a normalizing gene ±1 standard deviation of three biological replicates and two technical replicates. a Expression of arctic.contig47 (cold dehydrin); b arctic.contig61 (PR-10); c arctic.contig13/36 (PR-10); d temperate.contig98 (light harvesting protein I, lhcbI). Abbreviations: oa, O. arctobia ; om, O. maydelliana ; ocj, O. campestris subsp. johannensis ; os O. splendens . The white bars represent expression of plantlets from the arctic conditions, and the dark grey bars from the temperate conditions. Small letters a or b above bars denote values that are significantly different at the 0.05 level (one-way ANOVA-GLM with SNK)

Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

14) Product Images from "LncRNA TUG1 promotes the progression of colorectal cancer via the miR-138-5p/ZEB2 axis"

Article Title: LncRNA TUG1 promotes the progression of colorectal cancer via the miR-138-5p/ZEB2 axis

Journal: Bioscience Reports

doi: 10.1042/BSR20201025

Expression of TUG1 in cells and its effects on the biological function of cells Expression of TUG1 in cell lines from each group and expression of TUG1 in transfected LoVo cells ( A ). Proliferation of transfected LoVo cells ( B ). Apoptosis of transfected LoVo cells ( C ). Invasion of transfected LoVo cells ( D ). Expression of apoptosis-related proteins in transfected LoVo cells ( E ). a indicates P
Figure Legend Snippet: Expression of TUG1 in cells and its effects on the biological function of cells Expression of TUG1 in cell lines from each group and expression of TUG1 in transfected LoVo cells ( A ). Proliferation of transfected LoVo cells ( B ). Apoptosis of transfected LoVo cells ( C ). Invasion of transfected LoVo cells ( D ). Expression of apoptosis-related proteins in transfected LoVo cells ( E ). a indicates P

Techniques Used: Expressing, Transfection

Promotion of TUG1 on the development and metastasis of CRC by inhibiting the miR-138-5p/ZEB2 molecular axis in in vitro experiments ( A ) Proliferation of LoVo cells. ( B ) Apoptosis of LoVo cells. ( C ) Invasion of LoVo cells. ( D ) Apoptosis-related proteins in the cytoplasm o LoVo cells. ( E ) EMT-related proteins in the cytoplasm of LoVo cells. ( F ) Wb map of apoptosis-related protein. ( G ) Wb map of EMT-related proteins.
Figure Legend Snippet: Promotion of TUG1 on the development and metastasis of CRC by inhibiting the miR-138-5p/ZEB2 molecular axis in in vitro experiments ( A ) Proliferation of LoVo cells. ( B ) Apoptosis of LoVo cells. ( C ) Invasion of LoVo cells. ( D ) Apoptosis-related proteins in the cytoplasm o LoVo cells. ( E ) EMT-related proteins in the cytoplasm of LoVo cells. ( F ) Wb map of apoptosis-related protein. ( G ) Wb map of EMT-related proteins.

Techniques Used: In Vitro, Western Blot

Targeting binding between lncRNA TUG1 and miR-138-5p ( A ) Expression of miR-138-5p. The AUC of miR-138-5p for CRC diagnosis was larger than 0.8. ( B ) Expression of miR-138-5p in tissues with high/moderate/low differentiation. ( C ) Compared with FHC cells, LoVo cells showed significantly down-regulated miR-138-5p. ( D ) Expression of miR-138-5p in transfected LoVo cells. ( E ) Proliferation, apoptosis, and invasion of transfected LoVo cells. ( F ) Luciferase activity of LoVo cells. ( G ) Expression of apoptosis-related proteins in transfected LoVo cells. Cell apoptosis map. a indicates P
Figure Legend Snippet: Targeting binding between lncRNA TUG1 and miR-138-5p ( A ) Expression of miR-138-5p. The AUC of miR-138-5p for CRC diagnosis was larger than 0.8. ( B ) Expression of miR-138-5p in tissues with high/moderate/low differentiation. ( C ) Compared with FHC cells, LoVo cells showed significantly down-regulated miR-138-5p. ( D ) Expression of miR-138-5p in transfected LoVo cells. ( E ) Proliferation, apoptosis, and invasion of transfected LoVo cells. ( F ) Luciferase activity of LoVo cells. ( G ) Expression of apoptosis-related proteins in transfected LoVo cells. Cell apoptosis map. a indicates P

Techniques Used: Binding Assay, Expressing, Transfection, Luciferase, Activity Assay

15) Product Images from "SIM2l attenuates resistance to hypoxia and tumor growth by transcriptional suppression of HIF1A in uterine cervical squamous cell carcinoma"

Article Title: SIM2l attenuates resistance to hypoxia and tumor growth by transcriptional suppression of HIF1A in uterine cervical squamous cell carcinoma

Journal: Scientific Reports

doi: 10.1038/s41598-017-15261-4

SIM2 knockdown enhances survival and resistance to radiation in a 3D culture. ( a ) Western blot analysis of SIM2l in SIM2 shRNA-expressing SKG-ΙΙΙa cells. Two knockdown clones (#13 and #15) were established and analyzed. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S6 . (b) Cell viability assay of SIM2-knockdown cells cultured for 9 days in a 3D plate. Each viability was normalized by control shRNA-expressing cells. (c) qRT-PCR analysis of HIF1A and its target genes ( VEGFA , BNIP3 , HK2 , PDK1 , SLC2A , and MDR1 ) in SIM2-knockdown cells under a 3D culture. (d) SIM2 knockdown induces HIF-1α and resistance to apoptosis. Left panels show representative fluorescent images of immunohistochemistry for HIF-1α (Green) after 24-hour exposure by DMSO control (top panels) or 100 μM deferoxamine (bottom panels). All images were overlaid by DAPI staining for detection of nuclei (blue). Each bar represents 100 μm. Right panels show apoptosis detection of SIM2-knockdown cells treated by DMSO (solid bar) or 100 μM deferoxamine (striped bar) for 24 hours. Calculation of apoptotic fractions is described elsewhere. (e) Sensitivity of SIM2-knockdown cells against H 2 O 2 and γ-ray. Cells were cultured under 3D condition followed by 24-hour exposure of 1 mM H 2 O 2 or 5 Gy of γ-ray irradiation. Data were normalized by untreated control. Data were obtained from 3 independent experiments and presented as mean ± SD. All statistical analyses were performed by student t-test. *, **, and *** represent p
Figure Legend Snippet: SIM2 knockdown enhances survival and resistance to radiation in a 3D culture. ( a ) Western blot analysis of SIM2l in SIM2 shRNA-expressing SKG-ΙΙΙa cells. Two knockdown clones (#13 and #15) were established and analyzed. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S6 . (b) Cell viability assay of SIM2-knockdown cells cultured for 9 days in a 3D plate. Each viability was normalized by control shRNA-expressing cells. (c) qRT-PCR analysis of HIF1A and its target genes ( VEGFA , BNIP3 , HK2 , PDK1 , SLC2A , and MDR1 ) in SIM2-knockdown cells under a 3D culture. (d) SIM2 knockdown induces HIF-1α and resistance to apoptosis. Left panels show representative fluorescent images of immunohistochemistry for HIF-1α (Green) after 24-hour exposure by DMSO control (top panels) or 100 μM deferoxamine (bottom panels). All images were overlaid by DAPI staining for detection of nuclei (blue). Each bar represents 100 μm. Right panels show apoptosis detection of SIM2-knockdown cells treated by DMSO (solid bar) or 100 μM deferoxamine (striped bar) for 24 hours. Calculation of apoptotic fractions is described elsewhere. (e) Sensitivity of SIM2-knockdown cells against H 2 O 2 and γ-ray. Cells were cultured under 3D condition followed by 24-hour exposure of 1 mM H 2 O 2 or 5 Gy of γ-ray irradiation. Data were normalized by untreated control. Data were obtained from 3 independent experiments and presented as mean ± SD. All statistical analyses were performed by student t-test. *, **, and *** represent p

Techniques Used: Western Blot, shRNA, Expressing, Clone Assay, Viability Assay, Cell Culture, Quantitative RT-PCR, Immunohistochemistry, Staining, Irradiation

SIM2 knockdown induces HIF-1α and resistance to hypoxia. (a) RT-PCR analyses of radiosensitive genes in 5 CvSCC cell lines treated with control siRNA (cont) or SIM2 siRNA (SIM2). GAPDH was used as a loading control. The cropped gels are used in the figure and full gels are presented in Supplementary Figure S2 . (b) Quantitative RT-PCR (qRT-PCR) analyses of HIF1A and HIF-1α-target genes in control siRNA- or SIM2 siRNA-treated SKG-ΙΙΙa cells. All data were obtained from 3 independent experiments and presented as mean ± SD. (c) Western blot analyses of SIM2l and HIF-1α in SIM2-knockdown SKG-ΙΙΙa cells. Two kinds of siRNAs (#1 and #2) were used for the analyses. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S3 . (d) Induction of HIF-1α expression by hypoxia. SIM2l and HIF-1α expression was detected in SIM2-knockdown cells cultured under normoxia or hypoxia. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S5 . (e) Apoptosis induction by hypoxia mimetic agent, deferoxamine treatment. SIM2-knockdown cells were treated by DMSO (Control) or 100 μM deferoxamine (DFO) for 24 hours. Apoptotic cells were detected by FITC-Annexin V and 7-AAD double staining followed by FACS analysis. Representative FACS data are shown at upper panels. A bottom panel shows the rate of apoptotic cells calculated by the sum of early apoptotic fraction (AnnexinV High and 7-AAD Low ) and late apoptotic one (AnnexinV High and 7-AAD High ). Data were obtained from 3 independent experiments and presented as mean ± SD. All statistical analyses were performed by student t-test. *, **, and *** represent p
Figure Legend Snippet: SIM2 knockdown induces HIF-1α and resistance to hypoxia. (a) RT-PCR analyses of radiosensitive genes in 5 CvSCC cell lines treated with control siRNA (cont) or SIM2 siRNA (SIM2). GAPDH was used as a loading control. The cropped gels are used in the figure and full gels are presented in Supplementary Figure S2 . (b) Quantitative RT-PCR (qRT-PCR) analyses of HIF1A and HIF-1α-target genes in control siRNA- or SIM2 siRNA-treated SKG-ΙΙΙa cells. All data were obtained from 3 independent experiments and presented as mean ± SD. (c) Western blot analyses of SIM2l and HIF-1α in SIM2-knockdown SKG-ΙΙΙa cells. Two kinds of siRNAs (#1 and #2) were used for the analyses. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S3 . (d) Induction of HIF-1α expression by hypoxia. SIM2l and HIF-1α expression was detected in SIM2-knockdown cells cultured under normoxia or hypoxia. β-Actin was used as a loading control. The cropped blots are used in the figure and full blots are presented in Supplementary Figure S5 . (e) Apoptosis induction by hypoxia mimetic agent, deferoxamine treatment. SIM2-knockdown cells were treated by DMSO (Control) or 100 μM deferoxamine (DFO) for 24 hours. Apoptotic cells were detected by FITC-Annexin V and 7-AAD double staining followed by FACS analysis. Representative FACS data are shown at upper panels. A bottom panel shows the rate of apoptotic cells calculated by the sum of early apoptotic fraction (AnnexinV High and 7-AAD Low ) and late apoptotic one (AnnexinV High and 7-AAD High ). Data were obtained from 3 independent experiments and presented as mean ± SD. All statistical analyses were performed by student t-test. *, **, and *** represent p

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Expressing, Cell Culture, Double Staining, FACS

16) Product Images from "Ca2+ enrichment in culture medium potentiates effect of oligonucleotides"

Article Title: Ca2+ enrichment in culture medium potentiates effect of oligonucleotides

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkv626

CEM enhances the activity of siRNA and PMO, but not the transfection of plasmid DNA. ( A ) CEM effect on the activity of ApoB -siRNAs. Huh-7 cells were treated with 1 μM ApoB -siRNAs with or without 9 mM CaCl 2 for 24 h. ApoB mRNA levels were analyzed using qRT-PCR. The relative quantification of ApoB mRNA was normalized against expression of the GAPDH gene. Each data point represents the mean ± SD of three independent experiments. ( B ) Knockdown of STAT3 by exon skipping and nonsense-mediated decay. ST6-PMO targeting the boundary region of intron 5 and exon 6 in the human STAT3 pre-mRNA provides exon 6 skipping and induces RNA degradation by nonsense-mediated mRNA decay. PTC: premature termination codon. ( C ) RT-PCR analysis for STAT3 pre-mRNA splicing. Huh-7 cells were treated with ST6-PMO with or without 9 mM CaCl 2 . After 48 h, STAT3 pre-mRNA splicing was visualized by polyacrylamide gel separation of RT-PCR products. FL: full-length, Δe6: exon 6 skipping, NT: non-treatment, NC: negative control. ( D and E ) qRT-PCR and western blot analysis of STAT3 expression. Huh-7 cells were treated with ST6-PMO with or without 9 mM CaCl 2 . After 48 h, STAT3 mRNA was analyzed using qRT-PCR (D) and STAT3 protein was analyzed by western blot (E). For qRT-PCR, the relative quantification of STAT3 mRNA was normalized against expression of the GAPDH gene. Each data point represents the mean ± SD of three independent experiments. β-actin was the loading control for western blot. Endo-Porter was used as the positive control for PMO transfection. ( F ) CEM effect on the transfection of plasmid DNA. Twenty-four hours after seeding of Huh-7 cells, firefly luciferase expression plasmid, pGL4.50 was added with or without 9 mM CaCl 2 in the medium. CalPhos Mammalian Transfection kit was used as a positive control for plasmid transfection by the calcium phosphate method (Ca-P). At 48 h after transfection, firefly luciferase activity was measured using ONE-Glo Luciferase Assay system and is presented as relative luminescence units (RLU). Each value is presented as the mean ± SD of three independent experiments.
Figure Legend Snippet: CEM enhances the activity of siRNA and PMO, but not the transfection of plasmid DNA. ( A ) CEM effect on the activity of ApoB -siRNAs. Huh-7 cells were treated with 1 μM ApoB -siRNAs with or without 9 mM CaCl 2 for 24 h. ApoB mRNA levels were analyzed using qRT-PCR. The relative quantification of ApoB mRNA was normalized against expression of the GAPDH gene. Each data point represents the mean ± SD of three independent experiments. ( B ) Knockdown of STAT3 by exon skipping and nonsense-mediated decay. ST6-PMO targeting the boundary region of intron 5 and exon 6 in the human STAT3 pre-mRNA provides exon 6 skipping and induces RNA degradation by nonsense-mediated mRNA decay. PTC: premature termination codon. ( C ) RT-PCR analysis for STAT3 pre-mRNA splicing. Huh-7 cells were treated with ST6-PMO with or without 9 mM CaCl 2 . After 48 h, STAT3 pre-mRNA splicing was visualized by polyacrylamide gel separation of RT-PCR products. FL: full-length, Δe6: exon 6 skipping, NT: non-treatment, NC: negative control. ( D and E ) qRT-PCR and western blot analysis of STAT3 expression. Huh-7 cells were treated with ST6-PMO with or without 9 mM CaCl 2 . After 48 h, STAT3 mRNA was analyzed using qRT-PCR (D) and STAT3 protein was analyzed by western blot (E). For qRT-PCR, the relative quantification of STAT3 mRNA was normalized against expression of the GAPDH gene. Each data point represents the mean ± SD of three independent experiments. β-actin was the loading control for western blot. Endo-Porter was used as the positive control for PMO transfection. ( F ) CEM effect on the transfection of plasmid DNA. Twenty-four hours after seeding of Huh-7 cells, firefly luciferase expression plasmid, pGL4.50 was added with or without 9 mM CaCl 2 in the medium. CalPhos Mammalian Transfection kit was used as a positive control for plasmid transfection by the calcium phosphate method (Ca-P). At 48 h after transfection, firefly luciferase activity was measured using ONE-Glo Luciferase Assay system and is presented as relative luminescence units (RLU). Each value is presented as the mean ± SD of three independent experiments.

Techniques Used: Activity Assay, Transfection, Plasmid Preparation, Quantitative RT-PCR, Expressing, Reverse Transcription Polymerase Chain Reaction, Negative Control, Western Blot, Positive Control, Luciferase

CEM effect on subcellular localization of 2′, 4′-BNA ASO. ( A ) Huh-7 cells were lipofected with Cy3-labeled ApoB -ASO at 100 nM using Lipofectamine 2000 (Life Technologies). After 24 h of incubation, nuclei were stained with 0.5 μM Hoechst 33342 (Life Technologies) for 30 min, following by staining of lysosomes with LysoTraker ® Green DND-26 (Life Technologies) at 75 nM for 30 min at 37°C. After staining, the medium was replaced with HBSS and the cells were observed using a confocal laser scanning microscope (Leica, TCS SP5). ( B and C ) Huh-7 cells were treated with Cy3-labeled ApoB -ASO at 500 nM with or without 9 mM CaCl 2 . After 24 h of incubation, the subcellular localization of Cy3-labeled ApoB -ASO was visualized by confocal microscopy. ( D ) Huh-7 cells were transfected with the CalPhos™ Mammalian Transfection kit according to manufacturer's procedure. After 24 h of incubation, the subcellular localization of Cy3-labeled ApoB -ASO was visualized by confocal microscopy.
Figure Legend Snippet: CEM effect on subcellular localization of 2′, 4′-BNA ASO. ( A ) Huh-7 cells were lipofected with Cy3-labeled ApoB -ASO at 100 nM using Lipofectamine 2000 (Life Technologies). After 24 h of incubation, nuclei were stained with 0.5 μM Hoechst 33342 (Life Technologies) for 30 min, following by staining of lysosomes with LysoTraker ® Green DND-26 (Life Technologies) at 75 nM for 30 min at 37°C. After staining, the medium was replaced with HBSS and the cells were observed using a confocal laser scanning microscope (Leica, TCS SP5). ( B and C ) Huh-7 cells were treated with Cy3-labeled ApoB -ASO at 500 nM with or without 9 mM CaCl 2 . After 24 h of incubation, the subcellular localization of Cy3-labeled ApoB -ASO was visualized by confocal microscopy. ( D ) Huh-7 cells were transfected with the CalPhos™ Mammalian Transfection kit according to manufacturer's procedure. After 24 h of incubation, the subcellular localization of Cy3-labeled ApoB -ASO was visualized by confocal microscopy.

Techniques Used: Allele-specific Oligonucleotide, Labeling, Incubation, Staining, Laser-Scanning Microscopy, Confocal Microscopy, Transfection

17) Product Images from "A Novel Bromodomain Inhibitor Reverses HIV-1 Latency through Specific Binding with BRD4 to Promote Tat and P-TEFb Association"

Article Title: A Novel Bromodomain Inhibitor Reverses HIV-1 Latency through Specific Binding with BRD4 to Promote Tat and P-TEFb Association

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2017.01035

UMB-136 reverses HIV-1 latency from multiple cell models of HIV-1 latency. (A) Multiple J-Lat cell clones (6.3, 8.4, 9.2, and 10.4, CD4+ T cell background) were treated with UMB-136 (2.5 or 5 μM) or JQ1 (1 μM). GFP-positive cells were acquired and analyzed by flow cytometry. Percentage of GFP-positive cells was determined. One representative of three independent experiments was shown. (B) THP89GFP cells (monocyte/macrophage background) were treated with UMB-136 (5 μM) or JQ1 (1 μM). GFP-positive cells were acquired and analyzed by flow cytometry. The HIV-reactivated cell population was indicated. (C) HIV-1 latency was established in the CD4+ T cells isolated from the peripheral blood mononuclear cells (PBMCs) of 2 donors, following a previously reported primary cell model (Vicente Planelles). Cells latently infected with wild-type HIV-1 NL4-3 viruses were treated with UMB-136 (2.5 μM) or JQ1 (1 μM). The viral mRNAs from newly produced HIV-1 viruses in supernatant were measured by qRT-PCR assay. (D) The same assay in (D) was conducted using the CD4+ T cells isolated from the tonsillar mononuclear cells (TMCs) of 2 donors. Results were presented as mean ± s.e.m. ( n = 3 ); * p
Figure Legend Snippet: UMB-136 reverses HIV-1 latency from multiple cell models of HIV-1 latency. (A) Multiple J-Lat cell clones (6.3, 8.4, 9.2, and 10.4, CD4+ T cell background) were treated with UMB-136 (2.5 or 5 μM) or JQ1 (1 μM). GFP-positive cells were acquired and analyzed by flow cytometry. Percentage of GFP-positive cells was determined. One representative of three independent experiments was shown. (B) THP89GFP cells (monocyte/macrophage background) were treated with UMB-136 (5 μM) or JQ1 (1 μM). GFP-positive cells were acquired and analyzed by flow cytometry. The HIV-reactivated cell population was indicated. (C) HIV-1 latency was established in the CD4+ T cells isolated from the peripheral blood mononuclear cells (PBMCs) of 2 donors, following a previously reported primary cell model (Vicente Planelles). Cells latently infected with wild-type HIV-1 NL4-3 viruses were treated with UMB-136 (2.5 μM) or JQ1 (1 μM). The viral mRNAs from newly produced HIV-1 viruses in supernatant were measured by qRT-PCR assay. (D) The same assay in (D) was conducted using the CD4+ T cells isolated from the tonsillar mononuclear cells (TMCs) of 2 donors. Results were presented as mean ± s.e.m. ( n = 3 ); * p

Techniques Used: Clone Assay, Flow Cytometry, Cytometry, Isolation, Infection, Produced, Quantitative RT-PCR

18) Product Images from "A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients"

Article Title: A deleterious Nav1.1 mutation selectively impairs telencephalic inhibitory neurons derived from Dravet Syndrome patients

Journal: eLife

doi: 10.7554/eLife.13073

Transduction and RNAi efficiency of two human Nav1.1 lenti-shRNA clones. ( A ) Evaluating the transduction efficiency of the lentiviral particles were tested in HEK293T cells based on the expression of the tRFP reporter. Scale bars, 20 microns. ( B ) The RNAi efficiency of lenti-shRNA1 and lenti-shRNA2 relative to a non-silencing clone was determined by first transducing HEK293T cells with the lentiviral clones and next expressing the human Na v 1.1 cDNA via transfection. Na v 1.1 mRNAs were quantified with qRT-PCR. By ANOVA and post hoc Sidak’s multiple comparisons, p = 0.003 for the comparison between control and shRNA1; p = 0.002 for the comparison between control and shRNA2. DOI: http://dx.doi.org/10.7554/eLife.13073.034
Figure Legend Snippet: Transduction and RNAi efficiency of two human Nav1.1 lenti-shRNA clones. ( A ) Evaluating the transduction efficiency of the lentiviral particles were tested in HEK293T cells based on the expression of the tRFP reporter. Scale bars, 20 microns. ( B ) The RNAi efficiency of lenti-shRNA1 and lenti-shRNA2 relative to a non-silencing clone was determined by first transducing HEK293T cells with the lentiviral clones and next expressing the human Na v 1.1 cDNA via transfection. Na v 1.1 mRNAs were quantified with qRT-PCR. By ANOVA and post hoc Sidak’s multiple comparisons, p = 0.003 for the comparison between control and shRNA1; p = 0.002 for the comparison between control and shRNA2. DOI: http://dx.doi.org/10.7554/eLife.13073.034

Techniques Used: Transduction, shRNA, Clone Assay, Expressing, Transfection, Quantitative RT-PCR

19) Product Images from "Characterization of miR-122-independent propagation of HCV"

Article Title: Characterization of miR-122-independent propagation of HCV

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1006374

Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: Propagation of HCV 122KO in 751-122KO cells. (A) HCV was inoculated into Huh7-122KO (#2), Huh7-122KO-cured (#3 or #5), or 751-122KO (#1, #2 or #3) cells, and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined by qRT-PCR and focus formation assay, respectively, at 72 hpi. (B) Infectious titer in the culture medium on serial passage of each 751-122KO cell clone. (C) HCV and HCV 122KO were inoculated into 751-122KO and Huh7.5.1 cells and the levels of intracellular HCV-RNA replication (top) and infectious titers in the culture supernatants (bottom) were determined at 72 hpi. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: G28A mutants can replicate efficiently in an Ago2-independent manner. (A) Intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) of Huh7-122KO and Huh7-122KOR cells infected with either HCV or HCV 122KO in the presence of either control-LNA or LNA-miR-122 were determined at 72 hpi. (B) Ago2 complexes in 751-122KO and Huh7.5.1 cells infected with HCV were immunoprecipitated by either anti-IgG or anti-Ago2 mouse antibody at 12 dpi. Levels of Ago2 and HCV-RNA in the precipitates were determined by immunoblotting and qRT-PCR, respectively. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Infection, Immunoprecipitation, Quantitative RT-PCR, Standard Deviation

Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: Establishment of replicon cells derived from Huh7-122KO cells. (A) Subgenomic HCV replicon RNA was electroporated into Huh7-122KO and Huh7-122KOR cells, or into Huh7-122KO cells together with control- or miR-122-mimic, and G418-resistant colonies were stained with crystal violet at 21 days post-transduction. (B) Expression of miR-122 in Huh7-122KO cells electroporated with either control-mimic or miR-122-mimic at 72 h post-electroporation. Relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control. (C) Each of the three clones derived from each type of replicon cells was subjected to qRT-PCR after extraction of total RNA (top) and to immunoblotting by using anti-NS5A and β-actin (middle). The relative expression of miR-122 was determined by qRT-PCR by using U6 snRNA as an internal control (bottom). (D) Intracellular HCV-RNA replication in Huh7-122KO-SGR cells (#1, #3, #5) and Huh7-122KOR-SGR cells (#1, #5, #6) in the presence of 20 nM of either LNA-control or LNA-miR122 was determined by qRT-PCR. (E) The Ago2 complex was immunoprecipitated from Huh7-122KO-SGR#1 and Huh7-122KOR-SGR#1 cells by using either anti-IgG or anti-Ago2 mouse antibody. The HCV-RNA associated with Ago2 was determined by qRT-PCR and Ago2 was detected by immunoblotting. Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Derivative Assay, Staining, Transduction, Expressing, Electroporation, Quantitative RT-PCR, Clone Assay, Immunoprecipitation, Standard Deviation

miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P
Figure Legend Snippet: miR-122-independent HCV replication in Huh7-122KO cells. (A) HCV was inoculated into Huh7-122KO and Huh7-122KOR cells at an MOI of 3, and intracellular HCV-RNA levels (left panel) and infectious titers in the culture supernatants (right panel) were determined by qRT-PCR and focus formation assay, respectively. (B) HCV-RNA replication was inhibited by the treatment with IFNα, BILN, BMS790052, PSI7977 and anti-CD81 antibody. (C) HCV replication in Huh7-122KO cells was resistant to treatment with an miR-122 inhibitor, LNA (HCV-RNA replication: left; infectious titer: right). Error bars indicate the standard deviation of the mean and asterisks indicate significant differences (*P

Techniques Used: Quantitative RT-PCR, Tube Formation Assay, Standard Deviation

20) Product Images from "High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis"

Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis

Journal: Nature Communications

doi: 10.1038/s41467-018-05766-5

Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p
Figure Legend Snippet: Targeted Rasal1 promoter demethylation by dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA fusion protein ameliorates kidney fibrosis. a Schematic showing the parenchymal injection of lentiviral particles containing dCas9/dHFCas9-TET3CD fusion protein into UUO-challenged kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Rasal1 mRNA expression was significantly induced in UUO-challenged kidneys transduced with dCas9/dHFCas9-TET3CD- Rasal1 -sgRNA, but not in UUO-challenged kidneys transduced with control dCas9/dHFCas9-TET3CD- LacZ- sgRNA. There is no significant difference between dCas9-TET3CD and dHFCas9-TET3CD constructs. Results were normalized to reference gene Gapdh (expression is presented as mean value; error bars represent S.D., n ≥ 5 in each group, # not significant, *** p

Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction, Construct

Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p
Figure Legend Snippet: Induction of Klotho promoter hydroxymethylation by dHFCas9-TET3CD- Klotho -sgRNA in tubular epithelial cells ameliorates kidney fibrosis. a Schematic shows retrograde ureter injection of lentiviral particles containing dHFCas9-TET3CD- Klotho -sgRNA into UUO-operated kidneys. b Schedule of UUO mouse surgery, lentivirus injection, and analysis. c qRT-PCR results showing that Kl mRNA expression was significantly induced in UUO-operated kidneys transduced with dHFCas9-TET3CD- Kl -sgRNA but not in UUO-challenged kidneys transduced with LacZ- sgRNA control. Results were normalized to reference gene Gapdh (expression is presented as mean value, error bars represent S.E.M. , n = 6 in each group, *** p

Techniques Used: Injection, Quantitative RT-PCR, Expressing, Transduction

Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p
Figure Legend Snippet: Rasal1 gene disruption results in aggravated fibrosis level in the UUO model. a Schematic of knockout-first strategy for Rasal1 gene. The gene trapping LacZ cassette is alternatively spliced with exon 2 mediated by a splicing acceptor (SA). A promoter-driven Neomycin cassette is inserted after LacZ . The targeted exon 3 and 4 are flanked by loxP sites. Black arrows indicate the location of genotyping primers. b qRT-PCR analysis shows the Rasal1 mRNA expression in homozygous mice are significantly reduced as compared with wild-type mice, while there is no significant reduction in heterozygous mice. The data are presented as mean value, error bars represent S.D., n.s. not significant, *** p

Techniques Used: Knock-Out, Quantitative RT-PCR, Expressing, Mouse Assay

21) Product Images from "Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice"

Article Title: Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19123884

IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p
Figure Legend Snippet: IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

Techniques Used: Mouse Assay, Injection, Activity Assay, Staining, Synthesized, Real-time Polymerase Chain Reaction, Amplification, SYBR Green Assay, Polymerase Chain Reaction

22) Product Images from "A novel small heat shock protein of Haliotis discus hannai: characterization, structure modeling, and expression profiles under environmental stresses"

Article Title: A novel small heat shock protein of Haliotis discus hannai: characterization, structure modeling, and expression profiles under environmental stresses

Journal: Cell Stress & Chaperones

doi: 10.1007/s12192-016-0683-7

sHsp19 expression in abalone tissues under normal physiological conditions. sHsp19 expression in adductor muscle, digestive gland, foot muscle, gill, hemocyte, and mantle was determined by qRT-PCR. The data were analyzed with the mRNA level compared
Figure Legend Snippet: sHsp19 expression in abalone tissues under normal physiological conditions. sHsp19 expression in adductor muscle, digestive gland, foot muscle, gill, hemocyte, and mantle was determined by qRT-PCR. The data were analyzed with the mRNA level compared

Techniques Used: Expressing, Quantitative RT-PCR

sHsp19 expression in response to toxic metal ions. Pacific abalones were treated with Cu 2+ , Hg 2+ , and Pb 2+ , respectively. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin.
Figure Legend Snippet: sHsp19 expression in response to toxic metal ions. Pacific abalones were treated with Cu 2+ , Hg 2+ , and Pb 2+ , respectively. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin.

Techniques Used: Expressing, Quantitative RT-PCR

sHsp19 expression in response to high temperature. Pacific abalones were subjected to heat shock at 28 °C. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of
Figure Legend Snippet: sHsp19 expression in response to high temperature. Pacific abalones were subjected to heat shock at 28 °C. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of

Techniques Used: Expressing, Quantitative RT-PCR

sHsp19 expression in response to oxidative stress. Pacific abalones were subjected to H 2 O 2 treatment. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin. Data
Figure Legend Snippet: sHsp19 expression in response to oxidative stress. Pacific abalones were subjected to H 2 O 2 treatment. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin. Data

Techniques Used: Expressing, Quantitative RT-PCR

23) Product Images from "Long non-coding RNA OIP5-AS1 suppresses multiple myeloma progression by sponging miR-27a-3p to activate TSC1 expression"

Article Title: Long non-coding RNA OIP5-AS1 suppresses multiple myeloma progression by sponging miR-27a-3p to activate TSC1 expression

Journal: Cancer Cell International

doi: 10.1186/s12935-020-01234-7

MiR-27a-3p could target TSC1 in MM. a The binding sites between miR-27a-3p and TSC1 3′UTR, as well as the mutant were exhibited. b Dual-luciferase reporter assay was carried out to measure the luciferase activity in TSC1-wt group and TSC1-mut group of NCI-H929 and MM1.S cells. c The levels of miR-27a-3p and TSC1 were examined after Ago2 or IgG RIP by qRT-PCR assay. d The expression of TSC1 protein in NCI-H929 and MM1.S cells transfected with NC, miR-27a-3p, anti-NC or anti-miR-27a-3p was tested by western blot assay. e The expression of TSC1 protein in NCI-H929 and MM1.S cells transfected with Lnc-NC, LncRNA OIP5-AS1, LncRNA OIP5-AS1 + NC or LncRNA OIP5-AS1 + miR-27a-3p was measured by western blot assay. f , g The mRNA and protein levels of TSC1 in bone marrows of 38 MM patients and 25 healthy donors were determined by qRT-PCR and western blot assays, respectively. h, i The correlation between the expression of TSC1 mRNA and OIP5-AS1, as well as between the expression of miR-27a-3p and TSC1 mRNA was determined via Pearson correlation analysis. * P
Figure Legend Snippet: MiR-27a-3p could target TSC1 in MM. a The binding sites between miR-27a-3p and TSC1 3′UTR, as well as the mutant were exhibited. b Dual-luciferase reporter assay was carried out to measure the luciferase activity in TSC1-wt group and TSC1-mut group of NCI-H929 and MM1.S cells. c The levels of miR-27a-3p and TSC1 were examined after Ago2 or IgG RIP by qRT-PCR assay. d The expression of TSC1 protein in NCI-H929 and MM1.S cells transfected with NC, miR-27a-3p, anti-NC or anti-miR-27a-3p was tested by western blot assay. e The expression of TSC1 protein in NCI-H929 and MM1.S cells transfected with Lnc-NC, LncRNA OIP5-AS1, LncRNA OIP5-AS1 + NC or LncRNA OIP5-AS1 + miR-27a-3p was measured by western blot assay. f , g The mRNA and protein levels of TSC1 in bone marrows of 38 MM patients and 25 healthy donors were determined by qRT-PCR and western blot assays, respectively. h, i The correlation between the expression of TSC1 mRNA and OIP5-AS1, as well as between the expression of miR-27a-3p and TSC1 mRNA was determined via Pearson correlation analysis. * P

Techniques Used: Binding Assay, Mutagenesis, Luciferase, Reporter Assay, Activity Assay, Quantitative RT-PCR, Expressing, Transfection, Western Blot

LncRNA OIP5-AS1 inhibited tumor growth in vivo. MM xenograft model was built by injecting NCI-H929 or MM1.S cells stably expressing LncRNA OIP5-AS1 or Lnc-NC into nude mice. a , b Tumor volume and weight were recorded. c , d Levels of OIP5-AS1 and miR-27a-3p were examined by qRT-PCR assay. e Protein levels of PCNA, Cleaved caspase 3/total caspase 3 and TSC1 were measured using western blot analysis. * P
Figure Legend Snippet: LncRNA OIP5-AS1 inhibited tumor growth in vivo. MM xenograft model was built by injecting NCI-H929 or MM1.S cells stably expressing LncRNA OIP5-AS1 or Lnc-NC into nude mice. a , b Tumor volume and weight were recorded. c , d Levels of OIP5-AS1 and miR-27a-3p were examined by qRT-PCR assay. e Protein levels of PCNA, Cleaved caspase 3/total caspase 3 and TSC1 were measured using western blot analysis. * P

Techniques Used: In Vivo, Stable Transfection, Expressing, Mouse Assay, Quantitative RT-PCR, Western Blot

LncRNA OIP5-AS1 was low expressed in bone marrows of MM patients. a , b The relative expression of lncRNA OIP5-AS1 in bone marrows of 38 MM patients and 25 healthy donors was tested by qRT-PCR assay. c Kaplan–Meier analysis for the prognosis of 38 MM patients was done. * P
Figure Legend Snippet: LncRNA OIP5-AS1 was low expressed in bone marrows of MM patients. a , b The relative expression of lncRNA OIP5-AS1 in bone marrows of 38 MM patients and 25 healthy donors was tested by qRT-PCR assay. c Kaplan–Meier analysis for the prognosis of 38 MM patients was done. * P

Techniques Used: Expressing, Quantitative RT-PCR

Overexpression of OIP5-AS1 inhibited proliferation and metastasis, but promoted apoptosis of MM cells. MM NCI-H929 and MM1.S cells were transfected with LncRNA OIP5-AS1 or Lnc-NC. a The relative expression of lncRNA OIP5-AS1 in transfected cells was analyzed by qRT-PCR assay. b Cell viability of transfected cells was analyzed by CCK-8 assay. c The colony formation ability of transfected cells was monitored via colony formation assay. d , e The apoptosis rate and cell cycle distribution were tested through flow cytometry assay. f , g The migration and invasion abilities of transfected cells were examined by transwell assay. h , i The protein levels of Cleaved caspase 3/total caspase 3, Cleaved caspase 1, γ-H2AX, Cyclin D1, p21, Ki-67, MMP9, MMP7 and MMP10 were evaluated by western blot analysis. * P
Figure Legend Snippet: Overexpression of OIP5-AS1 inhibited proliferation and metastasis, but promoted apoptosis of MM cells. MM NCI-H929 and MM1.S cells were transfected with LncRNA OIP5-AS1 or Lnc-NC. a The relative expression of lncRNA OIP5-AS1 in transfected cells was analyzed by qRT-PCR assay. b Cell viability of transfected cells was analyzed by CCK-8 assay. c The colony formation ability of transfected cells was monitored via colony formation assay. d , e The apoptosis rate and cell cycle distribution were tested through flow cytometry assay. f , g The migration and invasion abilities of transfected cells were examined by transwell assay. h , i The protein levels of Cleaved caspase 3/total caspase 3, Cleaved caspase 1, γ-H2AX, Cyclin D1, p21, Ki-67, MMP9, MMP7 and MMP10 were evaluated by western blot analysis. * P

Techniques Used: Over Expression, Transfection, Expressing, Quantitative RT-PCR, CCK-8 Assay, Colony Assay, Flow Cytometry, Migration, Transwell Assay, Western Blot

Upregulation of miR-27a-3p counteracted the effects of OIP5-AS1 on the cellular behaviors of MM cells. MM NCI-H929 and MM1.S cells were transfected with Lnc-NC, LncRNA OIP5-AS1, LncRNA OIP5-AS1 + NC or LncRNA OIP5-AS1 + miR-27a-3p. a The relative expression of miR-27a-3p in transfected cells was detected by qRT-PCR assay. b Cell viability of transfected cells was analyzed by CCK-8 assay. c The colony formation ability of transfected cells was measured via colony formation assay. d , e The apoptosis rate and cell cycle distribution were detected through flow cytometry assay. f , g The migration and invasion abilities of transfected cells were evaluated by transwell assay. h , i Protein levels of Cleaved caspase 3/total caspase 3, Cleaved caspase 1, γ-H2AX, Cyclin D1, p21, Ki-67, MMP9, MMP7 and MMP10 were examined by western blot analysis. * P
Figure Legend Snippet: Upregulation of miR-27a-3p counteracted the effects of OIP5-AS1 on the cellular behaviors of MM cells. MM NCI-H929 and MM1.S cells were transfected with Lnc-NC, LncRNA OIP5-AS1, LncRNA OIP5-AS1 + NC or LncRNA OIP5-AS1 + miR-27a-3p. a The relative expression of miR-27a-3p in transfected cells was detected by qRT-PCR assay. b Cell viability of transfected cells was analyzed by CCK-8 assay. c The colony formation ability of transfected cells was measured via colony formation assay. d , e The apoptosis rate and cell cycle distribution were detected through flow cytometry assay. f , g The migration and invasion abilities of transfected cells were evaluated by transwell assay. h , i Protein levels of Cleaved caspase 3/total caspase 3, Cleaved caspase 1, γ-H2AX, Cyclin D1, p21, Ki-67, MMP9, MMP7 and MMP10 were examined by western blot analysis. * P

Techniques Used: Transfection, Expressing, Quantitative RT-PCR, CCK-8 Assay, Colony Assay, Flow Cytometry, Migration, Transwell Assay, Western Blot

LncRNA OIP5-AS1 directly targeted miR-27a-3p. a The binding sites between OIP5-AS1 and miR-27a-3p as well as the mutant were shown. b Dual-luciferase reporter assay was carried out to measure the luciferase activity in LncRNA OIP5-AS1-wt group and LncRNA OIP5-AS1-mut group of NCI-H929 and MM1.S cells. c The levels of OIP5-AS1 and miR-27a-3p were evaluated after Ago2 or IgG RIP by qRT-PCR assay. d The expression of miR-27a-3p in NCI-H929 and MM1.S cells transfected with Lnc-NC, LncRNA OIP5-AS1, si-NC or si-LncRNA OIP5-AS1 was analyzed by qRT-PCR assay. e The relative expression of miR-27a-3p in bone marrows of 38 MM patients and 25 healthy donors was tested by qRT-PCR assay. f The correlation between the expression of OIP5-AS1 and miR-27a-3p was determined via Pearson correlation analysis. * P
Figure Legend Snippet: LncRNA OIP5-AS1 directly targeted miR-27a-3p. a The binding sites between OIP5-AS1 and miR-27a-3p as well as the mutant were shown. b Dual-luciferase reporter assay was carried out to measure the luciferase activity in LncRNA OIP5-AS1-wt group and LncRNA OIP5-AS1-mut group of NCI-H929 and MM1.S cells. c The levels of OIP5-AS1 and miR-27a-3p were evaluated after Ago2 or IgG RIP by qRT-PCR assay. d The expression of miR-27a-3p in NCI-H929 and MM1.S cells transfected with Lnc-NC, LncRNA OIP5-AS1, si-NC or si-LncRNA OIP5-AS1 was analyzed by qRT-PCR assay. e The relative expression of miR-27a-3p in bone marrows of 38 MM patients and 25 healthy donors was tested by qRT-PCR assay. f The correlation between the expression of OIP5-AS1 and miR-27a-3p was determined via Pearson correlation analysis. * P

Techniques Used: Binding Assay, Mutagenesis, Luciferase, Reporter Assay, Activity Assay, Quantitative RT-PCR, Expressing, Transfection

24) Product Images from "Suppression of fibrosis in human pterygium fibroblasts by butyrate and phenylbutyrate"

Article Title: Suppression of fibrosis in human pterygium fibroblasts by butyrate and phenylbutyrate

Journal: International Journal of Ophthalmology

doi: 10.18240/ijo.2017.09.01

Collagen I expression in HPFs treated with butyrate or PB for 24 or 48h
Figure Legend Snippet: Collagen I expression in HPFs treated with butyrate or PB for 24 or 48h

Techniques Used: Expressing

25) Product Images from "Multiple roles of the transcription factor AtMYBR1/AtMYB44 in ABA signaling, stress responses, and leaf senescence"

Article Title: Multiple roles of the transcription factor AtMYBR1/AtMYB44 in ABA signaling, stress responses, and leaf senescence

Journal: BMC Plant Biology

doi: 10.1186/1471-2229-13-192

MYBR1 and MYBR2 regulate expression of some senescence-related genes. QRT-PCR was performed on total RNA extracted from rosette leaves numbers 3–5 of 21 d old soil grown plants of WT (Col-0), gain- and loss-of MYBR1 function as well as mybr2 and double mutant mybr1 x mybr2 . Standard error (n = 2) of biological repeats are indicated.
Figure Legend Snippet: MYBR1 and MYBR2 regulate expression of some senescence-related genes. QRT-PCR was performed on total RNA extracted from rosette leaves numbers 3–5 of 21 d old soil grown plants of WT (Col-0), gain- and loss-of MYBR1 function as well as mybr2 and double mutant mybr1 x mybr2 . Standard error (n = 2) of biological repeats are indicated.

Techniques Used: Expressing, Quantitative RT-PCR, Mutagenesis

26) Product Images from "Synergism between the mTOR inhibitor rapamycin and FAK down-regulation in the treatment of acute lymphoblastic leukemia"

Article Title: Synergism between the mTOR inhibitor rapamycin and FAK down-regulation in the treatment of acute lymphoblastic leukemia

Journal: Journal of Hematology & Oncology

doi: 10.1186/s13045-016-0241-x

Changes in BCL-2 family expression caused by rapamycin treatment and FAK down-regulation. REH-empty vector or REH-FAK shRNA cells were cultured with or without rapamycin (100 nM). After 10 h, RNA was extracted from these cells and mRNA expression was detected using quantitative real-time PCR. The expression of pro-apoptosis genes, such as BIK, PUMA, BMF, BAX, and MCL-1S, was higher in the combination treatment group than in the rapamycin-only group. The expression of anti-apoptosis genes, such as BCL-2, was decreased in the combination treatment group compared with the rapamycin-only group. The results represent the mean ± S.D. of three experiments performed in triplicate. * p
Figure Legend Snippet: Changes in BCL-2 family expression caused by rapamycin treatment and FAK down-regulation. REH-empty vector or REH-FAK shRNA cells were cultured with or without rapamycin (100 nM). After 10 h, RNA was extracted from these cells and mRNA expression was detected using quantitative real-time PCR. The expression of pro-apoptosis genes, such as BIK, PUMA, BMF, BAX, and MCL-1S, was higher in the combination treatment group than in the rapamycin-only group. The expression of anti-apoptosis genes, such as BCL-2, was decreased in the combination treatment group compared with the rapamycin-only group. The results represent the mean ± S.D. of three experiments performed in triplicate. * p

Techniques Used: Expressing, Plasmid Preparation, shRNA, Cell Culture, Real-time Polymerase Chain Reaction

27) Product Images from "Transcription factor NF-Y is involved in differentiation of R7 photoreceptor cell in Drosophila"

Article Title: Transcription factor NF-Y is involved in differentiation of R7 photoreceptor cell in Drosophila

Journal: Biology Open

doi: 10.1242/bio.2011013

Knockdown of dNF-YA reduces sev mRNA levels in third instar larvae. dNF-YA mRNA and sev mRNA levels were measured by quantitative RT-PCR. mRNA for Rp49 was used as a negative control. Fold differences against the amplification with RNA samples from Canton S are shown with standard deviations from three independent preparations of RNA.
Figure Legend Snippet: Knockdown of dNF-YA reduces sev mRNA levels in third instar larvae. dNF-YA mRNA and sev mRNA levels were measured by quantitative RT-PCR. mRNA for Rp49 was used as a negative control. Fold differences against the amplification with RNA samples from Canton S are shown with standard deviations from three independent preparations of RNA.

Techniques Used: Quantitative RT-PCR, Negative Control, Amplification

28) Product Images from "Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms"

Article Title: Tomato yellow leaf curl virus intergenic siRNAs target a host long noncoding RNA to modulate disease symptoms

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1007534

siRNA (-2752-21) targets tomato SlLNR1 . (A) Schematic illustration of SlLNR1 structure and its associated siRNAs. The sense SlLNR1 , SlLNR1 (+), from the susceptible cultivar is an 1132-nt lncRNA, which is validated by RACE. Its anti-sense, SlLNR1 (-), is generated by sequencing a segmental RT-PCR (the 54 th bp of the 3’ end to the 1008 th ). The full sequence of SlLNR1 was shown in S4 Fig . The vertical bar indicate the target site of siRNA(-2752-21). The data derived from small RNA sequencing of TYLCV infected plants or mock was aligned to SlLNR1 and the number indicates the aligned siRNA reads. (B) Negative correlation of expression of siRNA(-2752-21) and SlLNR1 . SlLNR1 (+) or SlLNR1 (-) was expressed with siRNA(-2752-21) in N . benthamiana . The RNA sample was extracted at 48 h after agroinfiltration. The EF1a gene of N . benthamiana was used as a refernce. (C) SlLNR1 was down regulated in the pTRV2:IR inoculated susceptible plants but not in the resistant plants. The RNA sample was extracted at 15 days after pTRV2:IR and EV inoculated plants. The relative expression of SlLNR1 was measured by qRT-PCR and calculated in relation to EV inoculated plants according to the ΔΔ Ct method. The tomato actin gene was set as reference gene. Error bars represented SE of three biological replicates and significant differences by Student’s t test (*, p
Figure Legend Snippet: siRNA (-2752-21) targets tomato SlLNR1 . (A) Schematic illustration of SlLNR1 structure and its associated siRNAs. The sense SlLNR1 , SlLNR1 (+), from the susceptible cultivar is an 1132-nt lncRNA, which is validated by RACE. Its anti-sense, SlLNR1 (-), is generated by sequencing a segmental RT-PCR (the 54 th bp of the 3’ end to the 1008 th ). The full sequence of SlLNR1 was shown in S4 Fig . The vertical bar indicate the target site of siRNA(-2752-21). The data derived from small RNA sequencing of TYLCV infected plants or mock was aligned to SlLNR1 and the number indicates the aligned siRNA reads. (B) Negative correlation of expression of siRNA(-2752-21) and SlLNR1 . SlLNR1 (+) or SlLNR1 (-) was expressed with siRNA(-2752-21) in N . benthamiana . The RNA sample was extracted at 48 h after agroinfiltration. The EF1a gene of N . benthamiana was used as a refernce. (C) SlLNR1 was down regulated in the pTRV2:IR inoculated susceptible plants but not in the resistant plants. The RNA sample was extracted at 15 days after pTRV2:IR and EV inoculated plants. The relative expression of SlLNR1 was measured by qRT-PCR and calculated in relation to EV inoculated plants according to the ΔΔ Ct method. The tomato actin gene was set as reference gene. Error bars represented SE of three biological replicates and significant differences by Student’s t test (*, p

Techniques Used: Generated, Sequencing, Reverse Transcription Polymerase Chain Reaction, Derivative Assay, RNA Sequencing Assay, Infection, Expressing, Quantitative RT-PCR

Identification of a 25-nt segment and a vsRNA that induce stunt and curled leaves in tomato. (A) VsRNAs generated by the IR and sequence alignment of vsRNAs and SlLNR1 . Location and frequency of TYCLV-derived siRNAs (vsRNAs) were mapped to the IR in sense- (above the x-axis) or antisense- (below the x-axis) orientation. Genome organization of the IR was shown at the top in which the inverted repeat was symbolized as a stem loop. Numbers indicate the first (2616) and last (147) nucleotides of the IR sequence. The histogram of location, frequency and size distribution of vsRNAs corresponding to the 25-nt-fragment (2730–2754) were shown at the medium panel. The fragment was highly complemented with SlLNR1 (-). The scissor means the cleavage site determined by 5’-RACE analysis. (B) Phenotypes of tomato inoculated with pTRV2:4TR. TYLCV-susceptible tomato plants were inoculated with pTRV2 containing 4×25-nt-fragment (2730–2754). The photos were taken at 15 dpi. (C) Validation of siRNA(-2752-21) in the tomato plants by siRNA Northern blot. The leaves of susceptible tomato plants inoculated by TYLCV infectious clone, natural infection by viruliferous whiteflies, agroinfiltrated with pTRV2:4TR and pTRV2:IR were used for total RNA extraction and analyzed at 24 dpi. U6 gene was set as the internal control. (D) Validation of siRNA(-2752-21) presence and downregulation of SlLNR1 in the overexpressed plants. Two individual transgenic lines (pCAMBIA2301:siRNA-1/2) with overexpression of siRNA(-2752-21) were used for total RNA extraction and analyzed. EV indicates the transgenic plant with the EV. The lower panel shows the relative expressi o n of SlLNR1 that was measured by qRT-PCR and calculated in relation to the transgenic plants according to the ΔΔ Ct method using tomat o actin gene as the reference. Error bars represented SE of three biological replicates and significant differences by Student’ s t test (*, p
Figure Legend Snippet: Identification of a 25-nt segment and a vsRNA that induce stunt and curled leaves in tomato. (A) VsRNAs generated by the IR and sequence alignment of vsRNAs and SlLNR1 . Location and frequency of TYCLV-derived siRNAs (vsRNAs) were mapped to the IR in sense- (above the x-axis) or antisense- (below the x-axis) orientation. Genome organization of the IR was shown at the top in which the inverted repeat was symbolized as a stem loop. Numbers indicate the first (2616) and last (147) nucleotides of the IR sequence. The histogram of location, frequency and size distribution of vsRNAs corresponding to the 25-nt-fragment (2730–2754) were shown at the medium panel. The fragment was highly complemented with SlLNR1 (-). The scissor means the cleavage site determined by 5’-RACE analysis. (B) Phenotypes of tomato inoculated with pTRV2:4TR. TYLCV-susceptible tomato plants were inoculated with pTRV2 containing 4×25-nt-fragment (2730–2754). The photos were taken at 15 dpi. (C) Validation of siRNA(-2752-21) in the tomato plants by siRNA Northern blot. The leaves of susceptible tomato plants inoculated by TYLCV infectious clone, natural infection by viruliferous whiteflies, agroinfiltrated with pTRV2:4TR and pTRV2:IR were used for total RNA extraction and analyzed at 24 dpi. U6 gene was set as the internal control. (D) Validation of siRNA(-2752-21) presence and downregulation of SlLNR1 in the overexpressed plants. Two individual transgenic lines (pCAMBIA2301:siRNA-1/2) with overexpression of siRNA(-2752-21) were used for total RNA extraction and analyzed. EV indicates the transgenic plant with the EV. The lower panel shows the relative expressi o n of SlLNR1 that was measured by qRT-PCR and calculated in relation to the transgenic plants according to the ΔΔ Ct method using tomat o actin gene as the reference. Error bars represented SE of three biological replicates and significant differences by Student’ s t test (*, p

Techniques Used: Generated, Sequencing, Derivative Assay, Northern Blot, Infection, RNA Extraction, Transgenic Assay, Over Expression, Quantitative RT-PCR

29) Product Images from "Injury factors alter miRNAs profiles of exosomes derived from islets and circulation"

Article Title: Injury factors alter miRNAs profiles of exosomes derived from islets and circulation

Journal: Aging (Albany NY)

doi: 10.18632/aging.101689

Expression of screened miRNAs in serum exosomes of STZ treated mice. Serum was sampled from ICR mice at different time after STZ injection. Fasting tail blood glucose ( A ) and serum insulin ( B ) levels were measured. The expression of 4 serum exosomal miRNAs selected from microarray miR-375-3p ( C ), miR-129-5p ( D ), miR-378a-3p ( E ), miR-382-5p ( F ) were analyzed using qRT-PCR. Values represent means ± SEM (n≥9 mice of each time point). (* P
Figure Legend Snippet: Expression of screened miRNAs in serum exosomes of STZ treated mice. Serum was sampled from ICR mice at different time after STZ injection. Fasting tail blood glucose ( A ) and serum insulin ( B ) levels were measured. The expression of 4 serum exosomal miRNAs selected from microarray miR-375-3p ( C ), miR-129-5p ( D ), miR-378a-3p ( E ), miR-382-5p ( F ) were analyzed using qRT-PCR. Values represent means ± SEM (n≥9 mice of each time point). (* P

Techniques Used: Expressing, Mouse Assay, Injection, Microarray, Quantitative RT-PCR

Validation of exosomal miRNAs detected by microarray. Four miRNAs with top high FC values (FC > 1.5 in both STZ and cytokines treated groups) miR-375-3p ( A ), miR-129-5p ( B ), miR-378a-3p ( C ), miR-382-5p ( D ) were further verified by qRT-PCR in three independent samples. The data are presented as mean±SEM. (* P
Figure Legend Snippet: Validation of exosomal miRNAs detected by microarray. Four miRNAs with top high FC values (FC > 1.5 in both STZ and cytokines treated groups) miR-375-3p ( A ), miR-129-5p ( B ), miR-378a-3p ( C ), miR-382-5p ( D ) were further verified by qRT-PCR in three independent samples. The data are presented as mean±SEM. (* P

Techniques Used: Microarray, Quantitative RT-PCR

Serum exosomal miRNA-375 and miRNA-129 expression in T1DM and T2DM patients with different β cell function. After standard mixed meal tolerance tests, the area under curve (AUC) of plasma glucose were measured ( A ), and the ratio of C-peptide AUC to glucose AUC were calculated to evaluate islet β cell function ( B ). Serum exosomal miRNA-375 ( E , F ) and miRNA-129 ( G , H ) expression in T1DM and T2DM patients with diverse diabetes course were detected by qRT-PCR. All measurements are mean ± SEM (n≥10 subjects of each group) (* P
Figure Legend Snippet: Serum exosomal miRNA-375 and miRNA-129 expression in T1DM and T2DM patients with different β cell function. After standard mixed meal tolerance tests, the area under curve (AUC) of plasma glucose were measured ( A ), and the ratio of C-peptide AUC to glucose AUC were calculated to evaluate islet β cell function ( B ). Serum exosomal miRNA-375 ( E , F ) and miRNA-129 ( G , H ) expression in T1DM and T2DM patients with diverse diabetes course were detected by qRT-PCR. All measurements are mean ± SEM (n≥10 subjects of each group) (* P

Techniques Used: Expressing, Cell Function Assay, Quantitative RT-PCR

30) Product Images from "Long Non-Coding RNA LINC01783 Promotes the Progression of Cervical Cancer by Sponging miR-199b-5p to Mediate GBP1 Expression"

Article Title: Long Non-Coding RNA LINC01783 Promotes the Progression of Cervical Cancer by Sponging miR-199b-5p to Mediate GBP1 Expression

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S230171

GBP1 is a direct target of miR-199b-5p. ( A ) Supposed miRNA binding sites in GBP1 sequences. ( B ) Direct target sites as verified by dual-luciferase reporter gene assay. ( C ) GBP1 expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic based on qRT-PCR. ( D ) Western Blot for protein level of GBP1 in HcerEpic, HeLa and C-33A cell lines. ( E ) GBP1 expression in cervical cancer tissues and normal tissues on TCGA dataset. ( F ) The correlation between miR-199b-5p and GBP1 on TCGA dataset. * P
Figure Legend Snippet: GBP1 is a direct target of miR-199b-5p. ( A ) Supposed miRNA binding sites in GBP1 sequences. ( B ) Direct target sites as verified by dual-luciferase reporter gene assay. ( C ) GBP1 expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic based on qRT-PCR. ( D ) Western Blot for protein level of GBP1 in HcerEpic, HeLa and C-33A cell lines. ( E ) GBP1 expression in cervical cancer tissues and normal tissues on TCGA dataset. ( F ) The correlation between miR-199b-5p and GBP1 on TCGA dataset. * P

Techniques Used: Binding Assay, Luciferase, Reporter Gene Assay, Expressing, Quantitative RT-PCR, Western Blot

LINC01783 is increased in cervical cancer. ( A ) LINC01783 expression in cervical cancer tissues and normal tissues on TCGA dataset. ( B ) Overall survival of cervical cancer patients stratified by LINC01783 expression based on TCGA dataset. ( C ) LINC01783 expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic as determined by qRT-PCR. * P
Figure Legend Snippet: LINC01783 is increased in cervical cancer. ( A ) LINC01783 expression in cervical cancer tissues and normal tissues on TCGA dataset. ( B ) Overall survival of cervical cancer patients stratified by LINC01783 expression based on TCGA dataset. ( C ) LINC01783 expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic as determined by qRT-PCR. * P

Techniques Used: Expressing, Quantitative RT-PCR

Direct interaction of LINC01783 with miR-199b-5p. ( A ) Cytoplasmic and nuclear level of LINC01783 in HeLa and C-33A cells as determined by qRT-PCR. ( B ) MiR-199b-5p expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic as indicated by qRT-PCR. ( C ) MiR-199b-5p expression in cervical cancer tissues and normal tissues on TCGA dataset. ( D ) The correlation between miR-199b-5p and LINC01783 on TCGA dataset. ( E ) Bioinformatics evidences of miR-199b-5p binding onto 3ʹ-UTR of LINC01783. ( F ) Dual-luciferase reporter gene assay in HeLa and C-33A cells post transfection with miR-NC or miR-199b-5p mimics. ( G ) Amount of LINC01783 and miR-199b-5p in HeLa and C-33A cells as detected by RIP experiments. * P
Figure Legend Snippet: Direct interaction of LINC01783 with miR-199b-5p. ( A ) Cytoplasmic and nuclear level of LINC01783 in HeLa and C-33A cells as determined by qRT-PCR. ( B ) MiR-199b-5p expression in cervical cancer cell lines (SW756, C-33A, SiHa, HeLa and CaSki) and normal human cervical epithelial cell line HcerEpic as indicated by qRT-PCR. ( C ) MiR-199b-5p expression in cervical cancer tissues and normal tissues on TCGA dataset. ( D ) The correlation between miR-199b-5p and LINC01783 on TCGA dataset. ( E ) Bioinformatics evidences of miR-199b-5p binding onto 3ʹ-UTR of LINC01783. ( F ) Dual-luciferase reporter gene assay in HeLa and C-33A cells post transfection with miR-NC or miR-199b-5p mimics. ( G ) Amount of LINC01783 and miR-199b-5p in HeLa and C-33A cells as detected by RIP experiments. * P

Techniques Used: Quantitative RT-PCR, Expressing, Binding Assay, Luciferase, Reporter Gene Assay, Transfection

LINC01783/miR-199b-5p axis is critical for GBP1 expression. ( A ) Transfection of MiR-199b-5p inhibitor with or without LINC01783 siRNA into HeLa cells and qRT-PCR evaluation for RNA level of GBP1. ( B ) Western blot of GBP1 protein level after treatment of HeLa cells, GAPDH as the control. ( C ) Transfection of C-33A cells with miR-199b-5p mimics with or without LINC01783 overexpression plasmid and relative RNA levels of GBP1 as detected by qRT-PCR. ( D ) Relative protein level of GBP1 for transfection with miR-199b-5p mimics and reversion by LINC01783 expression plasmid. ( E ) Relative RNA level of GBP1 for transfection with LINC01783 MUT overexpression plasmid or LINC01783 WT overexpression plasmid. ( F ) Relative protein level of GBP1 for transfection with LINC01783 WT overexpression plasmid or LINC01783 MUT overexpression plasmid. ** P
Figure Legend Snippet: LINC01783/miR-199b-5p axis is critical for GBP1 expression. ( A ) Transfection of MiR-199b-5p inhibitor with or without LINC01783 siRNA into HeLa cells and qRT-PCR evaluation for RNA level of GBP1. ( B ) Western blot of GBP1 protein level after treatment of HeLa cells, GAPDH as the control. ( C ) Transfection of C-33A cells with miR-199b-5p mimics with or without LINC01783 overexpression plasmid and relative RNA levels of GBP1 as detected by qRT-PCR. ( D ) Relative protein level of GBP1 for transfection with miR-199b-5p mimics and reversion by LINC01783 expression plasmid. ( E ) Relative RNA level of GBP1 for transfection with LINC01783 MUT overexpression plasmid or LINC01783 WT overexpression plasmid. ( F ) Relative protein level of GBP1 for transfection with LINC01783 WT overexpression plasmid or LINC01783 MUT overexpression plasmid. ** P

Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Western Blot, Over Expression, Plasmid Preparation

31) Product Images from "MicroRNA-21 plays an oncogenic role by targeting FOXO1 and activating the PI3K/AKT pathway in diffuse large B-cell lymphoma"

Article Title: MicroRNA-21 plays an oncogenic role by targeting FOXO1 and activating the PI3K/AKT pathway in diffuse large B-cell lymphoma

Journal: Oncotarget

doi:

FOXO1, which is directly targeted by miR-21 in addition to PTEN, controls Bim expression at a transcriptional level in DLBCLs A , The expression levels of miR-21, FOXO1, and PTEN were evaluated in GCB-DLBCL and ABC-DLBCL cell lines using qRT-PCR. The bar graph shows the relative expression levels (2 −ddCt ) of miR-21, FOXO1, and PTEN in each cell line compared with those of OCI-Ly1 cells. B , SU-DHL4 and SU-DHL5 cells were transfected with a miR-21 inhibitor or a negative (scramble) inhibitor using Lipofectamine 2000, and the cells were harvested at 24 hours after transfection. The expression levels of FOXO1 and PTEN in cells that were transfected with the miR-21 inhibitor were compared with those transfected with the negative inhibitor using qRT-PCR. C , OCI-Ly10 cells were transfected with miR-21 mimics or negative (scramble) mimics, and the differences in the expression levels of FOXO1 and PTEN between the negative- and miR-21 mimic-cells were assessed using qRT-PCR. D , The FOXO1 3′-untranslated region (UTR)-luciferase reporter construct containing many miR-21 binding motifs (5′-AGCUUAU-3′) was co-transfected into SU-DHL-4 and SU-DHL5 cells together with a miR-21 mimic, negative mimic, miR-21 inhibitor or negative inhibitor. At 24 hours post-transfection, the supernatant fractions of the lysed cells were recovered, and the luciferase activities were determined using a luminometer. E , At 24 hours after transfection of the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells, or miR-21 mimics or negative mimics into OCI-Ly10 cells, Western blotting was performed to determine FOXO1 level in the nucleus of tumor cells. F , Changes in the expression of FOXO1 target genes, including p27, p21, FasL and Bim, were evaluated using qRT-PCR after inhibiting the expression of miR-21 in SU-DHL4 and SU-DHL5 cells. G , A Bim promoter luciferase-reporter construct containing many copies of the FOXO1 binding motif (5′-GTAAACAA-3′) was co-transfected with either a miR-21 inhibitor or negative inhibitor into SU-DHL4 or SU-DHL5 cells. At 24 hours post-transfection, the supernatant fractions of the lysed cells were recovered, and the luciferase activities were measured using a luminometer. The values presented in the histogram are the mean values ± SD. Statistically significant differences are indicated by * and **, which signify P
Figure Legend Snippet: FOXO1, which is directly targeted by miR-21 in addition to PTEN, controls Bim expression at a transcriptional level in DLBCLs A , The expression levels of miR-21, FOXO1, and PTEN were evaluated in GCB-DLBCL and ABC-DLBCL cell lines using qRT-PCR. The bar graph shows the relative expression levels (2 −ddCt ) of miR-21, FOXO1, and PTEN in each cell line compared with those of OCI-Ly1 cells. B , SU-DHL4 and SU-DHL5 cells were transfected with a miR-21 inhibitor or a negative (scramble) inhibitor using Lipofectamine 2000, and the cells were harvested at 24 hours after transfection. The expression levels of FOXO1 and PTEN in cells that were transfected with the miR-21 inhibitor were compared with those transfected with the negative inhibitor using qRT-PCR. C , OCI-Ly10 cells were transfected with miR-21 mimics or negative (scramble) mimics, and the differences in the expression levels of FOXO1 and PTEN between the negative- and miR-21 mimic-cells were assessed using qRT-PCR. D , The FOXO1 3′-untranslated region (UTR)-luciferase reporter construct containing many miR-21 binding motifs (5′-AGCUUAU-3′) was co-transfected into SU-DHL-4 and SU-DHL5 cells together with a miR-21 mimic, negative mimic, miR-21 inhibitor or negative inhibitor. At 24 hours post-transfection, the supernatant fractions of the lysed cells were recovered, and the luciferase activities were determined using a luminometer. E , At 24 hours after transfection of the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells, or miR-21 mimics or negative mimics into OCI-Ly10 cells, Western blotting was performed to determine FOXO1 level in the nucleus of tumor cells. F , Changes in the expression of FOXO1 target genes, including p27, p21, FasL and Bim, were evaluated using qRT-PCR after inhibiting the expression of miR-21 in SU-DHL4 and SU-DHL5 cells. G , A Bim promoter luciferase-reporter construct containing many copies of the FOXO1 binding motif (5′-GTAAACAA-3′) was co-transfected with either a miR-21 inhibitor or negative inhibitor into SU-DHL4 or SU-DHL5 cells. At 24 hours post-transfection, the supernatant fractions of the lysed cells were recovered, and the luciferase activities were measured using a luminometer. The values presented in the histogram are the mean values ± SD. Statistically significant differences are indicated by * and **, which signify P

Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Luciferase, Construct, Binding Assay, Western Blot

Expression of miR-21, the miR-17-92 cluster and miR-155 in tumor tissues of DLBCL patients and their prognostic implications A , The levels of expression of miR-21, the miR-17-92 cluster and miR-155 were evaluated in the tumor tissues of DLBCL patients (n = 200) and in normal tonsils as a control (n = 11) using qRT-PCR. Box-and-whisker plots demonstrate the levels of expression of miR-21, the miR-17-92 cluster, and miR-155 as dCt (= Ct (miRNA) - Ct (U6) ) values in the DLBCL tissues compared with those in normal tonsils. A lower dCt implies a higher relative level of miRNA. The differences in the miRNA levels of the DLBCL and normal group were evaluated using Student's t-test. B , The relative expression levels of the miRNAs were calculated as ddCt (= dCt (case) - mean dCt (control) ). The diagrams show the correlation of the relative expression levels of miR-21, the miR-17-92 cluster and miR-155 determined using Pearson's correlation analysis (r, correlation coefficient). Kaplan-Meier curves obtained using the log-rank test show C - E , the overall survival and F - H , the progression-free survival of patients with DLBCLs with high vs. low relative expression levels of miR-21, the miR-17-92 cluster, and miR-155.
Figure Legend Snippet: Expression of miR-21, the miR-17-92 cluster and miR-155 in tumor tissues of DLBCL patients and their prognostic implications A , The levels of expression of miR-21, the miR-17-92 cluster and miR-155 were evaluated in the tumor tissues of DLBCL patients (n = 200) and in normal tonsils as a control (n = 11) using qRT-PCR. Box-and-whisker plots demonstrate the levels of expression of miR-21, the miR-17-92 cluster, and miR-155 as dCt (= Ct (miRNA) - Ct (U6) ) values in the DLBCL tissues compared with those in normal tonsils. A lower dCt implies a higher relative level of miRNA. The differences in the miRNA levels of the DLBCL and normal group were evaluated using Student's t-test. B , The relative expression levels of the miRNAs were calculated as ddCt (= dCt (case) - mean dCt (control) ). The diagrams show the correlation of the relative expression levels of miR-21, the miR-17-92 cluster and miR-155 determined using Pearson's correlation analysis (r, correlation coefficient). Kaplan-Meier curves obtained using the log-rank test show C - E , the overall survival and F - H , the progression-free survival of patients with DLBCLs with high vs. low relative expression levels of miR-21, the miR-17-92 cluster, and miR-155.

Techniques Used: Expressing, Quantitative RT-PCR, Whisker Assay

MiR-21 regulates the PI3K/AKT/mTOR/FOXO1 pathway and involved in the drug resistance and proliferation of DLBCL cells At 24 hours after transfection of A , the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells or B , miR-21 mimics or negative mimics into OCI-Ly10 cells, Western blotting was performed to determine the levels of phospho-AKT, AKT, phospho-p70S6K, p70S6K, phospho-FOXO1, FOXO1 and Bim. C , SU-DHL4, SU-DHL5, and OCI-Ly10 cells were treated with increasing doses of LY294002, a PI3K inhibitor. At 24 hours after incubation, Western blotting was performed to determine the levels of FOXO1 and Bim. D , OCI-Ly10 cells were treated with increasing doses of AS1842856, a functional inhibitor of FOXO1, and 2 hours after incubation, Western blotting was performed to determine the levels of phospho-p70S6K and p70S6K. At 24 hours after transfection of E , the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells, or F , miR-21 mimics or negative mimics into OCI-Ly10 cells, the expression levels of ABCB1 (MDR1) and ABCG2 were evaluated using qRT-PCR. G , SU-DHL4 and SU-DHL5 cells were treated with the miR-21 inhibitor or negative inhibitor for 24 hours and co-incubated with the efflux-blocking drug, vinblastine, for the last 30 minutes. The cells were then stained with DiOC 2 , and their drug efflux activity was analyzed. A decrease in the percentage of DiOC 2 -staining cells determined using FACS represents an increase in the population of cells with drug efflux activity. H , The effect of miR-21 inhibition on the doxorubicin-induced cytotoxicity in SU-DHL4 and SU-DHL5 cells was evaluated using the CCK8 assay. I , The effect of miR-21 overexpression on the doxorubicin-induced cytotoxicity in OCI-Ly10 cells was assessed using the CCK8 assay. J , The relative rates of cell proliferation of OCI-Ly10 cells treated with DMSO (control) and doxorubicin and/or the FOXO1 inhibitor (AS1842856) were determined using the CCK8 assay. The values presented in the histogram are the mean values ± SD. Statistically significant differences are indicated by *, ** and ***, which signify P
Figure Legend Snippet: MiR-21 regulates the PI3K/AKT/mTOR/FOXO1 pathway and involved in the drug resistance and proliferation of DLBCL cells At 24 hours after transfection of A , the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells or B , miR-21 mimics or negative mimics into OCI-Ly10 cells, Western blotting was performed to determine the levels of phospho-AKT, AKT, phospho-p70S6K, p70S6K, phospho-FOXO1, FOXO1 and Bim. C , SU-DHL4, SU-DHL5, and OCI-Ly10 cells were treated with increasing doses of LY294002, a PI3K inhibitor. At 24 hours after incubation, Western blotting was performed to determine the levels of FOXO1 and Bim. D , OCI-Ly10 cells were treated with increasing doses of AS1842856, a functional inhibitor of FOXO1, and 2 hours after incubation, Western blotting was performed to determine the levels of phospho-p70S6K and p70S6K. At 24 hours after transfection of E , the miR-21 inhibitor or negative inhibitor into SU-DHL4 and SU-DHL5 cells, or F , miR-21 mimics or negative mimics into OCI-Ly10 cells, the expression levels of ABCB1 (MDR1) and ABCG2 were evaluated using qRT-PCR. G , SU-DHL4 and SU-DHL5 cells were treated with the miR-21 inhibitor or negative inhibitor for 24 hours and co-incubated with the efflux-blocking drug, vinblastine, for the last 30 minutes. The cells were then stained with DiOC 2 , and their drug efflux activity was analyzed. A decrease in the percentage of DiOC 2 -staining cells determined using FACS represents an increase in the population of cells with drug efflux activity. H , The effect of miR-21 inhibition on the doxorubicin-induced cytotoxicity in SU-DHL4 and SU-DHL5 cells was evaluated using the CCK8 assay. I , The effect of miR-21 overexpression on the doxorubicin-induced cytotoxicity in OCI-Ly10 cells was assessed using the CCK8 assay. J , The relative rates of cell proliferation of OCI-Ly10 cells treated with DMSO (control) and doxorubicin and/or the FOXO1 inhibitor (AS1842856) were determined using the CCK8 assay. The values presented in the histogram are the mean values ± SD. Statistically significant differences are indicated by *, ** and ***, which signify P

Techniques Used: Transfection, Western Blot, Incubation, Functional Assay, Expressing, Quantitative RT-PCR, Blocking Assay, Staining, Activity Assay, FACS, Inhibition, CCK-8 Assay, Over Expression

32) Product Images from "Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression"

Article Title: Exosomes derived from preadipocytes improve osteogenic differentiation, potentially via reduced miR-223 expression

Journal: Molecular Medicine Reports

doi: 10.3892/mmr.2018.9760

3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P
Figure Legend Snippet: 3T3L1-exo activates 3T3L1 preadipocytes to undergo osteogenic differentiation via TGF-β signaling. (A) Western blot analysis detected p-smad3 and smad3 expression in 3T3L1 cells following stimulation with 3T3L1-exo for the indicated durations. (B) Reverse transcription-quantitative polymerase chain reaction was conducted to determine the mRNA expression levels of runt-related transcription factor 2 in 3T3L1 cells stimulated with ODM and/or 3T3L1 exo following treatment with the transforming growth factor-β inhibitor (SB431542). *P

Techniques Used: Western Blot, Expressing, Real-time Polymerase Chain Reaction

33) Product Images from "Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy"

Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy

Journal: Oncology Letters

doi: 10.3892/ol.2019.10047

pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.
Figure Legend Snippet: pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

Techniques Used: Expressing, Plasmid Preparation, RNA Extraction, Gel Extraction, Marker, Polymerase Chain Reaction, Recombinant

34) Product Images from "RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells"

Article Title: RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S186981

Expression patterns of RAP80 in breast cancer cell lines. Notes: Total RNA and proteins were extracted from wild-type MCF-7, ZR-75, and MDA-MB-231, then subjected to qRT-PCR and Western blotting for RAP80. Both protein ( A – D ) and mRNA ( C , E ) expression of RAP80 were observed consistently in MCF-7, but ZR-75 and MDA-MB-231 had very weak RAP80 mRNA and protein expression. Therefore, we picked MCF-7 for transfection with RAP80 siRNA. Data are presented as mean ± SD of three independent experiments, * P
Figure Legend Snippet: Expression patterns of RAP80 in breast cancer cell lines. Notes: Total RNA and proteins were extracted from wild-type MCF-7, ZR-75, and MDA-MB-231, then subjected to qRT-PCR and Western blotting for RAP80. Both protein ( A – D ) and mRNA ( C , E ) expression of RAP80 were observed consistently in MCF-7, but ZR-75 and MDA-MB-231 had very weak RAP80 mRNA and protein expression. Therefore, we picked MCF-7 for transfection with RAP80 siRNA. Data are presented as mean ± SD of three independent experiments, * P

Techniques Used: Expressing, Multiple Displacement Amplification, Quantitative RT-PCR, Western Blot, Transfection

35) Product Images from "Exendin-4 ameliorates oxidized-LDL-induced inhibition of macrophage migration in vitro via the NF-κB pathway"

Article Title: Exendin-4 ameliorates oxidized-LDL-induced inhibition of macrophage migration in vitro via the NF-κB pathway

Journal: Acta Pharmacologica Sinica

doi: 10.1038/aps.2013.128

RNA extraction and semi-quantitative RT-PCR
Figure Legend Snippet: RNA extraction and semi-quantitative RT-PCR

Techniques Used: RNA Extraction, Quantitative RT-PCR

36) Product Images from "Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice"

Article Title: Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice

Journal: Immunology letters

doi: 10.1016/j.imlet.2010.09.009

Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.
Figure Legend Snippet: Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.

Techniques Used: Selection, Mouse Assay, Magnetic Beads, Polymerase Chain Reaction, Produced, Real-time Polymerase Chain Reaction, Expressing

37) Product Images from "Network-based approach to prediction and population-based validation of in silico drug repurposing"

Article Title: Network-based approach to prediction and population-based validation of in silico drug repurposing

Journal: Nature Communications

doi: 10.1038/s41467-018-05116-5

Experimental validation of hydroxychloroquine’s likely mechanism-of-action in coronary artery disease (CAD). a A highlighted subnetwork shows the inferred mechanism-of-action for hydroxychloroquine’s protective effect in CAD by network analysis. A network analysis was designed to meet four criteria: (1) the shortest paths from the known drug targets (TLR7 and TLR9) in the human protein–protein interaction network; (2) the blood vessel-specific gene expression level based on RNA-seq data from Genotype-Tissue Expression database; (3) known CAD or cardiovascular disease (CVD) gene products (proteins); and (4) literature-reported in vitro and in vivo evidence. There are three proposed mechanisms: (i) ERK5 (encoded by MAPK7 ) activation prevents endothelial inflammation via inhibition of cell adhesion molecule expression (VCAM-1 and ICAM-1), (ii) suppression of pro-inflammatory cytokines (TNF-α and IL-1β), and (iii) improvement in endothelial dysfunction via enhanced nitric oxide production by endothelial nitric oxide synthase (NOS3). The node size scales show the blood vessel-specific expression level based on RNA-seq data from Genotype-Tissue Expression database (Methods section). b , d Endothelial cells were pretreated with various concentrations of hydroxychloroquine (HCQ, 10–50 µM) for 1 h prior to 24 h incubation with 5 ng/ml TNF-α. qRT-PCR was used to monitor gene expression of inflammatory genes ( b ) VCAM1 and IL1B ; and ( d ) NOS3 . Expression of the β-actin gene was used as an internal standard. VCAM1: no HCQ, no TNF, n = 8; TNF; n = 8; TNF+ 10 μM HCQ, n = 5; TNF+ 20 μM HCQ, n = 4; TNF+ 30 μM HCQ, n = 3; TNF+ 50 μM HCQ, n = 6. IL-1β and NOS3: no HCQ, no TNF, n = 9; TNF; n = 9; TNF+ 10 μM HCQ, n = 5; TNF+ 20 μM HCQ, n = 5; TNF+ 30 μM HCQ, n = 4; TNF+ 50 μM HCQ, n = 6. Error bars are standard deviations. *significantly different from TNF-α with no HCQ, p
Figure Legend Snippet: Experimental validation of hydroxychloroquine’s likely mechanism-of-action in coronary artery disease (CAD). a A highlighted subnetwork shows the inferred mechanism-of-action for hydroxychloroquine’s protective effect in CAD by network analysis. A network analysis was designed to meet four criteria: (1) the shortest paths from the known drug targets (TLR7 and TLR9) in the human protein–protein interaction network; (2) the blood vessel-specific gene expression level based on RNA-seq data from Genotype-Tissue Expression database; (3) known CAD or cardiovascular disease (CVD) gene products (proteins); and (4) literature-reported in vitro and in vivo evidence. There are three proposed mechanisms: (i) ERK5 (encoded by MAPK7 ) activation prevents endothelial inflammation via inhibition of cell adhesion molecule expression (VCAM-1 and ICAM-1), (ii) suppression of pro-inflammatory cytokines (TNF-α and IL-1β), and (iii) improvement in endothelial dysfunction via enhanced nitric oxide production by endothelial nitric oxide synthase (NOS3). The node size scales show the blood vessel-specific expression level based on RNA-seq data from Genotype-Tissue Expression database (Methods section). b , d Endothelial cells were pretreated with various concentrations of hydroxychloroquine (HCQ, 10–50 µM) for 1 h prior to 24 h incubation with 5 ng/ml TNF-α. qRT-PCR was used to monitor gene expression of inflammatory genes ( b ) VCAM1 and IL1B ; and ( d ) NOS3 . Expression of the β-actin gene was used as an internal standard. VCAM1: no HCQ, no TNF, n = 8; TNF; n = 8; TNF+ 10 μM HCQ, n = 5; TNF+ 20 μM HCQ, n = 4; TNF+ 30 μM HCQ, n = 3; TNF+ 50 μM HCQ, n = 6. IL-1β and NOS3: no HCQ, no TNF, n = 9; TNF; n = 9; TNF+ 10 μM HCQ, n = 5; TNF+ 20 μM HCQ, n = 5; TNF+ 30 μM HCQ, n = 4; TNF+ 50 μM HCQ, n = 6. Error bars are standard deviations. *significantly different from TNF-α with no HCQ, p

Techniques Used: Expressing, RNA Sequencing Assay, In Vitro, In Vivo, Activation Assay, Inhibition, Incubation, Quantitative RT-PCR

38) Product Images from "Obesity and p16INK4A Downregulation Activate Breast Adipocytes and Promote Their Protumorigenicity"

Article Title: Obesity and p16INK4A Downregulation Activate Breast Adipocytes and Promote Their Protumorigenicity

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.00101-17

Breast adipocytes from obese females promote EMT and tumor growth. LeaL-10 cells were exposed to SFM or SFCM from four Obadi and four Leadi cells for 24 h. (A) The migration/invasion and proliferation capabilities were assessed. The graphs are representative of different experiments. (B) Cell lysates were prepared and used for immunoblotting. (C) Total RNA was prepared from LeaL-10 cells grown in 3D cultures and used to assess the level of the indicated transcripts by qRT-PCR. Error bars represent means ± SD of values from three different experiments. *, P ≤ 2.33 × 10 −5 . (D and E) LeaL-10 cells were exposed to SFM, SFCM from Obadi-1 cells containing either antileptin or anti-IgG antibodies, or SFCM from Leadi-1 cells containing the human leptin protein for 24 h and then were utilized to assess the migration/invasion and proliferation capabilities (the graphs are representative of different experiments) or the levels of the indicated proteins by immunoblotting.
Figure Legend Snippet: Breast adipocytes from obese females promote EMT and tumor growth. LeaL-10 cells were exposed to SFM or SFCM from four Obadi and four Leadi cells for 24 h. (A) The migration/invasion and proliferation capabilities were assessed. The graphs are representative of different experiments. (B) Cell lysates were prepared and used for immunoblotting. (C) Total RNA was prepared from LeaL-10 cells grown in 3D cultures and used to assess the level of the indicated transcripts by qRT-PCR. Error bars represent means ± SD of values from three different experiments. *, P ≤ 2.33 × 10 −5 . (D and E) LeaL-10 cells were exposed to SFM, SFCM from Obadi-1 cells containing either antileptin or anti-IgG antibodies, or SFCM from Leadi-1 cells containing the human leptin protein for 24 h and then were utilized to assess the migration/invasion and proliferation capabilities (the graphs are representative of different experiments) or the levels of the indicated proteins by immunoblotting.

Techniques Used: Migration, Quantitative RT-PCR

Obesity promotes EMT in breast epithelium. (A and B) Immunofluorescence for the indicated FFPE breast tissues. Scale bar, 50 μm. (C and E) Normal breast luminal cells were subjected to cytospins and used for immunofluorescence. Scale bars, 50 μm. The histogram shows the mean Ki-67 labeling index for three ObeL and three LeaL cells. Error bars represent means ± SD of values from three independent experiments. **, P ≤ 0.000457. (D) Total RNA from three LeaL and three ObeL luminal cells was utilized to assess the level of the indicated genes by qRT-PCR. Values are the means ± SEM ( n = 3). Error bars represent means ± SD of values from three independent experiments. **, P = 0.000174. (F) Three ObeL and three LeaL cells were seeded in complete medium in the E-plate, and the proliferation rate was assessed. The graph is representative of different experiments.
Figure Legend Snippet: Obesity promotes EMT in breast epithelium. (A and B) Immunofluorescence for the indicated FFPE breast tissues. Scale bar, 50 μm. (C and E) Normal breast luminal cells were subjected to cytospins and used for immunofluorescence. Scale bars, 50 μm. The histogram shows the mean Ki-67 labeling index for three ObeL and three LeaL cells. Error bars represent means ± SD of values from three independent experiments. **, P ≤ 0.000457. (D) Total RNA from three LeaL and three ObeL luminal cells was utilized to assess the level of the indicated genes by qRT-PCR. Values are the means ± SEM ( n = 3). Error bars represent means ± SD of values from three independent experiments. **, P = 0.000174. (F) Three ObeL and three LeaL cells were seeded in complete medium in the E-plate, and the proliferation rate was assessed. The graph is representative of different experiments.

Techniques Used: Immunofluorescence, Formalin-fixed Paraffin-Embedded, Labeling, Quantitative RT-PCR

p16 suppresses the expression and secretion of leptin through targeting miR-141 and miR-146b-5p. (A and C to F) Total RNA from Leadi-sh and Leadi-C cells expressing the indicated constructs was utilized to assess the indicated transcripts by qRT-PCR. (B) SFCM from the indicated cells was used to assess the level of the secreted leptin by ELISA. Error bars represent means ± SD of values from three independent experiments. *, P ≤ 0.0002; **, P ≤ 0.000022.
Figure Legend Snippet: p16 suppresses the expression and secretion of leptin through targeting miR-141 and miR-146b-5p. (A and C to F) Total RNA from Leadi-sh and Leadi-C cells expressing the indicated constructs was utilized to assess the indicated transcripts by qRT-PCR. (B) SFCM from the indicated cells was used to assess the level of the secreted leptin by ELISA. Error bars represent means ± SD of values from three independent experiments. *, P ≤ 0.0002; **, P ≤ 0.000022.

Techniques Used: Expressing, Construct, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Breast adipocytes from obese females express low levels of p16 and high levels of leptin. (A) Mature adipocytes were subjected to cytospins, stained with Oil Red O or fixed with 4% paraformaldehyde, and then used for immunofluorescence utilizing the indicated antibodies. (B) Cell extracts were prepared from the indicated adipocytes and used for immunoblotting. (C) Immunohistochemistry for the indicated FFPE adipose tissues using antibodies against the indicated proteins. Scale bars, 50 μm. (D) Total RNA was prepared from the indicated adipocytes and utilized to assess the level of the indicated genes by qRT-PCR (upper panels) and the mean values of all Obadi and all Leadi cells (lower panels). Error bars represent means ± SD from three independent experiments. (E) Breast adipocytes from three lean and three obese females were treated with actinomycin D for the indicated periods of time. Total RNA was prepared, and the remaining amount of the CDKN2A mRNA was assessed by qRT-PCR. The values at time zero were considered 100%. The dashed lines reveal the half-life (50% mRNA remaining) using regression analysis. Error bars represent means ± SD from three independent experiments.
Figure Legend Snippet: Breast adipocytes from obese females express low levels of p16 and high levels of leptin. (A) Mature adipocytes were subjected to cytospins, stained with Oil Red O or fixed with 4% paraformaldehyde, and then used for immunofluorescence utilizing the indicated antibodies. (B) Cell extracts were prepared from the indicated adipocytes and used for immunoblotting. (C) Immunohistochemistry for the indicated FFPE adipose tissues using antibodies against the indicated proteins. Scale bars, 50 μm. (D) Total RNA was prepared from the indicated adipocytes and utilized to assess the level of the indicated genes by qRT-PCR (upper panels) and the mean values of all Obadi and all Leadi cells (lower panels). Error bars represent means ± SD from three independent experiments. (E) Breast adipocytes from three lean and three obese females were treated with actinomycin D for the indicated periods of time. Total RNA was prepared, and the remaining amount of the CDKN2A mRNA was assessed by qRT-PCR. The values at time zero were considered 100%. The dashed lines reveal the half-life (50% mRNA remaining) using regression analysis. Error bars represent means ± SD from three independent experiments.

Techniques Used: Staining, Immunofluorescence, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Quantitative RT-PCR

39) Product Images from "Hypoxia-induced Suppression of c-Myc by HIF-2α in Human Pulmonary Endothelial Cells Attenuates TFAM Expression"

Article Title: Hypoxia-induced Suppression of c-Myc by HIF-2α in Human Pulmonary Endothelial Cells Attenuates TFAM Expression

Journal: Cellular signalling

doi: 10.1016/j.cellsig.2017.07.008

Hypoxia suppresses TFAM expression. (A) Quantitative real-time PCR (qRT-PCR) with 0.5 μg RNA, using actin as an endogenous control, was performed to monitor TFAM (n=5) and PGC1β (n=3) gene expression after 24 h hypoxia. Shown are mean ± SD. (B) Western blot for TFAM and actin following 42 h hypoxia or normoxia. Graphs show the relative densitometries corrected for actin; mean ± SD (n=4) are plotted. (C) qRT-PCR with 12 μg RNA was used to monitor PGC1α gene expression in normoxia and hypoxia and to compare the Δ CT of PGC1α and PGC1β transcripts in normoxic conditions (normalized to actin) (n=4). *, significantly different (p
Figure Legend Snippet: Hypoxia suppresses TFAM expression. (A) Quantitative real-time PCR (qRT-PCR) with 0.5 μg RNA, using actin as an endogenous control, was performed to monitor TFAM (n=5) and PGC1β (n=3) gene expression after 24 h hypoxia. Shown are mean ± SD. (B) Western blot for TFAM and actin following 42 h hypoxia or normoxia. Graphs show the relative densitometries corrected for actin; mean ± SD (n=4) are plotted. (C) qRT-PCR with 12 μg RNA was used to monitor PGC1α gene expression in normoxia and hypoxia and to compare the Δ CT of PGC1α and PGC1β transcripts in normoxic conditions (normalized to actin) (n=4). *, significantly different (p

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot

40) Product Images from "Molecular Characterization of Iron Binding Proteins from Glossina morsitans morsitans (Diptera: Glossinidae)"

Article Title: Molecular Characterization of Iron Binding Proteins from Glossina morsitans morsitans (Diptera: Glossinidae)

Journal: Insect biochemistry and molecular biology

doi: 10.1016/j.ibmb.2006.09.003

Transcript abundance of transferrin and ferritin during life stages and in isolated tissues of G. m. morsitans . ( A ). Northern blot analysis of G. m. morsitans RNA from early larva (EL), late larva (LL), early pupa (EP), late pupa (LP), and adult female fat body (A F ). ( B ). Tissue-specific expression of GmmTsf1, GmmFer1HCH , and GmmFer2LCH in adult male and female tsetse identified by semi-quantitative RT-PCR analysis. Amplification products were generated using cDNAs from midgut (MG), fat body (FB) and reproductive tissues (RT) as templates. ( C ). Northern blot analysis of GmmTsf1 transcript abundance in whole flies analyzed at 0, 6, 12, 24 and 48 hours after blood feeding. Flies were collected from points after their first blood meal post eclosion and acquisition of their second blood meal. The tsetse tubulin gene GmmTub was used in hybridizations as a loading control. ( D ). Quantification of GmmTsf1 expression levels. Transcript abundance for the Northern data in ( C ) was quantified and then normalized against the GmmTub loading control.
Figure Legend Snippet: Transcript abundance of transferrin and ferritin during life stages and in isolated tissues of G. m. morsitans . ( A ). Northern blot analysis of G. m. morsitans RNA from early larva (EL), late larva (LL), early pupa (EP), late pupa (LP), and adult female fat body (A F ). ( B ). Tissue-specific expression of GmmTsf1, GmmFer1HCH , and GmmFer2LCH in adult male and female tsetse identified by semi-quantitative RT-PCR analysis. Amplification products were generated using cDNAs from midgut (MG), fat body (FB) and reproductive tissues (RT) as templates. ( C ). Northern blot analysis of GmmTsf1 transcript abundance in whole flies analyzed at 0, 6, 12, 24 and 48 hours after blood feeding. Flies were collected from points after their first blood meal post eclosion and acquisition of their second blood meal. The tsetse tubulin gene GmmTub was used in hybridizations as a loading control. ( D ). Quantification of GmmTsf1 expression levels. Transcript abundance for the Northern data in ( C ) was quantified and then normalized against the GmmTub loading control.

Techniques Used: Isolation, Northern Blot, Expressing, Quantitative RT-PCR, Amplification, Generated

Related Articles

Clone Assay:

Article Title: Immunogenicity evaluation of MS2 phage-mediated chimeric nanoparticle displaying an immunodominant B cell epitope of foot-and-mouth disease virus
Article Snippet: .. The cDNA of encoding AP and CP sequences of MS2 were reversely transcribed from MS2 genome mRNAs (purchased from Sigma) by primers MS2-F and MS2-R using a One-Step RT-PCR Kit (TaKaRa, Shiga, Japan) and cloned into T-Vector pMD™ 19 (Simple). .. The recombinant plasmid was named as T-MS2.

Amplification:

Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways
Article Snippet: .. Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan). .. The following PCR conditions were applied: Nrf2 and HO-1, 35 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 15 s extending at 72°C for 1 min, and β -actin, 25 cycles of denaturation at 94°C for 30 s and annealing at 60°C for 30 s extending at 72°C for 30 s. The PCR products were subjected to horizontal electrophoresis on 0.8% agarose gels, and images were captured in a Bio-Rad ChemiDoc imaging system (Hercules, CA, USA).

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Isolation:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Infection:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways
Article Snippet: .. Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan). .. The following PCR conditions were applied: Nrf2 and HO-1, 35 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 15 s extending at 72°C for 1 min, and β -actin, 25 cycles of denaturation at 94°C for 30 s and annealing at 60°C for 30 s extending at 72°C for 30 s. The PCR products were subjected to horizontal electrophoresis on 0.8% agarose gels, and images were captured in a Bio-Rad ChemiDoc imaging system (Hercules, CA, USA).

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock
Article Snippet: .. Then, 1 μg of DNA‐free total RNA was reverse transcribed by use of a one‐step RT‐PCR kit (TaKaRa Bio, Shiga, Japan). .. The following sequence‐specific primers were synthesized: 5′‐GGTTGATGGTTCGTGGGGATGTTG‐3′ and 5′‐AAGGCAAAGACACTGCCCTGTTGG‐3′ for mouse PGRN; 5′‐GAAAAGCAAGCAGCCAACCA‐3′ and 5′‐CGGATCATGCTTTCTGTGCTC‐3′ for mouse tumour necrosis factor α (TNF‐α); 5′‐CTGCAGCTGGAGAGTGTGG‐3′ and 5′‐GGGGAACTCTGCAGACTCAA‐3′ for mouse IL‐1β; 5′‐AGTTGCCTTCTTGGGACTGA‐3′ and 5′‐TCCACGATTTCCCAGAGAAC‐3′ for mouse IL‐6; 5′‐GGTTGCCAAGCCTTATCGGA‐3′ and 5′‐ACCTGCTCCACTGCCTTGCT‐3′ for mouse IL‐10; 5′‐GGCTGTATTCCCCTCCATCG‐3′ and 5′‐CCAGTTGGTAACAATGCCATGT‐3′ for mouse β‐actin; 5′‐CCTCTCTCTAATCAGCCCTCTG‐3′ and 5′‐GAGGACCTGGGAGTAGATGAG‐3′ for human TNF‐α; 5′‐ATGATGGCTTATTACAGTGGCAA‐3′ and 5′‐GTCGGAGATTCGTAGCTGGA‐3′ for human IL‐1β; 5′‐ACTCACCTCTTCAGAACGAATTG‐3′ and 5′‐CCATCTTTGGAAGGTTCAGGTTG‐3′ for human IL‐6; 5′‐CAGCCAGATGCAATCAATGCC‐3′ and 5′‐TGGAATCCTGAACCCACTTCT‐3′ for human monocyte chemoattractant protein 1 (MCP‐1); and 5′‐GAAGTGTGACGTGGACATCC‐3′ and 5′‐CCGATCCACACGGAGTACTT‐3′ for human β‐actin.

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus
Article Snippet: .. One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China). .. The reaction mixture includes: 2 × one-step RT-PCR Buffer III, 12.5 µl; TaKaRa Ex Taq HS (5 U/µl), 0.5 µl; Prime Script RT Enzyme Mix II, 0.5 µl; PCR forward primer (10 µM), 0.5 µl; PCR reverse primer (10 µM), 0.5 µl; probe (10 µM), 0.5 µl; total RNA, 2 µg; RNase free H2 O, added to 20 µl.

Article Title: Immunogenicity evaluation of MS2 phage-mediated chimeric nanoparticle displaying an immunodominant B cell epitope of foot-and-mouth disease virus
Article Snippet: .. The cDNA of encoding AP and CP sequences of MS2 were reversely transcribed from MS2 genome mRNAs (purchased from Sigma) by primers MS2-F and MS2-R using a One-Step RT-PCR Kit (TaKaRa, Shiga, Japan) and cloned into T-Vector pMD™ 19 (Simple). .. The recombinant plasmid was named as T-MS2.

Article Title: Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14
Article Snippet: .. The RNA was treated with DNase to remove DNA contamination and subjected to quantitative RT-PCR using a one-step RT-PCR kit (Takara, RR018A). ..

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Article Title: Development of a low resource RNA extraction cassette based on surface tension valves
Article Snippet: .. Reactions were performed in a 25 μL volume using 5 μL of RNA template and the Clontech one-step RT-PCR kit according to manufacturer’s instructions. .. Thermal cycling consisted of 48 °C for 20 minutes to synthesize cDNA, 95 °C for 3 minutes to inactivate the reverse transcriptase and activate QTaq DNA polymerase, and 40 cycles of 95 °C for 15 s and 60 °C for 60 s using a Rotor-Gene Q thermal cycler (Qiagen, Germantown, MD).

Quantitative RT-PCR:

Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus
Article Snippet: .. One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China). .. The reaction mixture includes: 2 × one-step RT-PCR Buffer III, 12.5 µl; TaKaRa Ex Taq HS (5 U/µl), 0.5 µl; Prime Script RT Enzyme Mix II, 0.5 µl; PCR forward primer (10 µM), 0.5 µl; PCR reverse primer (10 µM), 0.5 µl; probe (10 µM), 0.5 µl; total RNA, 2 µg; RNase free H2 O, added to 20 µl.

Article Title: Two novel NAC transcription factors regulate gene expression and flowering time by associating with the histone demethylase JMJ14
Article Snippet: .. The RNA was treated with DNase to remove DNA contamination and subjected to quantitative RT-PCR using a one-step RT-PCR kit (Takara, RR018A). ..

Expressing:

Article Title: Immunotherapy of tumors with recombinant adenovirus encoding macrophage inflammatory protein 3β induces tumor-specific immune response in immunocompetent tumor-bearing mice
Article Snippet: .. To confirm the expression of MIP3β mRNA mediated by AdMIP3β, total cellular RNA was isolated from the AdMIP3β infected SKOV3 cells using TRIzol reagent (Invitrogen, Grand Island, NY) and subjected to reverse transcription-PCR for the amplification of the fragment of MIP3β using a One-Step RT-PCR kit (Takara). .. Upstream primer and downstream primer for the amplified fragment of MIP3β were 5′-CTAATGATGCGGAAGACTGCTG-3′ and 5′-TGTTGCCTTTGTTCTTGGCA-3′.

Polymerase Chain Reaction:

Article Title: Ischemic postconditioning attenuates liver warm ischemia-reperfusion injury through Akt-eNOS-NO-HIF pathway
Article Snippet: .. RNA (1 μg) was reverse-transcribed and amplified using TaKaRa One-Step RT-PCR Kit (Takara Shuzo Co., Japan) at following RT-PCR conditions: 95°C for 2 min, 30 cycles at 95°C for 1 min, 59°C for 90 seconds, and 72°C for 2 min. Primers used in PCR reactions were as follows: TNF-α 5' primer (5'-AGCCCACGTAGCAAACCACCAA-3') and 3' primer (5'-ACACCCATTCCCTTCACAGAGCAAT-3'); ICAM-1 5' primer (5'-TGGAACTGCACGTGCTGTAT-3') and 3' primer (5'-ACCATTCTGTTCAAAAGCAG-3'); and β-actin 5' primer (5'-CTGAAGTACCCCATTGAACATGGC-3') and 3' primer (5'-CAGAGCAGTAATCTCCTTCTGCAT-3'). .. PCR products were stained with ethidium bromide and electrophoresed in a 1.5% agarose gel.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa one step rt pcr kit
    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible <t>RNA</t> ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ <t>PCR</t> analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P
    One Step Rt Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 286 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one step rt pcr kit/product/TaKaRa
    Average 99 stars, based on 286 article reviews
    Price from $9.99 to $1999.99
    one step rt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    90
    TaKaRa rt qpcr kits
    Expression of <t>mdig</t> mRNA in NCI-H1650 cells detected via <t>RT-qPCR.</t> In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p
    Rt Qpcr Kits, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt qpcr kits/product/TaKaRa
    Average 90 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    rt qpcr kits - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Progranulin deficiency leads to severe inflammation, lung injury and cell death in a mouse model of endotoxic shock

    doi: 10.1111/jcmm.12756

    Figure Lengend Snippet: PGRN deficiency increased the production of systemic and local pro‐inflammatory mediators after injection of LPS . ELISA of serum levels of inflammatory mediators including tumour necrosis factor α ( TNF ‐α) ( A ), interleukin 6 ( IL ‐6) ( B ), IL ‐10 ( C ) and monocyte chemoattractant protein 1 ( MCP ‐1) ( D ). ( E ) Western blot analysis of cold‐inducible RNA ‐binding protein ( CIRP ) and high mobility group box protein 1 ( HMGB 1) in the serum from WT and Grn −/− mice with LPS injection at 6 and 24 hrs. PS red, Ponceau S red staining. Real‐time RT ‐ PCR analysis of mRNA levels of TNF ‐α ( F ), IL ‐6 ( G ), IL ‐1β ( H ) and IL ‐10 ( I ) in the lung after LPS injection. Data are mean ± S.D. * P

    Article Snippet: Then, 1 μg of DNA‐free total RNA was reverse transcribed by use of a one‐step RT‐PCR kit (TaKaRa Bio, Shiga, Japan).

    Techniques: Injection, Enzyme-linked Immunosorbent Assay, Western Blot, RNA Binding Assay, Mouse Assay, Staining, Quantitative RT-PCR

    Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Journal: Oxidative Medicine and Cellular Longevity

    Article Title: Antifatigue Effect of Luteolin-6-C-Neohesperidoside on Oxidative Stress Injury Induced by Forced Swimming of Rats through Modulation of Nrf2/ARE Signaling Pathways

    doi: 10.1155/2017/3159358

    Figure Lengend Snippet: Effects of LN on the mRNA of Nrf2 and HO-1 in the liver and skeletal muscle of FST rats. (a) Representative PCR bands. (b) Relative levels of mRNA. Data are expressed as means ± SD ( n = 10). # P

    Article Snippet: Then, cDNAs of Nrf2 and HO-1 were amplified using oligonucleotide primers ( ) by One-step RT-PCR kit (Takara Co., Japan).

    Techniques: Polymerase Chain Reaction

    Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Journal: PLoS ONE

    Article Title: Integrin β3 Is Required in Infection and Proliferation of Classical Swine Fever Virus

    doi: 10.1371/journal.pone.0110911

    Figure Lengend Snippet: Establishment of standard curve for one-step qRT-PCR and evaluation of CSFV proliferation. A) Standard curve for one-step qRT-PCR. X-axis denotes Lg value of standard RNA and Y-axis denotes CT value (cycle for threshold, stands for the minimum cycle number of fluorescent quantitative PCR for Thermal Cycler to reach the defaulted value when collecting each tube’s fluorescence signal). The smaller the CT value is, the higher amount of interested RNA the sample contains. B) CT value from one-step qRT-PCR, showing the amount of CSFV virions in cell-culture liquid from four cell lines at 24 h, 48 h and 72 h p.i., respectively. C) CSFV proliferation amount in cell-culture liquid calculated according to the standard curve. The following formula is implemented: copy number = (45.665 - CT value)/3.4692. D) Evaluation of CSFV proliferation rate in four cell lines using two-step qPCR with β-actin as the norm. Statistical difference was calculated between ST group and EC, IEC or PK groups at the same time point, for example, *** marked above ST-24 column denotes extremely significant difference between ST-24 and EC-24, IEC-24 or PK-24 (This explanation applies to Fig. 1B, 1C and 1D).

    Article Snippet: One-step qRT-PCR was performed using One-step Prime Script RT-PCR kit (Perfect Real Time) in Thermal Cycler Dice Real Time System (Takara Bio., Dalian, China).

    Techniques: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Fluorescence, Cell Culture

    Expression of mdig mRNA in NCI-H1650 cells detected via RT-qPCR. In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p

    Journal: Oncology Letters

    Article Title: Effects of mdig on proliferation and apoptosis of lung cancer cells

    doi: 10.3892/ol.2018.9528

    Figure Lengend Snippet: Expression of mdig mRNA in NCI-H1650 cells detected via RT-qPCR. In comparison with control group, the mdig siRNA group has an obviously reduced expression of mdig mRNA in NCI-H1650 cells, **p

    Article Snippet: Materials Materials used in the study were: NCI-H1650 human lung cancer cells (Cell Bank of the Chinese Academy of Sciences, Shanghai, China); Dulbecco's modified Eagle's medium (DMEM) and fetal bovine serum (Hyclone, Logan, UT, USA); TRIzol kits and Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA); bicinchoninic acid (BCA) protein quantification kits and cell lysis buffer (Beyotime Biotechnology, Nantong, China); reverse transcription kits, RT-qPCR kits, primer syntheses, mdig siRNA, and negative control siRNA (N-siRNA) (Takara, Dalian, China); mdig, cleaved caspase-3, cleaved poly (ADP-ribose) polymerase 1 (PARP1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primary antibodies, and horseradish peroxidase (HRP)-labeled secondary antibodies (Proteintech Group, Inc., Wuhan, China); cycle detection kits and Annexin V-fluorescein isothiocyanate (FITC) apoptosis detection kits (Beyotime Biotechnology, Nantong, China).

    Techniques: Expressing, Quantitative RT-PCR