quantitative polymerase chain reaction master mix  (Stratagene)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Stratagene quantitative polymerase chain reaction master mix
    Quantitative Polymerase Chain Reaction Master Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative polymerase chain reaction master mix/product/Stratagene
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    quantitative polymerase chain reaction master mix - by Bioz Stars, 2020-08
    86/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Assaying macrophage activity in a murine model of inflammatory bowel disease using fluorine-19 MRI
    Article Snippet: .. For qRT-PCR, 0.25 μ l of cDNA templates was added to a mixture of 200 nM forward primers, 200 nM reverse primers, 200 nM probes for both GAPDH and CD68 and qPCR master mix (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. .. The PCR was then held at 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s, 58 °C for 60 s and 72 °C for 30 s, followed by 72 °C for 3 min and cooling to 4 °C The difference between threshold cycle (Ct) values of GAPDH and CD68 were used to calculate the relative expression of CD68 between different segments of the colon.

    Article Title: Increased PD-L1 expression in radioresistant HNSCC cell lines after irradiation affects cell proliferation due to inactivation of GSK-3beta
    Article Snippet: .. Reverse transcription of 1μg RNA to complementary DNA (cDNA) was performed using transcriptor First Strand cDNA synthesis kit (Roche, Mannheim, Germany) according to the manufacturer’s protocol. cDNA was amplified using the Brilliant III ultra fast quantitative polymerase chain reaction master mix (Stratagene Agilent Technologies, Santa Clara, CA.) in combination with TaqMan UPL probes (Roche, Mannheim, Germany) Nr. .. Real-time PCR primers were obtained from TIB Molbiol (Berlin, Germany).

    Article Title: Recombinant Forms of Leishmania amazonensis Excreted/Secreted Promastigote Surface Antigen (PSA) Induce Protective Immune Responses in Dogs
    Article Snippet: .. Optimization experiments led us to use the Stratagene qPCR master mix, 15 pmol of forward primer (CTTTTCTGGTCCTCCGGGTAGG), 15 pmol of reverse primer (CCACCCGGCCCTATTTTACACCAA), and 50 pmol of TaqMan probe (FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA). ..

    Article Title: Quantification of Leishmania infantum DNA by a Real-Time PCR Assay with High Sensitivity
    Article Snippet: .. Optimization experiments led us to use the Stratagene qPCR master mix (catalog number 600549-51), 15 pmol of direct primer (CTTTTCTGGTCCTCCGGGTAGG), 15 pmol of reverse primer (CCACCCGGCCCTATTTTACACCAA), and 50 pmol of TaqMan probe (FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA). ..

    Article Title: Collagen XVI Induces Expression of MMP9 via Modulation of AP-1 Transcription Factors and Facilitates Invasion of Oral Squamous Cell Carcinoma
    Article Snippet: .. Reverse transcription of 1 µg RNA to complementary DNA (cDNA) was performed using transcriptor high fidelity cDNA synthesis kit (Roche) according to the manufacturer’s protocol. cDNA was amplified using the Brilliant III ultra fast quantitative polymerase chain reaction master mix (Stratagene Agilent Technologies, Santa Clara, CA) in combination with TaqMan UPL probes (Roche). .. Real-time PCR primers were obtained from Eurofins (Ebersberg, Germany).

    Article Title: HER2 and p95HER2 differentially regulate miRNA expression in MCF-7 breast cancer cells and downregulate MYB proteins through miR-221/222 and miR-503
    Article Snippet: .. SyBR green qPCR was performed in triplicates on each cDNA sample using 1 µg cDNA and 19 µl qPCR master mix (Stratagene), 2 µM forward and reverse primers, and 30 nM reference dye (ROX). ..

    SYBR Green Assay:

    Article Title: Isolation of Meiotic Recombinants from Mouse Sperm
    Article Snippet: .. SYBR green included in a qPCR master mix (e.g., Brilliant® II SYBR® Green QPCR Master Mix, Stratagene). ..

    Article Title: HER2 and p95HER2 differentially regulate miRNA expression in MCF-7 breast cancer cells and downregulate MYB proteins through miR-221/222 and miR-503
    Article Snippet: .. SyBR green qPCR was performed in triplicates on each cDNA sample using 1 µg cDNA and 19 µl qPCR master mix (Stratagene), 2 µM forward and reverse primers, and 30 nM reference dye (ROX). ..

    Amplification:

    Article Title: Increased PD-L1 expression in radioresistant HNSCC cell lines after irradiation affects cell proliferation due to inactivation of GSK-3beta
    Article Snippet: .. Reverse transcription of 1μg RNA to complementary DNA (cDNA) was performed using transcriptor First Strand cDNA synthesis kit (Roche, Mannheim, Germany) according to the manufacturer’s protocol. cDNA was amplified using the Brilliant III ultra fast quantitative polymerase chain reaction master mix (Stratagene Agilent Technologies, Santa Clara, CA.) in combination with TaqMan UPL probes (Roche, Mannheim, Germany) Nr. .. Real-time PCR primers were obtained from TIB Molbiol (Berlin, Germany).

    Article Title: Collagen XVI Induces Expression of MMP9 via Modulation of AP-1 Transcription Factors and Facilitates Invasion of Oral Squamous Cell Carcinoma
    Article Snippet: .. Reverse transcription of 1 µg RNA to complementary DNA (cDNA) was performed using transcriptor high fidelity cDNA synthesis kit (Roche) according to the manufacturer’s protocol. cDNA was amplified using the Brilliant III ultra fast quantitative polymerase chain reaction master mix (Stratagene Agilent Technologies, Santa Clara, CA) in combination with TaqMan UPL probes (Roche). .. Real-time PCR primers were obtained from Eurofins (Ebersberg, Germany).

    Quantitative RT-PCR:

    Article Title: Assaying macrophage activity in a murine model of inflammatory bowel disease using fluorine-19 MRI
    Article Snippet: .. For qRT-PCR, 0.25 μ l of cDNA templates was added to a mixture of 200 nM forward primers, 200 nM reverse primers, 200 nM probes for both GAPDH and CD68 and qPCR master mix (Stratagene, La Jolla, CA, USA) according to the manufacturer’s instructions. .. The PCR was then held at 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s, 58 °C for 60 s and 72 °C for 30 s, followed by 72 °C for 3 min and cooling to 4 °C The difference between threshold cycle (Ct) values of GAPDH and CD68 were used to calculate the relative expression of CD68 between different segments of the colon.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Stratagene green qpcr master mix
    Ggt DNA quantification by quantitative <t>PCR</t> (number of copies genome Ggt uL -1 ) in roots from wheat plants growing in conducive soil 1 (S1), or suppressive soils 2, 4, and 13 (S2, S4, and S13). Tukey test to compare treatments means, values followed by the same letter do not differ at P
    Green Qpcr Master Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/green qpcr master mix/product/Stratagene
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    green qpcr master mix - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Stratagene brilliant sybr green qpcr master mix
    Real-time quantitative PCR analysis of Pon1 . Transcript abundance of hepatic Pon1 at various stages of embryonic development in F1 hybrid mice was quantified by <t>SYBR</t> Green detection method in triplicate. Values in the uppermost section represent total average Pon1 measurements normalized by β-2-microglobulin expression in each sample. Frequencies of CAST or JF1 and BL6 alleles measured by pyrosequencing are represented by pie charts, where the white portions represent the CAST or JF1 allele and the grey portions represent the BL6 allele. The shading in BJ-P0 expression indicates that it goes beyond the upper limit of the graph. The total expression at this developmental time point was found to be 22.2 ± 3.00 × 10 −1 . The four charts in the lower section represent the relative contribution of each allele towards the total expression of Pon1 , where the cross and developmental time point is indicated at the bottom of each bar. Fold increase in the expression of each allele from the previous time point is also indicated at the top of the bar. Error bars were calculated using the standard deviation of both pyrosequencing and quantitative PCR results. The results indicate a disproportionate increase in the expression of each allele. JB, CB, BC and BJ refer to JxB, CxB, BxC and BxJ F1 hybrids, respectively.
    Brilliant Sybr Green Qpcr Master Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 532 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant sybr green qpcr master mix/product/Stratagene
    Average 92 stars, based on 532 article reviews
    Price from $9.99 to $1999.99
    brilliant sybr green qpcr master mix - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Stratagene brilliant ii qpcr master mixture
    (A) Linearity of the pan- Aspergillus NASBA assay determined by triplicate amplification of total nucleic acids extracted from serially diluted A. fumigatus conidia with 10 5 to 10 1 spores. (B) Linearity of Aspergillus <t>qPCR</t> assay. The same <t>TNA</t> series used
    Brilliant Ii Qpcr Master Mixture, supplied by Stratagene, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant ii qpcr master mixture/product/Stratagene
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    brilliant ii qpcr master mixture - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    89
    Stratagene brilliant qpcr master mix
    The Use of the TaqMan <t>QPCR</t> Assay to Determine Replicative Fitness (A) The sequences (3′ to 5′) of the vifX and vifY TaqMan probes are shown on top, the sequences of the vifX and vifY <t>vif</t> alleles are shown below. Each probe differs from its target sequence by one nucleotide because the vifX probe was designed to match the consensus for HIV-1 subtype B vif in this region. Each probe binds to the sense strand of proviral DNA. The probes are aligned to the target sequences with bars indicating positions of identity. The two probes and the two vif alleles differ at 11 nucleotides each. The vifY vif allele that was engineered to tag the reference viruses contains only synonymous changes. (B) The plot demonstrates the working range and reproducibility of the QPCR assay. The average threshold cycle ( C T ) values obtained in six representative multiplexed assays are shown ± standard deviation (SD). In each assay, seven serial dilutions of the standard plasmid ranging from 5 × 10 7 to 5 × 10 1 DNA templates were measured using TaqMan probes specific either for the vifX (Cy5 fluorescence, top panel), or the vifY sequence (FAM fluorescence, bottom panel). The correlation coefficients ( R 2 ) of the two standard curves were > 0.995 and the PCR efficiencies were > 90%. (C) The specificity of the QPCR assay is depicted. Four independent PBMC cultures were singly infected with one of the CC1/85 cl.7 or the CC101.19 cl.7 viruses containing either the vifX or the vifY vif sequence. Genomic DNA from each culture was PCR amplified and then used in the multiplexed TaqMan QPCR assay, as described in Materials and Methods . The average number of copies of each vif allele detected per QPCR reaction for each of the four mono-infections from six representative experiments is shown ± SEM. The lower limit for copy number is set to 100 for plotting purposes, although 50 copies can be quantified reproducibly, and the allele that was not present in the infection was never detected in any quantifiable amount in singly infected cultures. (D) The vif tag has no effect on replicative fitness. Competitive replication assays were performed in which viruses bearing the NL4–3 (circles), CC1/85 cl.7 (squares), or CC101.19 cl.7 (triangles) env genes and the vifX vif allele were competed against viruses bearing the same env genes but the vifY sequence. The fitness differences (W D ) at each indicated MOI were calculated as described in Materials and Methods . The calculated fitness differences of each vifX virus relative to the vifY virus in each experiment are depicted, with the bar showing the mean value of three or four independent experiments. A fitness difference of 1 arises when the two competing viruses are of equal replicative fitness; a value
    Brilliant Qpcr Master Mix, supplied by Stratagene, used in various techniques. Bioz Stars score: 89/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brilliant qpcr master mix/product/Stratagene
    Average 89 stars, based on 43 article reviews
    Price from $9.99 to $1999.99
    brilliant qpcr master mix - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    Image Search Results


    Ggt DNA quantification by quantitative PCR (number of copies genome Ggt uL -1 ) in roots from wheat plants growing in conducive soil 1 (S1), or suppressive soils 2, 4, and 13 (S2, S4, and S13). Tukey test to compare treatments means, values followed by the same letter do not differ at P

    Journal: Frontiers in Microbiology

    Article Title: Microbial Community Composition in Take-All Suppressive Soils

    doi: 10.3389/fmicb.2018.02198

    Figure Lengend Snippet: Ggt DNA quantification by quantitative PCR (number of copies genome Ggt uL -1 ) in roots from wheat plants growing in conducive soil 1 (S1), or suppressive soils 2, 4, and 13 (S2, S4, and S13). Tukey test to compare treatments means, values followed by the same letter do not differ at P

    Article Snippet: Abundance analysis of Ggt was performed in an Applied Biosystems Step OneTM Real-Time PCR System in 12 μl reaction mixtures, containing Brillant® II SYBR® , Green QPCR master mix (Stratagene, Agilent Technologies Company, United States), 1 μl 1:10 Ggt DNA dilution (to determine standard curve) and 1 μL sample DNA and 600 nM of each primer.

    Techniques: Real-time Polymerase Chain Reaction

    Real-time quantitative PCR analysis of Pon1 . Transcript abundance of hepatic Pon1 at various stages of embryonic development in F1 hybrid mice was quantified by SYBR Green detection method in triplicate. Values in the uppermost section represent total average Pon1 measurements normalized by β-2-microglobulin expression in each sample. Frequencies of CAST or JF1 and BL6 alleles measured by pyrosequencing are represented by pie charts, where the white portions represent the CAST or JF1 allele and the grey portions represent the BL6 allele. The shading in BJ-P0 expression indicates that it goes beyond the upper limit of the graph. The total expression at this developmental time point was found to be 22.2 ± 3.00 × 10 −1 . The four charts in the lower section represent the relative contribution of each allele towards the total expression of Pon1 , where the cross and developmental time point is indicated at the bottom of each bar. Fold increase in the expression of each allele from the previous time point is also indicated at the top of the bar. Error bars were calculated using the standard deviation of both pyrosequencing and quantitative PCR results. The results indicate a disproportionate increase in the expression of each allele. JB, CB, BC and BJ refer to JxB, CxB, BxC and BxJ F1 hybrids, respectively.

    Journal: Human Molecular Genetics

    Article Title: Dynamic variation in allele-specific gene expression of Paraoxonase-1 in murine and human tissues

    doi: 10.1093/hmg/ddn222

    Figure Lengend Snippet: Real-time quantitative PCR analysis of Pon1 . Transcript abundance of hepatic Pon1 at various stages of embryonic development in F1 hybrid mice was quantified by SYBR Green detection method in triplicate. Values in the uppermost section represent total average Pon1 measurements normalized by β-2-microglobulin expression in each sample. Frequencies of CAST or JF1 and BL6 alleles measured by pyrosequencing are represented by pie charts, where the white portions represent the CAST or JF1 allele and the grey portions represent the BL6 allele. The shading in BJ-P0 expression indicates that it goes beyond the upper limit of the graph. The total expression at this developmental time point was found to be 22.2 ± 3.00 × 10 −1 . The four charts in the lower section represent the relative contribution of each allele towards the total expression of Pon1 , where the cross and developmental time point is indicated at the bottom of each bar. Fold increase in the expression of each allele from the previous time point is also indicated at the top of the bar. Error bars were calculated using the standard deviation of both pyrosequencing and quantitative PCR results. The results indicate a disproportionate increase in the expression of each allele. JB, CB, BC and BJ refer to JxB, CxB, BxC and BxJ F1 hybrids, respectively.

    Article Snippet: To compare Pon1 levels at different stages of embryonic development, quantitative PCR was performed using the Brilliant SYBR Green qPCR Master Mix (Stratagene).

    Techniques: Real-time Polymerase Chain Reaction, Mouse Assay, SYBR Green Assay, Expressing, Standard Deviation

    (A) Linearity of the pan- Aspergillus NASBA assay determined by triplicate amplification of total nucleic acids extracted from serially diluted A. fumigatus conidia with 10 5 to 10 1 spores. (B) Linearity of Aspergillus qPCR assay. The same TNA series used

    Journal: Journal of Clinical Microbiology

    Article Title: Detection of Aspergillus fumigatus in a Rat Model of Invasive Pulmonary Aspergillosis by Real-Time Nucleic Acid Sequence-Based Amplification ▿

    doi: 10.1128/JCM.02214-09

    Figure Lengend Snippet: (A) Linearity of the pan- Aspergillus NASBA assay determined by triplicate amplification of total nucleic acids extracted from serially diluted A. fumigatus conidia with 10 5 to 10 1 spores. (B) Linearity of Aspergillus qPCR assay. The same TNA series used

    Article Snippet: The PCR master mixture contained 0.2 μM each primer, 0.2 μM MB probe, 2 μl of TNA, and 12.5 μl of 2× Brilliant II qPCR master mixture (Stratagene) in a total reaction volume of 25 μl.

    Techniques: Amplification, Real-time Polymerase Chain Reaction

    The Use of the TaqMan QPCR Assay to Determine Replicative Fitness (A) The sequences (3′ to 5′) of the vifX and vifY TaqMan probes are shown on top, the sequences of the vifX and vifY vif alleles are shown below. Each probe differs from its target sequence by one nucleotide because the vifX probe was designed to match the consensus for HIV-1 subtype B vif in this region. Each probe binds to the sense strand of proviral DNA. The probes are aligned to the target sequences with bars indicating positions of identity. The two probes and the two vif alleles differ at 11 nucleotides each. The vifY vif allele that was engineered to tag the reference viruses contains only synonymous changes. (B) The plot demonstrates the working range and reproducibility of the QPCR assay. The average threshold cycle ( C T ) values obtained in six representative multiplexed assays are shown ± standard deviation (SD). In each assay, seven serial dilutions of the standard plasmid ranging from 5 × 10 7 to 5 × 10 1 DNA templates were measured using TaqMan probes specific either for the vifX (Cy5 fluorescence, top panel), or the vifY sequence (FAM fluorescence, bottom panel). The correlation coefficients ( R 2 ) of the two standard curves were > 0.995 and the PCR efficiencies were > 90%. (C) The specificity of the QPCR assay is depicted. Four independent PBMC cultures were singly infected with one of the CC1/85 cl.7 or the CC101.19 cl.7 viruses containing either the vifX or the vifY vif sequence. Genomic DNA from each culture was PCR amplified and then used in the multiplexed TaqMan QPCR assay, as described in Materials and Methods . The average number of copies of each vif allele detected per QPCR reaction for each of the four mono-infections from six representative experiments is shown ± SEM. The lower limit for copy number is set to 100 for plotting purposes, although 50 copies can be quantified reproducibly, and the allele that was not present in the infection was never detected in any quantifiable amount in singly infected cultures. (D) The vif tag has no effect on replicative fitness. Competitive replication assays were performed in which viruses bearing the NL4–3 (circles), CC1/85 cl.7 (squares), or CC101.19 cl.7 (triangles) env genes and the vifX vif allele were competed against viruses bearing the same env genes but the vifY sequence. The fitness differences (W D ) at each indicated MOI were calculated as described in Materials and Methods . The calculated fitness differences of each vifX virus relative to the vifY virus in each experiment are depicted, with the bar showing the mean value of three or four independent experiments. A fitness difference of 1 arises when the two competing viruses are of equal replicative fitness; a value

    Journal: PLoS Pathogens

    Article Title: Escape of HIV-1 from a Small Molecule CCR5 Inhibitor Is Not Associated with a Fitness Loss

    doi: 10.1371/journal.ppat.0030079

    Figure Lengend Snippet: The Use of the TaqMan QPCR Assay to Determine Replicative Fitness (A) The sequences (3′ to 5′) of the vifX and vifY TaqMan probes are shown on top, the sequences of the vifX and vifY vif alleles are shown below. Each probe differs from its target sequence by one nucleotide because the vifX probe was designed to match the consensus for HIV-1 subtype B vif in this region. Each probe binds to the sense strand of proviral DNA. The probes are aligned to the target sequences with bars indicating positions of identity. The two probes and the two vif alleles differ at 11 nucleotides each. The vifY vif allele that was engineered to tag the reference viruses contains only synonymous changes. (B) The plot demonstrates the working range and reproducibility of the QPCR assay. The average threshold cycle ( C T ) values obtained in six representative multiplexed assays are shown ± standard deviation (SD). In each assay, seven serial dilutions of the standard plasmid ranging from 5 × 10 7 to 5 × 10 1 DNA templates were measured using TaqMan probes specific either for the vifX (Cy5 fluorescence, top panel), or the vifY sequence (FAM fluorescence, bottom panel). The correlation coefficients ( R 2 ) of the two standard curves were > 0.995 and the PCR efficiencies were > 90%. (C) The specificity of the QPCR assay is depicted. Four independent PBMC cultures were singly infected with one of the CC1/85 cl.7 or the CC101.19 cl.7 viruses containing either the vifX or the vifY vif sequence. Genomic DNA from each culture was PCR amplified and then used in the multiplexed TaqMan QPCR assay, as described in Materials and Methods . The average number of copies of each vif allele detected per QPCR reaction for each of the four mono-infections from six representative experiments is shown ± SEM. The lower limit for copy number is set to 100 for plotting purposes, although 50 copies can be quantified reproducibly, and the allele that was not present in the infection was never detected in any quantifiable amount in singly infected cultures. (D) The vif tag has no effect on replicative fitness. Competitive replication assays were performed in which viruses bearing the NL4–3 (circles), CC1/85 cl.7 (squares), or CC101.19 cl.7 (triangles) env genes and the vifX vif allele were competed against viruses bearing the same env genes but the vifY sequence. The fitness differences (W D ) at each indicated MOI were calculated as described in Materials and Methods . The calculated fitness differences of each vifX virus relative to the vifY virus in each experiment are depicted, with the bar showing the mean value of three or four independent experiments. A fitness difference of 1 arises when the two competing viruses are of equal replicative fitness; a value

    Article Snippet: In the assay, the Brilliant QPCR Master Mix (Stratagene) was used with the primers Vif beta S (5′-AGT TAG TCC TAG GTG TGA-3′) and Vif beta AS (5′-TCC ATC TGT CCT CTG TCA-3′) and the reference dye ROX, according to the manufacturer's specifications.

    Techniques: Real-time Polymerase Chain Reaction, Sequencing, Standard Deviation, Plasmid Preparation, Fluorescence, Polymerase Chain Reaction, Infection, Amplification

    Replication and Replicative Fitness of the CC1/85 and CC101.19 Isolates (A) PBMC cultures were singly infected with the indicated isolates at an MOI of 0.0005 in the presence (open bars) or absence (shaded bars) of 1 μM AD101. The vifX vif probe was used in the TaqMan QPCR assay to derive the copy number per QPCR reaction; the values shown are the means ± SEM from three independent experiments. (B) The fitness differences of the isolates CC1/85 (open symbols) or CC101.19 (filled symbols) as detected by the vifX probe are shown relative to the indicated vifY reference viruses at MOIs of 0.0001 (squares) or 0.0005 (triangles). The values are derived from the mean virus proportions from three independent experiments.

    Journal: PLoS Pathogens

    Article Title: Escape of HIV-1 from a Small Molecule CCR5 Inhibitor Is Not Associated with a Fitness Loss

    doi: 10.1371/journal.ppat.0030079

    Figure Lengend Snippet: Replication and Replicative Fitness of the CC1/85 and CC101.19 Isolates (A) PBMC cultures were singly infected with the indicated isolates at an MOI of 0.0005 in the presence (open bars) or absence (shaded bars) of 1 μM AD101. The vifX vif probe was used in the TaqMan QPCR assay to derive the copy number per QPCR reaction; the values shown are the means ± SEM from three independent experiments. (B) The fitness differences of the isolates CC1/85 (open symbols) or CC101.19 (filled symbols) as detected by the vifX probe are shown relative to the indicated vifY reference viruses at MOIs of 0.0001 (squares) or 0.0005 (triangles). The values are derived from the mean virus proportions from three independent experiments.

    Article Snippet: In the assay, the Brilliant QPCR Master Mix (Stratagene) was used with the primers Vif beta S (5′-AGT TAG TCC TAG GTG TGA-3′) and Vif beta AS (5′-TCC ATC TGT CCT CTG TCA-3′) and the reference dye ROX, according to the manufacturer's specifications.

    Techniques: Infection, Real-time Polymerase Chain Reaction, Derivative Assay