quant it ribogreen rna assay kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Quant iT RiboGreen RNA Assay Kit
    Description:
    The Quant iT RiboGreen RNA Assay Kit contains Quant iT RiboGreen RNA reagent as well as buffers and RNA standards Quant iT RiboGreen RNA reagent is one of the most sensitive detection dyes for the quantitation of RNA in solution with linear fluorescence detection in the range of 1 200 ng of RNA Check out our products for nucleic acid purification
    Catalog Number:
    r11490
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|RNA Quantitation|Nucleic Acid Quantitation
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher quant it ribogreen rna assay kit
    Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ <t>RiboGreen®</t> <t>RNA</t> Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.
    The Quant iT RiboGreen RNA Assay Kit contains Quant iT RiboGreen RNA reagent as well as buffers and RNA standards Quant iT RiboGreen RNA reagent is one of the most sensitive detection dyes for the quantitation of RNA in solution with linear fluorescence detection in the range of 1 200 ng of RNA Check out our products for nucleic acid purification
    https://www.bioz.com/result/quant it ribogreen rna assay kit/product/Thermo Fisher
    Average 90 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    quant it ribogreen rna assay kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes"

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0195969

    Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.
    Figure Legend Snippet: Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.

    Techniques Used: Transfection, Expressing, Negative Control, Western Blot, Plasmid Preparation, Isolation, Purification, SDS Page, Staining, Pull Down Assay, Incubation

    2) Product Images from "Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes"

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0195969

    Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.
    Figure Legend Snippet: Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.

    Techniques Used: Transfection, Expressing, Negative Control, Western Blot, Plasmid Preparation, Isolation, Purification, SDS Page, Staining, Pull Down Assay, Incubation

    3) Product Images from "Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes"

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0195969

    Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.
    Figure Legend Snippet: Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.

    Techniques Used: Transfection, Expressing, Negative Control, Western Blot, Plasmid Preparation, Isolation, Purification, SDS Page, Staining, Pull Down Assay, Incubation

    4) Product Images from "Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes"

    Article Title: Identification of RNA-binding proteins in exosomes capable of interacting with different types of RNA: RBP-facilitated transport of RNAs into exosomes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0195969

    Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.
    Figure Legend Snippet: Validation of MVP. Transfected cells are expressing MVP-biotin and un-transfected cells were used as negative control. (A) Western blot analysis for the detection of MVP in HEK293F cell lysate and exosomal protein extracts shows that plasmid (MVP-biotin) was successfully expressed in HEK293F cells and was partitioned into exosomes isolated from these transfected cells. ( B ) Protein samples from different stages of MVP purification were separated by SDS-PAGE and the protein bands were detected by Comassie staining. After the pull down assay, the presence of MVP within exosomes was confirmed, i.e. MVP in exosomes from biotinylated MVP-transfected cells PD (pull-down lane), whereas it was absent in exosomes from untransfected cells. The position of the MVP-biotin band is indicated by squares. A representative experiment out of 3 is shown. ( C ) Total amount of RNAs coupled to MVP were extracted and quantified by Quant-iT™ RiboGreen® RNA Assay Kit (ThermoFisher Scientific). Captured RNA was expressed as a percentage of RNA eluted from the beads after the pull-down respect to the total RNA incubated with the beads. Exosomal-MVP was coupled with RNAs and the quantification of RNAs that had co-eluted with MVP showed that the amount of RNA present in the MVP elute (i.e. from MVP-RNA complex) was significantly higher than that from the untransfected control. The experiment was performed in 3-replicates and the graph shows the range of values and median (grey). Average and standard error of three independent experiments are shown. Samples: W = proteins from different wash steps during the MVP purification, and PD = pull-down proteins (MVP) after elution, I = input, and UB = unbound after RBP capture.

    Techniques Used: Transfection, Expressing, Negative Control, Western Blot, Plasmid Preparation, Isolation, Purification, SDS Page, Staining, Pull Down Assay, Incubation

    Related Articles

    Centrifugation:

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: The cell lysate was triturated 10 times through a 26G needle to insure complete lysis, incubated for 10 min on ice with periodic agitation, and clarified by a 10 min centrifugation at 20,000 x g at 4 °C. .. The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions.

    Amplification:

    Article Title: Differential Engagement of Fermentative Taxa in Gut Contents of the Earthworm Lumbricus terrestris
    Article Snippet: The amplification of the bacterial 16S rRNA gene was prepared as follows: (i) initial denaturation at 95°C for 5 min, (ii) 5 precycles of denaturation at 95°C for 60 s, annealing at 40°C for 60 s, and elongation 72°C for 70 s, (iii) 30 subsequent cycles of denaturation at 95°C for 30 s, annealing at 43°C for 30 s, and elongation at 72°C for 70 s, and (iv) terminal elongation at 72°C for 5 min (modified from reference ). .. The Quant-iT RiboGreen RNA assay kit (Molecular Probes; Thermo Fisher Scientific, Waltham, MA, USA) was used for quantification of single-stranded RNA.

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions. .. The primers for PCR amplification of tyrosinase transcript were designed using Primer Express 2.0 software on a sequence attained from GenBank (ref. no U01873).

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen). .. A titration was set up at 1, 2, 4, and 8 copies per bead (cpb) in the clonal amplification by emulsion PCR to optimize yield and sequence quality.

    Article Title: Mu killer-Mediated and Spontaneous Silencing of Zea mays Mutator Family Transposable Elements Define Distinctive Paths of Epigenetic Inactivation
    Article Snippet: RNA quantity and quality were assessed with the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and agarose gel electrophoresis, respectively. .. Target, expected amplicon size, and corresponding primer pairs are: Mu killer , 0.5 and 0.7 kb amplicons with the muk-flank (5′ CCTTTGGTCAGTTCGGTTATCTCTG 3′) and mudr-219r (5′ AGGAGAGACGGTGACAAGAGGAGTA 3′) primers; 0.5 kb (spliced) and 0.6 kb (alternatively spliced) mudrA with the mudrA-2345f (5′ AGGAATGGCAACACACTGGGAAAC′ 3′) and mudrA-2938r (5′ TTCAGTGACTTCCTCTGCTACGTC 3′) primers; and tubulin6 (a DNase I control transcript), 0.5 kb (cDNA) with the tub6-475f (5′ AGTATGCCACTCCCTTGGTG 3′) and tub6-979r (5′ GGCACACATCATGTTCTTGG 3′) primers.

    Quantitative RT-PCR:

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The transcriptional activity of tyrosinase gene was determined using a real-time RT-PCR technique. .. The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions.

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: Paragraph title: RNA extraction and RT-qPCR. ... Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA).

    Real-time Polymerase Chain Reaction:

    Article Title: Selective knockdown of ceramide synthases reveals complex interregulation of sphingolipid metabolism [S]
    Article Snippet: Paragraph title: Real-time quantitative PCR analysis ... RNA concentration was determined by using a Quant-iT™ RiboGreen® RNA assay kit (Invitrogen, Valencia, CA).

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). .. After enrichment, the libraries were quantified with qPCR using the KAPA Library Quantification Kit for Illumina Sequencing Platforms and then pooled equimolarly.

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Paragraph title: Reverse transcription and quantitative PCR ... Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions.

    Article Title: Dopamine neuron glutamate cotransmission evokes a delayed excitation in lateral dorsal striatal cholinergic interneurons
    Article Snippet: Paragraph title: Extraction of ChI mRNA and qPCR ... After extraction, RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (ThermoFisher Scientific).

    Incubation:

    Article Title: Dissecting Brain Networks Underlying Alcohol Binge Drinking Using a Systems Genomics Approach
    Article Snippet: RNA Extraction Lysis solution from RNAqueous-Micro Kit (Ambion, Austin, TX, USA) was added to the microdissected samples, and samples were incubated at 42 °C for 30 min and stored at − 80 °C until processed. .. RNA was isolated following the manufacturer’s instructions for laser capture microdissection (LCM) samples and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA), and then quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: The cell lysate was triturated 10 times through a 26G needle to insure complete lysis, incubated for 10 min on ice with periodic agitation, and clarified by a 10 min centrifugation at 20,000 x g at 4 °C. .. The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions.

    Article Title: Dopamine neuron glutamate cotransmission evokes a delayed excitation in lateral dorsal striatal cholinergic interneurons
    Article Snippet: Then Dynabeads Protein G (15 mg/ml; ThermoFisher Scientific) was added to the supernatant and incubated on the tube rotator overnight at 4°C. .. After extraction, RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (ThermoFisher Scientific).

    Activity Assay:

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The transcriptional activity of tyrosinase gene was determined using a real-time RT-PCR technique. .. The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions.

    Expressing:

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: Paragraph title: 2.2.2. Tyrosinase Expression (RT-PCR) ... The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions.

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions. .. Gene expression levels were determined by quantitative polymerase chain reaction (qPCR) using a SYBR Green-based detection system (iQ SYBR Green Supermix, Bio-Rad Laboratories, Hercules, CA).

    Modification:

    Article Title: Differential Engagement of Fermentative Taxa in Gut Contents of the Earthworm Lumbricus terrestris
    Article Snippet: PCR was facilitated with 5 Prime Mastermix (5 Prime, Hamburg, Germany); the 25-μl PCR mixture contained 0.6 U Taq DNA polymerase, 0.2 mM each deoxynucleoside triphosphate (dNTP), 4 mM MgCl2 , and 1.2 μM each primer (modified from reference ). .. The Quant-iT RiboGreen RNA assay kit (Molecular Probes; Thermo Fisher Scientific, Waltham, MA, USA) was used for quantification of single-stranded RNA.

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: Exosomes were purified from 20 × 106 HUVECs and the RNA was extracted using miRNeasy (Quiagen) with one modification: Five volumes of TRIzol were added to the exosomes; the volume of chloroform and ethanol were adjusted accordingly. .. RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA.

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). .. Established melanoma cell line (M14) was used as a positive controls for the miR-29 RT-qPCR assays. cDNA synthesis was performed using modified procedures outlined for miRCURY LNA microRNA PCR primer set (Exiqon, MA).

    Ligation:

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). .. The resultant cDNA then goes through library preparation (end repair, base ‘A’ addition, adapter ligation and enrichment) using Broad Institute-designed indexed adapters for multiplexing.

    Footprinting:

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions. .. Footprinting was performed at room temperature for 45 min using ART-Seq Nuclease (Epicentre), then stopped with SUPERase•In™ RNase Inhibitor (Life Technologies).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: Paragraph title: 2.2.2. Tyrosinase Expression (RT-PCR) ... The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions.

    Article Title: Mu killer-Mediated and Spontaneous Silencing of Zea mays Mutator Family Transposable Elements Define Distinctive Paths of Epigenetic Inactivation
    Article Snippet: RNA quantity and quality were assessed with the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and agarose gel electrophoresis, respectively. .. Approximately 20 ng cDNA was used as template for RT-PCR.

    Generated:

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA. .. Small RNA libraries were generated using the TruSeq Small RNA Library Prep Kit (IRS-200-0012, Illumina) for cellular and exosomal samples using 1 µg and 15 ng of RNA, respectively.

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Each of the cDNA libraries was characterised by unique sequence tags (MIDs) that allowed to trace back the sequences generated from single tissues after assembly. cDNAs were sheared by nebulization to yield random fragments approximately 500–800 bp in length, by applying 30 psi (2,1 bar) of nitrogen for 1 minute on 4 μ g of each library. .. Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen).

    Sequencing:

    Article Title: Physical and Molecular Landscapes of Mouse Glioma Extracellular Vesicles Define Heterogeneity
    Article Snippet: Paragraph title: RNA and libraries preparation, sequencing and annotations ... The concentrations of cellular and extracellular RNA were determined by spectrophotometer (NanoDrop 2000) and Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific), respectively.

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions. .. The primers for PCR amplification of tyrosinase transcript were designed using Primer Express 2.0 software on a sequence attained from GenBank (ref. no U01873).

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). .. After enrichment, the libraries were quantified with qPCR using the KAPA Library Quantification Kit for Illumina Sequencing Platforms and then pooled equimolarly.

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Paragraph title: 2.2. RNA Extraction and Sequencing ... Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen).

    Multiplexing:

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). .. The resultant cDNA then goes through library preparation (end repair, base ‘A’ addition, adapter ligation and enrichment) using Broad Institute-designed indexed adapters for multiplexing.

    RNA Sequencing Assay:

    Article Title: Physical and Molecular Landscapes of Mouse Glioma Extracellular Vesicles Define Heterogeneity
    Article Snippet: The concentrations of cellular and extracellular RNA were determined by spectrophotometer (NanoDrop 2000) and Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific), respectively. .. One quarter of the rRNA-depleted RNA was fragmented to 100–500 nt using the 5 × First-Strand Buffer (Clontech, CA), and utilized for the long RNA library construction by SMARTer Stranded RNA-Seq Kit (Clontech).

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: Paragraph title: RNA extraction and RNA-seq library preparation ... RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA.

    Fluorescence:

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions. .. Reactions were performed on laser-equipped thermal cyclers to detect changes in fluorescence in real time, and cDNA concentrations of Nr3c1 were calculated according to the relative quantification (ddCt) method, corrected for differences in PCR efficiency, and normalized to glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ), cyclophilin A ( Ppia ), or β-actin ( Actb ).

    Mutagenesis:

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: In brief, human wild-type fibroblasts, ESCO2 -mutant RBS fibroblasts, and ESCO2 -corrected RBS fibroblasts were grown on 15-cm plates in DMEM medium supplemented with 10 % Fetal Bovine Serum (FBS). .. The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions.

    Isolation:

    Article Title: Physical and Molecular Landscapes of Mouse Glioma Extracellular Vesicles Define Heterogeneity
    Article Snippet: Total cellular RNA was isolated from the corresponding source EGFR and PDGFRA cultures, and analyzed in parallel. .. The concentrations of cellular and extracellular RNA were determined by spectrophotometer (NanoDrop 2000) and Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific), respectively.

    Article Title: Dissecting Brain Networks Underlying Alcohol Binge Drinking Using a Systems Genomics Approach
    Article Snippet: .. RNA was isolated following the manufacturer’s instructions for laser capture microdissection (LCM) samples and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA), and then quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA). ..

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Total RNA was extracted using the PicoPure RNA Isolation kit (Applied Biosystems, Foster City, CA) and treated with DNase I (Qiagen, Valencia, CA). .. Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions.

    Purification:

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: Exosomes were purified from 20 × 106 HUVECs and the RNA was extracted using miRNeasy (Quiagen) with one modification: Five volumes of TRIzol were added to the exosomes; the volume of chloroform and ethanol were adjusted accordingly. .. RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA.

    Article Title: Genes associated with the progression of neurofibrillary tangles in Alzheimer's disease
    Article Snippet: Total RNA extraction and quality control Total RNA from brain tissues was extracted with a TRIzol Plus RNA Purification System (Life Technologies, Carlsbad, CA, USA). .. We fluorometrically determined the concentration of total RNA with a Quant-iT RiboGreen RNA Assay Kit (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: Differential Engagement of Fermentative Taxa in Gut Contents of the Earthworm Lumbricus terrestris
    Article Snippet: PCR was facilitated with 5 Prime Mastermix (5 Prime, Hamburg, Germany); the 25-μl PCR mixture contained 0.6 U Taq DNA polymerase, 0.2 mM each deoxynucleoside triphosphate (dNTP), 4 mM MgCl2 , and 1.2 μM each primer (modified from reference ). .. The Quant-iT RiboGreen RNA assay kit (Molecular Probes; Thermo Fisher Scientific, Waltham, MA, USA) was used for quantification of single-stranded RNA.

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions. .. The primers for PCR amplification of tyrosinase transcript were designed using Primer Express 2.0 software on a sequence attained from GenBank (ref. no U01873).

    Article Title: Selective knockdown of ceramide synthases reveals complex interregulation of sphingolipid metabolism [S]
    Article Snippet: RNA concentration was determined by using a Quant-iT™ RiboGreen® RNA assay kit (Invitrogen, Valencia, CA). .. The resultant cDNA was used for real-time quantitative PCR (q-PCR) using a QuantiTect SYBR Green PCR kit (Invitrogen) on an ABI 7300 quantitative (q)-PCR system (Applied Biosystems, Foster City, CA) as described by the manufacturer.

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). .. Established melanoma cell line (M14) was used as a positive controls for the miR-29 RT-qPCR assays. cDNA synthesis was performed using modified procedures outlined for miRCURY LNA microRNA PCR primer set (Exiqon, MA).

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen). .. A titration was set up at 1, 2, 4, and 8 copies per bead (cpb) in the clonal amplification by emulsion PCR to optimize yield and sequence quality.

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions. .. Reactions were performed on laser-equipped thermal cyclers to detect changes in fluorescence in real time, and cDNA concentrations of Nr3c1 were calculated according to the relative quantification (ddCt) method, corrected for differences in PCR efficiency, and normalized to glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ), cyclophilin A ( Ppia ), or β-actin ( Actb ).

    Article Title: Dopamine neuron glutamate cotransmission evokes a delayed excitation in lateral dorsal striatal cholinergic interneurons
    Article Snippet: After extraction, RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (ThermoFisher Scientific). .. The resulting cDNA was stored at −20°C pending quantitative PCR (qPCR) determinations. qPCR was performed in Custom RT2 Profiler PCR Arrays (Qiagen, 96 well, #330171, CLAM23840) using RT2 SYBR Green qPCR Mastermix (Qiagen).

    Concentration Assay:

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: .. RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA. .. To assess the quality of the samples, 2 µL of RNA was analyzed using the RNA pico Agilent Bioanalyzer.

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: .. The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions. .. The primers for PCR amplification of tyrosinase transcript were designed using Primer Express 2.0 software on a sequence attained from GenBank (ref. no U01873).

    Article Title: Genes associated with the progression of neurofibrillary tangles in Alzheimer's disease
    Article Snippet: .. We fluorometrically determined the concentration of total RNA with a Quant-iT RiboGreen RNA Assay Kit (Life Technologies). .. Whole-genome gene expression profiling For a genome-wide survey of transcripts associated with Braak NFT stages and BRs, we used GeneChip Human Exon 1.0 ST Arrays (Affymetrix, Santa Clara, CA, USA).

    Article Title: Selective knockdown of ceramide synthases reveals complex interregulation of sphingolipid metabolism [S]
    Article Snippet: .. RNA concentration was determined by using a Quant-iT™ RiboGreen® RNA assay kit (Invitrogen, Valencia, CA). .. One microgram of RNA was used to produce cDNA, using a SuperScript first-strand synthesis system (Invitrogen).

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). .. If the RNA was low in concentration or poor in quality, specimens were not used in the study.

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: .. The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions. ..

    Article Title: Light-Triggered Cellular Delivery of Oligonucleotides
    Article Snippet: .. The oligonucleotide concentrations were measured immediately after the light exposure using Quant-iT RiboGreen RNA Assay Kit as described in the previous section, and the release percentage was calculated using the formula: % released = (ONl − ON0 )/(ONt − ON0 ) × 100, where ONl = oligonucleotide concentration of light exposed liposomes, ON0 = oligonucleotide concentration of non-treated liposomes, and ONt = oligonucleotide concentration of Triton-X 100 treated liposomes. ..

    Sample Prep:

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: .. Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). ..

    Titration:

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen). .. A titration was set up at 1, 2, 4, and 8 copies per bead (cpb) in the clonal amplification by emulsion PCR to optimize yield and sequence quality.

    Software:

    Article Title: Evaluation of Melanogenesis in A-375 Cells in the Presence of DMSO and Analysis of Pyrolytic Profile of Isolated Melanin
    Article Snippet: The RNA concentration was determined using Quant-iT RiboGreen RNA Assay Kit (Invitrogen) according to the manufacturer's instructions. .. The primers for PCR amplification of tyrosinase transcript were designed using Primer Express 2.0 software on a sequence attained from GenBank (ref. no U01873).

    SYBR Green Assay:

    Article Title: Selective knockdown of ceramide synthases reveals complex interregulation of sphingolipid metabolism [S]
    Article Snippet: RNA concentration was determined by using a Quant-iT™ RiboGreen® RNA assay kit (Invitrogen, Valencia, CA). .. The resultant cDNA was used for real-time quantitative PCR (q-PCR) using a QuantiTect SYBR Green PCR kit (Invitrogen) on an ABI 7300 quantitative (q)-PCR system (Applied Biosystems, Foster City, CA) as described by the manufacturer.

    Article Title: Corticosteroid-dependent plasticity mediates compulsive alcohol drinking in rats
    Article Snippet: Concentrations were determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). cDNA was reverse-transcribed from total RNA using iScript cDNA (Bio-Rad, Hercules, CA) in the presence of Oligo (dT) and random primers according to the manufacturer’s instructions. .. Gene expression levels were determined by quantitative polymerase chain reaction (qPCR) using a SYBR Green-based detection system (iQ SYBR Green Supermix, Bio-Rad Laboratories, Hercules, CA).

    Article Title: Dopamine neuron glutamate cotransmission evokes a delayed excitation in lateral dorsal striatal cholinergic interneurons
    Article Snippet: After extraction, RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (ThermoFisher Scientific). .. The resulting cDNA was stored at −20°C pending quantitative PCR (qPCR) determinations. qPCR was performed in Custom RT2 Profiler PCR Arrays (Qiagen, 96 well, #330171, CLAM23840) using RT2 SYBR Green qPCR Mastermix (Qiagen).

    RNA Extraction:

    Article Title: Exploring the RNA landscape of endothelial exosomes
    Article Snippet: Paragraph title: RNA extraction and RNA-seq library preparation ... RNA concentration was determined by Nanodrop (ThermoFisher) for cellular samples and with the Quant-it Ribogreen RNA assay kit ( , ThermoFisher) for exosomal RNA.

    Article Title: Genes associated with the progression of neurofibrillary tangles in Alzheimer's disease
    Article Snippet: Paragraph title: Total RNA extraction and quality control ... We fluorometrically determined the concentration of total RNA with a Quant-iT RiboGreen RNA Assay Kit (Life Technologies).

    Article Title: Dissecting Brain Networks Underlying Alcohol Binge Drinking Using a Systems Genomics Approach
    Article Snippet: Paragraph title: RNA Extraction ... RNA was isolated following the manufacturer’s instructions for laser capture microdissection (LCM) samples and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA), and then quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: Paragraph title: RNA extraction and RT-qPCR. ... Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA).

    Article Title: Transcriptome of the Deep-Sea Black Scabbardfish, Aphanopus carbo (Perciformes: Trichiuridae): Tissue-Specific Expression Patterns and Candidate Genes Associated to Depth Adaptation
    Article Snippet: Paragraph title: 2.2. RNA Extraction and Sequencing ... Quality of the library was assayed on a BioAnalyser RNA 6000 Pico LabChip (Agilent Technologies) and quantity measured by spectrofluorimetry with the Quant-iT RiboGreen RNA Assay kit (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: Mu killer-Mediated and Spontaneous Silencing of Zea mays Mutator Family Transposable Elements Define Distinctive Paths of Epigenetic Inactivation
    Article Snippet: .. RNA quantity and quality were assessed with the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and agarose gel electrophoresis, respectively. .. Approximately 1 μg of total RNA was treated with DNase I and reverse transcribed into cDNA with an oligo(dT) primer using the SuperScript III Reverse Transcription system (Invitrogen) as per manufacturer’s instructions.

    Laser Capture Microdissection:

    Article Title: Dissecting Brain Networks Underlying Alcohol Binge Drinking Using a Systems Genomics Approach
    Article Snippet: .. RNA was isolated following the manufacturer’s instructions for laser capture microdissection (LCM) samples and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA), and then quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA). ..

    Spectrophotometry:

    Article Title: Physical and Molecular Landscapes of Mouse Glioma Extracellular Vesicles Define Heterogeneity
    Article Snippet: .. The concentrations of cellular and extracellular RNA were determined by spectrophotometer (NanoDrop 2000) and Quant-iT RiboGreen RNA Assay Kit (Thermo Fisher Scientific), respectively. .. The RNA quality was examined using Agilent 2100 Bioanalyzer (Agilent, CA) and the RNA Integrity Number (RIN) estimated.

    Article Title: Downregulation of microRNA-29c is associated with hypermethylation of tumor-related genes and disease outcome in cutaneous melanoma
    Article Snippet: .. Total RNA was assessed for purity by UV spectrophotometry and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA). .. If the RNA was low in concentration or poor in quality, specimens were not used in the study.

    Immunoprecipitation:

    Article Title: Dopamine neuron glutamate cotransmission evokes a delayed excitation in lateral dorsal striatal cholinergic interneurons
    Article Snippet: The suspension was then vortexed at full speed for 30 s, and put on the magnetic rack again to remove the beads, and the supernatant was then used as the immunoprecipitation (IP) fraction. .. After extraction, RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (ThermoFisher Scientific).

    Lysis:

    Article Title: Dissecting Brain Networks Underlying Alcohol Binge Drinking Using a Systems Genomics Approach
    Article Snippet: RNA Extraction Lysis solution from RNAqueous-Micro Kit (Ambion, Austin, TX, USA) was added to the microdissected samples, and samples were incubated at 42 °C for 30 min and stored at − 80 °C until processed. .. RNA was isolated following the manufacturer’s instructions for laser capture microdissection (LCM) samples and quantified using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen, Carlsbad, CA, USA), and then quality was assessed using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA).

    Article Title: Improved transcription and translation with L-leucine stimulation of mTORC1 in Roberts syndrome
    Article Snippet: The cell lysate was triturated 10 times through a 26G needle to insure complete lysis, incubated for 10 min on ice with periodic agitation, and clarified by a 10 min centrifugation at 20,000 x g at 4 °C. .. The RNA concentration of the supernatant was determined using the Quant-iT RiboGreen RNA Assay Kit (Invitrogen) and a SpectraMax M2 reader (Molecular Devices) according to manufacturer’s instructions.

    Variant Assay:

    Article Title: Genomic profiling of ER+ breast cancers after short-term estrogen suppression reveals alterations associated with endocrine resistance
    Article Snippet: .. Total RNA was quantified using the Quant-iT™ RiboGreen® RNA Assay Kit (Invitrogen) and normalized to 4 ng/μL; 200 ng of each sample were used for library preparation on an automated variant of the Illumina TruSeq™ RNA Sample Preparation protocol (Revision A, 2010). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher quant it picogreen dsdna assay kit
    Quant It Picogreen Dsdna Assay Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 475 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quant it picogreen dsdna assay kit/product/Thermo Fisher
    Average 90 stars, based on 475 article reviews
    Price from $9.99 to $1999.99
    quant it picogreen dsdna assay kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    The QuantStudio 12K Flex OpenArray Block Rnase P Kit is used for verification of the QuantStudio 12K Flex OpenArray block The kit contains 2 Rnase P arrays plus reagents Each
      Buy from Supplier

    N/A
    Accurate quantification from limited RNA concentrations Target preparation assay kits such as GeneChip WT Pico Kit and GeneChip 3 IVT Pico Kit allow expression profiling using as little as 100
      Buy from Supplier

    Image Search Results