Structured Review

TaKaRa qrt pcr reactions
PDL1 is a target of miR-34a, and its functions could be inhibited by miR-34a. a The expression level of miR-34a was determined by <t>qRT-PCR</t> in the above cell lines. U6 snRNA was used as an internal control. b HCC38 and MDA-MB-231 cells were transfected with miR-34a mimic or scrambled oligonucleotide, and qRT-PCR analysis demonstrated that the transfection was successful. c HCC38 and MDA-MB-231 cells were transfected as described, and the mRNA and protein expression of PDL1 was suppressed by miR-34a. d Histogram presenting cell viability based on MTS assays for HCC38 and MDA-MB-231 cells 48 h after transfection. e Transwell invasion assays demonstrated that the PDL1 3’UTR promoted cell invasion. Representative images of invaded cells are shown in the left panel, and the results are summarized in the right panel. f The expression levels of PDL1 were determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. g The impact of miR-34a on immune cell populations in the tumor microenvironment. Flow cytometry revealed that miR-34a increased the number of CD8+ cells and CD4+ cells and reduced the number of macrophages and Tregs. All the data are shown as the mean ± s.e.m. * P
Qrt Pcr Reactions, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 152 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qrt pcr reactions/product/TaKaRa
Average 99 stars, based on 152 article reviews
Price from $9.99 to $1999.99
qrt pcr reactions - by Bioz Stars, 2020-08
99/100 stars

Images

1) Product Images from "PDL1 And LDHA act as ceRNAs in triple negative breast cancer by regulating miR-34a"

Article Title: PDL1 And LDHA act as ceRNAs in triple negative breast cancer by regulating miR-34a

Journal: Journal of Experimental & Clinical Cancer Research : CR

doi: 10.1186/s13046-017-0593-2

PDL1 is a target of miR-34a, and its functions could be inhibited by miR-34a. a The expression level of miR-34a was determined by qRT-PCR in the above cell lines. U6 snRNA was used as an internal control. b HCC38 and MDA-MB-231 cells were transfected with miR-34a mimic or scrambled oligonucleotide, and qRT-PCR analysis demonstrated that the transfection was successful. c HCC38 and MDA-MB-231 cells were transfected as described, and the mRNA and protein expression of PDL1 was suppressed by miR-34a. d Histogram presenting cell viability based on MTS assays for HCC38 and MDA-MB-231 cells 48 h after transfection. e Transwell invasion assays demonstrated that the PDL1 3’UTR promoted cell invasion. Representative images of invaded cells are shown in the left panel, and the results are summarized in the right panel. f The expression levels of PDL1 were determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. g The impact of miR-34a on immune cell populations in the tumor microenvironment. Flow cytometry revealed that miR-34a increased the number of CD8+ cells and CD4+ cells and reduced the number of macrophages and Tregs. All the data are shown as the mean ± s.e.m. * P
Figure Legend Snippet: PDL1 is a target of miR-34a, and its functions could be inhibited by miR-34a. a The expression level of miR-34a was determined by qRT-PCR in the above cell lines. U6 snRNA was used as an internal control. b HCC38 and MDA-MB-231 cells were transfected with miR-34a mimic or scrambled oligonucleotide, and qRT-PCR analysis demonstrated that the transfection was successful. c HCC38 and MDA-MB-231 cells were transfected as described, and the mRNA and protein expression of PDL1 was suppressed by miR-34a. d Histogram presenting cell viability based on MTS assays for HCC38 and MDA-MB-231 cells 48 h after transfection. e Transwell invasion assays demonstrated that the PDL1 3’UTR promoted cell invasion. Representative images of invaded cells are shown in the left panel, and the results are summarized in the right panel. f The expression levels of PDL1 were determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. g The impact of miR-34a on immune cell populations in the tumor microenvironment. Flow cytometry revealed that miR-34a increased the number of CD8+ cells and CD4+ cells and reduced the number of macrophages and Tregs. All the data are shown as the mean ± s.e.m. * P

Techniques Used: Expressing, Quantitative RT-PCR, Multiple Displacement Amplification, Transfection, Western Blot, Flow Cytometry, Cytometry

LDHA is highly expressed in TNBC and correlated with a poor outcome. a The expression level of LDHA was determined by qRT-PCR and Western blotting in the above cell lines. β-Actin was used as an internal control. b The expression levels of LDHA in 20 pairs of TNBC tissues and their matched normal adjacent tissues. c OS (left) and DFS (right) curves for breast cancer patients with positive or negative LDHA expression. d OS (left) and DFS (right) curves for TNBC patients with positive or negative LDHA expression. All the data are shown as the mean ± s.e.m. * P
Figure Legend Snippet: LDHA is highly expressed in TNBC and correlated with a poor outcome. a The expression level of LDHA was determined by qRT-PCR and Western blotting in the above cell lines. β-Actin was used as an internal control. b The expression levels of LDHA in 20 pairs of TNBC tissues and their matched normal adjacent tissues. c OS (left) and DFS (right) curves for breast cancer patients with positive or negative LDHA expression. d OS (left) and DFS (right) curves for TNBC patients with positive or negative LDHA expression. All the data are shown as the mean ± s.e.m. * P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

PDL1 is highly expressed in TNBC and correlated with a poor outcome. a The expression level of PDL1 was determined by qRT-PCR and Western blotting in seven different mammary cell lines, including one HME cell line (MCF-10A) and six TNBC cell lines. PDL1 expression was normalized using β-actin expression. b The expression level of PDL1 in 20 pairs of TNBC tissues and their matched normal adjacent tissues. c OS (left) and DFS (right) curves for breast cancer patients with positive or negative PDL1 expression. d OS (left) and DFS (right) curves for TNBC patients with positive or negative PDL1 expression. All the data are shown as the mean ± s.e.m. * P
Figure Legend Snippet: PDL1 is highly expressed in TNBC and correlated with a poor outcome. a The expression level of PDL1 was determined by qRT-PCR and Western blotting in seven different mammary cell lines, including one HME cell line (MCF-10A) and six TNBC cell lines. PDL1 expression was normalized using β-actin expression. b The expression level of PDL1 in 20 pairs of TNBC tissues and their matched normal adjacent tissues. c OS (left) and DFS (right) curves for breast cancer patients with positive or negative PDL1 expression. d OS (left) and DFS (right) curves for TNBC patients with positive or negative PDL1 expression. All the data are shown as the mean ± s.e.m. * P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

PDL1 and LDHA act as ceRNAs in TNBC by regulating miR-34a. a The expression level of miR-34a was determined by qRT-PCR in stable cell lines expressing the PDL1 3’UTR or LDHA 3’UTR. U6 snRNA was used as an internal control. b The expression level of PDL1 was determined by qRT-PCR and Western blotting. β-Actin was used as an internal control. c The expression level of LDHA was determined by qRT-PCR and Western blotting. β-Actin was used as an internal control. d The expression level of LDHA was determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. e The expression level of PDL1 was determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. f Lactate production and glucose consumption was evaluated by measuring the lactate and glucose levels in cell medium. g The impact of the LDHA 3’UTR on immune cell populations in the tumor microenvironment. Flow cytometry revealed that the LDHA 3’UTR increased the number of macrophages and Tregs and reduced the number of CD8+ cells and CD4+ cells. All of the data are shown as the mean ± s.e.m. ** P
Figure Legend Snippet: PDL1 and LDHA act as ceRNAs in TNBC by regulating miR-34a. a The expression level of miR-34a was determined by qRT-PCR in stable cell lines expressing the PDL1 3’UTR or LDHA 3’UTR. U6 snRNA was used as an internal control. b The expression level of PDL1 was determined by qRT-PCR and Western blotting. β-Actin was used as an internal control. c The expression level of LDHA was determined by qRT-PCR and Western blotting. β-Actin was used as an internal control. d The expression level of LDHA was determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. e The expression level of PDL1 was determined by Western blotting in xenograft tumors (six in each group). β-Actin was used as an internal control. f Lactate production and glucose consumption was evaluated by measuring the lactate and glucose levels in cell medium. g The impact of the LDHA 3’UTR on immune cell populations in the tumor microenvironment. Flow cytometry revealed that the LDHA 3’UTR increased the number of macrophages and Tregs and reduced the number of CD8+ cells and CD4+ cells. All of the data are shown as the mean ± s.e.m. ** P

Techniques Used: Activated Clotting Time Assay, Expressing, Quantitative RT-PCR, Stable Transfection, Western Blot, Flow Cytometry, Cytometry

2) Product Images from "CNV analysis in Chinese children of mental retardation highlights a sex differentiation in parental contribution to de novo and inherited mutational burdens"

Article Title: CNV analysis in Chinese children of mental retardation highlights a sex differentiation in parental contribution to de novo and inherited mutational burdens

Journal: Scientific Reports

doi: 10.1038/srep25954

Atypical CNVs associated with known genomic disorders. ( A ) Five de novo CNVs (two duplications and three deletions) in the Smith-Magenis/Potocki-Lupski syndrome region. The minimal overlapping region encompasses two known haploinsufficient genes RAI1 and SHMT1 . ( B ) An atypical 1q21.1 duplication inherited from mother. The left boundary is uncertain due to gaps and segmental duplications in that region. Previous studies suggested a dosage sensitive gene HYDIN2 in that region be the causative gene 26 29 . We tested the copy number of this gene using qRT-PCR, but did not find copy number gain of this gene. ( C ) A de novo 16p12.1 duplication partially overlaps the region of the known 16p11.2-p12.1 deletion/duplication syndrome, including PLK1 gene. The duplication is proximal to 16p12.1 deletion syndrome 50 . In all cases, green lines above indicate the typical boundaries of genomic disorder-associated CNVs.
Figure Legend Snippet: Atypical CNVs associated with known genomic disorders. ( A ) Five de novo CNVs (two duplications and three deletions) in the Smith-Magenis/Potocki-Lupski syndrome region. The minimal overlapping region encompasses two known haploinsufficient genes RAI1 and SHMT1 . ( B ) An atypical 1q21.1 duplication inherited from mother. The left boundary is uncertain due to gaps and segmental duplications in that region. Previous studies suggested a dosage sensitive gene HYDIN2 in that region be the causative gene 26 29 . We tested the copy number of this gene using qRT-PCR, but did not find copy number gain of this gene. ( C ) A de novo 16p12.1 duplication partially overlaps the region of the known 16p11.2-p12.1 deletion/duplication syndrome, including PLK1 gene. The duplication is proximal to 16p12.1 deletion syndrome 50 . In all cases, green lines above indicate the typical boundaries of genomic disorder-associated CNVs.

Techniques Used: Quantitative RT-PCR

3) Product Images from "Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley"

Article Title: Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley

Journal: PLoS ONE

doi: 10.1371/journal.pone.0190559

Pairwise variation (V) of 10 candidate reference genes under various stresses calculated via geNorm to determine the optimal number of reference genes for normalization. Pairwise variation (Vn/n+1) was calculated between the normalization factors (NFn and NFn+1) with the geNorm program to determine the optimal number of reference genes for qRT-PCR data normalization of various samples.
Figure Legend Snippet: Pairwise variation (V) of 10 candidate reference genes under various stresses calculated via geNorm to determine the optimal number of reference genes for normalization. Pairwise variation (Vn/n+1) was calculated between the normalization factors (NFn and NFn+1) with the geNorm program to determine the optimal number of reference genes for qRT-PCR data normalization of various samples.

Techniques Used: Quantitative RT-PCR

4) Product Images from "iTRAQ-Based Proteomic Analysis of Ogura-CMS Cabbage and Its Maintainer Line"

Article Title: iTRAQ-Based Proteomic Analysis of Ogura-CMS Cabbage and Its Maintainer Line

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19103180

Integrative analyses comparing proteome and transcriptome data. ( A ) Genes were divided into nine groups according to log 2 ratios of the protein species ( y -axis) and transcripts ( x -axis); ( B ) Number of genes among the nine groups in ( A ). T: transcript; P: protein species; N, no difference; U: up-accumulation; D, down-accumulation. ( C ) Expression validation for nine key genes by qRT-PCR. * p
Figure Legend Snippet: Integrative analyses comparing proteome and transcriptome data. ( A ) Genes were divided into nine groups according to log 2 ratios of the protein species ( y -axis) and transcripts ( x -axis); ( B ) Number of genes among the nine groups in ( A ). T: transcript; P: protein species; N, no difference; U: up-accumulation; D, down-accumulation. ( C ) Expression validation for nine key genes by qRT-PCR. * p

Techniques Used: Expressing, Quantitative RT-PCR

5) Product Images from "Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing"

Article Title: Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing

Journal: Scientific Reports

doi: 10.1038/s41598-018-21193-4

Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P
Figure Legend Snippet: Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P

Techniques Used: Quantitative RT-PCR, Expressing

6) Product Images from "An Overexpressed Q Allele Leads to Increased Spike Density and Improved Processing Quality in Common Wheat (Triticum aestivum)"

Article Title: An Overexpressed Q Allele Leads to Increased Spike Density and Improved Processing Quality in Common Wheat (Triticum aestivum)

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.117.300562

Expression of Q c1 measured by qRT-PCR. (A–D) Spikes of S-Cp1-1 (left) and WT (right) at GS22, GS24, GS29, and GS32, respectively. Scale bar, 0.1 cm (A and B) and 1 cm (C and D). (E) Relative expression levels of Q c1 and Q in root, stem, and leaf at GS24. (F) Relative expression of Q c1 and Q at GS24, GS29, and GS32. Error bars represent means ± SD ( n = 3).
Figure Legend Snippet: Expression of Q c1 measured by qRT-PCR. (A–D) Spikes of S-Cp1-1 (left) and WT (right) at GS22, GS24, GS29, and GS32, respectively. Scale bar, 0.1 cm (A and B) and 1 cm (C and D). (E) Relative expression levels of Q c1 and Q in root, stem, and leaf at GS24. (F) Relative expression of Q c1 and Q at GS24, GS29, and GS32. Error bars represent means ± SD ( n = 3).

Techniques Used: Expressing, Quantitative RT-PCR

7) Product Images from "Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing"

Article Title: Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing

Journal: Scientific Reports

doi: 10.1038/s41598-018-21193-4

Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P
Figure Legend Snippet: Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P

Techniques Used: Quantitative RT-PCR, Expressing

8) Product Images from "AVE0991, a nonpeptide analogue of Ang-(1-7), attenuates aging-related neuroinflammation"

Article Title: AVE0991, a nonpeptide analogue of Ang-(1-7), attenuates aging-related neuroinflammation

Journal: Aging (Albany NY)

doi: 10.18632/aging/101419

AVE0991 attenuates neuroinflammation in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Il1b in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il6 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Tnf in the brains were investigated by qRT-PCR. ( D ) The protein levels of IL-1β in the brains were investigated by ELISA. ( E ) The protein levels of IL-6 in the brains were investigated by ELISA. ( F ) The protein levels of TNF-α in the brains were investigated by ELISA. In panel A - C, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P
Figure Legend Snippet: AVE0991 attenuates neuroinflammation in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Il1b in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il6 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Tnf in the brains were investigated by qRT-PCR. ( D ) The protein levels of IL-1β in the brains were investigated by ELISA. ( E ) The protein levels of IL-6 in the brains were investigated by ELISA. ( F ) The protein levels of TNF-α in the brains were investigated by ELISA. In panel A - C, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P

Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Ang-(1-7) levels are decreased in the brains of SAMP8 mice during the aging process. ( A ) The activity of ACE2 in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed using a specific detection kit. ( B ) The Ang-(1-7) levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were detected by ELISA. ( C ) The expression of Mas1 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed by qRT-PCR. Gapdh was used as an internal control. Data from panel B and C were expressed as a fold change relative to 4-month-old SAMR1 control mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). * P
Figure Legend Snippet: Ang-(1-7) levels are decreased in the brains of SAMP8 mice during the aging process. ( A ) The activity of ACE2 in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed using a specific detection kit. ( B ) The Ang-(1-7) levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were detected by ELISA. ( C ) The expression of Mas1 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed by qRT-PCR. Gapdh was used as an internal control. Data from panel B and C were expressed as a fold change relative to 4-month-old SAMR1 control mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). * P

Techniques Used: Mouse Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Expressing, Quantitative RT-PCR

AVE0991 elevates microglial M2 activation makers in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Arg1 in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla in the brains were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P
Figure Legend Snippet: AVE0991 elevates microglial M2 activation makers in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Arg1 in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla in the brains were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P

Techniques Used: Activation Assay, Mouse Assay, Injection, Quantitative RT-PCR

AVE0991 suppresses microglial-mediated inflammatory response through a MAS1 receptor-dependent manner. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. ( A ) The localization of MAS1 receptor on microglia was confirmed by double immunofluorescence staining. Scale bar=15 μm. Next, microglia were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( B ) The mRNA levels of Il6 were investigated by qRT-PCR. ( C ) The mRNA levels of Ilb were investigated by qRT-PCR. ( D ) The mRNA levels of Tnf were investigated by qRT-PCR. In panel B - D, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P
Figure Legend Snippet: AVE0991 suppresses microglial-mediated inflammatory response through a MAS1 receptor-dependent manner. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. ( A ) The localization of MAS1 receptor on microglia was confirmed by double immunofluorescence staining. Scale bar=15 μm. Next, microglia were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( B ) The mRNA levels of Il6 were investigated by qRT-PCR. ( C ) The mRNA levels of Ilb were investigated by qRT-PCR. ( D ) The mRNA levels of Tnf were investigated by qRT-PCR. In panel B - D, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P

Techniques Used: Isolation, Mouse Assay, Double Immunofluorescence Staining, Incubation, Quantitative RT-PCR

AVE0991 elevates M2 activation makers in primary microglia. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. They were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( A ) The mRNA levels of Arg1 were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P
Figure Legend Snippet: AVE0991 elevates M2 activation makers in primary microglia. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. They were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( A ) The mRNA levels of Arg1 were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P

Techniques Used: Activation Assay, Isolation, Mouse Assay, Incubation, Quantitative RT-PCR

Inflammatory markers are increased in the brains of SAMP8 mice during the aging process. ( A ) The dynamic changes of Il1b mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( B ) The dynamic changes of Il6 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( C ) The dynamic changes of Tnf mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. Gapdh was used as an internal control. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test and were expressed as a fold change relative to 4-month-old SAMR1 control mice. Columns represent mean ± SD (n=8 per group). * P
Figure Legend Snippet: Inflammatory markers are increased in the brains of SAMP8 mice during the aging process. ( A ) The dynamic changes of Il1b mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( B ) The dynamic changes of Il6 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( C ) The dynamic changes of Tnf mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. Gapdh was used as an internal control. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test and were expressed as a fold change relative to 4-month-old SAMR1 control mice. Columns represent mean ± SD (n=8 per group). * P

Techniques Used: Mouse Assay, Quantitative RT-PCR

9) Product Images from "AVE0991, a nonpeptide analogue of Ang-(1-7), attenuates aging-related neuroinflammation"

Article Title: AVE0991, a nonpeptide analogue of Ang-(1-7), attenuates aging-related neuroinflammation

Journal: Aging (Albany NY)

doi: 10.18632/aging/101419

AVE0991 attenuates neuroinflammation in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Il1b in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il6 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Tnf in the brains were investigated by qRT-PCR. ( D ) The protein levels of IL-1β in the brains were investigated by ELISA. ( E ) The protein levels of IL-6 in the brains were investigated by ELISA. ( F ) The protein levels of TNF-α in the brains were investigated by ELISA. In panel A - C, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P
Figure Legend Snippet: AVE0991 attenuates neuroinflammation in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Il1b in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il6 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Tnf in the brains were investigated by qRT-PCR. ( D ) The protein levels of IL-1β in the brains were investigated by ELISA. ( E ) The protein levels of IL-6 in the brains were investigated by ELISA. ( F ) The protein levels of TNF-α in the brains were investigated by ELISA. In panel A - C, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P

Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Ang-(1-7) levels are decreased in the brains of SAMP8 mice during the aging process. ( A ) The activity of ACE2 in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed using a specific detection kit. ( B ) The Ang-(1-7) levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were detected by ELISA. ( C ) The expression of Mas1 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed by qRT-PCR. Gapdh was used as an internal control. Data from panel B and C were expressed as a fold change relative to 4-month-old SAMR1 control mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). * P
Figure Legend Snippet: Ang-(1-7) levels are decreased in the brains of SAMP8 mice during the aging process. ( A ) The activity of ACE2 in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed using a specific detection kit. ( B ) The Ang-(1-7) levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were detected by ELISA. ( C ) The expression of Mas1 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were assessed by qRT-PCR. Gapdh was used as an internal control. Data from panel B and C were expressed as a fold change relative to 4-month-old SAMR1 control mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). * P

Techniques Used: Mouse Assay, Activity Assay, Enzyme-linked Immunosorbent Assay, Expressing, Quantitative RT-PCR

AVE0991 elevates microglial M2 activation makers in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Arg1 in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla in the brains were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P
Figure Legend Snippet: AVE0991 elevates microglial M2 activation makers in the brains of SAMP8 mice. Eight-month-old SAMP8 mice were injected intraperitoneally with vehicle or AVE0991 (1, 3 or 10 mg/kg/day) for 30 days. Afterwards, mice were sacrificed for analysis. ( A ) The mRNA levels of Arg1 in the brains were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 in the brains were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla in the brains were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated SAMP8 mice. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=8 per group). # P

Techniques Used: Activation Assay, Mouse Assay, Injection, Quantitative RT-PCR

AVE0991 suppresses microglial-mediated inflammatory response through a MAS1 receptor-dependent manner. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. ( A ) The localization of MAS1 receptor on microglia was confirmed by double immunofluorescence staining. Scale bar=15 μm. Next, microglia were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( B ) The mRNA levels of Il6 were investigated by qRT-PCR. ( C ) The mRNA levels of Ilb were investigated by qRT-PCR. ( D ) The mRNA levels of Tnf were investigated by qRT-PCR. In panel B - D, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P
Figure Legend Snippet: AVE0991 suppresses microglial-mediated inflammatory response through a MAS1 receptor-dependent manner. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. ( A ) The localization of MAS1 receptor on microglia was confirmed by double immunofluorescence staining. Scale bar=15 μm. Next, microglia were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( B ) The mRNA levels of Il6 were investigated by qRT-PCR. ( C ) The mRNA levels of Ilb were investigated by qRT-PCR. ( D ) The mRNA levels of Tnf were investigated by qRT-PCR. In panel B - D, Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P

Techniques Used: Isolation, Mouse Assay, Double Immunofluorescence Staining, Incubation, Quantitative RT-PCR

AVE0991 elevates M2 activation makers in primary microglia. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. They were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( A ) The mRNA levels of Arg1 were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P
Figure Legend Snippet: AVE0991 elevates M2 activation makers in primary microglia. Primary microglia were directly isolated from the brain of 8-month-old SAMP8 mice. They were treated for 4 h with 100 ng/ml LPS with or without 4 h pre-incubation with AVE0991 (1×10 -8 , 1×10 -7 or 1×10 -6 M) in the presence or absence of A-779 (1×10 -6 M) and were harvested and lysed for analysis. ( A ) The mRNA levels of Arg1 were investigated by qRT-PCR. ( B ) The mRNA levels of Il10 were investigated by qRT-PCR. ( C ) The mRNA levels of Retnla were investigated by qRT-PCR. Gapdh was used as an internal control, and data were expressed as a fold change relative to non-treated microglia. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test. Columns represent mean ± SD (n=4-6). * P

Techniques Used: Activation Assay, Isolation, Mouse Assay, Incubation, Quantitative RT-PCR

Inflammatory markers are increased in the brains of SAMP8 mice during the aging process. ( A ) The dynamic changes of Il1b mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( B ) The dynamic changes of Il6 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( C ) The dynamic changes of Tnf mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. Gapdh was used as an internal control. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test and were expressed as a fold change relative to 4-month-old SAMR1 control mice. Columns represent mean ± SD (n=8 per group). * P
Figure Legend Snippet: Inflammatory markers are increased in the brains of SAMP8 mice during the aging process. ( A ) The dynamic changes of Il1b mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( B ) The dynamic changes of Il6 mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. ( C ) The dynamic changes of Tnf mRNA levels in the brains of 4-, 8-, and 12-month-old SAMP8 mice as well as their age-matched SAMR1 control mice were investigated by qRT-PCR. Gapdh was used as an internal control. All data were analyzed by one-way ANOVA followed by Tukey’s post hoc test and were expressed as a fold change relative to 4-month-old SAMR1 control mice. Columns represent mean ± SD (n=8 per group). * P

Techniques Used: Mouse Assay, Quantitative RT-PCR

10) Product Images from "ARHGAP1 overexpression inhibits proliferation, migration and invasion of C-33A and SiHa cell lines"

Article Title: ARHGAP1 overexpression inhibits proliferation, migration and invasion of C-33A and SiHa cell lines

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S112223

ARHGAP1 expression in cervical carcinoma cell lines. Notes: ( A ) ARHGAP1 mRNA expression was determined by qRT-PCR in HeLa, CaSKi, C-33A, SiHa and C4-1 cell lines. ( B ) Protein levels of ARHGAP1 were determined by Western blot in HeLa, CaSKi, C-33A, SiHa and C4-1 cell lines. ( C ) Expression of ARHGAP1 protein in C-33A cell lines following transduction with lenti-ARHGAP1. ( D ) Expression of ARHGAP1 protein in SiHa cell lines following transduction with lenti-ARHGAP1. ( E ) Expression of ARHGAP1 protein in HeLa cell lines following transduction with lenti-shRNA-ARHGAP1. n=3, mean ± SD. *** P
Figure Legend Snippet: ARHGAP1 expression in cervical carcinoma cell lines. Notes: ( A ) ARHGAP1 mRNA expression was determined by qRT-PCR in HeLa, CaSKi, C-33A, SiHa and C4-1 cell lines. ( B ) Protein levels of ARHGAP1 were determined by Western blot in HeLa, CaSKi, C-33A, SiHa and C4-1 cell lines. ( C ) Expression of ARHGAP1 protein in C-33A cell lines following transduction with lenti-ARHGAP1. ( D ) Expression of ARHGAP1 protein in SiHa cell lines following transduction with lenti-ARHGAP1. ( E ) Expression of ARHGAP1 protein in HeLa cell lines following transduction with lenti-shRNA-ARHGAP1. n=3, mean ± SD. *** P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Transduction, shRNA

11) Product Images from "Regulation of FT splicing by an endogenous cue in temperate grasses"

Article Title: Regulation of FT splicing by an endogenous cue in temperate grasses

Journal: Nature Communications

doi: 10.1038/ncomms14320

Age-dependent FT2 AS. ( a ) Expression analysis of FT2α and FT2β along with different age. Upper flat leaves from five Bd21 plants with the indicated age were pooled and collected for RNA isolation. Each qRT-PCR analysis was performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. The transition from vegetative to reproductive stage of Bd21 plants occurs at 4–5 weeks. Standard curve for FT2α , FT2β and UBC18 quantification is shown in Supplementary Fig. 2 . The absolute value of FT2α , FT2β and UBC18 is shown in Supplementary Fig. 10a . Error bars indicate s.d. w, weeks. ( b ) FT2β/FT2α ratio during plant development. ( c ) and ( d ) Diurnal expression analysis of FT2α and FT2β in 24-h period when plants were 4 and 7 weeks old. The absolute value of FT2α , FT2β and UBC18 at each time point is shown in Supplementary Fig. 12 . Upper flat leaves from five Bd21 plants at the indicated time were pooled and collected for RNA isolation. The white and black bars along the horizontal axes represent light and dark periods, respectively. The numbers below the horizontal axes indicate the time in hours. Error bars indicate s.d. h, hours, w, weeks.
Figure Legend Snippet: Age-dependent FT2 AS. ( a ) Expression analysis of FT2α and FT2β along with different age. Upper flat leaves from five Bd21 plants with the indicated age were pooled and collected for RNA isolation. Each qRT-PCR analysis was performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. The transition from vegetative to reproductive stage of Bd21 plants occurs at 4–5 weeks. Standard curve for FT2α , FT2β and UBC18 quantification is shown in Supplementary Fig. 2 . The absolute value of FT2α , FT2β and UBC18 is shown in Supplementary Fig. 10a . Error bars indicate s.d. w, weeks. ( b ) FT2β/FT2α ratio during plant development. ( c ) and ( d ) Diurnal expression analysis of FT2α and FT2β in 24-h period when plants were 4 and 7 weeks old. The absolute value of FT2α , FT2β and UBC18 at each time point is shown in Supplementary Fig. 12 . Upper flat leaves from five Bd21 plants at the indicated time were pooled and collected for RNA isolation. The white and black bars along the horizontal axes represent light and dark periods, respectively. The numbers below the horizontal axes indicate the time in hours. Error bars indicate s.d. h, hours, w, weeks.

Techniques Used: Expressing, Isolation, Quantitative RT-PCR

Interruption of FT2β activity by artificial miRNA results in early flowering. ( a ) Schematic diagram of amiRFT2β . ( b ) Northern blotting analysis of artificial miRNA accumulation in amiRFT2β transgenic plants. U6 was used as a loading control for RNA gel blot. ( c ) qRT-PCR analysis of FT2β expression in wild-type Bd21-3 and the indicated amiRFT2β transgenic plants. UBC18 was used as an internal control for normalization of qRT-PCR results. Three six-week-old B. distachyon plants were pooled and collected for RNA isolation. Each qRT-PCR analysis were performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. Error bars indicate s.d. Student's t -test, * P
Figure Legend Snippet: Interruption of FT2β activity by artificial miRNA results in early flowering. ( a ) Schematic diagram of amiRFT2β . ( b ) Northern blotting analysis of artificial miRNA accumulation in amiRFT2β transgenic plants. U6 was used as a loading control for RNA gel blot. ( c ) qRT-PCR analysis of FT2β expression in wild-type Bd21-3 and the indicated amiRFT2β transgenic plants. UBC18 was used as an internal control for normalization of qRT-PCR results. Three six-week-old B. distachyon plants were pooled and collected for RNA isolation. Each qRT-PCR analysis were performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. Error bars indicate s.d. Student's t -test, * P

Techniques Used: Activity Assay, Northern Blot, Transgenic Assay, Western Blot, Quantitative RT-PCR, Expressing, Isolation

Identification of FT2 AS in B. distachyon . ( a ) Detection of alternatively spliced FT2 transcripts by RT-PCR. F1 and F2 are specific forward primers for FT2α and FT2β amplification, respectively, while primer F is used for FT2α and FT2β PCR simultaneously. R is the reverse primer. RT, reverse transcription. M, marker. bp, base pairs. ( b ) Protein sequence alignment of different FT2 alternative isoforms and FT1. ( c ) Schematic genomic structure of FT2 splicing variants. White boxes indicate untranslated regions and black boxes indicate exons. TSS indicates the transcriptional start site. ( d ) qRT-PCR analysis of FT2β expression in wild-type Bd21 and the indicated FT2β-OE transgenic plants. Three four-week-old B. distachyon plants were pooled and collected for RNA isolation. UBC18 was used as an internal control for normalization of qRT-PCR results. qRT-PCR analyses were performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. Error bars indicate s.d. ( e ) Representative phenotype of FT2β overexpressing transgenic plants.White arrows point to spikes. Scale bar, 2 cm. ( f ) Flowering time of wild-type and the indicated FT2β-OE transgenic plants. Error bars indicate s.d. ( n =13). Student's t -test, ** P
Figure Legend Snippet: Identification of FT2 AS in B. distachyon . ( a ) Detection of alternatively spliced FT2 transcripts by RT-PCR. F1 and F2 are specific forward primers for FT2α and FT2β amplification, respectively, while primer F is used for FT2α and FT2β PCR simultaneously. R is the reverse primer. RT, reverse transcription. M, marker. bp, base pairs. ( b ) Protein sequence alignment of different FT2 alternative isoforms and FT1. ( c ) Schematic genomic structure of FT2 splicing variants. White boxes indicate untranslated regions and black boxes indicate exons. TSS indicates the transcriptional start site. ( d ) qRT-PCR analysis of FT2β expression in wild-type Bd21 and the indicated FT2β-OE transgenic plants. Three four-week-old B. distachyon plants were pooled and collected for RNA isolation. UBC18 was used as an internal control for normalization of qRT-PCR results. qRT-PCR analyses were performed in three biological replicates with similar results. The point represents the mean value of three technical replicates in a representative biological experiment. Error bars indicate s.d. ( e ) Representative phenotype of FT2β overexpressing transgenic plants.White arrows point to spikes. Scale bar, 2 cm. ( f ) Flowering time of wild-type and the indicated FT2β-OE transgenic plants. Error bars indicate s.d. ( n =13). Student's t -test, ** P

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Marker, Sequencing, Quantitative RT-PCR, Expressing, Transgenic Assay, Isolation

12) Product Images from "Silencing the HaAK Gene by Transgenic Plant-Mediated RNAi Impairs Larval Growth of Helicoverpa armigera"

Article Title: Silencing the HaAK Gene by Transgenic Plant-Mediated RNAi Impairs Larval Growth of Helicoverpa armigera

Journal: International Journal of Biological Sciences

doi: 10.7150/ijbs.10468

HaAK expression in midguts of H. armigera larvae. Suppression of HaAK transcript levels in midguts of third-instar larve fed on AtdsHaAK-8 and AtdsHaAK-11 plants, respectively. The mRNA abundance was determined by qRT-PCR analysis and Actin gene was amplified as an internal control. The error bar means standard error of three biological replicates (* P
Figure Legend Snippet: HaAK expression in midguts of H. armigera larvae. Suppression of HaAK transcript levels in midguts of third-instar larve fed on AtdsHaAK-8 and AtdsHaAK-11 plants, respectively. The mRNA abundance was determined by qRT-PCR analysis and Actin gene was amplified as an internal control. The error bar means standard error of three biological replicates (* P

Techniques Used: Expressing, Quantitative RT-PCR, Amplification

13) Product Images from "Long Noncoding RNA HOTAIR Is Associated with Motility, Invasion, and Metastatic Potential of Metastatic Melanoma"

Article Title: Long Noncoding RNA HOTAIR Is Associated with Motility, Invasion, and Metastatic Potential of Metastatic Melanoma

Journal: BioMed Research International

doi: 10.1155/2013/251098

Degradation of matrix in situ is suppressed by knockdown of HOTAIR. (a) qRT-PCR analysis was performed to examine HOTAIR RNA levels in A375 cells transfected with siControl or siHOTAIR (I and II). (b) A375 cells were transfected with siControl or siHOTAIR (I and II) for 24 hours. In situ zymography was performed with Oregon green 488-conjugated gelatin. Cells were plated on gelatin matrix and incubated for 24 hours. The slides were observed by phase-contrast microscopy (left column), and gelatin degradation was visualized by fluorescence microscopy (right column).
Figure Legend Snippet: Degradation of matrix in situ is suppressed by knockdown of HOTAIR. (a) qRT-PCR analysis was performed to examine HOTAIR RNA levels in A375 cells transfected with siControl or siHOTAIR (I and II). (b) A375 cells were transfected with siControl or siHOTAIR (I and II) for 24 hours. In situ zymography was performed with Oregon green 488-conjugated gelatin. Cells were plated on gelatin matrix and incubated for 24 hours. The slides were observed by phase-contrast microscopy (left column), and gelatin degradation was visualized by fluorescence microscopy (right column).

Techniques Used: In Situ, Quantitative RT-PCR, Transfection, Zymography, Incubation, Microscopy, Fluorescence

Knockdown of HOTAIR decreases melanoma A375 cell motility. (a) qRT-PCR analysis was performed to examine HOTAIR RNA levels in A375 cells transfected with siControl, siHOTAIR I, or siHOTAIR II. (b) Wounds were introduced by scratching confluent monolayers of A375 cells transfected with siControl, siHOTAIR I, or siHOTAIR II. Migration was monitored by light microscopy at 0 hours and 24 hours (upper panel). The widths of the gaps from 3 experiments were measured and the results are presented in a bar graph (lower panel). * P
Figure Legend Snippet: Knockdown of HOTAIR decreases melanoma A375 cell motility. (a) qRT-PCR analysis was performed to examine HOTAIR RNA levels in A375 cells transfected with siControl, siHOTAIR I, or siHOTAIR II. (b) Wounds were introduced by scratching confluent monolayers of A375 cells transfected with siControl, siHOTAIR I, or siHOTAIR II. Migration was monitored by light microscopy at 0 hours and 24 hours (upper panel). The widths of the gaps from 3 experiments were measured and the results are presented in a bar graph (lower panel). * P

Techniques Used: Quantitative RT-PCR, Transfection, Migration, Light Microscopy

14) Product Images from "AEBP1 promotes epithelial-mesenchymal transition of gastric cancer cells by activating the NF-κB pathway and predicts poor outcome of the patients"

Article Title: AEBP1 promotes epithelial-mesenchymal transition of gastric cancer cells by activating the NF-κB pathway and predicts poor outcome of the patients

Journal: Scientific Reports

doi: 10.1038/s41598-018-29878-6

Silencing AEBP1 reduces the proliferation of gastric cancer cells. ( A ) The knockdown efficiencies of AEBP1 in MGC803 and XN0422 were confirmed by Western blotting and qRT-PCR ( B ) analyses; *P
Figure Legend Snippet: Silencing AEBP1 reduces the proliferation of gastric cancer cells. ( A ) The knockdown efficiencies of AEBP1 in MGC803 and XN0422 were confirmed by Western blotting and qRT-PCR ( B ) analyses; *P

Techniques Used: Western Blot, Quantitative RT-PCR

Expression of AEBP1 is elevated in gastric cancer tissues and cell lines. ( A ) Analyses of the AEBP1 mRNA levels from the NCBI GEO datasets GSE13911, GSE54129, GSE27342 and GSE29272. ( B ) Western blotting analysis of AEBP1 expression in 5 fresh surgical gastric cancer specimens (T) and corresponding adjacent normal tissues (N). ( C and D ) Western blotting and qRT-PCR analyses of AEBP1 in four gastric cancer cell lines (MKN-45, BGC823, MGC803, SGC7901) and a primary gastric cancer cell XN0422 as well as in GES-1. The western blots were derived under the same experimental conditions from the same cell lysates; the original full-length Western blot images are shown in Supplementary Fig. S3 .
Figure Legend Snippet: Expression of AEBP1 is elevated in gastric cancer tissues and cell lines. ( A ) Analyses of the AEBP1 mRNA levels from the NCBI GEO datasets GSE13911, GSE54129, GSE27342 and GSE29272. ( B ) Western blotting analysis of AEBP1 expression in 5 fresh surgical gastric cancer specimens (T) and corresponding adjacent normal tissues (N). ( C and D ) Western blotting and qRT-PCR analyses of AEBP1 in four gastric cancer cell lines (MKN-45, BGC823, MGC803, SGC7901) and a primary gastric cancer cell XN0422 as well as in GES-1. The western blots were derived under the same experimental conditions from the same cell lysates; the original full-length Western blot images are shown in Supplementary Fig. S3 .

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Derivative Assay

Silencing AEBP1 results in the inhibition of epithelial-mesenchymal transition (EMT) by downregulating the NF-κB pathway. ( A ) qRT-PCR and ( B ) Western blotting analyses of EMT-related markers (E-cadherin, MMP2, MMP9, snail and vimentin) in AEBP1-knockdown and mock cells; *P
Figure Legend Snippet: Silencing AEBP1 results in the inhibition of epithelial-mesenchymal transition (EMT) by downregulating the NF-κB pathway. ( A ) qRT-PCR and ( B ) Western blotting analyses of EMT-related markers (E-cadherin, MMP2, MMP9, snail and vimentin) in AEBP1-knockdown and mock cells; *P

Techniques Used: Inhibition, Quantitative RT-PCR, Western Blot

15) Product Images from "α3-Deletion Isoform of HLA-A11 Modulates Cytotoxicity of NK Cells: Correlations with HIV-1 Infection of Cells"

Article Title: α3-Deletion Isoform of HLA-A11 Modulates Cytotoxicity of NK Cells: Correlations with HIV-1 Infection of Cells

Journal: The Journal of Immunology Author Choice

doi: 10.4049/jimmunol.1602183

Expression of HLA-A and HLA-AsvE4 in HIV + and HIV − cohorts and their relationship with HIV viral load. ( A ) The whole blood of 30 HIV-1 + individuals not taking a mixture of HIV drugs, 27 HIV-1 − individuals, and 28 individuals treated with a mixture of HIV drugs and without detectable levels of HIV virus were collected. mRNA levels of HLA-A and HLA-AsvE4 of the three groups were examined by qRT-PCR, and viral load was measured using kits. Relative expression of HLA-A and HLA-AsvE4 was normalized to β-actin expression. ( B and C ) The relationship of HLA-A and HLA-AsvE4 with HIV viral load, respectively. ( D ) HSV, HBV, and CMV upregulated HLA-AsvE4 in vitro. The RNA of MRC5 cells (with or without CMV), vero cells (with or without HSV), and Hep and Hep2.215 (HBV + ) were extracted, and qRT-PCR was performed to detect HLA-A and HLA-AsvE4 . Relative expression of HLA-A and HLA-A Δ E4 was normalized to β-actin expression. Expression of HLA-A and HLA-AsvE4 in CMV-, HBV-, and HSV-infected cell lines was compared with that in cells without CMV, HBV, and HSV. Each experiment was performed independently three times. Bars, mean with SD.
Figure Legend Snippet: Expression of HLA-A and HLA-AsvE4 in HIV + and HIV − cohorts and their relationship with HIV viral load. ( A ) The whole blood of 30 HIV-1 + individuals not taking a mixture of HIV drugs, 27 HIV-1 − individuals, and 28 individuals treated with a mixture of HIV drugs and without detectable levels of HIV virus were collected. mRNA levels of HLA-A and HLA-AsvE4 of the three groups were examined by qRT-PCR, and viral load was measured using kits. Relative expression of HLA-A and HLA-AsvE4 was normalized to β-actin expression. ( B and C ) The relationship of HLA-A and HLA-AsvE4 with HIV viral load, respectively. ( D ) HSV, HBV, and CMV upregulated HLA-AsvE4 in vitro. The RNA of MRC5 cells (with or without CMV), vero cells (with or without HSV), and Hep and Hep2.215 (HBV + ) were extracted, and qRT-PCR was performed to detect HLA-A and HLA-AsvE4 . Relative expression of HLA-A and HLA-A Δ E4 was normalized to β-actin expression. Expression of HLA-A and HLA-AsvE4 in CMV-, HBV-, and HSV-infected cell lines was compared with that in cells without CMV, HBV, and HSV. Each experiment was performed independently three times. Bars, mean with SD.

Techniques Used: Expressing, Quantitative RT-PCR, In Vitro, Infection

Expression of HLA-A11 and HLA-A11svE4 in different cohorts of PBMCs stimulated by mitogens. ( A ) B, NK, CD8 + , CD4 + T cells, and monocytes were selected by microbeads from PBMCs expressing HLA-A11 . RNA from each lymphocyte subpopulation and PBMCs (control) were extracted and then qRT-PCR was performed. The relative expressions of HLA-A11 and HLA-A11svE4 from each subpopulation were compared with that of PBMCs. ( B ) PBMCs were incubated with Con A, PHA, SPA, LPS, and PWM in serial concentration gradients for 24 h at 37°C. The most effective concentration of each mitogen is shown (10 μg/ml Con A, 10 μg/ml PHA, 10 μg/ml SPA, 10 ng/ml LPS, and 1 μg/ml PWM). RNA from each lymphocyte group and PBMCs were extracted and subjected to qRT-PCR. The relative expressions of HLA-A11 and HLA-A11svE4 in each group were compared with that of PBMCs. Each experiment was performed independently three times.
Figure Legend Snippet: Expression of HLA-A11 and HLA-A11svE4 in different cohorts of PBMCs stimulated by mitogens. ( A ) B, NK, CD8 + , CD4 + T cells, and monocytes were selected by microbeads from PBMCs expressing HLA-A11 . RNA from each lymphocyte subpopulation and PBMCs (control) were extracted and then qRT-PCR was performed. The relative expressions of HLA-A11 and HLA-A11svE4 from each subpopulation were compared with that of PBMCs. ( B ) PBMCs were incubated with Con A, PHA, SPA, LPS, and PWM in serial concentration gradients for 24 h at 37°C. The most effective concentration of each mitogen is shown (10 μg/ml Con A, 10 μg/ml PHA, 10 μg/ml SPA, 10 ng/ml LPS, and 1 μg/ml PWM). RNA from each lymphocyte group and PBMCs were extracted and subjected to qRT-PCR. The relative expressions of HLA-A11 and HLA-A11svE4 in each group were compared with that of PBMCs. Each experiment was performed independently three times.

Techniques Used: Expressing, Quantitative RT-PCR, Incubation, Concentration Assay

16) Product Images from "Nucleolin mediates the internalization of rabbit hemorrhagic disease virus through clathrin-dependent endocytosis"

Article Title: Nucleolin mediates the internalization of rabbit hemorrhagic disease virus through clathrin-dependent endocytosis

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1007383

NCL is involved in RHDV internalization. (A) Screening of host proteins that interacted with the RHDV capsid protein. SDS-PAGE analysis of immunoprecipitation-purified host factors of RK-13 cells that interact with the mRHDV capsid protein. The red arrows indicate the bands identified by mass spectrometry. Lane M is the protein marker and the lane titled “blank” is the negative control (RK-13 cells not infected with mRHDV) [ 8 ]. (B) Immunofluorescence co-localization analysis of NCL (green) and VP60 (red). mRHDV-infected cells incubated with mAbs against NCL and VP60 at 0, 1, 2, 3, and 4 h, respectively. The small white boxes represent amplified random co-localization spots within the merged image, and the co-localization spots are indicated with white arrowheads. (C) The effect of changing the expression level of NCL on RHDV attachment. RK-13 cells were pre-transfected with Flag-tagged NCL plasmids or NCL siRNA for 24 h, or pre-incubated with anti-NCL mAb for 1 h at 37°C. The cells were then chilled and mRHDV was added at a MOI of 1. After viral attachment at 4°C for 2 h, the RK-13 cells were washed and lysed. The numbers of attached viral RNA copies were determined by qRT-PCR. Percent changes in VP60 RNA copy numbers were derived by comparing the number of VP60 RNA copies in the treated samples to those of the untreated RK-13 cells. The p3×FLAG-CMV-14 vector, non-specific siRNA, and mouse IgG were used as negative controls. (D) The effect of NCL on RHDV internalization. The treatment of cells in each group was the same as that for the attachment assay. RK-13 cells were incubated with mRHDV (MOI = 1) for 2 h at 4°C and then washed with chilled PBS. The temperature was then shifted to 37°C to facilitate viral internalization. At 30 min post infection, when RHDV internalization was proportionally increasing, the cells were washed in pre-chilled acidic PBS (pH = 2.5) to remove non-internalized viruses. After cell lysis, the amount of internalized mRHDV VP60 RNA copies was determined by qRT-PCR. The percentage of internalized VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The student’s t -tests and analysis of variance were used for statistical analyses. * p
Figure Legend Snippet: NCL is involved in RHDV internalization. (A) Screening of host proteins that interacted with the RHDV capsid protein. SDS-PAGE analysis of immunoprecipitation-purified host factors of RK-13 cells that interact with the mRHDV capsid protein. The red arrows indicate the bands identified by mass spectrometry. Lane M is the protein marker and the lane titled “blank” is the negative control (RK-13 cells not infected with mRHDV) [ 8 ]. (B) Immunofluorescence co-localization analysis of NCL (green) and VP60 (red). mRHDV-infected cells incubated with mAbs against NCL and VP60 at 0, 1, 2, 3, and 4 h, respectively. The small white boxes represent amplified random co-localization spots within the merged image, and the co-localization spots are indicated with white arrowheads. (C) The effect of changing the expression level of NCL on RHDV attachment. RK-13 cells were pre-transfected with Flag-tagged NCL plasmids or NCL siRNA for 24 h, or pre-incubated with anti-NCL mAb for 1 h at 37°C. The cells were then chilled and mRHDV was added at a MOI of 1. After viral attachment at 4°C for 2 h, the RK-13 cells were washed and lysed. The numbers of attached viral RNA copies were determined by qRT-PCR. Percent changes in VP60 RNA copy numbers were derived by comparing the number of VP60 RNA copies in the treated samples to those of the untreated RK-13 cells. The p3×FLAG-CMV-14 vector, non-specific siRNA, and mouse IgG were used as negative controls. (D) The effect of NCL on RHDV internalization. The treatment of cells in each group was the same as that for the attachment assay. RK-13 cells were incubated with mRHDV (MOI = 1) for 2 h at 4°C and then washed with chilled PBS. The temperature was then shifted to 37°C to facilitate viral internalization. At 30 min post infection, when RHDV internalization was proportionally increasing, the cells were washed in pre-chilled acidic PBS (pH = 2.5) to remove non-internalized viruses. After cell lysis, the amount of internalized mRHDV VP60 RNA copies was determined by qRT-PCR. The percentage of internalized VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The student’s t -tests and analysis of variance were used for statistical analyses. * p

Techniques Used: SDS Page, Immunoprecipitation, Purification, Mass Spectrometry, Marker, Negative Control, Infection, Immunofluorescence, Incubation, Amplification, Expressing, Transfection, Quantitative RT-PCR, Derivative Assay, Plasmid Preparation, Lysis

Synthetic DVN peptides significantly inhibit RHDV internalization. (A) RK-13 cells were pretreated with DVN or control peptides at a concentration of 100 μg/mL for 6 h. Then, the attachment and internalization assays were performed with mRHDV-infected cells (MOI = 1) and the cells harvested for RNA analysis. The percentage of RHDV VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The control peptide was employed as a negative control. (B) Kinetics of mRHDV internalization into RK-13 cells. Internalization of mRHDV (MOI = 1) or mRHDV-FITC into RK-13 cells was assessed by mRHDV incubation for 10, 30, and 60 min at 37°C. The amount of internalized virus was determined by qRT-PCR and expressed as VP60 RNA copies per 100,000 of GADPH. (C) RK-13 cells were pretreated with the DVN and control peptides at concentrations of 5, 10, 20, 40, 80, and 100 μg/mL for 6 h, respectively. mRHDV-FITC-infected cells (MOI = 1) were then used for internalization assays and harvested for flow cytometry analyses. The control peptide was employed as a negative control. The data are representative of the means and standard deviations (error bars) of three samples per group (** p
Figure Legend Snippet: Synthetic DVN peptides significantly inhibit RHDV internalization. (A) RK-13 cells were pretreated with DVN or control peptides at a concentration of 100 μg/mL for 6 h. Then, the attachment and internalization assays were performed with mRHDV-infected cells (MOI = 1) and the cells harvested for RNA analysis. The percentage of RHDV VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The control peptide was employed as a negative control. (B) Kinetics of mRHDV internalization into RK-13 cells. Internalization of mRHDV (MOI = 1) or mRHDV-FITC into RK-13 cells was assessed by mRHDV incubation for 10, 30, and 60 min at 37°C. The amount of internalized virus was determined by qRT-PCR and expressed as VP60 RNA copies per 100,000 of GADPH. (C) RK-13 cells were pretreated with the DVN and control peptides at concentrations of 5, 10, 20, 40, 80, and 100 μg/mL for 6 h, respectively. mRHDV-FITC-infected cells (MOI = 1) were then used for internalization assays and harvested for flow cytometry analyses. The control peptide was employed as a negative control. The data are representative of the means and standard deviations (error bars) of three samples per group (** p

Techniques Used: Concentration Assay, Infection, Negative Control, Incubation, Quantitative RT-PCR, Flow Cytometry, Cytometry

17) Product Images from "Comparative Proteomics of Leaves from Phytase-Transgenic Maize and Its Non-transgenic Isogenic Variety"

Article Title: Comparative Proteomics of Leaves from Phytase-Transgenic Maize and Its Non-transgenic Isogenic Variety

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2016.01211

Comparison of the expression patterns of 22 typical identified proteins at the protein and transcript levels . The selected protein spots corresponding toDEPs in the 2-DE gels are shown (A) . Mean abundance values (Vol%) of the target protein spots in the 2-DE gels from PT and NT maize leaves (B) . qRT-PCR analysis of the gene expression patterns corresponding to the identified proteins in PT and NT maize leaves (C) . The gray dotted line in each qRT-PCR bar chart represents the 1.0 ratio value. Error bars represent the standard deviation (SD) of three replicates. Although several up-regulated proteins displayed a different pattern at the gene expression level, the comparisons showed that most genes and proteins exhibited a similar pattern in maize leaves.
Figure Legend Snippet: Comparison of the expression patterns of 22 typical identified proteins at the protein and transcript levels . The selected protein spots corresponding toDEPs in the 2-DE gels are shown (A) . Mean abundance values (Vol%) of the target protein spots in the 2-DE gels from PT and NT maize leaves (B) . qRT-PCR analysis of the gene expression patterns corresponding to the identified proteins in PT and NT maize leaves (C) . The gray dotted line in each qRT-PCR bar chart represents the 1.0 ratio value. Error bars represent the standard deviation (SD) of three replicates. Although several up-regulated proteins displayed a different pattern at the gene expression level, the comparisons showed that most genes and proteins exhibited a similar pattern in maize leaves.

Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

18) Product Images from "Transcriptomic analysis of the prothoracic gland from two lepidopteran insects, domesticated silkmoth Bombyx mori and wild silkmoth Antheraea pernyi"

Article Title: Transcriptomic analysis of the prothoracic gland from two lepidopteran insects, domesticated silkmoth Bombyx mori and wild silkmoth Antheraea pernyi

Journal: Scientific Reports

doi: 10.1038/s41598-019-41864-0

qRT-PCR results of expression of the JH related genes. The expression patterns of 8 genes related to JH in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.
Figure Legend Snippet: qRT-PCR results of expression of the JH related genes. The expression patterns of 8 genes related to JH in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

Techniques Used: Quantitative RT-PCR, Expressing

qRT-PCR results of expression of the clock genes. The expression patterns of 12 genes related to clock in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.
Figure Legend Snippet: qRT-PCR results of expression of the clock genes. The expression patterns of 12 genes related to clock in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

Techniques Used: Quantitative RT-PCR, Expressing

19) Product Images from "Transcriptome Analysis by Illumina High-Throughout Paired-End Sequencing Reveals the Complexity of Differential Gene Expression during In Vitro Plantlet Growth and Flowering in Amaranthus tricolor L."

Article Title: Transcriptome Analysis by Illumina High-Throughout Paired-End Sequencing Reveals the Complexity of Differential Gene Expression during In Vitro Plantlet Growth and Flowering in Amaranthus tricolor L.

Journal: PLoS ONE

doi: 10.1371/journal.pone.0100919

Results of qRT-PCR analysis of 26 candidate unigenes during Am. tricolor in vitro plantlet growth and flowering. (a) Plant circadian rhythm pathway-related unigenes. (b) Ubiquitin-mediated proteolysis pathway-related unigenes. (c–d) Genes related to other or unknown pathways.
Figure Legend Snippet: Results of qRT-PCR analysis of 26 candidate unigenes during Am. tricolor in vitro plantlet growth and flowering. (a) Plant circadian rhythm pathway-related unigenes. (b) Ubiquitin-mediated proteolysis pathway-related unigenes. (c–d) Genes related to other or unknown pathways.

Techniques Used: Quantitative RT-PCR, In Vitro

20) Product Images from "Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish"

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish

Journal: Disease Models & Mechanisms

doi: 10.1242/dmm.014951

Zebrafish bach1b is a co-ortholog of mammalian Bach1 , and heme regulates exocrine peptidase precursor genes. (A) Zebrafish Bach1b contains four CP motifs, three of which are also found in human and mouse. (B) Phylogenetic analysis of Bach1 proteins shows that zebrafish contain two bach1 genes, bach1a and bach1b , which are co-orthologs of mammalian Bach1 . The tree was constructed using the neighbor-joining method with MEGA5 ( Tamura et al., 2011 ). The numbers indicate the percentage bootstrap support. Dr , Danio rerio; Tr , Takifugu rubripes; Tn , Tetraodon nigroviridis; Ol , Oryzias latipes; Ga , Gasterosteus aculeatus; On , Oreochromis niloticus; Xt , Xenopus tropicalis; Ci , Ciona intestinalis; Cs , Ciona savignyi; Rn , Rattus norvegicus; Mm , Mus musculus; Hs , Homo sapiens. Ciona intestinalis and Ciona savignyi Bach proteins were used as an outgroup. The Ensembl gene IDs of these genes are listed in supplementary material Table S2 . (C) Downregulation of six peptidase precursor genes in zebrafish yquem/urod (−/−) and their rescue upon treatment with hemin. The concentration of hemin used was 100 μM. The expression levels of six peptidase precursor genes in larvae at 84 hpf were determined by using qRT-PCR. Student’s t -tests were conducted. * P
Figure Legend Snippet: Zebrafish bach1b is a co-ortholog of mammalian Bach1 , and heme regulates exocrine peptidase precursor genes. (A) Zebrafish Bach1b contains four CP motifs, three of which are also found in human and mouse. (B) Phylogenetic analysis of Bach1 proteins shows that zebrafish contain two bach1 genes, bach1a and bach1b , which are co-orthologs of mammalian Bach1 . The tree was constructed using the neighbor-joining method with MEGA5 ( Tamura et al., 2011 ). The numbers indicate the percentage bootstrap support. Dr , Danio rerio; Tr , Takifugu rubripes; Tn , Tetraodon nigroviridis; Ol , Oryzias latipes; Ga , Gasterosteus aculeatus; On , Oreochromis niloticus; Xt , Xenopus tropicalis; Ci , Ciona intestinalis; Cs , Ciona savignyi; Rn , Rattus norvegicus; Mm , Mus musculus; Hs , Homo sapiens. Ciona intestinalis and Ciona savignyi Bach proteins were used as an outgroup. The Ensembl gene IDs of these genes are listed in supplementary material Table S2 . (C) Downregulation of six peptidase precursor genes in zebrafish yquem/urod (−/−) and their rescue upon treatment with hemin. The concentration of hemin used was 100 μM. The expression levels of six peptidase precursor genes in larvae at 84 hpf were determined by using qRT-PCR. Student’s t -tests were conducted. * P

Techniques Used: Construct, Concentration Assay, Expressing, Quantitative RT-PCR

ChIP assays. Capped mRNAs encoding mafK -FLAG, nrf2a -FLAG or bach1b -HA were microinjected into one-cell stage embryos, antibodies against FLAG or HA were used to pull down complexes of the protein with the DNA, and the DNAs were eluted. Specific primers and the eluted DNAs were used in PCR analyses to amplify the DNA fragments that contained cpa5 MARE sites, which were subsequently quantified by using qRT-PCR. (A) Electrophoresis analysis of the ChIP results showed that MafK bound to MARE-containing regulatory fragments of six zymogens. (B) Electrophoresis analysis of the cpa5 ChIP assay. Approximately 2.6-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in wild-type control larvae; whereas approximately 2.8-fold more Bach1b than Nrf2a protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in heme-deficient yquem/urod (−/−) larvae. Moreover, treatment of the heme-deficient yquem/urod (−/−) larvae with hemin reversed the situation so that approximately 1.2-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in hemin-treated yquem/urod (−/−) larvae. (C) qRT-PCR analysis of the cpa5 ChIP assay, the results of which were consistent with the gel electrophoresis analysis in B.
Figure Legend Snippet: ChIP assays. Capped mRNAs encoding mafK -FLAG, nrf2a -FLAG or bach1b -HA were microinjected into one-cell stage embryos, antibodies against FLAG or HA were used to pull down complexes of the protein with the DNA, and the DNAs were eluted. Specific primers and the eluted DNAs were used in PCR analyses to amplify the DNA fragments that contained cpa5 MARE sites, which were subsequently quantified by using qRT-PCR. (A) Electrophoresis analysis of the ChIP results showed that MafK bound to MARE-containing regulatory fragments of six zymogens. (B) Electrophoresis analysis of the cpa5 ChIP assay. Approximately 2.6-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in wild-type control larvae; whereas approximately 2.8-fold more Bach1b than Nrf2a protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in heme-deficient yquem/urod (−/−) larvae. Moreover, treatment of the heme-deficient yquem/urod (−/−) larvae with hemin reversed the situation so that approximately 1.2-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in hemin-treated yquem/urod (−/−) larvae. (C) qRT-PCR analysis of the cpa5 ChIP assay, the results of which were consistent with the gel electrophoresis analysis in B.

Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Quantitative RT-PCR, Electrophoresis, Nucleic Acid Electrophoresis

The regulatory functions of BACH1 on exocrine zymogens are conserved, developmental delay of the exocrine pancreas in the HEP fish and a model for heme-mediated regulation of the exocrine peptidase precursor gene. (A) Overexpression of human BACH1 in zebrafish resulted in downregulation of the six peptidase precursor genes investigated. (B) Downregulation of exdpf ( Jiang et al., 2008 ), an exocrine pancreas marker, in zebrafish yquem/urod (−/−), as determined by qRT-PCR analysis, the results of which are consistent with those achieved by using in situ hybridization (shown in supplementary material Fig. S7A,B ). The primers used for the qRT-PCR analysis are listed in supplementary material Table S1 . Student’s t -tests were conducted. ** P
Figure Legend Snippet: The regulatory functions of BACH1 on exocrine zymogens are conserved, developmental delay of the exocrine pancreas in the HEP fish and a model for heme-mediated regulation of the exocrine peptidase precursor gene. (A) Overexpression of human BACH1 in zebrafish resulted in downregulation of the six peptidase precursor genes investigated. (B) Downregulation of exdpf ( Jiang et al., 2008 ), an exocrine pancreas marker, in zebrafish yquem/urod (−/−), as determined by qRT-PCR analysis, the results of which are consistent with those achieved by using in situ hybridization (shown in supplementary material Fig. S7A,B ). The primers used for the qRT-PCR analysis are listed in supplementary material Table S1 . Student’s t -tests were conducted. ** P

Techniques Used: Fluorescence In Situ Hybridization, Over Expression, Marker, Quantitative RT-PCR, In Situ Hybridization

Knockdown experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b knockdown results in the upregulation of the six peptidase precursor genes that we examined, whereas nrf2a knockdown resulted in their downregulation. Knockdown experiments were performed by microinjecting MOs that targeted bach1b or nrf2a into one-cell stage embryos. For bach1b knockdown experiments, an ATG MO and SPL MO were used. Reverse transcription PCR showed that the SPL MO effectively altered bach1b intron 2 splicing ( supplementary material Fig. S1A,B ). The ATG MO also effectively knocked down bach1b ( supplementary material Fig. S1C ). The results using the SPL MO are shown here. For nrf2a knockdown experiments, we used an ATG MO, of which the efficacy of knockdown has been confirmed previously ( Kobayashi et al., 2002 ; Kobayashi et al., 2009 ; Wang and Gallagher, 2013 ). The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by using qRT-PCR. (B) Representative images of in situ hybridization staining show that the upregulation of cpa5 resulted from bach1b knockdown and that its downregulation resulted from nrf2a knockdown, both results occurred specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 4C were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b knockdown overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, and the optic density values lower than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a knockdown group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, the optic density values higher than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ were marked as ‘medium’. The statistical significance of difference between means was determined by using one-way ANOVA and Tukey’s multiple comparison test ( n =9) with SPSS10.0.1. * P
Figure Legend Snippet: Knockdown experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b knockdown results in the upregulation of the six peptidase precursor genes that we examined, whereas nrf2a knockdown resulted in their downregulation. Knockdown experiments were performed by microinjecting MOs that targeted bach1b or nrf2a into one-cell stage embryos. For bach1b knockdown experiments, an ATG MO and SPL MO were used. Reverse transcription PCR showed that the SPL MO effectively altered bach1b intron 2 splicing ( supplementary material Fig. S1A,B ). The ATG MO also effectively knocked down bach1b ( supplementary material Fig. S1C ). The results using the SPL MO are shown here. For nrf2a knockdown experiments, we used an ATG MO, of which the efficacy of knockdown has been confirmed previously ( Kobayashi et al., 2002 ; Kobayashi et al., 2009 ; Wang and Gallagher, 2013 ). The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by using qRT-PCR. (B) Representative images of in situ hybridization staining show that the upregulation of cpa5 resulted from bach1b knockdown and that its downregulation resulted from nrf2a knockdown, both results occurred specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 4C were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b knockdown overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, and the optic density values lower than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a knockdown group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, the optic density values higher than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ were marked as ‘medium’. The statistical significance of difference between means was determined by using one-way ANOVA and Tukey’s multiple comparison test ( n =9) with SPSS10.0.1. * P

Techniques Used: Expressing, Quantitative RT-PCR, Polymerase Chain Reaction, In Situ Hybridization, Staining, Over Expression

Overexpression experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b overexpression resulted in the downregulation of six peptidase precursor genes – cpa5 , ctr1l , ctrb1 , ela2l , try and tryl – whereas nrf2a overexpression resulted in their upregulation. Overexpression experiments were performed by microinjecting bach1b or nrf2a capped mRNAs into one-cell stage embryos. The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by qRT-PCR analysis. (B) Representative images of in situ hybridization staining show that downregulation of cpa5 resulted from bach1b overexpression and that its upregulation resulted from nrf2a overexpression, both specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 3B were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b overexpression group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, and the optic density values higher than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, the optic density values lower than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ marked as ‘medium’. The statistical significance of difference between means was determined by one-way ANOVA and Tukey’s multiple comparison test ( n =9) by using SPSS10.0.1. * P
Figure Legend Snippet: Overexpression experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b overexpression resulted in the downregulation of six peptidase precursor genes – cpa5 , ctr1l , ctrb1 , ela2l , try and tryl – whereas nrf2a overexpression resulted in their upregulation. Overexpression experiments were performed by microinjecting bach1b or nrf2a capped mRNAs into one-cell stage embryos. The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by qRT-PCR analysis. (B) Representative images of in situ hybridization staining show that downregulation of cpa5 resulted from bach1b overexpression and that its upregulation resulted from nrf2a overexpression, both specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 3B were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b overexpression group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, and the optic density values higher than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, the optic density values lower than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ marked as ‘medium’. The statistical significance of difference between means was determined by one-way ANOVA and Tukey’s multiple comparison test ( n =9) by using SPSS10.0.1. * P

Techniques Used: Over Expression, Expressing, Quantitative RT-PCR, In Situ Hybridization, Staining

21) Product Images from "Serum-derived three-circRNA signature as a diagnostic biomarker for hepatocellular carcinoma"

Article Title: Serum-derived three-circRNA signature as a diagnostic biomarker for hepatocellular carcinoma

Journal: Cancer Cell International

doi: 10.1186/s12935-020-01302-y

The qRT-PCR assay validation for three-circRNAs expression. Compared with the normal samples, hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were all notably up-regulated in the HCC serum samples
Figure Legend Snippet: The qRT-PCR assay validation for three-circRNAs expression. Compared with the normal samples, hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were all notably up-regulated in the HCC serum samples

Techniques Used: Quantitative RT-PCR, Expressing

22) Product Images from "P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression"

Article Title: P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression

Journal: Cell Death & Disease

doi: 10.1038/cddis.2014.201

The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P

Techniques Used: In Vivo, Transfection, Injection, Mouse Assay, Quantitative RT-PCR, Expressing, Histopathology, Staining, Immunohistochemistry

TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P

Techniques Used: Binding Assay, Quantitative RT-PCR, Expressing, Transfection, Western Blot, Immunohistochemistry, Positive Control, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitation Assay

p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P

Techniques Used: Expressing, Quantitative RT-PCR, Mutagenesis, Chromatin Immunoprecipitation, Western Blot, Over Expression, Activity Assay, Binding Assay

Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P
Figure Legend Snippet: Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P

Techniques Used: Expressing, Quantitative RT-PCR

TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P
Figure Legend Snippet: TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P

Techniques Used: MTT Assay, Cotransfection, Transfection, Flow Cytometry, Cytometry, Quantitative RT-PCR, Expressing, Over Expression, Western Blot, Immunostaining

23) Product Images from "Transcriptomic Response to Nitric Oxide Treatment in Larix olgensis Henry"

Article Title: Transcriptomic Response to Nitric Oxide Treatment in Larix olgensis Henry

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms161226117

QRT-PCR analysis of selected genes. Fifteen genes were selected to verify the transcriptomic data. The histogram represents qRT-PCR analysis and the line chart represents RPKM (Reads per Kilobase of exon model per Million mapped reads) values. The X -axis stands for different samples. The right Y -axis stands for relative expression level and the left Y -axis indicates RPKM values. Standard deviations were derived from three replicates of each experiment.
Figure Legend Snippet: QRT-PCR analysis of selected genes. Fifteen genes were selected to verify the transcriptomic data. The histogram represents qRT-PCR analysis and the line chart represents RPKM (Reads per Kilobase of exon model per Million mapped reads) values. The X -axis stands for different samples. The right Y -axis stands for relative expression level and the left Y -axis indicates RPKM values. Standard deviations were derived from three replicates of each experiment.

Techniques Used: Quantitative RT-PCR, Expressing, Derivative Assay

24) Product Images from "Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex"

Article Title: Knockdown of miR-27a sensitizes colorectal cancer stem cells to TRAIL by promoting the formation of Apaf-1-caspase-9 complex

Journal: Oncotarget

doi: 10.18632/oncotarget.16779

Overexpresion of miR-27a in colorectal cancer stem cells ( A ) Flow cytometry analysis was performed to detect the populations of CSCs and non-CSCs in HT29 and SW48 cell lines. ( B ) Expression of miR-27a in FHC, HT29 and SW480 CSCs and non-CSCs was measured by using qRT-PCR analysis. * P
Figure Legend Snippet: Overexpresion of miR-27a in colorectal cancer stem cells ( A ) Flow cytometry analysis was performed to detect the populations of CSCs and non-CSCs in HT29 and SW48 cell lines. ( B ) Expression of miR-27a in FHC, HT29 and SW480 CSCs and non-CSCs was measured by using qRT-PCR analysis. * P

Techniques Used: Flow Cytometry, Cytometry, Expressing, Quantitative RT-PCR

25) Product Images from "Isolation and functional analysis of fatty acid desaturase genes from peanut (Arachis hypogaea L.)"

Article Title: Isolation and functional analysis of fatty acid desaturase genes from peanut (Arachis hypogaea L.)

Journal: PLoS ONE

doi: 10.1371/journal.pone.0189759

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under drought stress. 0h to 72h, leaves exposed to 20% PEG-6000 treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under drought stress. 0h to 72h, leaves exposed to 20% PEG-6000 treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves upon cold treatment. 0h to 72h, leaves exposed to cold (4°C) treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves upon cold treatment. 0h to 72h, leaves exposed to cold (4°C) treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under ABA treatment. 0h to 72h, leaves exposed to 100uM ABA treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under ABA treatment. 0h to 72h, leaves exposed to 100uM ABA treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under salt stress. 0h to 48h, leaves exposed to high salt (200 mM NaCl) treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in peanut leaves and roots under salt stress. 0h to 48h, leaves exposed to high salt (200 mM NaCl) treatment. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR at six stages of seed development. DS (10 to 60 DAP): six developmental stages of seeds. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR at six stages of seed development. DS (10 to 60 DAP): six developmental stages of seeds. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in five peanut tissues. R, root; SM, stem; L, leaf; F, flower; SD, seed. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.
Figure Legend Snippet: Expression analysis of fatty acid desaturase genes of peanut using qRT-PCR in five peanut tissues. R, root; SM, stem; L, leaf; F, flower; SD, seed. The relative mRNA abundance was normalized with respect to the peanut AhTUA5 gene. The bars were standard deviations (SD) of three biological repeats.

Techniques Used: Expressing, Quantitative RT-PCR

26) Product Images from "Comparative Transcriptomic Analyses of Vegetable and Grain Pea (Pisum sativum L.) Seed Development"

Article Title: Comparative Transcriptomic Analyses of Vegetable and Grain Pea (Pisum sativum L.) Seed Development

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2015.01039

qRT-PCR analysis of 30 differential expressed unigenes during seed development of vegetable pea and grain pea . The expression patterns of selected genes were analyzed at 10 and 25 DAP. Black bars with standard errors represent the relative expression level determined by qRT-PCR from three independent biological replicateds (left y-axis). Lines indicate transcript abundance change based on RPKM values according to RNA-Seq (right y-axis).
Figure Legend Snippet: qRT-PCR analysis of 30 differential expressed unigenes during seed development of vegetable pea and grain pea . The expression patterns of selected genes were analyzed at 10 and 25 DAP. Black bars with standard errors represent the relative expression level determined by qRT-PCR from three independent biological replicateds (left y-axis). Lines indicate transcript abundance change based on RPKM values according to RNA-Seq (right y-axis).

Techniques Used: Quantitative RT-PCR, Expressing, RNA Sequencing Assay

Total content of starch and amylose in Zhewan 1 and Zhongwan 6 seeds during development (A), schematic of starch synthesis pathway (B) and qRT-PCR analysis of candidate differentially expressed genes related to starch biosynthesis (C) . Mean starch and amylose contents in (A) is shown with standard errors bars from three repeated experiments. Asterisk indicates that starch and amylose contents are significantly different between Zhewan 1 and Zhongwan 6 according to an LSD test at P
Figure Legend Snippet: Total content of starch and amylose in Zhewan 1 and Zhongwan 6 seeds during development (A), schematic of starch synthesis pathway (B) and qRT-PCR analysis of candidate differentially expressed genes related to starch biosynthesis (C) . Mean starch and amylose contents in (A) is shown with standard errors bars from three repeated experiments. Asterisk indicates that starch and amylose contents are significantly different between Zhewan 1 and Zhongwan 6 according to an LSD test at P

Techniques Used: Quantitative RT-PCR

27) Product Images from "Genome-wide characterization and expression profiling of SWEET genes in cabbage (Brassica oleracea var. capitata L.) reveal their roles in chilling and clubroot disease responses"

Article Title: Genome-wide characterization and expression profiling of SWEET genes in cabbage (Brassica oleracea var. capitata L.) reveal their roles in chilling and clubroot disease responses

Journal: BMC Genomics

doi: 10.1186/s12864-019-5454-2

qRT-PCR analysis of eight BoSWEET genes in cabbage leaves following chilling treatment. Data are presented as means ± standard deviations of three technical replicates derived from one bulked biological replicate. A Duncan’s multiple range test was used to calculate the significance level of the data at P
Figure Legend Snippet: qRT-PCR analysis of eight BoSWEET genes in cabbage leaves following chilling treatment. Data are presented as means ± standard deviations of three technical replicates derived from one bulked biological replicate. A Duncan’s multiple range test was used to calculate the significance level of the data at P

Techniques Used: Quantitative RT-PCR, Derivative Assay

28) Product Images from "MicroRNA-16 is putatively involved in the NF-κB pathway regulation in ulcerative colitis through adenosine A2a receptor (A2aAR) mRNA targeting"

Article Title: MicroRNA-16 is putatively involved in the NF-κB pathway regulation in ulcerative colitis through adenosine A2a receptor (A2aAR) mRNA targeting

Journal: Scientific Reports

doi: 10.1038/srep30824

miR-16 regulates the endogenous expression of A2aAR. ( A ) qRT-PCR detected enhanced expression of miR-16 in a dose-dependent manner ( P
Figure Legend Snippet: miR-16 regulates the endogenous expression of A2aAR. ( A ) qRT-PCR detected enhanced expression of miR-16 in a dose-dependent manner ( P

Techniques Used: Expressing, Quantitative RT-PCR

Effect of miR-16 on the activation of NF-κB p65 and expression of IFN-γ and IL-8. HT-29 cells were transfected with 150 nM of miR-16 mimics, mimics-NC, miR-16 inhibitor and/or inhibitor-NC, respectively. These cells were then treated with TNF-α. ( A–C ) NF-κB p65 protein in cytosolic and nuclear fraction of these cells as analysed by western blot and quantified. Compared to the corresponding NC control, nuclear translocation of NF-κB p65 protein was enhanced in cells transfected with miR-16 mimics, and decreased in cells transfected with miR-16 inhibitor. ( D,E ) qRT-PCR detecting the expression of IFN-γ and IL-8 mRNAs in these cells. ( F,G ) ELISA for IFN-γ and IL-8 in cell supernatants. Data are presented as mean ± SD, * P
Figure Legend Snippet: Effect of miR-16 on the activation of NF-κB p65 and expression of IFN-γ and IL-8. HT-29 cells were transfected with 150 nM of miR-16 mimics, mimics-NC, miR-16 inhibitor and/or inhibitor-NC, respectively. These cells were then treated with TNF-α. ( A–C ) NF-κB p65 protein in cytosolic and nuclear fraction of these cells as analysed by western blot and quantified. Compared to the corresponding NC control, nuclear translocation of NF-κB p65 protein was enhanced in cells transfected with miR-16 mimics, and decreased in cells transfected with miR-16 inhibitor. ( D,E ) qRT-PCR detecting the expression of IFN-γ and IL-8 mRNAs in these cells. ( F,G ) ELISA for IFN-γ and IL-8 in cell supernatants. Data are presented as mean ± SD, * P

Techniques Used: Activation Assay, Expressing, Transfection, Western Blot, Translocation Assay, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Effect of TNF-α stimulation on NF-κB p65 activation and IFN-γ and IL-8 expression. HT-29 cells were treated with or without TNF-α for 12 h or 24 h. ( A–C ) NF-κB p65 protein in cytosolic and nuclear fraction of these cells were analysed by western blot, and quantified by Quantity One software. ( D,E ) IFN-γ and IL-8 mRNA expression in HT-29 cells detected by qRT-PCR. ( F,G ) ELISA for IFN-γ and IL-8 in supernatants released by these cells. Data are presented as mean ± SD, * P
Figure Legend Snippet: Effect of TNF-α stimulation on NF-κB p65 activation and IFN-γ and IL-8 expression. HT-29 cells were treated with or without TNF-α for 12 h or 24 h. ( A–C ) NF-κB p65 protein in cytosolic and nuclear fraction of these cells were analysed by western blot, and quantified by Quantity One software. ( D,E ) IFN-γ and IL-8 mRNA expression in HT-29 cells detected by qRT-PCR. ( F,G ) ELISA for IFN-γ and IL-8 in supernatants released by these cells. Data are presented as mean ± SD, * P

Techniques Used: Activation Assay, Expressing, Western Blot, Software, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Effect of A2aAR-siRNA on NF-κB p65 activation and IFN-γ and IL-8 expression. HT-29 cells were co-transfected with 150 nM of miR-16 inhibitor and A2aAR-siRNA or siRNA-NC, and stimulated with TNF-α. ( A–C ) Western blot analyses and quantification of NF-κB p65 protein in cytosolic and nuclear fraction of cells. ( B ) Silencing of the A2aAR significantly decreased the NF-κB p65 protein expression in cytosolic extracts, ( C ) and increased the NF-κB p65 protein expression in nuclear extracts. ( D,E ) Expression of IFN-γ and IL-8 mRNAs in these cells as detected by qRT-PCR. ( F,G ) ELISA for IFN-γ and IL-8 present in cell supernatants. Data are presented as mean ± SD, * P
Figure Legend Snippet: Effect of A2aAR-siRNA on NF-κB p65 activation and IFN-γ and IL-8 expression. HT-29 cells were co-transfected with 150 nM of miR-16 inhibitor and A2aAR-siRNA or siRNA-NC, and stimulated with TNF-α. ( A–C ) Western blot analyses and quantification of NF-κB p65 protein in cytosolic and nuclear fraction of cells. ( B ) Silencing of the A2aAR significantly decreased the NF-κB p65 protein expression in cytosolic extracts, ( C ) and increased the NF-κB p65 protein expression in nuclear extracts. ( D,E ) Expression of IFN-γ and IL-8 mRNAs in these cells as detected by qRT-PCR. ( F,G ) ELISA for IFN-γ and IL-8 present in cell supernatants. Data are presented as mean ± SD, * P

Techniques Used: Activation Assay, Expressing, Transfection, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Expression of the A2aAR and miR-16 in tissues. ( A ) IF staining of sigmoid biopsy section using specific antibody to label A2aAR protein and DAPI for counterstaining the nuclei (Blue). The strong green fluorescence signal indicating A2aAR was observed mainly in the sigmoid colonic epithelial cells. The expression of A2aAR was reduced in UC inflamed tissues. ( B ) miR-16 expression, and ( C ) A2aAR mRNA expression in individual sigmoid colon tissues (normal controls n = 20, IBS n = 22 and active UC n = 28), were measured by qRT-PCR (Data are shown as mean ± SD, ** P
Figure Legend Snippet: Expression of the A2aAR and miR-16 in tissues. ( A ) IF staining of sigmoid biopsy section using specific antibody to label A2aAR protein and DAPI for counterstaining the nuclei (Blue). The strong green fluorescence signal indicating A2aAR was observed mainly in the sigmoid colonic epithelial cells. The expression of A2aAR was reduced in UC inflamed tissues. ( B ) miR-16 expression, and ( C ) A2aAR mRNA expression in individual sigmoid colon tissues (normal controls n = 20, IBS n = 22 and active UC n = 28), were measured by qRT-PCR (Data are shown as mean ± SD, ** P

Techniques Used: Expressing, Staining, Fluorescence, Quantitative RT-PCR

29) Product Images from "TREK-1 mediates isoflurane-induced cytotoxicity in astrocytes"

Article Title: TREK-1 mediates isoflurane-induced cytotoxicity in astrocytes

Journal: BMC Anesthesiology

doi: 10.1186/s12871-017-0420-5

Regulation of astrocytic TREK-1 influenced the expression of BDNF in cultured astrocytes after isoflurane exposure. The TREK-1 ( a , N = 5) and BDNF ( b , N = 5) mRNA levels were analysed by qRT-PCR in TREK-1 overexpression and knock-down models. a and b were treated with different doses of isoflurane (0%, 2.4%, and 3.6%) for 9 h. ISO, isoflurane. Data are presented as relative to the values of 0% isoflurane in Con group. The data are presented as the mean ± SEM. * P
Figure Legend Snippet: Regulation of astrocytic TREK-1 influenced the expression of BDNF in cultured astrocytes after isoflurane exposure. The TREK-1 ( a , N = 5) and BDNF ( b , N = 5) mRNA levels were analysed by qRT-PCR in TREK-1 overexpression and knock-down models. a and b were treated with different doses of isoflurane (0%, 2.4%, and 3.6%) for 9 h. ISO, isoflurane. Data are presented as relative to the values of 0% isoflurane in Con group. The data are presented as the mean ± SEM. * P

Techniques Used: Expressing, Cell Culture, Quantitative RT-PCR, Over Expression

The over-expression of TREK-1 aggravated isoflurane-induced astrocytic cytotoxicity. a Verification of the astrocytic TREK-1 over-expression and knockdown models by Western blotting ( N = 4) and qRT-PCR ( N = 5). b Astrocytic viabilities were detected in the TREK-1 over-expression and knockdown models using MTT assays after treatment with different isoflurane doses (0%, 2.4%, and 3.6%) with an exposure duration of 9 h ( N = 5). Data are presented as relative to Con group. c The cytotoxicity induced by isoflurane (2.4%) exposure for 9 h was verified via LDH assay ( N = 5). Data are presented as relative to Con group. d The percentages of TUNEL-positive cells after 9 h of isoflurane exposure (2.4%) were determined in the astrocytic TREK-1 over-expression and knockdown models ( N = 3). ISO, isoflurane. The data are presented as the mean ± SEM. * P
Figure Legend Snippet: The over-expression of TREK-1 aggravated isoflurane-induced astrocytic cytotoxicity. a Verification of the astrocytic TREK-1 over-expression and knockdown models by Western blotting ( N = 4) and qRT-PCR ( N = 5). b Astrocytic viabilities were detected in the TREK-1 over-expression and knockdown models using MTT assays after treatment with different isoflurane doses (0%, 2.4%, and 3.6%) with an exposure duration of 9 h ( N = 5). Data are presented as relative to Con group. c The cytotoxicity induced by isoflurane (2.4%) exposure for 9 h was verified via LDH assay ( N = 5). Data are presented as relative to Con group. d The percentages of TUNEL-positive cells after 9 h of isoflurane exposure (2.4%) were determined in the astrocytic TREK-1 over-expression and knockdown models ( N = 3). ISO, isoflurane. The data are presented as the mean ± SEM. * P

Techniques Used: Over Expression, Western Blot, Quantitative RT-PCR, MTT Assay, Lactate Dehydrogenase Assay, TUNEL Assay

30) Product Images from "Mitochondrial-Nuclear DNA Interactions Contribute to the Regulation of Nuclear Transcript Levels as Part of the Inter-Organelle Communication System"

Article Title: Mitochondrial-Nuclear DNA Interactions Contribute to the Regulation of Nuclear Transcript Levels as Part of the Inter-Organelle Communication System

Journal: PLoS ONE

doi: 10.1371/journal.pone.0030943

Knocking out mitochondrial encoded reverse transcriptase activity results in increased transcript levels of nuclear genes that are involved in Mito-nDNA interactions. A) Nuclear encoded MSY1 transcript levels were determined by qRT-PCR in WT (strain 161-U7), 161-U7 GII-0 (lacks both the mitochondrial group II introns and the COX1 interacting region; Figure 4A ), and 161-U7 GII-0 a15γ (contains the interacting region and lacks the group II introns; Figure 4A ) cells. B) Nuclear encoded RSM7 transcript levels were determined by qRT-PCR in: WT (strain 161-U7); 161-U7 GII-0; and 161-U7 GII-0 a15γ cells. Neither 161-U7 GII-0 nor 161-U7 GII-0 a15γ has any alteration within the Q0182 open reading frame. C) Deletion of MRS1 (BY4741 Δ mrs1 ), a nuclear gene involved in splicing mitochondrial type-I introns, has no effect on i) MSY1 or ii) RSM7 transcript levels. All transcript levels were standardized to nuclear ACT1 and expressed as percentage of wild-type (set at 100%) +/− standard error of the mean (n = 2).
Figure Legend Snippet: Knocking out mitochondrial encoded reverse transcriptase activity results in increased transcript levels of nuclear genes that are involved in Mito-nDNA interactions. A) Nuclear encoded MSY1 transcript levels were determined by qRT-PCR in WT (strain 161-U7), 161-U7 GII-0 (lacks both the mitochondrial group II introns and the COX1 interacting region; Figure 4A ), and 161-U7 GII-0 a15γ (contains the interacting region and lacks the group II introns; Figure 4A ) cells. B) Nuclear encoded RSM7 transcript levels were determined by qRT-PCR in: WT (strain 161-U7); 161-U7 GII-0; and 161-U7 GII-0 a15γ cells. Neither 161-U7 GII-0 nor 161-U7 GII-0 a15γ has any alteration within the Q0182 open reading frame. C) Deletion of MRS1 (BY4741 Δ mrs1 ), a nuclear gene involved in splicing mitochondrial type-I introns, has no effect on i) MSY1 or ii) RSM7 transcript levels. All transcript levels were standardized to nuclear ACT1 and expressed as percentage of wild-type (set at 100%) +/− standard error of the mean (n = 2).

Techniques Used: Activity Assay, Quantitative RT-PCR

31) Product Images from "Identification and characterisation of Dof transcription factors in the cucumber genome"

Article Title: Identification and characterisation of Dof transcription factors in the cucumber genome

Journal: Scientific Reports

doi: 10.1038/srep23072

Expression profiling of CsDof genes under WMV stress. The 34 CsDof genes were determined to have varied expression after WMV inoculation via qRT-PCR, and the sparkline presents the expression variation. The expression colour scale was shown at the top. A higher expression for each gene was presented in red; otherwise, green was used. The columns indicate the changes in CsDof gene expression levels at various time points (1 d, 3 d, 6 d, 9 d, 12 d, 18 d and 24 d under WMV inoculation; Ck was treated with MOCK).
Figure Legend Snippet: Expression profiling of CsDof genes under WMV stress. The 34 CsDof genes were determined to have varied expression after WMV inoculation via qRT-PCR, and the sparkline presents the expression variation. The expression colour scale was shown at the top. A higher expression for each gene was presented in red; otherwise, green was used. The columns indicate the changes in CsDof gene expression levels at various time points (1 d, 3 d, 6 d, 9 d, 12 d, 18 d and 24 d under WMV inoculation; Ck was treated with MOCK).

Techniques Used: Expressing, Quantitative RT-PCR

32) Product Images from "iTRAQ-Based Proteomic Analysis of Ogura-CMS Cabbage and Its Maintainer Line"

Article Title: iTRAQ-Based Proteomic Analysis of Ogura-CMS Cabbage and Its Maintainer Line

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19103180

Integrative analyses comparing proteome and transcriptome data. ( A ) Genes were divided into nine groups according to log 2 ratios of the protein species ( y -axis) and transcripts ( x -axis); ( B ) Number of genes among the nine groups in ( A ). T: transcript; P: protein species; N, no difference; U: up-accumulation; D, down-accumulation. ( C ) Expression validation for nine key genes by qRT-PCR. * p
Figure Legend Snippet: Integrative analyses comparing proteome and transcriptome data. ( A ) Genes were divided into nine groups according to log 2 ratios of the protein species ( y -axis) and transcripts ( x -axis); ( B ) Number of genes among the nine groups in ( A ). T: transcript; P: protein species; N, no difference; U: up-accumulation; D, down-accumulation. ( C ) Expression validation for nine key genes by qRT-PCR. * p

Techniques Used: Expressing, Quantitative RT-PCR

33) Product Images from "miR-30b, Down-Regulated in Gastric Cancer, Promotes Apoptosis and Suppresses Tumor Growth by Targeting Plasminogen Activator Inhibitor-1"

Article Title: miR-30b, Down-Regulated in Gastric Cancer, Promotes Apoptosis and Suppresses Tumor Growth by Targeting Plasminogen Activator Inhibitor-1

Journal: PLoS ONE

doi: 10.1371/journal.pone.0106049

Inverse correlation between miR-30b and PAI-1 expression in gastric cancer cell lines and human tumor tissues. ( A ) The expression of mir-30b and PAI-1 in gastric cancer cell lines MKN45, MGC-823, SGC-7901, AGS and HGC-27. Top, western blot analysis of PAI-1 protein levels; bottom, qRT-PCR analysis of miR-30b levels. Data represent means±S.D. from three independent experiments. ( B ) miR-30b and PAI-1 mRNA levels in gastric cancer tissues were analyzed by qRT-PCR. The inset graph indicated a statistically significant inverse correlation ( R = −0.6475, P = 0.0123). U6 and β-actin served as internal normalized references for miR-30b and PAI-1 mRNA, respectively.
Figure Legend Snippet: Inverse correlation between miR-30b and PAI-1 expression in gastric cancer cell lines and human tumor tissues. ( A ) The expression of mir-30b and PAI-1 in gastric cancer cell lines MKN45, MGC-823, SGC-7901, AGS and HGC-27. Top, western blot analysis of PAI-1 protein levels; bottom, qRT-PCR analysis of miR-30b levels. Data represent means±S.D. from three independent experiments. ( B ) miR-30b and PAI-1 mRNA levels in gastric cancer tissues were analyzed by qRT-PCR. The inset graph indicated a statistically significant inverse correlation ( R = −0.6475, P = 0.0123). U6 and β-actin served as internal normalized references for miR-30b and PAI-1 mRNA, respectively.

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR

34) Product Images from "Aflatoxin B1 affects apoptosis and expression of death receptor and endoplasmic reticulum molecules in chicken spleen"

Article Title: Aflatoxin B1 affects apoptosis and expression of death receptor and endoplasmic reticulum molecules in chicken spleen

Journal: Oncotarget

doi: 10.18632/oncotarget.20595

Expression levels of apoptosis associated gens by qRT-PCR Note: Data are presented with the means ± standard deviation ( n = 6). * P
Figure Legend Snippet: Expression levels of apoptosis associated gens by qRT-PCR Note: Data are presented with the means ± standard deviation ( n = 6). * P

Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

35) Product Images from "An Overexpressed Q Allele Leads to Increased Spike Density and Improved Processing Quality in Common Wheat (Triticum aestivum)"

Article Title: An Overexpressed Q Allele Leads to Increased Spike Density and Improved Processing Quality in Common Wheat (Triticum aestivum)

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.117.300562

Expression of Q c1 measured by qRT-PCR. (A–D) Spikes of S-Cp1-1 (left) and WT (right) at GS22, GS24, GS29, and GS32, respectively. Scale bar, 0.1 cm (A and B) and 1 cm (C and D). (E) Relative expression levels of Q c1 and Q in root, stem, and leaf at GS24. (F) Relative expression of Q c1 and Q at GS24, GS29, and GS32. Error bars represent means ± SD ( n = 3).
Figure Legend Snippet: Expression of Q c1 measured by qRT-PCR. (A–D) Spikes of S-Cp1-1 (left) and WT (right) at GS22, GS24, GS29, and GS32, respectively. Scale bar, 0.1 cm (A and B) and 1 cm (C and D). (E) Relative expression levels of Q c1 and Q in root, stem, and leaf at GS24. (F) Relative expression of Q c1 and Q at GS24, GS29, and GS32. Error bars represent means ± SD ( n = 3).

Techniques Used: Expressing, Quantitative RT-PCR

36) Product Images from "Nucleolin mediates the internalization of rabbit hemorrhagic disease virus through clathrin-dependent endocytosis"

Article Title: Nucleolin mediates the internalization of rabbit hemorrhagic disease virus through clathrin-dependent endocytosis

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1007383

NCL is involved in RHDV internalization. (A) ]. (B) Immunofluorescence co-localization analysis of NCL (green) and VP60 (red). mRHDV-infected cells incubated with mAbs against NCL and VP60 at 0, 1, 2, 3, and 4 h, respectively. The small white boxes represent amplified random co-localization spots within the merged image, and the co-localization spots are indicated with white arrowheads. (C) The effect of changing the expression level of NCL on RHDV attachment. RK-13 cells were pre-transfected with Flag-tagged NCL plasmids or NCL siRNA for 24 h, or pre-incubated with anti-NCL mAb for 1 h at 37°C. The cells were then chilled and mRHDV was added at a MOI of 1. After viral attachment at 4°C for 2 h, the RK-13 cells were washed and lysed. The numbers of attached viral RNA copies were determined by qRT-PCR. Percent changes in VP60 RNA copy numbers were derived by comparing the number of VP60 RNA copies in the treated samples to those of the untreated RK-13 cells. The p3×FLAG-CMV-14 vector, non-specific siRNA, and mouse IgG were used as negative controls. (D) The effect of NCL on RHDV internalization. The treatment of cells in each group was the same as that for the attachment assay. RK-13 cells were incubated with mRHDV (MOI = 1) for 2 h at 4°C and then washed with chilled PBS. The temperature was then shifted to 37°C to facilitate viral internalization. At 30 min post infection, when RHDV internalization was proportionally increasing, the cells were washed in pre-chilled acidic PBS (pH = 2.5) to remove non-internalized viruses. After cell lysis, the amount of internalized mRHDV VP60 RNA copies was determined by qRT-PCR. The percentage of internalized VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The student’s t -tests and analysis of variance were used for statistical analyses. * p
Figure Legend Snippet: NCL is involved in RHDV internalization. (A) ]. (B) Immunofluorescence co-localization analysis of NCL (green) and VP60 (red). mRHDV-infected cells incubated with mAbs against NCL and VP60 at 0, 1, 2, 3, and 4 h, respectively. The small white boxes represent amplified random co-localization spots within the merged image, and the co-localization spots are indicated with white arrowheads. (C) The effect of changing the expression level of NCL on RHDV attachment. RK-13 cells were pre-transfected with Flag-tagged NCL plasmids or NCL siRNA for 24 h, or pre-incubated with anti-NCL mAb for 1 h at 37°C. The cells were then chilled and mRHDV was added at a MOI of 1. After viral attachment at 4°C for 2 h, the RK-13 cells were washed and lysed. The numbers of attached viral RNA copies were determined by qRT-PCR. Percent changes in VP60 RNA copy numbers were derived by comparing the number of VP60 RNA copies in the treated samples to those of the untreated RK-13 cells. The p3×FLAG-CMV-14 vector, non-specific siRNA, and mouse IgG were used as negative controls. (D) The effect of NCL on RHDV internalization. The treatment of cells in each group was the same as that for the attachment assay. RK-13 cells were incubated with mRHDV (MOI = 1) for 2 h at 4°C and then washed with chilled PBS. The temperature was then shifted to 37°C to facilitate viral internalization. At 30 min post infection, when RHDV internalization was proportionally increasing, the cells were washed in pre-chilled acidic PBS (pH = 2.5) to remove non-internalized viruses. After cell lysis, the amount of internalized mRHDV VP60 RNA copies was determined by qRT-PCR. The percentage of internalized VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The student’s t -tests and analysis of variance were used for statistical analyses. * p

Techniques Used: Immunofluorescence, Infection, Incubation, Amplification, Expressing, Transfection, Quantitative RT-PCR, Derivative Assay, Plasmid Preparation, Lysis

Synthetic DVN peptides significantly inhibit RHDV internalization. (A) RK-13 cells were pretreated with DVN or control peptides at a concentration of 100 μg/mL for 6 h. Then, the attachment and internalization assays were performed with mRHDV-infected cells (MOI = 1) and the cells harvested for RNA analysis. The percentage of RHDV VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The control peptide was employed as a negative control. (B) Kinetics of mRHDV internalization into RK-13 cells. Internalization of mRHDV (MOI = 1) or mRHDV-FITC into RK-13 cells was assessed by mRHDV incubation for 10, 30, and 60 min at 37°C. The amount of internalized virus was determined by qRT-PCR and expressed as VP60 RNA copies per 100,000 of GADPH. (C) RK-13 cells were pretreated with the DVN and control peptides at concentrations of 5, 10, 20, 40, 80, and 100 μg/mL for 6 h, respectively. mRHDV-FITC-infected cells (MOI = 1) were then used for internalization assays and harvested for flow cytometry analyses. The control peptide was employed as a negative control. The data are representative of the means and standard deviations (error bars) of three samples per group (** p
Figure Legend Snippet: Synthetic DVN peptides significantly inhibit RHDV internalization. (A) RK-13 cells were pretreated with DVN or control peptides at a concentration of 100 μg/mL for 6 h. Then, the attachment and internalization assays were performed with mRHDV-infected cells (MOI = 1) and the cells harvested for RNA analysis. The percentage of RHDV VP60 copies was calculated as a ratio to the value obtained from untreated RK-13 cells. The control peptide was employed as a negative control. (B) Kinetics of mRHDV internalization into RK-13 cells. Internalization of mRHDV (MOI = 1) or mRHDV-FITC into RK-13 cells was assessed by mRHDV incubation for 10, 30, and 60 min at 37°C. The amount of internalized virus was determined by qRT-PCR and expressed as VP60 RNA copies per 100,000 of GADPH. (C) RK-13 cells were pretreated with the DVN and control peptides at concentrations of 5, 10, 20, 40, 80, and 100 μg/mL for 6 h, respectively. mRHDV-FITC-infected cells (MOI = 1) were then used for internalization assays and harvested for flow cytometry analyses. The control peptide was employed as a negative control. The data are representative of the means and standard deviations (error bars) of three samples per group (** p

Techniques Used: Concentration Assay, Infection, Negative Control, Incubation, Quantitative RT-PCR, Flow Cytometry, Cytometry

37) Product Images from "Long non‐coding RNA ROR promotes proliferation, migration and chemoresistance of nasopharyngeal carcinoma"

Article Title: Long non‐coding RNA ROR promotes proliferation, migration and chemoresistance of nasopharyngeal carcinoma

Journal: Cancer Science

doi: 10.1111/cas.12989

Aberrant expression of lnc RNA ‐ ROR in human nasopharyngeal carcinoma ( NPC ) tissue samples and cell lines. (a) The expression levels of lnc RNA ‐ ROR in NPC and non‐cancer tissue were measured by qRT ‐ PCR . T (human NPC tissues), N (non‐cancer tissue). (b) qRT ‐ PCR assays for lnc RNA ‐ ROR expression in NPC cell lines ( CNE 2, CNE 1, 5‐8F and 6‐10B). Relative levels compared with the nasopharyngeal epithelia cell NP 69 for qRT ‐ PCR . Data are mean ± SE . * P
Figure Legend Snippet: Aberrant expression of lnc RNA ‐ ROR in human nasopharyngeal carcinoma ( NPC ) tissue samples and cell lines. (a) The expression levels of lnc RNA ‐ ROR in NPC and non‐cancer tissue were measured by qRT ‐ PCR . T (human NPC tissues), N (non‐cancer tissue). (b) qRT ‐ PCR assays for lnc RNA ‐ ROR expression in NPC cell lines ( CNE 2, CNE 1, 5‐8F and 6‐10B). Relative levels compared with the nasopharyngeal epithelia cell NP 69 for qRT ‐ PCR . Data are mean ± SE . * P

Techniques Used: Expressing, Quantitative RT-PCR

Lnc RNA ‐ ROR promotes nasopharyngeal carcinoma ( NPC ) cell proliferation by regulating the cell cycle. (a) CNE 2 cells were transfected with no si RNA ( CNE 2), si‐ NC (scrambled si RNA ) and si RNA ROR . After 48 h, total RNA from CNE 2 cells was isolated and qRT ‐ PCR for lnc RNA ‐ ROR was performed. (b) CCK 8 assays were used to determine the viability of si RNA ROR transfected CNE 2 cells. (c) Flow cytometry assays were performed to analyze the cell cycle progression when CNE 2 cells were transfected with si RNA ROR 24 h later. (d) The expression of Proliferating Cell Nuclear Antigen and cyclin A were detected by western blot analysis. Data are mean ± SE . The same experiments were performed in triplicate. * P
Figure Legend Snippet: Lnc RNA ‐ ROR promotes nasopharyngeal carcinoma ( NPC ) cell proliferation by regulating the cell cycle. (a) CNE 2 cells were transfected with no si RNA ( CNE 2), si‐ NC (scrambled si RNA ) and si RNA ROR . After 48 h, total RNA from CNE 2 cells was isolated and qRT ‐ PCR for lnc RNA ‐ ROR was performed. (b) CCK 8 assays were used to determine the viability of si RNA ROR transfected CNE 2 cells. (c) Flow cytometry assays were performed to analyze the cell cycle progression when CNE 2 cells were transfected with si RNA ROR 24 h later. (d) The expression of Proliferating Cell Nuclear Antigen and cyclin A were detected by western blot analysis. Data are mean ± SE . The same experiments were performed in triplicate. * P

Techniques Used: Transfection, Isolation, Quantitative RT-PCR, CCK-8 Assay, Flow Cytometry, Cytometry, Expressing, Western Blot

Lnc RNA ‐ ROR can improve the chemoresistance of nasopharyngeal carcinoma ( NPC ). (a) The expression levels of lnc RNA ‐ ROR in treated CNE 2 were measured by qRT ‐ PCR . (b) qRT ‐ PCR assays for lnc RNA ‐ ROR expression in CNE 2 cultured with DDP concentration gradient. (c) CCK 8 assays were used to determine the viability of si RNA ‐1 transfected CNE 2 cells with DDP . (d) Flow cytometry assays were performed to analyze the cell cycle progression. CNE 2 cells were first treated by DDP then transfected with negative control or si RNA ‐1 at the indicated concentrations for 24 h before harvesting for flow cytometry assays. (e) Flow cytometry assays were performed to analyze the cell cycle progression. CNE 2 cells were first treated by DDP then transfected with negative control or si RNA ‐1 at the indicated concentrations for 24 h before harvesting for apoptosis. (f) CNE 2 cells were transfected with control si RNA or si RNA ‐1 for 6 h, treated with DDP in 2.0 μg/mL. The cells were harvested for western blot at the indicated time points after DDP treatment. The same experiments were performed in triplicate. Data are mean ± SE . * P
Figure Legend Snippet: Lnc RNA ‐ ROR can improve the chemoresistance of nasopharyngeal carcinoma ( NPC ). (a) The expression levels of lnc RNA ‐ ROR in treated CNE 2 were measured by qRT ‐ PCR . (b) qRT ‐ PCR assays for lnc RNA ‐ ROR expression in CNE 2 cultured with DDP concentration gradient. (c) CCK 8 assays were used to determine the viability of si RNA ‐1 transfected CNE 2 cells with DDP . (d) Flow cytometry assays were performed to analyze the cell cycle progression. CNE 2 cells were first treated by DDP then transfected with negative control or si RNA ‐1 at the indicated concentrations for 24 h before harvesting for flow cytometry assays. (e) Flow cytometry assays were performed to analyze the cell cycle progression. CNE 2 cells were first treated by DDP then transfected with negative control or si RNA ‐1 at the indicated concentrations for 24 h before harvesting for apoptosis. (f) CNE 2 cells were transfected with control si RNA or si RNA ‐1 for 6 h, treated with DDP in 2.0 μg/mL. The cells were harvested for western blot at the indicated time points after DDP treatment. The same experiments were performed in triplicate. Data are mean ± SE . * P

Techniques Used: Expressing, Quantitative RT-PCR, Cell Culture, Concentration Assay, CCK-8 Assay, Transfection, Flow Cytometry, Cytometry, Negative Control, Western Blot

38) Product Images from "Identification of Glyceraldehyde 3-Phosphate Dehydrogenase Sequence and Expression Profiles in Tree Shrew (Tupaia belangeri)"

Article Title: Identification of Glyceraldehyde 3-Phosphate Dehydrogenase Sequence and Expression Profiles in Tree Shrew (Tupaia belangeri)

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098552

Expression-Profile Measurement of Tree shrew GAPDH Gene. Three pair of primers for qRT-PCR were designed to measure tsGAPDH mRNA expression in various tree shrew tissues. Data are shown in a point chart and grouped according to ANOVA (p
Figure Legend Snippet: Expression-Profile Measurement of Tree shrew GAPDH Gene. Three pair of primers for qRT-PCR were designed to measure tsGAPDH mRNA expression in various tree shrew tissues. Data are shown in a point chart and grouped according to ANOVA (p

Techniques Used: Expressing, Quantitative RT-PCR

39) Product Images from "MicroRNA-125b inhibits cell proliferation and induces cell apoptosis in esophageal squamous cell carcinoma by targeting BMF"

Article Title: MicroRNA-125b inhibits cell proliferation and induces cell apoptosis in esophageal squamous cell carcinoma by targeting BMF

Journal: Oncology Reports

doi: 10.3892/or.2018.6413

BMF is a direct target of miR-125b in ESCC cancer cells. (A) The prediction of the binding between miR-125b and BMF as determined using TargetScan. (B) A dual-luciferase reporter assay was performed to verify the binding of miR-125b with BMF. (C) qRT-PCR assay was performed to detect the mRNA level of BMF in EC109 and EC9706 cells treated with miR-125b mimics and miR-125b inhibitors. (D) The expression of BMF was assessed in the tumor sections. *P
Figure Legend Snippet: BMF is a direct target of miR-125b in ESCC cancer cells. (A) The prediction of the binding between miR-125b and BMF as determined using TargetScan. (B) A dual-luciferase reporter assay was performed to verify the binding of miR-125b with BMF. (C) qRT-PCR assay was performed to detect the mRNA level of BMF in EC109 and EC9706 cells treated with miR-125b mimics and miR-125b inhibitors. (D) The expression of BMF was assessed in the tumor sections. *P

Techniques Used: Binding Assay, Luciferase, Reporter Assay, Quantitative RT-PCR, Expressing

The expression of miR-125b in ESCC tissues and cells. (A) The expression of miR-125b in ESCC and paired normal tissues was examined by qRT-PCR. (B) The expression of miR-125b in ESCC cell lines and a human esophageal epithelial cell line was examined by qRT-PCR. *P
Figure Legend Snippet: The expression of miR-125b in ESCC tissues and cells. (A) The expression of miR-125b in ESCC and paired normal tissues was examined by qRT-PCR. (B) The expression of miR-125b in ESCC cell lines and a human esophageal epithelial cell line was examined by qRT-PCR. *P

Techniques Used: Expressing, Quantitative RT-PCR

BMF inhibits ESCC cell proliferation. (A) A qRT-PCR assay was conducted to assess the mRNA expression of BMF. (B) Western blot analysis was performed to assess the protein expression of BMF. (C) A CCK-8 assay was used to reveal the proliferation rate in ESCC cells with si-BMF transfection. (D) The cell cycle was examined in ESCC cell lines. *P
Figure Legend Snippet: BMF inhibits ESCC cell proliferation. (A) A qRT-PCR assay was conducted to assess the mRNA expression of BMF. (B) Western blot analysis was performed to assess the protein expression of BMF. (C) A CCK-8 assay was used to reveal the proliferation rate in ESCC cells with si-BMF transfection. (D) The cell cycle was examined in ESCC cell lines. *P

Techniques Used: Quantitative RT-PCR, Expressing, Western Blot, CCK-8 Assay, Transfection

40) Product Images from "Long noncoding RNA AFAP1-AS1 predicts a poor prognosis and regulates non–small cell lung cancer cell proliferation by epigenetically repressing p21 expression"

Article Title: Long noncoding RNA AFAP1-AS1 predicts a poor prognosis and regulates non–small cell lung cancer cell proliferation by epigenetically repressing p21 expression

Journal: Molecular Cancer

doi: 10.1186/s12943-018-0836-7

AFAP1-AS1 could directly bind to EZH2. a After nuclear and cytosolic separation, RNA expression levels were measured by qRT-PCR. GAPDH was used as a cytosol marker and U6 was used as a nucleus marker. b RIPs experiments for EZH2, SUZ12 were performed and the coprecipitated RNA was subjected to qRT-PCR for AFAP1-AS1
Figure Legend Snippet: AFAP1-AS1 could directly bind to EZH2. a After nuclear and cytosolic separation, RNA expression levels were measured by qRT-PCR. GAPDH was used as a cytosol marker and U6 was used as a nucleus marker. b RIPs experiments for EZH2, SUZ12 were performed and the coprecipitated RNA was subjected to qRT-PCR for AFAP1-AS1

Techniques Used: RNA Expression, Quantitative RT-PCR, Marker

AFAP1-AS1 regulates NSCLC cell proliferation in vitro. a Analysis of AFAP1-AS1 expression levels in NSCLC cell lines compared with a normal bronchial epithelial cell line (16HBE) using qRT-PCR. b The relative expression levels of AFAP1-AS1 in A549 and SPCA1 cells transfected with si-NC or si-AFAP1-AS1 (si-AFAP1-AS1 1# and si-AFAP1-AS1 2#) were measured using qPCR. c MTT assays were performed after transfection to determine the cell viability of the transfected A549 and SPCA1 cells. d Colony-forming assays were conducted after transfection to determine the proliferation of the transfected A549 and SPCA1 cells. The colonies were counted and captured. e BrdU assays were used to detect the cell proliferation after transfection, respectively. f After transfection, the cell cycle stages of A549 and SPCA1 cells were analyzed by flow cytometry. The bar chart represents the percentages of cells in the G1/G0, S, or G2/M phases, as indicated.*, P
Figure Legend Snippet: AFAP1-AS1 regulates NSCLC cell proliferation in vitro. a Analysis of AFAP1-AS1 expression levels in NSCLC cell lines compared with a normal bronchial epithelial cell line (16HBE) using qRT-PCR. b The relative expression levels of AFAP1-AS1 in A549 and SPCA1 cells transfected with si-NC or si-AFAP1-AS1 (si-AFAP1-AS1 1# and si-AFAP1-AS1 2#) were measured using qPCR. c MTT assays were performed after transfection to determine the cell viability of the transfected A549 and SPCA1 cells. d Colony-forming assays were conducted after transfection to determine the proliferation of the transfected A549 and SPCA1 cells. The colonies were counted and captured. e BrdU assays were used to detect the cell proliferation after transfection, respectively. f After transfection, the cell cycle stages of A549 and SPCA1 cells were analyzed by flow cytometry. The bar chart represents the percentages of cells in the G1/G0, S, or G2/M phases, as indicated.*, P

Techniques Used: In Vitro, Expressing, Quantitative RT-PCR, Transfection, Real-time Polymerase Chain Reaction, MTT Assay, Flow Cytometry, Cytometry

RNA-seq assay after AFAP1-AS1 knockdown in A549 cells. a Mean-centered, hierarchical clustering of 591 transcripts altered (≥2-fold change) in si-NC-treated cells and siRNA-AFAP1-AS1 treated A549 cells. b Gene Ontology analysis for all genes with altered expressions. c The altered mRNA levels of genes were selectively confirmed by qRT-PCR in knockdown AFAP1-AS1
Figure Legend Snippet: RNA-seq assay after AFAP1-AS1 knockdown in A549 cells. a Mean-centered, hierarchical clustering of 591 transcripts altered (≥2-fold change) in si-NC-treated cells and siRNA-AFAP1-AS1 treated A549 cells. b Gene Ontology analysis for all genes with altered expressions. c The altered mRNA levels of genes were selectively confirmed by qRT-PCR in knockdown AFAP1-AS1

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR

Related Articles

Clone Assay:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Amplification:

Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Polymerase Chain Reaction:

Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

TA Cloning:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Quantitative RT-PCR:

Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

Article Title: P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression
Article Snippet: .. After the RT reaction, 1 μ l of the complementary DNA was used for subsequent qRT-PCR reactions (SYBR Premix Ex Taq, TaKaRa) according to the manufacturer's instructions. .. The results were normalized to the expression of GAPDH.

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. ..

Real-time Polymerase Chain Reaction:

Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer
Article Snippet: .. According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ). .. The 25 μl mixture of PCR consisted of 12.5 μl SYBR Green supermix, 8.5 μl RNase-free water, 1 μl forward primers, 1 μl reverse primers and 2 μl reverse transcribed product.

Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
Article Snippet: .. The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions. .. Cells were lysed in RIPA buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) containing protease inhibitors.

Expressing:

Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

Sequencing:

Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

Plasmid Preparation:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa qrt pcr total rna
    Detailed expression profile analysis of the four SlPG genes based on <t>qRT-PCR</t> analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.
    Qrt Pcr Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 246 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr total rna/product/TaKaRa
    Average 94 stars, based on 246 article reviews
    Price from $9.99 to $1999.99
    qrt pcr total rna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    TaKaRa real time quantitative polymerase chain reaction qrt pcr total rna
    LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by <t>qRT-PCR</t> in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p
    Real Time Quantitative Polymerase Chain Reaction Qrt Pcr Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative polymerase chain reaction qrt pcr total rna/product/TaKaRa
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time quantitative polymerase chain reaction qrt pcr total rna - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    TaKaRa quantitative real time rt pcr qrt pcr
    Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by <t>qRT-PCR</t> (list of primers are provided in Table S2 ). * P
    Quantitative Real Time Rt Pcr Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time rt pcr qrt pcr/product/TaKaRa
    Average 92 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    quantitative real time rt pcr qrt pcr - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    86
    TaKaRa two step relative qrt pcr
    Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for <t>qRT-PCR</t> analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p
    Two Step Relative Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/two step relative qrt pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    two step relative qrt pcr - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Image Search Results


    Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.

    Journal: International Journal of Molecular Sciences

    Article Title: Genome-Wide Identification and Analysis of Polygalacturonase Genes in Solanum lycopersicum

    doi: 10.3390/ijms19082290

    Figure Lengend Snippet: Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.

    Article Snippet: Expression Analysis of SlPG Genes by qRT-PCR Total RNA was extracted using MiniBEST Plant RNA Extraction Kit (Takara, Japan).

    Techniques: Expressing, Quantitative RT-PCR

    LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by qRT-PCR in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by qRT-PCR in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    Up-regulation of lncRNA CASC2 inhibited proliferation in hypoxia-induced PASMCs. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in PASMCs. ( b ) Cell number of PASMCs was counted by CyQuant cell proliferation assay kit. ( c ) The mRNA expression of PCNA was detected by qRT-PCR in PASMCs. ( d ) The protein expression of PCNA was detected by western blot analysis in PASMCs. ( e , f ) Cell proliferation status of PASMCs was assessed by EdU staining assay. ### p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: Up-regulation of lncRNA CASC2 inhibited proliferation in hypoxia-induced PASMCs. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in PASMCs. ( b ) Cell number of PASMCs was counted by CyQuant cell proliferation assay kit. ( c ) The mRNA expression of PCNA was detected by qRT-PCR in PASMCs. ( d ) The protein expression of PCNA was detected by western blot analysis in PASMCs. ( e , f ) Cell proliferation status of PASMCs was assessed by EdU staining assay. ### p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR, CyQUANT Assay, Proliferation Assay, Western Blot, Staining

    LncRNA CASC2 was down-regulated in hypoxia-induced rats and reversed the increase of mPAP and progression of right ventricular hypertrophy caused by hypoxia. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in rat pulmonary arterial tissues. ( b ) Systemic blood pressure (SBP) was assessed in normoxia and hypoxia-induced rats. ( c ) Mean pulmonary arterial pressure (mPAP) was detected in normoxia and hypoxia-induced rats. ( d ) The right ventricular hypertrophy index (RVI) was calculated in normoxia and hypoxia-induced rats. # p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: LncRNA CASC2 was down-regulated in hypoxia-induced rats and reversed the increase of mPAP and progression of right ventricular hypertrophy caused by hypoxia. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in rat pulmonary arterial tissues. ( b ) Systemic blood pressure (SBP) was assessed in normoxia and hypoxia-induced rats. ( c ) Mean pulmonary arterial pressure (mPAP) was detected in normoxia and hypoxia-induced rats. ( d ) The right ventricular hypertrophy index (RVI) was calculated in normoxia and hypoxia-induced rats. # p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR

    Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by qRT-PCR (list of primers are provided in Table S2 ). * P

    Journal: PLoS ONE

    Article Title: The Molecular Basis of Inactivation of Metronidazole-Resistant Helicobacter pylori Using Polyethyleneimine Functionalized Zinc Oxide Nanoparticles

    doi: 10.1371/journal.pone.0070776

    Figure Lengend Snippet: Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by qRT-PCR (list of primers are provided in Table S2 ). * P

    Article Snippet: Quantitative real-time RT-PCR (qRT-PCR) was performed using the SYBR Green One-step qRT-PCR kit (Takara) in an iCycler IQ5, Real-time PCR Detection System (Bio-Rad).

    Techniques: Incubation, Transmission Electron Microscopy, Quantitative RT-PCR

    Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for qRT-PCR analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p

    Journal: PLoS ONE

    Article Title: Contribution of Eukaryotic-Type Serine/Threonine Kinase to Stress Response and Virulence of Streptococcus suis

    doi: 10.1371/journal.pone.0091971

    Figure Lengend Snippet: Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for qRT-PCR analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p

    Article Snippet: The two-step relative qRT-PCR was performed to analyze the expression profile of the virulence factors using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China).

    Techniques: Expressing, In Vitro, Quantitative RT-PCR