qrt pcr reactions  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Premix Ex Taq
    Description:
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    Catalog Number:
    rr390w
    Price:
    None
    Size:
    1 000 Rxns
    Category:
    Premix Ex Taq Probe qPCR qPCR with probe detection Real time PCR kits Real time PCR
    Buy from Supplier


    Structured Review

    TaKaRa qrt pcr reactions
    Age-related changes in the expression of genes and proteins of PDLSCs from different age groups. a , c <t>qRT-PCR</t> analysis showed that compared with YPDLSCs, CCND3 and RC3H2 mRNA expression in APDLSCs were upregulated, whereas Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 mRNA expression levels were downregulated. b , d qRT-PCR analysis showed that compared with YPDLSCs (co-cultured with PBMCs), the expression of CCND3 and RC3H2 in APDLSCs (co-cultured with PBMCs) increased, whereas the expression of Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 decreased. e , f Western blot analysis showed that the protein expression levels of Runx2, ALP, COL1A1, and PPARγ2 in APDLSCs were lower than YPDLSCs, whereas those of CCND3 in APDLSCs was higher than YPDLSCs. The young group had three independent donors, and the adult group had three independent donors. Data are presented as mean ± SD of three independent experiments (* p
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    https://www.bioz.com/result/qrt pcr reactions/product/TaKaRa
    Average 99 stars, based on 152 article reviews
    Price from $9.99 to $1999.99
    qrt pcr reactions - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "The effect of aging on the biological and immunological characteristics of periodontal ligament stem cells"

    Article Title: The effect of aging on the biological and immunological characteristics of periodontal ligament stem cells

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-020-01846-w

    Age-related changes in the expression of genes and proteins of PDLSCs from different age groups. a , c qRT-PCR analysis showed that compared with YPDLSCs, CCND3 and RC3H2 mRNA expression in APDLSCs were upregulated, whereas Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 mRNA expression levels were downregulated. b , d qRT-PCR analysis showed that compared with YPDLSCs (co-cultured with PBMCs), the expression of CCND3 and RC3H2 in APDLSCs (co-cultured with PBMCs) increased, whereas the expression of Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 decreased. e , f Western blot analysis showed that the protein expression levels of Runx2, ALP, COL1A1, and PPARγ2 in APDLSCs were lower than YPDLSCs, whereas those of CCND3 in APDLSCs was higher than YPDLSCs. The young group had three independent donors, and the adult group had three independent donors. Data are presented as mean ± SD of three independent experiments (* p
    Figure Legend Snippet: Age-related changes in the expression of genes and proteins of PDLSCs from different age groups. a , c qRT-PCR analysis showed that compared with YPDLSCs, CCND3 and RC3H2 mRNA expression in APDLSCs were upregulated, whereas Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 mRNA expression levels were downregulated. b , d qRT-PCR analysis showed that compared with YPDLSCs (co-cultured with PBMCs), the expression of CCND3 and RC3H2 in APDLSCs (co-cultured with PBMCs) increased, whereas the expression of Runx2, ALP, COL1A1, PPARγ2, PPP3CB, CXCL12, FKBP1A, FKBP1B, NCSTN, P2RX7, RIPK2, SLC11A1, and TP53 decreased. e , f Western blot analysis showed that the protein expression levels of Runx2, ALP, COL1A1, and PPARγ2 in APDLSCs were lower than YPDLSCs, whereas those of CCND3 in APDLSCs was higher than YPDLSCs. The young group had three independent donors, and the adult group had three independent donors. Data are presented as mean ± SD of three independent experiments (* p

    Techniques Used: Expressing, Quantitative RT-PCR, Cell Culture, Western Blot

    2) Product Images from "SILAC-Based Quantitative Proteomics Identifies Multifactorial Mechanism of Oxaliplatin Resistance in Pancreatic Cancer Cells"

    Article Title: SILAC-Based Quantitative Proteomics Identifies Multifactorial Mechanism of Oxaliplatin Resistance in Pancreatic Cancer Cells

    Journal: bioRxiv

    doi: 10.1101/2020.09.04.283150

    MARCKS-or WLS-mediated downstream signaling is activated in PANC-1R cells. (A) The SILAC ratio of MARCKS was increased in PANC-1R cells. (B) The quantitative level of MARCKS mRNA by qRT-PCR was higher in PANC-1R cells. Three independent experiments were performed in triplicates. (C) The protein level of MARCKS, phosphor-Akt (Ser473 or Thr308), and total Akt was determined by Western blotting. GAPDH was the loading control. (D) The SILAC ratio of WLS was increased in PANC-1R cells. (E) The level of WLS mRNA by qRT-PCR was higher in PANC-1R cells. Three independent experiments were performed in triplicate. (F) The protein level of WLS, β-catenin, and cyclin D1 was determined by Western blotting. GAPDH was loading control. ** p
    Figure Legend Snippet: MARCKS-or WLS-mediated downstream signaling is activated in PANC-1R cells. (A) The SILAC ratio of MARCKS was increased in PANC-1R cells. (B) The quantitative level of MARCKS mRNA by qRT-PCR was higher in PANC-1R cells. Three independent experiments were performed in triplicates. (C) The protein level of MARCKS, phosphor-Akt (Ser473 or Thr308), and total Akt was determined by Western blotting. GAPDH was the loading control. (D) The SILAC ratio of WLS was increased in PANC-1R cells. (E) The level of WLS mRNA by qRT-PCR was higher in PANC-1R cells. Three independent experiments were performed in triplicate. (F) The protein level of WLS, β-catenin, and cyclin D1 was determined by Western blotting. GAPDH was loading control. ** p

    Techniques Used: Quantitative RT-PCR, Western Blot

    3) Product Images from "Serum-derived three-circRNA signature as a diagnostic biomarker for hepatocellular carcinoma"

    Article Title: Serum-derived three-circRNA signature as a diagnostic biomarker for hepatocellular carcinoma

    Journal: Cancer Cell International

    doi: 10.1186/s12935-020-01302-y

    The qRT-PCR assay validation for three-circRNAs expression. Compared with the normal samples, hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were all notably up-regulated in the HCC serum samples
    Figure Legend Snippet: The qRT-PCR assay validation for three-circRNAs expression. Compared with the normal samples, hsa_circ_0004001, hsa_circ_0004123, and hsa_circ_0075792 were all notably up-regulated in the HCC serum samples

    Techniques Used: Quantitative RT-PCR, Expressing

    4) Product Images from "P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression"

    Article Title: P53-regulated long non-coding RNA TUG1 affects cell proliferation in human non-small cell lung cancer, partly through epigenetically regulating HOXB7 expression

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2014.201

    The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P
    Figure Legend Snippet: The impact of TUG1 on tumorigenesis in vivo . ( a and b ) Scramble or shTUG1 was transfected into SPC-A1 cells, which were injected in the nude mice ( n =10), respectively. Tumor volumes were calculated after injection every 2 days. Bars indicate S.D. ( c ) Tumor weights are represented as means of tumor weights ±S.D. qRT-PCR was performed to detect the average expression of TUG1. ( d ) Histopathology of xenograft tumors. The tumor sections were under H E staining and IHC staining using antibodies against Ki-67. Bar, 100 μ m. Error bars indicate means±S.E.M. * P

    Techniques Used: In Vivo, Transfection, Injection, Mouse Assay, Quantitative RT-PCR, Expressing, Histopathology, Staining, Immunohistochemistry

    TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P
    Figure Legend Snippet: TUG1 could epigenetically regulate HOXB7 by binding to PRC2. ( a ) qRT-PCR was performed to detect the expression of HOX genes in transfected cells, and western blot assays were used to detect the level of HOXB7 after the transfection of si-TUG1. IHC assays were used to detect the HOXB7 in tumor sections from shTUG1-transfected cells. ( b ) RIP experiments were performed in SPC-A1 and the coprecipitated RNA was subjected to qRT-PCR for TUG1. HOTAIR was used as a positive control. The fold enrichment of TUG1 in EZH2 RIP is relative to its matching IgG control RIP. TUG1 nuclear localization, as identified using qRT-PCR in fractionated SPC-A1 and A549 cells. ( c ) ChIP of H3K27me3 and EZH2 of the promoter region of HOXB7 locus after siRNA treatment targeting si-NC or si-TUG1; qPCR were performed to determine the quantitation of ChIP assays. The levels of qPCR products are expressed as a percentage of the input DNA. Error bars indicate means±S.E.M. * P

    Techniques Used: Binding Assay, Quantitative RT-PCR, Expressing, Transfection, Western Blot, Immunohistochemistry, Positive Control, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitation Assay

    p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P
    Figure Legend Snippet: p53 induces TUG1 through interacting with the promoter region of TUG1. ( a ) Analysis of TUG1 expression levels in NSCLC cell lines (A549, SPC-A1, SK-MES-1, NCI-H1299 and NCI-H1650) compared with the normal bronchial epithelial cell line (16HBE) by qRT-PCR. ( b ) Description of p53RE and mutant p53RE in promoter region of TUG1. The position of ChIP primers ( e ) was indicated by arrows. ( c ) Western blotting was used to detect the p53 induction by doxo. qRT-PCR was used to detect the effect of doxo on TUG1 expression in p53-WT and p53-null cells. ( d ) Induction of TUG1 by ectopically expressed p53 (wild-type p53 or mutant p53). Overexpression was confirmed by western blotting. ( e ) Induction of TUG1 promoter activity by p53, but not mutant p53 in NCI-H1299 cell lines. ( f ) Deletion and mutation analysis of the promoter activity to determine the role of the p53RE in p53-mediated regulation of TUG1. ( g ) The p53 binding at the promoter regions of TUG1 was assessed by ChIP analysis. ChIP primers were detailed in Materials and Methods section. Shown are representative images of three independent experiments. Error bars indicate means±S.E.M. * P

    Techniques Used: Expressing, Quantitative RT-PCR, Mutagenesis, Chromatin Immunoprecipitation, Western Blot, Over Expression, Activity Assay, Binding Assay

    Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P
    Figure Legend Snippet: Analysis of TUG1 expression in NSCLC tissues and clinical parameters. ( a ) TUG1 was detected in 192 pairs of NSCLC tissues by qRT-PCR. The levels of TUG1 in NSCLC tissues are significantly lower than those in non-tumorous tissues. The ΔCt value was determined by subtracting the GAPDH Ct value from the TUG1 Ct value (relative to a single reference value). Smaller ΔCt value indicates higher expression. ( b and c ) Data are presented as relative expression level in tumor tissues (shown as ΔCt). TUG1 expression was significantly lower in patients with a higher pathological stage and big tumor size. ( d ) Patients with low levels of TUG1 expression showed reduced survival times compared with patients with high levels of TUG1 expression ( P

    Techniques Used: Expressing, Quantitative RT-PCR

    TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P
    Figure Legend Snippet: TUG1 could participate in AKT and MAPK pathway through modulating HOXB7. ( A ) MTT analysis of cell proliferation by co-transfection (si-NC, si-HOXB7, si-HOXB7+si-TUG1). At 48 h after transfection of si-HOXB7, the cell cycle and apoptosis were analyzed by flow cytometry. LR, early apoptotic cells. UR, terminal apoptotic cells. ( B ) qRT-PCR were performed to detect the expression of HOXB7 after overexpression of p53 and transfected with p53 followed by transfection with si-TUG1. ( C ) Western blotting analysis of the expression of p-ERK, total ERK, p-AKT, total AKT, p-GSK-3 β , total GSK-3 β proteins in indicated si-NC-transfected, si-HOXB7 and si-TUG1-transfected SPC-A1 cell lines. ( D ) Immunostaining of HOXB7 was negatively or very weakly positive in corresponding non-tumor lung tissues (a and b), but was strongly positive in squamous cell carcinoma tissues (c and d) and lung adenocarcinoma (e and f). Bar, 100 μ m. ( E ) The immunoreactivity of HOXB7 protein in NSCLC tissues showed a statistically significant inverse correlation with the relative level of TUG1 expression. Error bars indicate means±S.E.M. * P

    Techniques Used: MTT Assay, Cotransfection, Transfection, Flow Cytometry, Cytometry, Quantitative RT-PCR, Expressing, Over Expression, Western Blot, Immunostaining

    5) Product Images from "The long non-coding RNA lncRNA973 is involved in cotton response to salt stress"

    Article Title: The long non-coding RNA lncRNA973 is involved in cotton response to salt stress

    Journal: BMC Plant Biology

    doi: 10.1186/s12870-019-2088-0

    Characteristics of lncRNA973. a . Schematic diagram of the location of lncRNA973 in a chromosome. Yellow boxes show the exon of lncRNA973. P1 and P2 indicated the primers used for qRT-PCR to detect the expression level of lncRNA973 X1 and lncRNA973 X2 , respectively. b . Expression levels of lncRNA973 transcripts in cotton stem, root and cotyledon, determined by qPCR. c . Expression levels of lncRNA973 X1 and X2 in cotton true leaves treated with 250 mM NaCl at different time points, determined by qPCR. The lncRNA973 expression level was normalized by the GhUBQ7 expression level. The relative expression levels of lncRNA973 in stem and NaCl-0 h were assigned a value of 1, respectively. Error bars indicate ±SD of three biological replicates, with each measured in triplicate. Samples marked with different letters show a significant difference at p
    Figure Legend Snippet: Characteristics of lncRNA973. a . Schematic diagram of the location of lncRNA973 in a chromosome. Yellow boxes show the exon of lncRNA973. P1 and P2 indicated the primers used for qRT-PCR to detect the expression level of lncRNA973 X1 and lncRNA973 X2 , respectively. b . Expression levels of lncRNA973 transcripts in cotton stem, root and cotyledon, determined by qPCR. c . Expression levels of lncRNA973 X1 and X2 in cotton true leaves treated with 250 mM NaCl at different time points, determined by qPCR. The lncRNA973 expression level was normalized by the GhUBQ7 expression level. The relative expression levels of lncRNA973 in stem and NaCl-0 h were assigned a value of 1, respectively. Error bars indicate ±SD of three biological replicates, with each measured in triplicate. Samples marked with different letters show a significant difference at p

    Techniques Used: Quantitative RT-PCR, Expressing, Real-time Polymerase Chain Reaction

    6) Product Images from "MicroRNA-186-5p Inhibits Proliferation And Metastasis Of Esophageal Cancer By Mediating HOXA9"

    Article Title: MicroRNA-186-5p Inhibits Proliferation And Metastasis Of Esophageal Cancer By Mediating HOXA9

    Journal: OncoTargets and therapy

    doi: 10.2147/OTT.S227920

    MiR-186-5p is underexpressed in esophageal cancer tissues and cell lines. ( A ) qRT-PCR was used to detect the difference in expression of miR-186-5p in esophageal cancer tumor tissues and adjacent tissues; ( B ) qRT-PCR was used to detect the expression level of miR-186-5p in esophageal cancer cell lines; ( C ) Kaplan Meier survival curve of esophageal cancer patients based on miR-186-5p expression; the prognosis of patients with low expression was significantly worse than that of high expression group. Data are mean ± SD, * P
    Figure Legend Snippet: MiR-186-5p is underexpressed in esophageal cancer tissues and cell lines. ( A ) qRT-PCR was used to detect the difference in expression of miR-186-5p in esophageal cancer tumor tissues and adjacent tissues; ( B ) qRT-PCR was used to detect the expression level of miR-186-5p in esophageal cancer cell lines; ( C ) Kaplan Meier survival curve of esophageal cancer patients based on miR-186-5p expression; the prognosis of patients with low expression was significantly worse than that of high expression group. Data are mean ± SD, * P

    Techniques Used: Quantitative RT-PCR, Expressing

    Inhibition of esophageal cancer cell proliferation after overexpression of miR-186-5p. ( A ) qRT-PCR verified the interference efficiency of miR-186-5p after transfection of the miR-186-5p vector in the TE-1 and EC-109 cell lines; ( B ) The CCK-8 assay detects the effect of overexpression of the miR-186-5p vector on proliferation of esophageal cancer cells in TE-1 and EC-109 cell lines; ( C ) Plate cloning experiments were performed to detect the number of esophageal cancer proliferating positive cells after overexpression of miR-186-5p vector in TE-1 and EC-109 cell lines; the data were mean ± SD, * P
    Figure Legend Snippet: Inhibition of esophageal cancer cell proliferation after overexpression of miR-186-5p. ( A ) qRT-PCR verified the interference efficiency of miR-186-5p after transfection of the miR-186-5p vector in the TE-1 and EC-109 cell lines; ( B ) The CCK-8 assay detects the effect of overexpression of the miR-186-5p vector on proliferation of esophageal cancer cells in TE-1 and EC-109 cell lines; ( C ) Plate cloning experiments were performed to detect the number of esophageal cancer proliferating positive cells after overexpression of miR-186-5p vector in TE-1 and EC-109 cell lines; the data were mean ± SD, * P

    Techniques Used: Inhibition, Over Expression, Quantitative RT-PCR, Transfection, Plasmid Preparation, CCK-8 Assay, Clone Assay

    miR-186-5p binds directly to HOXA9. ( A ) The dual luciferase reporter assay validated the direct targeting of miR-186-5p with HOXA9; ( B ) qRT-PCR verified the expression level of HOXA9 after transfection of miR-186-5p in TE-1 and EC-109 cell lines; ( C ) qRT-PCR was used to detect the difference in expression of HOXA9 in tumor tissues and adjacent tissues of esophageal carcinoma; ( D ) qRT-PCR was used to detect the expression level of HOXA9 in esophageal cancer cell lines; ( E ) There was a significant negative correlation between miR-186-5p and HOXA9 expression in esophageal cancer tissues. Data are mean ± SD, * P
    Figure Legend Snippet: miR-186-5p binds directly to HOXA9. ( A ) The dual luciferase reporter assay validated the direct targeting of miR-186-5p with HOXA9; ( B ) qRT-PCR verified the expression level of HOXA9 after transfection of miR-186-5p in TE-1 and EC-109 cell lines; ( C ) qRT-PCR was used to detect the difference in expression of HOXA9 in tumor tissues and adjacent tissues of esophageal carcinoma; ( D ) qRT-PCR was used to detect the expression level of HOXA9 in esophageal cancer cell lines; ( E ) There was a significant negative correlation between miR-186-5p and HOXA9 expression in esophageal cancer tissues. Data are mean ± SD, * P

    Techniques Used: Luciferase, Reporter Assay, Quantitative RT-PCR, Expressing, Transfection

    miR-186-5p regulates the mechanism of action of HOXA9 to inhibit the development of esophageal cancer. ( A ) HOXA9 expression levels in eR esophageal cancer TE-1 and EC-109 cell lines co-transfected with miR-186-5p and HOXA9 were detected by qRT-PCR; ( B ) The CCK-8 assay detects the effect of co-transfection of miR-186-5p and HOXA9 overexpression vectors on proliferation of esophageal cancer cells in TE-1 and EC-109 cell lines; ( C ) Plate cloning experiments were performed to detect the number of esophageal cancer proliferation-positive cells after co-transfection of miR-186-5p and HOXA9 overexpression vectors in TE-1 and EC-109 cell lines; ( D ) Transwell assay was used to detect the effect of co-transfection of miR-186-5p and HOXA9 overexpression vectors on the migration ability of esophageal cancer cells in TE-1 and EC-109 cell lines. Data are mean ± SD, * P
    Figure Legend Snippet: miR-186-5p regulates the mechanism of action of HOXA9 to inhibit the development of esophageal cancer. ( A ) HOXA9 expression levels in eR esophageal cancer TE-1 and EC-109 cell lines co-transfected with miR-186-5p and HOXA9 were detected by qRT-PCR; ( B ) The CCK-8 assay detects the effect of co-transfection of miR-186-5p and HOXA9 overexpression vectors on proliferation of esophageal cancer cells in TE-1 and EC-109 cell lines; ( C ) Plate cloning experiments were performed to detect the number of esophageal cancer proliferation-positive cells after co-transfection of miR-186-5p and HOXA9 overexpression vectors in TE-1 and EC-109 cell lines; ( D ) Transwell assay was used to detect the effect of co-transfection of miR-186-5p and HOXA9 overexpression vectors on the migration ability of esophageal cancer cells in TE-1 and EC-109 cell lines. Data are mean ± SD, * P

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR, CCK-8 Assay, Cotransfection, Over Expression, Clone Assay, Transwell Assay, Migration

    7) Product Images from "Temperature-dependent fasciation mutants connect mitochondrial RNA processing to the control of cell proliferation during lateral root morphogenesis"

    Article Title: Temperature-dependent fasciation mutants connect mitochondrial RNA processing to the control of cell proliferation during lateral root morphogenesis

    Journal: bioRxiv

    doi: 10.1101/2020.06.09.141382

    Accumulation of polyadenylated mitochondrial transcripts in rrd1 . (A) MA plot for the microarray analysis of poly(A) + transcripts of rrd1 vs. wild-type (WT) explants in which LRs were induced at 28°C for 12 hours. (B) qRT–PCR analysis of explants in which LRs were induced at 28°C for 12 hours. The total and polyadenylated transcript levels are shown for cytochrome oxidase subunit 1 ( cox1 ), cox2, NADH dehydrogenase subunit 6 ( nad6 ), apocytochrome B ( cob ), and ATP synthase subunit 4 ( atp4 ) (mean ± s.d., N = 3, * P
    Figure Legend Snippet: Accumulation of polyadenylated mitochondrial transcripts in rrd1 . (A) MA plot for the microarray analysis of poly(A) + transcripts of rrd1 vs. wild-type (WT) explants in which LRs were induced at 28°C for 12 hours. (B) qRT–PCR analysis of explants in which LRs were induced at 28°C for 12 hours. The total and polyadenylated transcript levels are shown for cytochrome oxidase subunit 1 ( cox1 ), cox2, NADH dehydrogenase subunit 6 ( nad6 ), apocytochrome B ( cob ), and ATP synthase subunit 4 ( atp4 ) (mean ± s.d., N = 3, * P

    Techniques Used: Microarray, Quantitative RT-PCR

    Related Articles

    Clone Assay:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Amplification:

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    TA Cloning:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer
    Article Snippet: .. According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ). .. The 25 μl mixture of PCR consisted of 12.5 μl SYBR Green supermix, 8.5 μl RNase-free water, 1 μl forward primers, 1 μl reverse primers and 2 μl reverse transcribed product.

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
    Article Snippet: .. The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions. .. Cells were lysed in RIPA buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) containing protease inhibitors.

    Expressing:

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Sequencing:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Transformation Assay:

    Article Title: Oral administration of Lactobacillus reuteri expressing a 3D8 single-chain variable fragment (scFv) enhances chicken growth and conserves immune homeostasis
    Article Snippet: .. Quantitative real-time PCR to analyze the expression level of 3D8 scFv in transformed L. reuteri was conducted with SYBR Premix Ex Taq (TaKaRa, Otsu, Shinga, Japan) and a Rotor-Gene Q system (Qiagen, Chadstone, Victoria, Australia). .. The universal 16S rRNA gene as an internal control and 3D8 scFv gene were amplified with the indicated primers: 16S rRNA (forward 5′-CAYRCCGTAAACGATGARTGCTA-3′; reverse 5′-TAAGGTTCTTCGCGTWGCWTC-3′) and 3D8 scFv (forward 5′-GGCAGTATCTGCTGGTGAGA-3′; reverse 5′-CAGTGCCTGAACCACTACCA-3′) (Fig. ).

    Plasmid Preparation:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa qrt pcr total rna
    Detailed expression profile analysis of the four SlPG genes based on <t>qRT-PCR</t> analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.
    Qrt Pcr Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 246 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr total rna/product/TaKaRa
    Average 94 stars, based on 246 article reviews
    Price from $9.99 to $1999.99
    qrt pcr total rna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    TaKaRa real time quantitative polymerase chain reaction qrt pcr total rna
    LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by <t>qRT-PCR</t> in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p
    Real Time Quantitative Polymerase Chain Reaction Qrt Pcr Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time quantitative polymerase chain reaction qrt pcr total rna/product/TaKaRa
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time quantitative polymerase chain reaction qrt pcr total rna - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    92
    TaKaRa quantitative real time rt pcr qrt pcr
    Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by <t>qRT-PCR</t> (list of primers are provided in Table S2 ). * P
    Quantitative Real Time Rt Pcr Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time rt pcr qrt pcr/product/TaKaRa
    Average 92 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    quantitative real time rt pcr qrt pcr - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    86
    TaKaRa two step relative qrt pcr
    Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for <t>qRT-PCR</t> analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p
    Two Step Relative Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/two step relative qrt pcr/product/TaKaRa
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    two step relative qrt pcr - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.

    Journal: International Journal of Molecular Sciences

    Article Title: Genome-Wide Identification and Analysis of Polygalacturonase Genes in Solanum lycopersicum

    doi: 10.3390/ijms19082290

    Figure Lengend Snippet: Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.

    Article Snippet: Expression Analysis of SlPG Genes by qRT-PCR Total RNA was extracted using MiniBEST Plant RNA Extraction Kit (Takara, Japan).

    Techniques: Expressing, Quantitative RT-PCR

    LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by qRT-PCR in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: LncRNA CASC2 inhibited hypoxia-induced cell proliferation in rat pulmonary arterial tissues. ( a ) The mRNA expression of PCNA was detected by qRT-PCR in rats′ PAs tissues. ( b , c ) The protein expression of PCNA was detected by western blot analysis in rat pulmonary arterial tissues. ## p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot

    Up-regulation of lncRNA CASC2 inhibited proliferation in hypoxia-induced PASMCs. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in PASMCs. ( b ) Cell number of PASMCs was counted by CyQuant cell proliferation assay kit. ( c ) The mRNA expression of PCNA was detected by qRT-PCR in PASMCs. ( d ) The protein expression of PCNA was detected by western blot analysis in PASMCs. ( e , f ) Cell proliferation status of PASMCs was assessed by EdU staining assay. ### p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: Up-regulation of lncRNA CASC2 inhibited proliferation in hypoxia-induced PASMCs. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in PASMCs. ( b ) Cell number of PASMCs was counted by CyQuant cell proliferation assay kit. ( c ) The mRNA expression of PCNA was detected by qRT-PCR in PASMCs. ( d ) The protein expression of PCNA was detected by western blot analysis in PASMCs. ( e , f ) Cell proliferation status of PASMCs was assessed by EdU staining assay. ### p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR, CyQUANT Assay, Proliferation Assay, Western Blot, Staining

    LncRNA CASC2 was down-regulated in hypoxia-induced rats and reversed the increase of mPAP and progression of right ventricular hypertrophy caused by hypoxia. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in rat pulmonary arterial tissues. ( b ) Systemic blood pressure (SBP) was assessed in normoxia and hypoxia-induced rats. ( c ) Mean pulmonary arterial pressure (mPAP) was detected in normoxia and hypoxia-induced rats. ( d ) The right ventricular hypertrophy index (RVI) was calculated in normoxia and hypoxia-induced rats. # p

    Journal: Respiratory Research

    Article Title: Long non-coding RNA CASC2 suppresses pulmonary artery smooth muscle cell proliferation and phenotypic switch in hypoxia-induced pulmonary hypertension

    doi: 10.1186/s12931-019-1018-x

    Figure Lengend Snippet: LncRNA CASC2 was down-regulated in hypoxia-induced rats and reversed the increase of mPAP and progression of right ventricular hypertrophy caused by hypoxia. ( a ) The expression of lncRNA CASC2 was detected by qRT-PCR in rat pulmonary arterial tissues. ( b ) Systemic blood pressure (SBP) was assessed in normoxia and hypoxia-induced rats. ( c ) Mean pulmonary arterial pressure (mPAP) was detected in normoxia and hypoxia-induced rats. ( d ) The right ventricular hypertrophy index (RVI) was calculated in normoxia and hypoxia-induced rats. # p

    Article Snippet: Real time-quantitative polymerase chain reaction (qRT-PCR) Total RNA from PASMCs or rat pulmonary arterial tissues was extracted using the Trizol reagent and reversely transcribed into cDNA using Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer′s instructions.

    Techniques: Expressing, Quantitative RT-PCR

    Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by qRT-PCR (list of primers are provided in Table S2 ). * P

    Journal: PLoS ONE

    Article Title: The Molecular Basis of Inactivation of Metronidazole-Resistant Helicobacter pylori Using Polyethyleneimine Functionalized Zinc Oxide Nanoparticles

    doi: 10.1371/journal.pone.0070776

    Figure Lengend Snippet: Morphological transition and rRNA degradation. H. pylori incubated without or with ZnO-PEI NP for 3 h was visualized by (a) SEM and (b) TEM. (c) RNA was extracted from ZnO-PEI NP treated and untreated H. pylori and electrophoresed on 7M urea-6% polyacrylamide gel. In (a), (b) and (c) the left panel shows the control and the right panel shows treated cells. (d) 16S and 23S rRNA was estimated in the RNA samples by qRT-PCR (list of primers are provided in Table S2 ). * P

    Article Snippet: Quantitative real-time RT-PCR (qRT-PCR) was performed using the SYBR Green One-step qRT-PCR kit (Takara) in an iCycler IQ5, Real-time PCR Detection System (Bio-Rad).

    Techniques: Incubation, Transmission Electron Microscopy, Quantitative RT-PCR

    Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for qRT-PCR analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p

    Journal: PLoS ONE

    Article Title: Contribution of Eukaryotic-Type Serine/Threonine Kinase to Stress Response and Virulence of Streptococcus suis

    doi: 10.1371/journal.pone.0091971

    Figure Lengend Snippet: Virulence gene expression of different strains in vitro . Total RNA was extracted from SS2-1, Δ stk and C Δ stk grown in THY medium at an OD600 of 0.6–0.8 and used for qRT-PCR analysis. The mRNA level of each gene was normalized to that of 16S rRNA . Results are shown as relative expression ratios compared to expression in the parental strain SS2-1. Data from three independent assays are presented as the means±SE. Differences between SS2-1 and Δ stk was determined by two-way ANOVA. (**p

    Article Snippet: The two-step relative qRT-PCR was performed to analyze the expression profile of the virulence factors using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China).

    Techniques: Expressing, In Vitro, Quantitative RT-PCR