Structured Review

Bio-Rad qrt pcr reactions
Whole genome transcriptomic analysis of TSA-induced survival of rd1 T-NXL cones. (A) Volcano plot representation of differentially expressed genes as detected by RNA-seq in flow-sorted cones from treated vs. untreated PN19-26 rd1 TN-XL (n = 3 animals). Orange and blue dots: significantly enriched and perturbed genes, respectively, in TSA treated cones (FDR-based, Student’s T-test of mean difference). PaintOmics analysis was used to identify differentially regulated pathways in TSA-protected cones. (B) Heat maps with hierarchical clustering of differentially expressed genes within PI3k-Akt, MAPK and autophagy pathways. Genes showing Student’s t-test difference between TSA and control, with p≤ 0.05 were selected. (C) <t>qRT-PCR</t> validation of differential expression of PI3K-Akt, MAPK and autophagy regulators in FACS-sorted cones. Fold changes are relative to controls. Data are shown as mean ± SEM (n = 4 animals). Numerical p-values by Mann-Whitney nonparametric test.
Qrt Pcr Reactions, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 584 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qrt pcr reactions/product/Bio-Rad
Average 94 stars, based on 584 article reviews
Price from $9.99 to $1999.99
qrt pcr reactions - by Bioz Stars, 2020-08
94/100 stars

Images

1) Product Images from "HDAC inhibition ameliorates cone survival in retinitis pigmentosa mice"

Article Title: HDAC inhibition ameliorates cone survival in retinitis pigmentosa mice

Journal: bioRxiv

doi: 10.1101/2019.12.13.874339

Whole genome transcriptomic analysis of TSA-induced survival of rd1 T-NXL cones. (A) Volcano plot representation of differentially expressed genes as detected by RNA-seq in flow-sorted cones from treated vs. untreated PN19-26 rd1 TN-XL (n = 3 animals). Orange and blue dots: significantly enriched and perturbed genes, respectively, in TSA treated cones (FDR-based, Student’s T-test of mean difference). PaintOmics analysis was used to identify differentially regulated pathways in TSA-protected cones. (B) Heat maps with hierarchical clustering of differentially expressed genes within PI3k-Akt, MAPK and autophagy pathways. Genes showing Student’s t-test difference between TSA and control, with p≤ 0.05 were selected. (C) qRT-PCR validation of differential expression of PI3K-Akt, MAPK and autophagy regulators in FACS-sorted cones. Fold changes are relative to controls. Data are shown as mean ± SEM (n = 4 animals). Numerical p-values by Mann-Whitney nonparametric test.
Figure Legend Snippet: Whole genome transcriptomic analysis of TSA-induced survival of rd1 T-NXL cones. (A) Volcano plot representation of differentially expressed genes as detected by RNA-seq in flow-sorted cones from treated vs. untreated PN19-26 rd1 TN-XL (n = 3 animals). Orange and blue dots: significantly enriched and perturbed genes, respectively, in TSA treated cones (FDR-based, Student’s T-test of mean difference). PaintOmics analysis was used to identify differentially regulated pathways in TSA-protected cones. (B) Heat maps with hierarchical clustering of differentially expressed genes within PI3k-Akt, MAPK and autophagy pathways. Genes showing Student’s t-test difference between TSA and control, with p≤ 0.05 were selected. (C) qRT-PCR validation of differential expression of PI3K-Akt, MAPK and autophagy regulators in FACS-sorted cones. Fold changes are relative to controls. Data are shown as mean ± SEM (n = 4 animals). Numerical p-values by Mann-Whitney nonparametric test.

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing, FACS, MANN-WHITNEY

2) Product Images from "Maternal Stress Induces Epigenetic Signatures of Psychiatric and Neurological Diseases in the Offspring"

Article Title: Maternal Stress Induces Epigenetic Signatures of Psychiatric and Neurological Diseases in the Offspring

Journal: PLoS ONE

doi: 10.1371/journal.pone.0056967

Gestational stress induces differential miRNA expression in frontal cortex. A, Schematic overview of miRNA biogenesis pathways. B, Heat map representation of differentially regulated miRNAs, as observed by microarray analysis. C, Table of target genes for miRNAs modulated by gestational stress (miR-329, miR-380, miR-20a, and miR-500; p≤0.05), and their physiological implications. D, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Note that prenatal stress downregulated miR-181 and miR-186 expression in the frontal cortex. miRNA analyses were performed in dams that showed representative behavioural characteristics (n = 3 per group, three repeats per sample). All data are presented as mean ± SEM.
Figure Legend Snippet: Gestational stress induces differential miRNA expression in frontal cortex. A, Schematic overview of miRNA biogenesis pathways. B, Heat map representation of differentially regulated miRNAs, as observed by microarray analysis. C, Table of target genes for miRNAs modulated by gestational stress (miR-329, miR-380, miR-20a, and miR-500; p≤0.05), and their physiological implications. D, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Note that prenatal stress downregulated miR-181 and miR-186 expression in the frontal cortex. miRNA analyses were performed in dams that showed representative behavioural characteristics (n = 3 per group, three repeats per sample). All data are presented as mean ± SEM.

Techniques Used: Expressing, Microarray, Quantitative RT-PCR

Prenatal stress modulates the brain miRNAome in male newborn offspring. A, Heat map representation of differentially regulated miRNA as observed by microarray analyses. B, Table of putative target genes for modulated miRNAs (miR-103, miR-151, and miR-219-2-3p; p≤0.05) and their physiological functions. C, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Whole brains of newborns born to dams shown in Figures 1 and 2 (n = 3 per group, three repeats per sample; 1 pup per dam) were used. All data are presented as mean ± SEM.
Figure Legend Snippet: Prenatal stress modulates the brain miRNAome in male newborn offspring. A, Heat map representation of differentially regulated miRNA as observed by microarray analyses. B, Table of putative target genes for modulated miRNAs (miR-103, miR-151, and miR-219-2-3p; p≤0.05) and their physiological functions. C, Expression ratio group averages of miRNAs as observed by qRT-PCR analysis (p≤0.05). Whole brains of newborns born to dams shown in Figures 1 and 2 (n = 3 per group, three repeats per sample; 1 pup per dam) were used. All data are presented as mean ± SEM.

Techniques Used: Microarray, Expressing, Quantitative RT-PCR

3) Product Images from "Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells"

Article Title: Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0053933

qRT-PCR analysis of CD90 fold change relative to a control capture containing no antibody after normalisation to a beta-actin control. Error bars represent 1 standard deviation from the mean, n = 3 (technical replicates).
Figure Legend Snippet: qRT-PCR analysis of CD90 fold change relative to a control capture containing no antibody after normalisation to a beta-actin control. Error bars represent 1 standard deviation from the mean, n = 3 (technical replicates).

Techniques Used: Quantitative RT-PCR, Standard Deviation

4) Product Images from "In TCR-Stimulated T-cells, N-ras Regulates Specific Genes and Signal Transduction Pathways"

Article Title: In TCR-Stimulated T-cells, N-ras Regulates Specific Genes and Signal Transduction Pathways

Journal: PLoS ONE

doi: 10.1371/journal.pone.0063193

Schematic of the rationale and the experimental design of qRT-PCR-based validation experiments that were performed with candidate genes from the second set of microarray experiments. The assumption behind these experiments was that over-expression of WT N-ras in N-ras KO CD4 + T-cells should be able to reconstitute or rescue the gene expression of the candidate genes as seen in WT cells. In contrast, over-expression of WT H-ras in N-ras KO CD4 + T-cells should not be able to rescue the expression of these candidate genes, and N-ras KO cells over-expressing WT H-ras should therefore be most similar to N-ras KO cells in their pattern of gene expression. From a palmitoylation state perspective, N-ras-Palm H was similar to WT H-ras, and one would therefore not expect that over-expression of N-ras-Palm H in the N-ras KO background would be able to rescue the expression of candidate genes downstream on N-ras.
Figure Legend Snippet: Schematic of the rationale and the experimental design of qRT-PCR-based validation experiments that were performed with candidate genes from the second set of microarray experiments. The assumption behind these experiments was that over-expression of WT N-ras in N-ras KO CD4 + T-cells should be able to reconstitute or rescue the gene expression of the candidate genes as seen in WT cells. In contrast, over-expression of WT H-ras in N-ras KO CD4 + T-cells should not be able to rescue the expression of these candidate genes, and N-ras KO cells over-expressing WT H-ras should therefore be most similar to N-ras KO cells in their pattern of gene expression. From a palmitoylation state perspective, N-ras-Palm H was similar to WT H-ras, and one would therefore not expect that over-expression of N-ras-Palm H in the N-ras KO background would be able to rescue the expression of candidate genes downstream on N-ras.

Techniques Used: Quantitative RT-PCR, Microarray, Over Expression, Expressing

5) Product Images from "OTUB1 enhances TGF? signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3"

Article Title: OTUB1 enhances TGF? signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3

Journal: Nature Communications

doi: 10.1038/ncomms3519

Depletion of OTUB1 represses TGFβ-induced transcription. ( a ) C2C12 cells were transfected with three different siRNAs (#1, #2 and #3) targeting mouse OTUB1 (300 pM/10-cm dish each) and lysed 48 h after transfection. Extracts were resolved by SDS-PAGE and immunoblotted with OTUB1 and tubulin antibodies. ( b ) C2C12 cells stably expressing a SMAD3-dependent TGFβ-responsive CAGA-luciferase reporter construct were transfected with iFoxO4 or iOTUB1# 1. Cells were treated with or without 50 pM TGFβ for 6 h before lysis and luciferase activity was measured. Data are represented as mean and error bars indicate s.d. ( n =3). ( c ) HaCaT cells stably expressing shRNA against OTUB1 or transfected with control (−) or OTUB1 siRNA (300 pM/10-cm dish each) for 48 h were lysed, and extracts were resolved by SDS-PAGE and immunoblotted with OTUB1 and GAPDH antibodies. ( d ) HaCaT cells, transfected with human OTUB1 siRNA, human FoxO4 siRNA, or stably expressing OTUB1 shRNA, were treated with 50 pM TGFβ for 4 h before RNA isolation. Relative expression levels of indicated mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). ( e ) HaCaT cells depleted of human OTUB1 or FoxO4 by RNAi were treated with 50 pM TGFβ for 1 h. TGFβ was then washed off and SB505124 (1 μM) added. RNA was isolated 45 min after TGFβ removal. Relative expression levels of OTUB1 and CTGF mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). Statistical significance of differences between experimental groups was assessed with Student’s t -test. ** P
Figure Legend Snippet: Depletion of OTUB1 represses TGFβ-induced transcription. ( a ) C2C12 cells were transfected with three different siRNAs (#1, #2 and #3) targeting mouse OTUB1 (300 pM/10-cm dish each) and lysed 48 h after transfection. Extracts were resolved by SDS-PAGE and immunoblotted with OTUB1 and tubulin antibodies. ( b ) C2C12 cells stably expressing a SMAD3-dependent TGFβ-responsive CAGA-luciferase reporter construct were transfected with iFoxO4 or iOTUB1# 1. Cells were treated with or without 50 pM TGFβ for 6 h before lysis and luciferase activity was measured. Data are represented as mean and error bars indicate s.d. ( n =3). ( c ) HaCaT cells stably expressing shRNA against OTUB1 or transfected with control (−) or OTUB1 siRNA (300 pM/10-cm dish each) for 48 h were lysed, and extracts were resolved by SDS-PAGE and immunoblotted with OTUB1 and GAPDH antibodies. ( d ) HaCaT cells, transfected with human OTUB1 siRNA, human FoxO4 siRNA, or stably expressing OTUB1 shRNA, were treated with 50 pM TGFβ for 4 h before RNA isolation. Relative expression levels of indicated mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). ( e ) HaCaT cells depleted of human OTUB1 or FoxO4 by RNAi were treated with 50 pM TGFβ for 1 h. TGFβ was then washed off and SB505124 (1 μM) added. RNA was isolated 45 min after TGFβ removal. Relative expression levels of OTUB1 and CTGF mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). Statistical significance of differences between experimental groups was assessed with Student’s t -test. ** P

Techniques Used: Transfection, SDS Page, Stable Transfection, Expressing, Luciferase, Construct, Lysis, Activity Assay, shRNA, Isolation, Quantitative RT-PCR

OTUB1 prevents SMAD3 ubiquitylation in vitro. ( a ) For in-cell polyubiquitylation of FLAG-SMAD2/3/4, vectors encoding FLAG-SMAD2/3/4 were co-transfected with HA-NEDD4L and HA-ubiquitin in HEK293 cells and treated with 50 pM TGFβ and 10 μM bortezomib for 3 h before lysis and FLAG-SMAD2/3/4 were immunoprecipitated. An in vitro DUB assay of in-cell polyubiquitylated FLAG-SMAD2/3/4 was performed with GST-OTUB1 and the indicated GST-OTUB1 mutants in DUB assay buffer for 1 h at 30 °C. The assay mix was resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( b ) An in vitro ubiquitylation assay was performed with human recombinant SMAD2. SMAD2 was incubated with E1, E2, E3 and ubiquitin in ubiquitylation assay buffer for 1 h at 30 °C. Increasing concentrations of GST-OTUB1 and GST-OTUB1 C91S (8–60 ng μl −1 ) were added at the start of the ubiquitylation assay (time 0). Proteins were resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( c ) FLAG-SMAD2/3/4 IPs (from HEK293 cells expressing FLAG-SMAD2/3/4 treated with 50 pM TGFβ for 1 h before lysis) were ubiquitylated in vitro in ubiquitylation assay buffer for 1 h at 30 °C using E1, E2, E3 and ubiquitin. The indicated DUBs were added at the start of the ubiquitylation assay (time 0) and proteins were resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( d ) HaCaT cells were stably transfected with vectors encoding siRNA-resistant silent mutations (rescue) of the indicated OTUB1 constructs. These cells were then transfected with control FoxO4 or OTUB1 siRNA for 48 h and treated with or without TGFβ for 4 h before RNA isolation. Relative expression levels of indicated mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). Statistical significance of differences between experimental groups was assessed with Student’s t -test. ** P
Figure Legend Snippet: OTUB1 prevents SMAD3 ubiquitylation in vitro. ( a ) For in-cell polyubiquitylation of FLAG-SMAD2/3/4, vectors encoding FLAG-SMAD2/3/4 were co-transfected with HA-NEDD4L and HA-ubiquitin in HEK293 cells and treated with 50 pM TGFβ and 10 μM bortezomib for 3 h before lysis and FLAG-SMAD2/3/4 were immunoprecipitated. An in vitro DUB assay of in-cell polyubiquitylated FLAG-SMAD2/3/4 was performed with GST-OTUB1 and the indicated GST-OTUB1 mutants in DUB assay buffer for 1 h at 30 °C. The assay mix was resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( b ) An in vitro ubiquitylation assay was performed with human recombinant SMAD2. SMAD2 was incubated with E1, E2, E3 and ubiquitin in ubiquitylation assay buffer for 1 h at 30 °C. Increasing concentrations of GST-OTUB1 and GST-OTUB1 C91S (8–60 ng μl −1 ) were added at the start of the ubiquitylation assay (time 0). Proteins were resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( c ) FLAG-SMAD2/3/4 IPs (from HEK293 cells expressing FLAG-SMAD2/3/4 treated with 50 pM TGFβ for 1 h before lysis) were ubiquitylated in vitro in ubiquitylation assay buffer for 1 h at 30 °C using E1, E2, E3 and ubiquitin. The indicated DUBs were added at the start of the ubiquitylation assay (time 0) and proteins were resolved by SDS-PAGE and immunoblotted with the indicated antibodies. ( d ) HaCaT cells were stably transfected with vectors encoding siRNA-resistant silent mutations (rescue) of the indicated OTUB1 constructs. These cells were then transfected with control FoxO4 or OTUB1 siRNA for 48 h and treated with or without TGFβ for 4 h before RNA isolation. Relative expression levels of indicated mRNAs were analysed by qRT-PCR. Data are represented as mean and error bars indicate s.d. ( n =6). Statistical significance of differences between experimental groups was assessed with Student’s t -test. ** P

Techniques Used: In Vitro, Transfection, Lysis, Immunoprecipitation, SDS Page, Ubiquitin Assay, Recombinant, Incubation, Expressing, Stable Transfection, Construct, Isolation, Quantitative RT-PCR

6) Product Images from "Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars"

Article Title: Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars

Journal: PLoS ONE

doi: 10.1371/journal.pone.0228680

qRT-PCR results of genes selected from the RNA-Seq analysis of common bean–spider mite interaction. Expression levels of tested genes were normalized based on of Actin gene and then compared to relative expression values determined by RNA-Seq. Relative expression values of samples were determined by using the average expression value of all replicates of a particular group. Standard deviation among replicates is represented by error bars. Res and Sus represent resistant and susceptible cultivars. TP0, TP1 and TP5 represent first, second and third time points. RT ans RS in parentheses represent qRT-PCR and RNA-Seq.
Figure Legend Snippet: qRT-PCR results of genes selected from the RNA-Seq analysis of common bean–spider mite interaction. Expression levels of tested genes were normalized based on of Actin gene and then compared to relative expression values determined by RNA-Seq. Relative expression values of samples were determined by using the average expression value of all replicates of a particular group. Standard deviation among replicates is represented by error bars. Res and Sus represent resistant and susceptible cultivars. TP0, TP1 and TP5 represent first, second and third time points. RT ans RS in parentheses represent qRT-PCR and RNA-Seq.

Techniques Used: Quantitative RT-PCR, RNA Sequencing Assay, Expressing, Standard Deviation

7) Product Images from "Non-digestible oligosaccharides directly regulate host kinome to modulate host inflammatory responses without alterations in the gut microbiota"

Article Title: Non-digestible oligosaccharides directly regulate host kinome to modulate host inflammatory responses without alterations in the gut microbiota

Journal: Microbiome

doi: 10.1186/s40168-017-0357-4

Effect of inulin and scFOS on LPS-induced murine endotoxemia. a Diagram illustrating the animal protocol employed to induce murine endotoxemia. b Hematoxylin and eosin staining of the terminal ileum from mice gavaged with prebiotics (staining representative of at least five individual animals). c Body weights of animals throughout the duration of the study protocol ( n = 8/group). d – g RNA extracted from terminal ileum were measured for inflammatory cytokines and chemokines using qRT-PCR ( n = 8/group). h , i Terminal ileal sections were lysed and immunoblotted for MAPK phosphorylation ( n = 4/group). Bars represent means ± SEM, * P
Figure Legend Snippet: Effect of inulin and scFOS on LPS-induced murine endotoxemia. a Diagram illustrating the animal protocol employed to induce murine endotoxemia. b Hematoxylin and eosin staining of the terminal ileum from mice gavaged with prebiotics (staining representative of at least five individual animals). c Body weights of animals throughout the duration of the study protocol ( n = 8/group). d – g RNA extracted from terminal ileum were measured for inflammatory cytokines and chemokines using qRT-PCR ( n = 8/group). h , i Terminal ileal sections were lysed and immunoblotted for MAPK phosphorylation ( n = 4/group). Bars represent means ± SEM, * P

Techniques Used: Staining, Mouse Assay, Quantitative RT-PCR

8) Product Images from "Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves"

Article Title: Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves

Journal: Scientific Reports

doi: 10.1038/srep42165

Expression patterns of cold-inducible genes shown by qRT-PCR following cold stress (4 °C) treatment. Three measurements were averaged from the results of three replicated experiments and statistically treated using a t -test. * P ≤ 0.05 > 0.005; ** P ≤ 0.005
Figure Legend Snippet: Expression patterns of cold-inducible genes shown by qRT-PCR following cold stress (4 °C) treatment. Three measurements were averaged from the results of three replicated experiments and statistically treated using a t -test. * P ≤ 0.05 > 0.005; ** P ≤ 0.005

Techniques Used: Expressing, Quantitative RT-PCR

Differentially expressed genes involved in terpenoid biosynthesis in response to cold stress. ( a ) Heat map of changes of transcript abundance for eight genes. ( b ) qRT-PCR determination of transcript levels of these genes in leaves and roots following cold treatment (4 °C). Three measurements were averaged from the results of three replicated experiments and statistically treated using a t -test. * P ≤ 0.05 > 0.005; ** P ≤ 0.005
Figure Legend Snippet: Differentially expressed genes involved in terpenoid biosynthesis in response to cold stress. ( a ) Heat map of changes of transcript abundance for eight genes. ( b ) qRT-PCR determination of transcript levels of these genes in leaves and roots following cold treatment (4 °C). Three measurements were averaged from the results of three replicated experiments and statistically treated using a t -test. * P ≤ 0.05 > 0.005; ** P ≤ 0.005

Techniques Used: Quantitative RT-PCR

9) Product Images from "Effect of efflux pump inhibition on Pseudomonas aeruginosa transcriptome and virulence"

Article Title: Effect of efflux pump inhibition on Pseudomonas aeruginosa transcriptome and virulence

Journal: Scientific Reports

doi: 10.1038/s41598-017-11892-9

Validation of the microarray data by qRT-PCR. mRNA levels of the indicated genes quantified by qRT-PCR in: ( A ) The P . aeruginosa PAO1 strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN, relative to the same strain grown in LB (grey bars), in comparison with microarray data for the same genes (white bars); ( B ) The P . aeruginosa PAO1 strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN (white bars), with 1 mM MgSO 4 (light-grey bars), or with 27 µM PAßN plus 1 mM MgSO 4 (dark-grey bars) relative to the same strain grown in LB; ( C ) The P . aeruginosa PAO1-KP strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN (white bars), with 1 mM MgSO 4 (light-grey bars), or with 27 µM PAßN plus 1 mM MgSO 4 (dark-grey bars), and the P . aeruginosa PAO1-KP ∆efflux strain grown to an A 600 of 2.5 in LB (black bars), relative to the PAO-KP strain grown in LB. The average of two independent analyses performed on three technical replicates is shown with SD.
Figure Legend Snippet: Validation of the microarray data by qRT-PCR. mRNA levels of the indicated genes quantified by qRT-PCR in: ( A ) The P . aeruginosa PAO1 strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN, relative to the same strain grown in LB (grey bars), in comparison with microarray data for the same genes (white bars); ( B ) The P . aeruginosa PAO1 strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN (white bars), with 1 mM MgSO 4 (light-grey bars), or with 27 µM PAßN plus 1 mM MgSO 4 (dark-grey bars) relative to the same strain grown in LB; ( C ) The P . aeruginosa PAO1-KP strain grown to an A 600 of 2.5 in LB supplemented with 27 µM PAßN (white bars), with 1 mM MgSO 4 (light-grey bars), or with 27 µM PAßN plus 1 mM MgSO 4 (dark-grey bars), and the P . aeruginosa PAO1-KP ∆efflux strain grown to an A 600 of 2.5 in LB (black bars), relative to the PAO-KP strain grown in LB. The average of two independent analyses performed on three technical replicates is shown with SD.

Techniques Used: Microarray, Quantitative RT-PCR

10) Product Images from "Transcriptomic profiles reveal the genome-wide responses of the harmful dinoflagellate Cochlodinium polykrikoides when exposed to the algicide copper sulfate"

Article Title: Transcriptomic profiles reveal the genome-wide responses of the harmful dinoflagellate Cochlodinium polykrikoides when exposed to the algicide copper sulfate

Journal: BMC Genomics

doi: 10.1186/s12864-015-2341-3

qRT-PCR validation of 13 DEGs identified by RNA-Seq. The relative expression levels of 12 h, 24 h, and 48 h CuSO 4 treated sample were presented. The housekeeping gene α-tubulin ( TUA ) was used as an internal control for qRT-PCR normalization. The relative expression level of control was considered as 1, and the control samples were not shown in the figure
Figure Legend Snippet: qRT-PCR validation of 13 DEGs identified by RNA-Seq. The relative expression levels of 12 h, 24 h, and 48 h CuSO 4 treated sample were presented. The housekeeping gene α-tubulin ( TUA ) was used as an internal control for qRT-PCR normalization. The relative expression level of control was considered as 1, and the control samples were not shown in the figure

Techniques Used: Quantitative RT-PCR, RNA Sequencing Assay, Expressing

11) Product Images from "Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya"

Article Title: Transcriptome Profiling Revealed Stress-Induced and Disease Resistance Genes Up-Regulated in PRSV Resistant Transgenic Papaya

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2016.00855

Expression pattern validation of 21 selected DEGs by qRT-PCR in transgenic SunUp relative to the donor control Sunset . The transcriptional level of candidate genes was examined by real-time PCR with three biological replicates. EIF was used as an internal control. RNA-Seq data were highly consistent with qRT-PCR results ( r = 0.9247). The Y -axis indicates the fold change of transcript abundance in SU-NP relative to the control SS-NP.
Figure Legend Snippet: Expression pattern validation of 21 selected DEGs by qRT-PCR in transgenic SunUp relative to the donor control Sunset . The transcriptional level of candidate genes was examined by real-time PCR with three biological replicates. EIF was used as an internal control. RNA-Seq data were highly consistent with qRT-PCR results ( r = 0.9247). The Y -axis indicates the fold change of transcript abundance in SU-NP relative to the control SS-NP.

Techniques Used: Expressing, Quantitative RT-PCR, Transgenic Assay, Real-time Polymerase Chain Reaction, RNA Sequencing Assay

12) Product Images from "Validation of quantitative real-time PCR reference genes for the determination of seasonal and labor-specific gene expression profiles in the head of Western honey bee, Apis mellifera"

Article Title: Validation of quantitative real-time PCR reference genes for the determination of seasonal and labor-specific gene expression profiles in the head of Western honey bee, Apis mellifera

Journal: PLoS ONE

doi: 10.1371/journal.pone.0200369

Expression patterns of ace2 normalized with each of the two reference genes and combination of two genes in forager and nurse heads. The transcript trends of ace2 in the head samples of foragers (A) and nurses (B) were determined by qRT-PCR using gapdh , rpS18 , and normalization with two reference genes. The expression trends of ace2 over a yearlong cycle, calculated on a monthly basis across different reference genes, were statistically analyzed (repeated-measures ANOVA; Post-hoc: Tukey’s multiple comparison test, P
Figure Legend Snippet: Expression patterns of ace2 normalized with each of the two reference genes and combination of two genes in forager and nurse heads. The transcript trends of ace2 in the head samples of foragers (A) and nurses (B) were determined by qRT-PCR using gapdh , rpS18 , and normalization with two reference genes. The expression trends of ace2 over a yearlong cycle, calculated on a monthly basis across different reference genes, were statistically analyzed (repeated-measures ANOVA; Post-hoc: Tukey’s multiple comparison test, P

Techniques Used: Expressing, Quantitative RT-PCR

13) Product Images from "Micro-scaled topographies direct differentiation of human epidermal stem cells"

Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells

Journal: Acta Biomaterialia

doi: 10.1016/j.actbio.2018.12.003

Validation of hits using fabricated polysterene topographies. A) Fluorescent microscopic images (20× objective) from TopoUnits that were chosen for further validation based on the analyses presented in Fig. 3 . The first row represents composite images of all fluorescent channels; the second row an overlay of F-Actin (green) and DAPI staining (blue); and the last row an overlay of TGM1 (red) and DAPI staining. The first column represents the TopoUnit on which topography 1 was based. The second column represents the TopoUnit on which topography 2 was based. B) Scanning electron microscopy (SEM) images and C) height profiles of the fabricated topographies. In B) the first column represents top-view SEM images, while the second column represents images from a tilted (30°) view. D) Schematic overview of production of polystyrene (PS) topographies. Production starts with a silicon (Si) wafer, which is coated with polydimethylsiloxane (PDMS) to create a negative mould of the topographies after curing ( > 5h at 80 °C). The negative mould is then coated with PS that is dissolved in γ-butyrolactone (GBL). Upon evaporation of the solvent (4 h at 95 °C, followed by > 12 h at 150 °C) this creates solid PS topographies that can be used for cell culture. E) Fluorescent microscopic images (20x) showing staining for TGM1 (green) and IVL (red) on flat and topography surfaces after 24 h of culture. Images represent overlays of DAPI (blue), TGM1 (green) and IVL (red). F) Quantification of the proportion of differentiated cells after 1 h versus 24 h of culture. G) Relative expression of the differentiation markers IVL, suprabasin, envoplakin and periplakin after 24 h of culture as determined by qRT-PCR. In F) differentiated cells are cells positive for TGM1. Scale bars represent 50 μm in A and E and 20 μm in B. Results in F and G are from 3 independent experiments. Results in A and E are representative images from five and three independent experiments, respectively. ns: not significant, *p
Figure Legend Snippet: Validation of hits using fabricated polysterene topographies. A) Fluorescent microscopic images (20× objective) from TopoUnits that were chosen for further validation based on the analyses presented in Fig. 3 . The first row represents composite images of all fluorescent channels; the second row an overlay of F-Actin (green) and DAPI staining (blue); and the last row an overlay of TGM1 (red) and DAPI staining. The first column represents the TopoUnit on which topography 1 was based. The second column represents the TopoUnit on which topography 2 was based. B) Scanning electron microscopy (SEM) images and C) height profiles of the fabricated topographies. In B) the first column represents top-view SEM images, while the second column represents images from a tilted (30°) view. D) Schematic overview of production of polystyrene (PS) topographies. Production starts with a silicon (Si) wafer, which is coated with polydimethylsiloxane (PDMS) to create a negative mould of the topographies after curing ( > 5h at 80 °C). The negative mould is then coated with PS that is dissolved in γ-butyrolactone (GBL). Upon evaporation of the solvent (4 h at 95 °C, followed by > 12 h at 150 °C) this creates solid PS topographies that can be used for cell culture. E) Fluorescent microscopic images (20x) showing staining for TGM1 (green) and IVL (red) on flat and topography surfaces after 24 h of culture. Images represent overlays of DAPI (blue), TGM1 (green) and IVL (red). F) Quantification of the proportion of differentiated cells after 1 h versus 24 h of culture. G) Relative expression of the differentiation markers IVL, suprabasin, envoplakin and periplakin after 24 h of culture as determined by qRT-PCR. In F) differentiated cells are cells positive for TGM1. Scale bars represent 50 μm in A and E and 20 μm in B. Results in F and G are from 3 independent experiments. Results in A and E are representative images from five and three independent experiments, respectively. ns: not significant, *p

Techniques Used: Staining, Electron Microscopy, Evaporation, Cell Culture, Expressing, Quantitative RT-PCR

14) Product Images from "Age-related differences in IL-1 signaling and capsule serotype affect persistence of Streptococcus pneumoniae colonization"

Article Title: Age-related differences in IL-1 signaling and capsule serotype affect persistence of Streptococcus pneumoniae colonization

Journal: PLoS Pathogens

doi: 10.1371/journal.ppat.1007396

Lack of IL-1 signaling is essential for pneumococcal persistence. Pups aged 4 days were infected with serotype 23F wild-type or ply- . (A-D) Pneumococcal colonization density at 9 weeks post-infection in (A) Tlr2 -/- , (B) Nod2 -/- , (C) Ifnar -/- , and (D) Ccr2 -/- , and (E) Il1r -/- mice. (F-G) Starting 24 hours following challenge, pups infected with the serotype 4 ply- received daily i.n. treatment with 10 or 100 ng of recombinant (F) IL-1α or (G) IL-1β for 3 consecutive days. Control pups received PBS treatment and pneumococcal colonization density was determined at 4 days post-infection. (H-I) At 21 days post-challenge, the URT of infants was lavaged to assess expression of mucosal (H) Il1a and (I) Il1b by qRT-PCR and calculated as fold-change compared to mock-challenged age-controlled animals. (J-K) At 9 weeks after inoculation, pneumococcal colonization density was determined in (J) Nlrp3 -/- , (K) Il1a -/- and Il1b -/- mice. Groups represent n = 5–11 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by *, P
Figure Legend Snippet: Lack of IL-1 signaling is essential for pneumococcal persistence. Pups aged 4 days were infected with serotype 23F wild-type or ply- . (A-D) Pneumococcal colonization density at 9 weeks post-infection in (A) Tlr2 -/- , (B) Nod2 -/- , (C) Ifnar -/- , and (D) Ccr2 -/- , and (E) Il1r -/- mice. (F-G) Starting 24 hours following challenge, pups infected with the serotype 4 ply- received daily i.n. treatment with 10 or 100 ng of recombinant (F) IL-1α or (G) IL-1β for 3 consecutive days. Control pups received PBS treatment and pneumococcal colonization density was determined at 4 days post-infection. (H-I) At 21 days post-challenge, the URT of infants was lavaged to assess expression of mucosal (H) Il1a and (I) Il1b by qRT-PCR and calculated as fold-change compared to mock-challenged age-controlled animals. (J-K) At 9 weeks after inoculation, pneumococcal colonization density was determined in (J) Nlrp3 -/- , (K) Il1a -/- and Il1b -/- mice. Groups represent n = 5–11 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by *, P

Techniques Used: Infection, Mouse Assay, Recombinant, Expressing, Quantitative RT-PCR

Repressed IL-1 signaling in infants. Five uninfected pups aged 1 week (Infant Mock) and five u ninfected adults aged 8 weeks (Adult Mock) received RLT lavages from which RNA was subjected to qRT-PCR analysis. (A-J) Expression of (A) Il1a , (B) Il1b , (C) Il1r1 , (D) Irak1 , (E) Map3k14 , (F) Mapk3 , (G) Irak2 , (H) Tirap , (I) Capn13 , and (J) Casp1 by qRT-PCR was calculated as fold change in uninfected adults (aged 8 weeks) as compared to uninfected infants (aged 1 week). (K) Il1b expression in uninfected (mock) and serotype 23F infected infants and adults calculated as fold-change compared to mock-infected infants. (L-N) Serotype 23F i.n. colonization of (L) C57BL6 and Il1r -/- and (M) Il1a -/- and Il1b -/- adult mice (aged 8 weeks) and (N) C57BL6 and Il1r -/- pups (aged 1 week). Pneumococcal colonization density in adult and infant URT was determined 3 days post-inoculation. Groups represent n = 4–15 animals with mean ±SEM. Significance is indicated by *, P
Figure Legend Snippet: Repressed IL-1 signaling in infants. Five uninfected pups aged 1 week (Infant Mock) and five u ninfected adults aged 8 weeks (Adult Mock) received RLT lavages from which RNA was subjected to qRT-PCR analysis. (A-J) Expression of (A) Il1a , (B) Il1b , (C) Il1r1 , (D) Irak1 , (E) Map3k14 , (F) Mapk3 , (G) Irak2 , (H) Tirap , (I) Capn13 , and (J) Casp1 by qRT-PCR was calculated as fold change in uninfected adults (aged 8 weeks) as compared to uninfected infants (aged 1 week). (K) Il1b expression in uninfected (mock) and serotype 23F infected infants and adults calculated as fold-change compared to mock-infected infants. (L-N) Serotype 23F i.n. colonization of (L) C57BL6 and Il1r -/- and (M) Il1a -/- and Il1b -/- adult mice (aged 8 weeks) and (N) C57BL6 and Il1r -/- pups (aged 1 week). Pneumococcal colonization density in adult and infant URT was determined 3 days post-inoculation. Groups represent n = 4–15 animals with mean ±SEM. Significance is indicated by *, P

Techniques Used: Quantitative RT-PCR, Expressing, Infection, Mouse Assay

Pathways involved in clearance of pneumococcal colonization. At day 4 of life, pups were i.n. infected with serotype 23F wild-type or ply- and URT was lavaged with RLT to obtain RNA for RNA-seq comparisons. RNA-seq heatmaps show gene expression of the comparison wild-type colonized versus mock controls with relative gene expression in log2 fold change demonstrating increased expression in red and decreased expression in blue. Expression of these genes during ply- colonization is shown for comparison. (A) Heat-map illustrating gene expression in IL-1 related inflammation pathways. qRT-PCR was used to measure expression of (B) Ccl22 and (C) Il1rn that was calculated as fold-change compared to mock-challenged age-controlled animals. (D-E) Heatmaps showing go-term clusters (D) Chemokine-mediated signaling and (E) Phagocytosis that are significantly upregulated following pneumococcal colonization. qRT-PCR was used to measure expression of (F) Cxcl2 , (G) Cd11b , (H), Nos2 , and (I) Fcyr3 at 21 days post-inoculation. Fold-change compared to mock-challenged age-controlled animals. (J) Fold change in Fcyr3 expression in serotype 4 ply- colonized pups following IL-1α and IL-1β dosing as compared to PBS-treated control pups at 4 days post-challenge. (K) Fold change in Fcyr3 expression in 23F colonized C57BL6 and Il1r -/- pups at 21 days post-inoculation. Groups represent n = 7–11 animals with mean ±SEM. Significance is indicated by *, P
Figure Legend Snippet: Pathways involved in clearance of pneumococcal colonization. At day 4 of life, pups were i.n. infected with serotype 23F wild-type or ply- and URT was lavaged with RLT to obtain RNA for RNA-seq comparisons. RNA-seq heatmaps show gene expression of the comparison wild-type colonized versus mock controls with relative gene expression in log2 fold change demonstrating increased expression in red and decreased expression in blue. Expression of these genes during ply- colonization is shown for comparison. (A) Heat-map illustrating gene expression in IL-1 related inflammation pathways. qRT-PCR was used to measure expression of (B) Ccl22 and (C) Il1rn that was calculated as fold-change compared to mock-challenged age-controlled animals. (D-E) Heatmaps showing go-term clusters (D) Chemokine-mediated signaling and (E) Phagocytosis that are significantly upregulated following pneumococcal colonization. qRT-PCR was used to measure expression of (F) Cxcl2 , (G) Cd11b , (H), Nos2 , and (I) Fcyr3 at 21 days post-inoculation. Fold-change compared to mock-challenged age-controlled animals. (J) Fold change in Fcyr3 expression in serotype 4 ply- colonized pups following IL-1α and IL-1β dosing as compared to PBS-treated control pups at 4 days post-challenge. (K) Fold change in Fcyr3 expression in 23F colonized C57BL6 and Il1r -/- pups at 21 days post-inoculation. Groups represent n = 7–11 animals with mean ±SEM. Significance is indicated by *, P

Techniques Used: Infection, RNA Sequencing Assay, Expressing, Quantitative RT-PCR

Host responses involved in pneumolysin-mediated clearance. Pups aged 4 days were infected with serotype 23F wild-type or ply- . (A) Sera IgG titers as determined by whole cell ELISA at 9 weeks post-challenge compared to age-controlled uncolonized (mock) mice. (B) Pneumococcal colonization density assessed in muMT -/- mice at 9 weeks post-challenge. (C) URT Il17a expression by qRT-PCR at day 7 (D7) and 21 (D21) post-infection. Fold-change was calculated from age-corrected mock-infected controls. Groups represent n = 5–11 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by **, P
Figure Legend Snippet: Host responses involved in pneumolysin-mediated clearance. Pups aged 4 days were infected with serotype 23F wild-type or ply- . (A) Sera IgG titers as determined by whole cell ELISA at 9 weeks post-challenge compared to age-controlled uncolonized (mock) mice. (B) Pneumococcal colonization density assessed in muMT -/- mice at 9 weeks post-challenge. (C) URT Il17a expression by qRT-PCR at day 7 (D7) and 21 (D21) post-infection. Fold-change was calculated from age-corrected mock-infected controls. Groups represent n = 5–11 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by **, P

Techniques Used: Infection, Enzyme-linked Immunosorbent Assay, Mouse Assay, Expressing, Quantitative RT-PCR

Capsule type determines serotype-dependent clearance. Pups at day 4 of life received i.n. infection with serotype 23F or 4 S . pneumoniae . (A) Pneumococcal colonization density at 3 and 6 weeks after infection. At day 7 (D7) and 21 (D21) after challenge, mucosal expression of (B) Il1a and (C) Il1b was measured by qRT-PCR as fold change compared to mock challenged age-controlled mice. (D-E) At day 4 of life, pups were i.n. infected with S . pneumoniae isogenic capsular switch mutants 23F 4 (23F isolate expressing 4 CPS) and 4 23F (4 isolate expressing the 23F CPS). Pneumococcal colonization density was determined at (D) 5 days and (E) 6 weeks after inoculation. Groups represent n = 5–13 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by ***, P
Figure Legend Snippet: Capsule type determines serotype-dependent clearance. Pups at day 4 of life received i.n. infection with serotype 23F or 4 S . pneumoniae . (A) Pneumococcal colonization density at 3 and 6 weeks after infection. At day 7 (D7) and 21 (D21) after challenge, mucosal expression of (B) Il1a and (C) Il1b was measured by qRT-PCR as fold change compared to mock challenged age-controlled mice. (D-E) At day 4 of life, pups were i.n. infected with S . pneumoniae isogenic capsular switch mutants 23F 4 (23F isolate expressing 4 CPS) and 4 23F (4 isolate expressing the 23F CPS). Pneumococcal colonization density was determined at (D) 5 days and (E) 6 weeks after inoculation. Groups represent n = 5–13 animals with mean ±SEM. Dotted line represents the lower limit of detection. Significance is indicated by ***, P

Techniques Used: Infection, Expressing, Quantitative RT-PCR, Mouse Assay

Pneumolysin pore-formation drives host responses. Pups colonized with the serotype 4 ply- received daily treatments with 100 ng recombinant Ply (PLY) or toxoid PdB (W 433 F) starting at 24 hours until 4 days after inoculation. Control animals received PBS dosing. The URT of the pups was lavaged to obtain RNA for qRT-PCR analysis at 5 days post-challenge. Fold change in expression of (A) Il1a , (B) Ilb , (C), Cxcl2 , (D) Cd11b , (E) Nos2 , and (F) Fcγr3 was calculated compared to PBS-treated control pups. Groups represent n = 7–11 animals with mean ±SEM. Significance is indicated by *, P
Figure Legend Snippet: Pneumolysin pore-formation drives host responses. Pups colonized with the serotype 4 ply- received daily treatments with 100 ng recombinant Ply (PLY) or toxoid PdB (W 433 F) starting at 24 hours until 4 days after inoculation. Control animals received PBS dosing. The URT of the pups was lavaged to obtain RNA for qRT-PCR analysis at 5 days post-challenge. Fold change in expression of (A) Il1a , (B) Ilb , (C), Cxcl2 , (D) Cd11b , (E) Nos2 , and (F) Fcγr3 was calculated compared to PBS-treated control pups. Groups represent n = 7–11 animals with mean ±SEM. Significance is indicated by *, P

Techniques Used: Recombinant, Quantitative RT-PCR, Expressing

15) Product Images from "Osteoprotegerin mediates tumor-promoting effects of Interleukin-1beta in breast cancer cells"

Article Title: Osteoprotegerin mediates tumor-promoting effects of Interleukin-1beta in breast cancer cells

Journal: Molecular Cancer

doi: 10.1186/s12943-017-0606-y

Co-culture with THP-1 macrophages induces OPG secretion in breast cancer cells. a Diagram of the transwell co-culture experiment set-up. Breast cancer cells were co-cultured with THP-1 macrophages in the presence and absence of Interleukin-1 receptor antagonist (IL-1RA, 400 ng/mL). b After 8 h of co-culture, relative OPG mRNA was measured by qRT-PCR, ( n ≥ 3). c Breast cancer cells were subsequently cultured alone in fresh media for an additional 16 h and OPG secreted protein was measured from this supernatant by ELISA, ( n ≥ 3). OPG mRNA and secreted protein levels reveal that the co-culture mediated induction of OPG expression in breast cancer cells were partially repressed by IL-1RA. d Representative image for d CD68 immunohistochemistry and e OPG immunohistochemistry on primary/malignant tumor sections on a human breast cancer tissue microarray. Images are taken at 400× magnification. Data are represented by mean ± SD. Asterisks indicate statistical significance ( p
Figure Legend Snippet: Co-culture with THP-1 macrophages induces OPG secretion in breast cancer cells. a Diagram of the transwell co-culture experiment set-up. Breast cancer cells were co-cultured with THP-1 macrophages in the presence and absence of Interleukin-1 receptor antagonist (IL-1RA, 400 ng/mL). b After 8 h of co-culture, relative OPG mRNA was measured by qRT-PCR, ( n ≥ 3). c Breast cancer cells were subsequently cultured alone in fresh media for an additional 16 h and OPG secreted protein was measured from this supernatant by ELISA, ( n ≥ 3). OPG mRNA and secreted protein levels reveal that the co-culture mediated induction of OPG expression in breast cancer cells were partially repressed by IL-1RA. d Representative image for d CD68 immunohistochemistry and e OPG immunohistochemistry on primary/malignant tumor sections on a human breast cancer tissue microarray. Images are taken at 400× magnification. Data are represented by mean ± SD. Asterisks indicate statistical significance ( p

Techniques Used: Co-Culture Assay, Cell Culture, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Expressing, Immunohistochemistry, Microarray

IL1B promotes the invasion of breast cancer cells in an OPG-dependent manner. MDA-MB-436 breast cancer cells transfected with OPG (siOPG1) or negative control (siNeg) siRNA were pretreated with IL1B (10 ng/mL), and subsequently assayed for invasiveness. a IL1B-mediated cell invasion is reduced in OPG knockdown cells, ( n = 3). Data is represented as relative fluorescence units (RFU) fold change relative to the untreated negative control. b OPG knockdown in the breast cancer cells used in the cell invasion assay was assessed at the end point of the experiment. Knockdown was verified by qRT-PCR. MDA-MB-436 cells transfected with OPG or control siRNA were treated with IL1B or PBS (10 ng/mL) for 72 h. c OPG knockdown at 72 h was verified by qRT-PCR. Assessment of d MMP3 and e IL1B mRNA levels indicate the IL1B-mediated induction is inhibited by OPG depletion, ( n = 3). Data are represented by mean ± SD. Asterisks indicate statistical significance ( p
Figure Legend Snippet: IL1B promotes the invasion of breast cancer cells in an OPG-dependent manner. MDA-MB-436 breast cancer cells transfected with OPG (siOPG1) or negative control (siNeg) siRNA were pretreated with IL1B (10 ng/mL), and subsequently assayed for invasiveness. a IL1B-mediated cell invasion is reduced in OPG knockdown cells, ( n = 3). Data is represented as relative fluorescence units (RFU) fold change relative to the untreated negative control. b OPG knockdown in the breast cancer cells used in the cell invasion assay was assessed at the end point of the experiment. Knockdown was verified by qRT-PCR. MDA-MB-436 cells transfected with OPG or control siRNA were treated with IL1B or PBS (10 ng/mL) for 72 h. c OPG knockdown at 72 h was verified by qRT-PCR. Assessment of d MMP3 and e IL1B mRNA levels indicate the IL1B-mediated induction is inhibited by OPG depletion, ( n = 3). Data are represented by mean ± SD. Asterisks indicate statistical significance ( p

Techniques Used: Multiple Displacement Amplification, Transfection, Negative Control, Fluorescence, Invasion Assay, Quantitative RT-PCR

IL1B induces OPG secretion in breast cancer cell lines regardless of subtype and basal OPG protein levels. a Basal OPG and b IL1B protein levels were assessed by ELISA on supernatant collected from several different breast cancer cell lines, ( n ≥ 3). c Relative OPG mRNA measured by qRT-PCR and d OPG secreted protein levels increase upon treatment with IL1B (10 ng/mL) in several different breast cancer cell lines, ( n ≥ 3). e OPG RNA and f OPG secreted protein levels decrease upon treatment with PBS or IL-1B receptor antagonist IL-1RA (50 ng/mL) of MDA-MB-436 cells ( n = 4). Data are represented by mean ± SD. Asterisks indicate statistical significance ( p
Figure Legend Snippet: IL1B induces OPG secretion in breast cancer cell lines regardless of subtype and basal OPG protein levels. a Basal OPG and b IL1B protein levels were assessed by ELISA on supernatant collected from several different breast cancer cell lines, ( n ≥ 3). c Relative OPG mRNA measured by qRT-PCR and d OPG secreted protein levels increase upon treatment with IL1B (10 ng/mL) in several different breast cancer cell lines, ( n ≥ 3). e OPG RNA and f OPG secreted protein levels decrease upon treatment with PBS or IL-1B receptor antagonist IL-1RA (50 ng/mL) of MDA-MB-436 cells ( n = 4). Data are represented by mean ± SD. Asterisks indicate statistical significance ( p

Techniques Used: Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Multiple Displacement Amplification

16) Product Images from "RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug"

Article Title: RNA-Seq and molecular docking reveal multi-level pesticide resistance in the bed bug

Journal: BMC Genomics

doi: 10.1186/1471-2164-13-6

qRT-PCR analysis of CYP397A1V2 and CYP6A13 in Cimex lectularius . (A) mRNA levels of CYP397A1V2 (black bars) and CYP6A13 (grey bars) in tissues of C. lectularius . Tissues assayed included cuticle (CU), Malpighian tubules (MT), and midgut (MG). Tissues samples of pesticide susceptible strains were taken as calibrator to calculate fold change. (B) qRT-PCR analysis of CYP397A1V2 (black bars) and CYP6A13 (grey bars) in C. lectularius early instar nymphs, late instar nymphs and adults. The pesticide susceptible strains were taken as calibrator to calculate fold change. A C. lectularius -specific RPL-18 was used as an internal control. Standard error of the mean of three biological replicates and two technical replicates (within each biological replicate) is represented by the error bars.
Figure Legend Snippet: qRT-PCR analysis of CYP397A1V2 and CYP6A13 in Cimex lectularius . (A) mRNA levels of CYP397A1V2 (black bars) and CYP6A13 (grey bars) in tissues of C. lectularius . Tissues assayed included cuticle (CU), Malpighian tubules (MT), and midgut (MG). Tissues samples of pesticide susceptible strains were taken as calibrator to calculate fold change. (B) qRT-PCR analysis of CYP397A1V2 (black bars) and CYP6A13 (grey bars) in C. lectularius early instar nymphs, late instar nymphs and adults. The pesticide susceptible strains were taken as calibrator to calculate fold change. A C. lectularius -specific RPL-18 was used as an internal control. Standard error of the mean of three biological replicates and two technical replicates (within each biological replicate) is represented by the error bars.

Techniques Used: Quantitative RT-PCR

17) Product Images from "Inhibition of geranylgeranyl diphosphate synthase is a novel therapeutic strategy for pancreatic ductal adenocarcinoma"

Article Title: Inhibition of geranylgeranyl diphosphate synthase is a novel therapeutic strategy for pancreatic ductal adenocarcinoma

Journal: Oncogene

doi: 10.1038/s41388-019-0794-6

GGDPS inhibition activates the UPR pathway. a and b Immunoblot analysis showing protein levels of UPR markers in six human (a) and two mouse (b) PDAC cell lines treated with or without RAM2061 for 48 or 72 hours. Mouse KPC8069 cells are denoted as 8069 and KPC7017 are denoted 7017. β-tubulin is shown as a loading control. Immunoblots are representative of three independent experiments. c Human PDAC cells were incubated for 48 hours with or without RAM2061. PCR was performed using XBP-1-specific primers. The upper band represents unspliced XBP-1 (US) and the lower band represents spliced XBP-1 (S). d qRT-PCR analysis of ATF4, ATF6, CHOP and PERK expression in human PDAC cells incubated in the presence or absence of RAM2061 (48 hour incubation). Data represents fold change normalized to control ( n = 3, data are displayed as mean ± SEM, *denotes p
Figure Legend Snippet: GGDPS inhibition activates the UPR pathway. a and b Immunoblot analysis showing protein levels of UPR markers in six human (a) and two mouse (b) PDAC cell lines treated with or without RAM2061 for 48 or 72 hours. Mouse KPC8069 cells are denoted as 8069 and KPC7017 are denoted 7017. β-tubulin is shown as a loading control. Immunoblots are representative of three independent experiments. c Human PDAC cells were incubated for 48 hours with or without RAM2061. PCR was performed using XBP-1-specific primers. The upper band represents unspliced XBP-1 (US) and the lower band represents spliced XBP-1 (S). d qRT-PCR analysis of ATF4, ATF6, CHOP and PERK expression in human PDAC cells incubated in the presence or absence of RAM2061 (48 hour incubation). Data represents fold change normalized to control ( n = 3, data are displayed as mean ± SEM, *denotes p

Techniques Used: Inhibition, Western Blot, Incubation, Polymerase Chain Reaction, Quantitative RT-PCR, Expressing

18) Product Images from "Gut Antibody Deficiency in a Mouse Model of CVID Results in Spontaneous Development of a Gluten-Sensitive Enteropathy"

Article Title: Gut Antibody Deficiency in a Mouse Model of CVID Results in Spontaneous Development of a Gluten-Sensitive Enteropathy

Journal: Frontiers in Immunology

doi: 10.3389/fimmu.2019.02484

Immune Involvement in Intestinal Malabsorption in CD19 −/− . (A) DE gene transcripts in CD19 −/− mice associated with innate immunity. (B) qRT-PCR of Cpa3 mRNA expression. (C) Representative flow cytometry plot of activated peritoneal mast cells with relative abundance shown. (D) DE gene transcripts in CD19 −/− mice associated with adaptive immunity. (E) Representative anti-CD3 immunohistochemistry staining of WT and CD19 −/− ileal sections. (F) The relative and absolute abundance of CD4 and CD8 T cells isolated from the gut mucosa (lamina propria) of WT and CD19 −/− are provided. (A,D) Quasi-likelihood ratio test to identify significantly DE genes. (B,C,F) Student's t -test; ns, non-significant, * = p
Figure Legend Snippet: Immune Involvement in Intestinal Malabsorption in CD19 −/− . (A) DE gene transcripts in CD19 −/− mice associated with innate immunity. (B) qRT-PCR of Cpa3 mRNA expression. (C) Representative flow cytometry plot of activated peritoneal mast cells with relative abundance shown. (D) DE gene transcripts in CD19 −/− mice associated with adaptive immunity. (E) Representative anti-CD3 immunohistochemistry staining of WT and CD19 −/− ileal sections. (F) The relative and absolute abundance of CD4 and CD8 T cells isolated from the gut mucosa (lamina propria) of WT and CD19 −/− are provided. (A,D) Quasi-likelihood ratio test to identify significantly DE genes. (B,C,F) Student's t -test; ns, non-significant, * = p

Techniques Used: Mouse Assay, Quantitative RT-PCR, Expressing, Flow Cytometry, Cytometry, Immunohistochemistry, Staining, Isolation

19) Product Images from "Resveratrol promotes osteogenesis and alleviates osteoporosis by inhibiting p53"

Article Title: Resveratrol promotes osteogenesis and alleviates osteoporosis by inhibiting p53

Journal: Aging (Albany NY)

doi: 10.18632/aging.103262

MDM2-mediated p53 degradation induces osteoblast differentiation in vitro . ( A , B ) p53 levels in non-OP patients and OP patients were measured by qRT-PCR and western blot; n=10 per group. ( C ) MDM2 expression in hMSCs was assessed by qRT-PCR analysis after different treatments. ( D – E ) p53 levels were measured by qRT-PCR and western blot in the three groups. ( F ) Osteogenic gene levels were measured by qRT-PCR. ( G – H ) Alizarin red-mediated calcium staining in hMSCs 21 days after transfection with different constructs. Scale bar = 10mm. Data are means ± SD. *p
Figure Legend Snippet: MDM2-mediated p53 degradation induces osteoblast differentiation in vitro . ( A , B ) p53 levels in non-OP patients and OP patients were measured by qRT-PCR and western blot; n=10 per group. ( C ) MDM2 expression in hMSCs was assessed by qRT-PCR analysis after different treatments. ( D – E ) p53 levels were measured by qRT-PCR and western blot in the three groups. ( F ) Osteogenic gene levels were measured by qRT-PCR. ( G – H ) Alizarin red-mediated calcium staining in hMSCs 21 days after transfection with different constructs. Scale bar = 10mm. Data are means ± SD. *p

Techniques Used: In Vitro, Quantitative RT-PCR, Western Blot, Expressing, Staining, Transfection, Construct

Resveratrol partially reverses p53-induced inhibition of osteogenic differentiation. ( A ) Effects of different concentrations of resveratrol on MDM2 expression were measured by qRT-PCR. ( B ) p53 expression in different groups was assessed by qRT-PCR. ( C , D ) Osteogenic genes expression in different groups was measured by qRT-PCR and western blot. ( E ) MDM2 expression in hMSCs after different treatments was assessed by qRT-PCR. ( F ) p53 expression in different groups was assessed by qRT-PCR. ( G – H ) Alizarin red-mediated calcium staining in hMSCs 21 days after transfection with different constructs. Scale bar = 10mm. Data are means ± SD. *p
Figure Legend Snippet: Resveratrol partially reverses p53-induced inhibition of osteogenic differentiation. ( A ) Effects of different concentrations of resveratrol on MDM2 expression were measured by qRT-PCR. ( B ) p53 expression in different groups was assessed by qRT-PCR. ( C , D ) Osteogenic genes expression in different groups was measured by qRT-PCR and western blot. ( E ) MDM2 expression in hMSCs after different treatments was assessed by qRT-PCR. ( F ) p53 expression in different groups was assessed by qRT-PCR. ( G – H ) Alizarin red-mediated calcium staining in hMSCs 21 days after transfection with different constructs. Scale bar = 10mm. Data are means ± SD. *p

Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, Western Blot, Staining, Transfection, Construct

20) Product Images from "Comparative Transcriptomics Provides Insights into Reticulate and Adaptive Evolution of a Butterfly Radiation"

Article Title: Comparative Transcriptomics Provides Insights into Reticulate and Adaptive Evolution of a Butterfly Radiation

Journal: Genome Biology and Evolution

doi: 10.1093/gbe/evz202

—Tissue- and sex-specific expression of four genes in eight butterfly species. For each gene, we construct a maximum likelihood phylogeny based on its conserved cluster, and the scale bar represents the percentage of substitutions per site. The branches highlighted in red, if any, indicate a significant pattern of positive selection, and the numbers in brackets are significant sites identified using CodeML branch-site model. Each heat map grid stands for relative expression base on a normalized gender- and tissue-specific qRT-PCR result with n = 3.
Figure Legend Snippet: —Tissue- and sex-specific expression of four genes in eight butterfly species. For each gene, we construct a maximum likelihood phylogeny based on its conserved cluster, and the scale bar represents the percentage of substitutions per site. The branches highlighted in red, if any, indicate a significant pattern of positive selection, and the numbers in brackets are significant sites identified using CodeML branch-site model. Each heat map grid stands for relative expression base on a normalized gender- and tissue-specific qRT-PCR result with n = 3.

Techniques Used: Expressing, Construct, Selection, Quantitative RT-PCR

21) Product Images from "In vitro activity of a G-quadruplex-stabilizing small molecule that synergizes with Navitoclax to induce cytotoxicity in acute myeloid leukemia cells"

Article Title: In vitro activity of a G-quadruplex-stabilizing small molecule that synergizes with Navitoclax to induce cytotoxicity in acute myeloid leukemia cells

Journal: BMC Cancer

doi: 10.1186/s12885-019-6464-9

The G-quadruplex stabilizer GQC-05 induces rapid downregulation of MYC in AML cells. The AML cell lines KG-1a, CMK and TF-1 were treated with vehicle (DMSO), 100 nM, 300 nM 600 nM or 1 μM GQC-05 for 6 h. a qRT-PCR analysis for MYC expression in vehicle (DMSO) or GQC-05 treated AML cells. Data normalized to YWHAZ as +/− mean and is representative of three biological replicates. * P
Figure Legend Snippet: The G-quadruplex stabilizer GQC-05 induces rapid downregulation of MYC in AML cells. The AML cell lines KG-1a, CMK and TF-1 were treated with vehicle (DMSO), 100 nM, 300 nM 600 nM or 1 μM GQC-05 for 6 h. a qRT-PCR analysis for MYC expression in vehicle (DMSO) or GQC-05 treated AML cells. Data normalized to YWHAZ as +/− mean and is representative of three biological replicates. * P

Techniques Used: Quantitative RT-PCR, Expressing

22) Product Images from "Small molecule NSC59984 restores p53 pathway signaling and anti-tumor effects against colorectal cancer via p73 activation and degradation of mutant p53"

Article Title: Small molecule NSC59984 restores p53 pathway signaling and anti-tumor effects against colorectal cancer via p73 activation and degradation of mutant p53

Journal: Cancer research

doi: 10.1158/0008-5472.CAN-13-1079

NSC59984 induces mutant p53 degradation via MDM2-mediated ubiquitination. A. Mutant p53 protein levels in SW480 cells treated with 10µM of MG132 and NSC59984 for 16 hr. B. Mutant p53 protein levels in SW480 cells treated with 5µM of nutlin-3 and 25µM of NSC59984 for 16 hr. C. Ubiquitination (Ub) of mutant p53 in cells treated with NSC59984 and MG132. Cells were transfected with HA-Ub for 48 hr, followed by treatment with 25µM of NSC59984 and MG132 for 16 hr. Cell lysates were subjected to immunoprecipitation. D. Mutant p53 mRNA level in SW480 cells treated with NSC59984 for 3hr and 16 hr, mRNA was quantified by qRT-PCR. Data were normalized to GAPDH and plotted relative to cells treated with the DMSO control. Data are expressed as mean ± SD.
Figure Legend Snippet: NSC59984 induces mutant p53 degradation via MDM2-mediated ubiquitination. A. Mutant p53 protein levels in SW480 cells treated with 10µM of MG132 and NSC59984 for 16 hr. B. Mutant p53 protein levels in SW480 cells treated with 5µM of nutlin-3 and 25µM of NSC59984 for 16 hr. C. Ubiquitination (Ub) of mutant p53 in cells treated with NSC59984 and MG132. Cells were transfected with HA-Ub for 48 hr, followed by treatment with 25µM of NSC59984 and MG132 for 16 hr. Cell lysates were subjected to immunoprecipitation. D. Mutant p53 mRNA level in SW480 cells treated with NSC59984 for 3hr and 16 hr, mRNA was quantified by qRT-PCR. Data were normalized to GAPDH and plotted relative to cells treated with the DMSO control. Data are expressed as mean ± SD.

Techniques Used: Mutagenesis, Transfection, Immunoprecipitation, Quantitative RT-PCR

NSC59984 restores p53-responsive transcriptional activity in mutant p53- expressing tumor cells. A. Structure of NSC59984. B. Imaging bioluminescence assay of p53-responsive transcriptional activity in cells at 24 hr after NSC59984 treatment. Data are representative of triplicate wells. C. The fold-increase of p53 responsive bioluminescence (B). D. mRNA levels of p21, Puma and Noxa in cells at 3 hr after NSC59984 treatment. mRNA levels were quantified by qRT-PCR. Data were normalized to GAPDH expression and plotted relative to cells treated with DMSO as control. Data are expressed as mean ± SD, *p
Figure Legend Snippet: NSC59984 restores p53-responsive transcriptional activity in mutant p53- expressing tumor cells. A. Structure of NSC59984. B. Imaging bioluminescence assay of p53-responsive transcriptional activity in cells at 24 hr after NSC59984 treatment. Data are representative of triplicate wells. C. The fold-increase of p53 responsive bioluminescence (B). D. mRNA levels of p21, Puma and Noxa in cells at 3 hr after NSC59984 treatment. mRNA levels were quantified by qRT-PCR. Data were normalized to GAPDH expression and plotted relative to cells treated with DMSO as control. Data are expressed as mean ± SD, *p

Techniques Used: Activity Assay, Mutagenesis, Expressing, Imaging, ATP Bioluminescent Assay, Quantitative RT-PCR

23) Product Images from "BNC2 is a putative tumor suppressor gene in high-grade serous ovarian carcinoma and impacts cell survival after oxidative stress"

Article Title: BNC2 is a putative tumor suppressor gene in high-grade serous ovarian carcinoma and impacts cell survival after oxidative stress

Journal: Cell Death & Disease

doi: 10.1038/cddis.2016.278

A human genomic region including rs3814113 regulates BNC2 expression. ( a ) Genomic view of the 6.6 kb, surrounding rs3814113, with annotated human mRNAs from GenBank, according to UCSC genome browser. Positions for guides 6 and 9 (guide RNAs used for CRISPR (clustered regularly interspaced short palindromic repeat) deletion of the region), for Screen 6F and Screen 7F (primers used for PCR screening of KO), and for AK 5+3 (amplicon used to detect AK024561 transcript) are indicated. ( b ) Agarose gel of PCR with AK 5+3 primers to detect AK024561 in human samples: top panels, 14 normal human tissues and 3 PBMCs from healthy donors; bottom panels, 11 serous ovarian cancers (10 high grade, 1 low grade=LG) and 8 non-malignant control samples (4 fallopian tubes, 1 round ligament=RL, 3 ovaries). gDNA=genomic DNA used as PCR positive control; RT-PCR on non-retrotranscribed RNA, to exclude genomic contamination; GAPDH and U6 =housekeeping genes used for normalization. ( c ) Representative agarose gel of PCR with Screen 6F+Screen 7R primer pair showing the deletion of the 5 kb region surrounding rs3814113. ( d ) qRT-PCR analysis of BNC2 and CNTLN expression in 293FT KO cell clones. Points for WT and KO samples represent normalized expression data from four distinct WT and five distinct KO clones. The values for each clone are the average of two biologically independent experiments. Three distinct primer pairs (encompassing BNC2's exon 1-2, exon 2-2a and exon 6) were used to detect BNC2 expression levels. t -Test assuming unequal variances was used for statistical analysis. Scatter dot plot bars indicate mean±S.E. * P
Figure Legend Snippet: A human genomic region including rs3814113 regulates BNC2 expression. ( a ) Genomic view of the 6.6 kb, surrounding rs3814113, with annotated human mRNAs from GenBank, according to UCSC genome browser. Positions for guides 6 and 9 (guide RNAs used for CRISPR (clustered regularly interspaced short palindromic repeat) deletion of the region), for Screen 6F and Screen 7F (primers used for PCR screening of KO), and for AK 5+3 (amplicon used to detect AK024561 transcript) are indicated. ( b ) Agarose gel of PCR with AK 5+3 primers to detect AK024561 in human samples: top panels, 14 normal human tissues and 3 PBMCs from healthy donors; bottom panels, 11 serous ovarian cancers (10 high grade, 1 low grade=LG) and 8 non-malignant control samples (4 fallopian tubes, 1 round ligament=RL, 3 ovaries). gDNA=genomic DNA used as PCR positive control; RT-PCR on non-retrotranscribed RNA, to exclude genomic contamination; GAPDH and U6 =housekeeping genes used for normalization. ( c ) Representative agarose gel of PCR with Screen 6F+Screen 7R primer pair showing the deletion of the 5 kb region surrounding rs3814113. ( d ) qRT-PCR analysis of BNC2 and CNTLN expression in 293FT KO cell clones. Points for WT and KO samples represent normalized expression data from four distinct WT and five distinct KO clones. The values for each clone are the average of two biologically independent experiments. Three distinct primer pairs (encompassing BNC2's exon 1-2, exon 2-2a and exon 6) were used to detect BNC2 expression levels. t -Test assuming unequal variances was used for statistical analysis. Scatter dot plot bars indicate mean±S.E. * P

Techniques Used: Expressing, CRISPR, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Positive Control, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Clone Assay

Oxidative stress reduces BNC2 expression in vitro and in vivo . ( a ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 and COV504 cells treated with increasing amounts of H 2 O 2 (0.06, 0.125 and 0.25 mM) at 3 or 24 h post-treatment. Total H2AX was used as loading control. Phospho-H2AX (pH2AX) was detected to check effectiveness of H 2 O 2 treatment. ( b ) qRT-PCR analysis of BNC2 expression in COV318 and OVCAR4 at 5 h after H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( c ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 cells treated with 0.06 mM H 2 O 2 and collected 1, 6 and 24 h post-treatment. Total H2AX was used as loading control. pH2AX was detected to check effectiveness of H 2 O 2 treatment. ( d ) qRT-PCR analysis of BNC2 expression in COV318 at 1, 6 and 24 h after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( e ) ChIP for H3K4me3 enrichment (measured by qRT-PCR) of three regulatory elements of BNC2 locus in COV318 treated with 0.06 mM H 2 O 2 at different time points. Bars indicate mean±S.E. from two independent experiments. ( f ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 cells treated with 0.06 mM H 2 O 2 and collected 1 week post-treatment. Total H2AX was used as loading control. pH2AX was detected to check effectiveness of H 2 O 2 treatment. ( g ) qRT-PCR analysis of BNC2 expression in COV318 at 1 week after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( h ) ChIP for H3K4me3 enrichment (left panel) and H3K27me3 enrichment (right panel) (measured by qRT-PCR) of three regulatory elements of BNC2 locus in COV318 at 1 week after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( i ) Left panel: Western blot detection of BNC2 protein levels in NP40-insoluble extracts from prepubertal mice oviducts treated or not with hCG 16 h earlier. COV318 was used as positive control for BNC2 expression. Right panel: Densitometric analysis of BNC2 western blot bands in oviducts from hCG treated ( n =10) and untreated ( n =10) prepubertal mice as described above. Scatter dot plot bars indicate mean±S.E. from two independent experiments, including the one presented in the left panel. * P
Figure Legend Snippet: Oxidative stress reduces BNC2 expression in vitro and in vivo . ( a ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 and COV504 cells treated with increasing amounts of H 2 O 2 (0.06, 0.125 and 0.25 mM) at 3 or 24 h post-treatment. Total H2AX was used as loading control. Phospho-H2AX (pH2AX) was detected to check effectiveness of H 2 O 2 treatment. ( b ) qRT-PCR analysis of BNC2 expression in COV318 and OVCAR4 at 5 h after H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( c ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 cells treated with 0.06 mM H 2 O 2 and collected 1, 6 and 24 h post-treatment. Total H2AX was used as loading control. pH2AX was detected to check effectiveness of H 2 O 2 treatment. ( d ) qRT-PCR analysis of BNC2 expression in COV318 at 1, 6 and 24 h after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( e ) ChIP for H3K4me3 enrichment (measured by qRT-PCR) of three regulatory elements of BNC2 locus in COV318 treated with 0.06 mM H 2 O 2 at different time points. Bars indicate mean±S.E. from two independent experiments. ( f ) Western blot detection of BNC2 protein levels in NP40-insoluble extracts from COV318 cells treated with 0.06 mM H 2 O 2 and collected 1 week post-treatment. Total H2AX was used as loading control. pH2AX was detected to check effectiveness of H 2 O 2 treatment. ( g ) qRT-PCR analysis of BNC2 expression in COV318 at 1 week after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( h ) ChIP for H3K4me3 enrichment (left panel) and H3K27me3 enrichment (right panel) (measured by qRT-PCR) of three regulatory elements of BNC2 locus in COV318 at 1 week after 0.06 mM H 2 O 2 treatment. Bars indicate mean±S.E. from two independent experiments. ( i ) Left panel: Western blot detection of BNC2 protein levels in NP40-insoluble extracts from prepubertal mice oviducts treated or not with hCG 16 h earlier. COV318 was used as positive control for BNC2 expression. Right panel: Densitometric analysis of BNC2 western blot bands in oviducts from hCG treated ( n =10) and untreated ( n =10) prepubertal mice as described above. Scatter dot plot bars indicate mean±S.E. from two independent experiments, including the one presented in the left panel. * P

Techniques Used: Expressing, In Vitro, In Vivo, Western Blot, Quantitative RT-PCR, Chromatin Immunoprecipitation, Mouse Assay, Positive Control

BNC2 expression and genetic regulation. ( a ) qRT-PCR analysis of BNC2 expression in a panel of 16 ovarian cancer cell lines, grouped in likely and unlikely HGSOC. ( b ) Western blot detection of BNC2 shows several isoforms in NP40-insoluble protein extracts from seven likely HGSOC cell lines. H2AX total was used as loading control. ( c ) ChIP for histone mark enrichment (measured by qRT-PCR) in the putative promoter/enhancer genomic regions comprising BNC2 , CNTLN and the intergenic region in between, according to UCSC ( Supplementary Figure S3 ). H3K4me3 (top panels) and H3K27Ac (bottom panels)=histone H3 trymethylated on lysine 4 and acetylated on lysine 27, respectively. BNC2 intron 2 (Intr 2) was set as 1
Figure Legend Snippet: BNC2 expression and genetic regulation. ( a ) qRT-PCR analysis of BNC2 expression in a panel of 16 ovarian cancer cell lines, grouped in likely and unlikely HGSOC. ( b ) Western blot detection of BNC2 shows several isoforms in NP40-insoluble protein extracts from seven likely HGSOC cell lines. H2AX total was used as loading control. ( c ) ChIP for histone mark enrichment (measured by qRT-PCR) in the putative promoter/enhancer genomic regions comprising BNC2 , CNTLN and the intergenic region in between, according to UCSC ( Supplementary Figure S3 ). H3K4me3 (top panels) and H3K27Ac (bottom panels)=histone H3 trymethylated on lysine 4 and acetylated on lysine 27, respectively. BNC2 intron 2 (Intr 2) was set as 1

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Chromatin Immunoprecipitation

24) Product Images from "RNA-binding protein ZFP36L1 regulates osteoarthritis by modulating members of the heat shock protein 70 family"

Article Title: RNA-binding protein ZFP36L1 regulates osteoarthritis by modulating members of the heat shock protein 70 family

Journal: Nature Communications

doi: 10.1038/s41467-018-08035-7

HSPA1A inhibits chondrocyte apoptosis. a qRT-PCR analysis ( n = 7) of matrix-degrading enzymes in chondrocytes treated with IL-1β and infected with 400 MOI of control virus or the indicated MOIs of Ad-shZFP36L1. b , c Chondrocytes were infected with Ad-C or Ad-HSPA1A ( b ) or transfected with empty vector (EV, 1 μg) or vectors encoding WT-HSPA1A or K71E-HSPA1A ( c ) and left untreated or exposed to the NO donor, SNP, for 6 h. Apoptotic chondrocytes were identified and quantified by TUNEL staining ( n = 5). d – f Detection and quantitation of apoptotic chondrocytes in calcified cartilage (CC) and articular cartilage (AC) of sham- or DMM-operated mice subjected to IA injection with Ad-C or Ad-HSPA1A ( n = 5 mice per group) ( d ), sham- or DMM-operated Zfp36l1 +/− and WT mice ( e ; n = 6 mice per group), or sham- or DMM-operated mice subjected to IA injection with Ad-shC or Ad-shZFP36L1 ( f ; n = 5 mice per group). Means ± s.e.m. with one-way ANOVA ( a – c ) and two-tailed t -test ( d – f ). * P
Figure Legend Snippet: HSPA1A inhibits chondrocyte apoptosis. a qRT-PCR analysis ( n = 7) of matrix-degrading enzymes in chondrocytes treated with IL-1β and infected with 400 MOI of control virus or the indicated MOIs of Ad-shZFP36L1. b , c Chondrocytes were infected with Ad-C or Ad-HSPA1A ( b ) or transfected with empty vector (EV, 1 μg) or vectors encoding WT-HSPA1A or K71E-HSPA1A ( c ) and left untreated or exposed to the NO donor, SNP, for 6 h. Apoptotic chondrocytes were identified and quantified by TUNEL staining ( n = 5). d – f Detection and quantitation of apoptotic chondrocytes in calcified cartilage (CC) and articular cartilage (AC) of sham- or DMM-operated mice subjected to IA injection with Ad-C or Ad-HSPA1A ( n = 5 mice per group) ( d ), sham- or DMM-operated Zfp36l1 +/− and WT mice ( e ; n = 6 mice per group), or sham- or DMM-operated mice subjected to IA injection with Ad-shC or Ad-shZFP36L1 ( f ; n = 5 mice per group). Means ± s.e.m. with one-way ANOVA ( a – c ) and two-tailed t -test ( d – f ). * P

Techniques Used: Quantitative RT-PCR, Infection, Transfection, Plasmid Preparation, TUNEL Assay, Staining, Quantitation Assay, Mouse Assay, IA, Injection, Two Tailed Test

Upregulation of ZFP36L1 in chondrocytes stimulated with OA-associated catabolic regulators. a Microarray analysis of AU-rich element (ARE)-binding proteins in chondrocytes treated with IL-1β or infected with Ad-HIF-2α or Ad-ZIP8. b , c qRT-PCR analyses of ZFP36 family members in chondrocytes treated with IL-1β or infected with 800 MOI of control virus (Ad-C) or the indicated MOIs of Ad-HIF-2α or Ad-ZIP8 ( n = 3 or 5). d Representative images of Alcian blue staining and ZFP36L1 immunostaining in undamaged and damaged regions of OA cartilage from the same patient ( n = 7 patients). e Representative images of Safranin-O staining and ZFP36L1 immunostaining in mouse OA cartilage caused by DMM surgery ( n = 5 mice per group) or by IA injection of Ad-HIF-2α or Ad-ZIP8 ( n = 5 mice per group). Means ± s.e.m. with one-way ANOVA (* P
Figure Legend Snippet: Upregulation of ZFP36L1 in chondrocytes stimulated with OA-associated catabolic regulators. a Microarray analysis of AU-rich element (ARE)-binding proteins in chondrocytes treated with IL-1β or infected with Ad-HIF-2α or Ad-ZIP8. b , c qRT-PCR analyses of ZFP36 family members in chondrocytes treated with IL-1β or infected with 800 MOI of control virus (Ad-C) or the indicated MOIs of Ad-HIF-2α or Ad-ZIP8 ( n = 3 or 5). d Representative images of Alcian blue staining and ZFP36L1 immunostaining in undamaged and damaged regions of OA cartilage from the same patient ( n = 7 patients). e Representative images of Safranin-O staining and ZFP36L1 immunostaining in mouse OA cartilage caused by DMM surgery ( n = 5 mice per group) or by IA injection of Ad-HIF-2α or Ad-ZIP8 ( n = 5 mice per group). Means ± s.e.m. with one-way ANOVA (* P

Techniques Used: Microarray, Binding Assay, Infection, Quantitative RT-PCR, Staining, Immunostaining, Mouse Assay, IA, Injection

ZFP36L1 targets HSP70 family members in chondrocytes. a Microarray analysis of chondrocytes infected with 400 MOI of Ad-shZFP36L1 to knock down ZFP36L1 (3 replicates). b , c qRT-PCR ( b ) and RT-PCR and western blot analyses ( c ) of ZFP36L1, HSPA1A, HSPA1B, and HSP70 in chondrocytes infected with Ad-C (800 MOI) or the indicated MOIs of Ad-shZFP36L1 or Ad-ZFP36L1 for 36 h ( n = 4). Representative images are presented ( c ). d RNA binding of ZFP36L1 in chondrocytes infected with Ad-C or Ad-ZFP36L1. The binding of ZFP36L1 to the 3′-UTR of HSPA1A was determined by RT-PCR of immunoprecipitates obtained using anti-ZFP36L1 or IgG. Representative images are presented from five biologically independent samples. e mRNA decay assay. Chondrocytes were infected with Ad-HSPA1A with or without Ad- ZFP36L1 for 12 h, and then exposed to Actinomycin D (1 μg ml − 1 ) for the indicated time periods. The mRNA levels of HSPA1A were quantified by qRT-PCR analysis ( n = 9). Representative western blot images of HSP70 and ZFP36L1 proteins. Means ± s.e.m. with one-way ANOVA (* P
Figure Legend Snippet: ZFP36L1 targets HSP70 family members in chondrocytes. a Microarray analysis of chondrocytes infected with 400 MOI of Ad-shZFP36L1 to knock down ZFP36L1 (3 replicates). b , c qRT-PCR ( b ) and RT-PCR and western blot analyses ( c ) of ZFP36L1, HSPA1A, HSPA1B, and HSP70 in chondrocytes infected with Ad-C (800 MOI) or the indicated MOIs of Ad-shZFP36L1 or Ad-ZFP36L1 for 36 h ( n = 4). Representative images are presented ( c ). d RNA binding of ZFP36L1 in chondrocytes infected with Ad-C or Ad-ZFP36L1. The binding of ZFP36L1 to the 3′-UTR of HSPA1A was determined by RT-PCR of immunoprecipitates obtained using anti-ZFP36L1 or IgG. Representative images are presented from five biologically independent samples. e mRNA decay assay. Chondrocytes were infected with Ad-HSPA1A with or without Ad- ZFP36L1 for 12 h, and then exposed to Actinomycin D (1 μg ml − 1 ) for the indicated time periods. The mRNA levels of HSPA1A were quantified by qRT-PCR analysis ( n = 9). Representative western blot images of HSP70 and ZFP36L1 proteins. Means ± s.e.m. with one-way ANOVA (* P

Techniques Used: Microarray, Infection, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Western Blot, RNA Binding Assay, Binding Assay, Mrna Decay Assay

25) Product Images from "Respiratory metabolism and calorie restriction relieve persistent endoplasmic reticulum stress induced by calcium shortage in yeast"

Article Title: Respiratory metabolism and calorie restriction relieve persistent endoplasmic reticulum stress induced by calcium shortage in yeast

Journal: Scientific Reports

doi: 10.1038/srep27942

Calcium shortage upregulates the oxidative stress response and promotes ROS accumulation. ( a ) qRT-PCR analysis of transcripts encoding proteins involved in stress response. Values are means ±SDs of biological duplicates (* p
Figure Legend Snippet: Calcium shortage upregulates the oxidative stress response and promotes ROS accumulation. ( a ) qRT-PCR analysis of transcripts encoding proteins involved in stress response. Values are means ±SDs of biological duplicates (* p

Techniques Used: Quantitative RT-PCR

The effects of calcium shortage are carbon source-dependent. ( a ) Glucose consumption and ethanol production rates were determined in cells grown overnight in either SCD or SCD Cd media and resuspended in medium containing 50 mM glucose at a final density of about 4*10 6 cells/mL. A glucose-to-ethanol ratio close to 2 moles of ethanol produced per moles of glucose consumed (the maximum theoretical value) indicates a mostly fermentative metabolism. Values are means ± SDs of three biological replicates. ( b ) Alterations in the proteomic and metabolomic profiles of cells grown under calcium shortage in 2% glucose medium (SCD Cd ). Changes in protein or mRNA levels were evaluated by 2D-page or qRT-PCR, respectively. Increase/decrease under calcium shortage are red/green colored; grey indicates no significant change. A colored box indicates transcriptional regulation under calcium shortage. Proteins whose expression changes under calcium shortage are colored. Blue lines indicate reactions specific for the gluconeogenic pathway. Orange lines indicate reactions specific for the glyoxylate cycle. ( c ) Cellular suspensions of CEN.PK2-1C cells were serially diluted and spotted on SC and SC Cd media plates supplemented with the indicated carbon sources. ( d ) Cell viability under calcium shortage during exponential growth in liquid media on the indicated carbon source, as evaluated by cytofluorimetric analysis. Values are means ± SDs of two biological replicates (* p
Figure Legend Snippet: The effects of calcium shortage are carbon source-dependent. ( a ) Glucose consumption and ethanol production rates were determined in cells grown overnight in either SCD or SCD Cd media and resuspended in medium containing 50 mM glucose at a final density of about 4*10 6 cells/mL. A glucose-to-ethanol ratio close to 2 moles of ethanol produced per moles of glucose consumed (the maximum theoretical value) indicates a mostly fermentative metabolism. Values are means ± SDs of three biological replicates. ( b ) Alterations in the proteomic and metabolomic profiles of cells grown under calcium shortage in 2% glucose medium (SCD Cd ). Changes in protein or mRNA levels were evaluated by 2D-page or qRT-PCR, respectively. Increase/decrease under calcium shortage are red/green colored; grey indicates no significant change. A colored box indicates transcriptional regulation under calcium shortage. Proteins whose expression changes under calcium shortage are colored. Blue lines indicate reactions specific for the gluconeogenic pathway. Orange lines indicate reactions specific for the glyoxylate cycle. ( c ) Cellular suspensions of CEN.PK2-1C cells were serially diluted and spotted on SC and SC Cd media plates supplemented with the indicated carbon sources. ( d ) Cell viability under calcium shortage during exponential growth in liquid media on the indicated carbon source, as evaluated by cytofluorimetric analysis. Values are means ± SDs of two biological replicates (* p

Techniques Used: Produced, Polyacrylamide Gel Electrophoresis, Quantitative RT-PCR, Expressing

Calcium shortage causes sustained Endoplasmic Reticulum (ER) stress and activates the Unfolded Protein Response (UPR). ( a ) qRT-PCR analysis of gene targets of the Unfolded Protein Response (UPR). Values are means ± SDs of at least biological duplicates (* p
Figure Legend Snippet: Calcium shortage causes sustained Endoplasmic Reticulum (ER) stress and activates the Unfolded Protein Response (UPR). ( a ) qRT-PCR analysis of gene targets of the Unfolded Protein Response (UPR). Values are means ± SDs of at least biological duplicates (* p

Techniques Used: Quantitative RT-PCR

Loss of mitochondrial function does not prevent ROS accumulation under calcium shortage. ( a ) Expression profile of genes encoding for mitochondrial NADH dehydrogenases and enzymes of the glyoxylate cycle under calcium shortage (obtained by qRT-PCR analysis). Values are means ± SDs of two biological replicates (* p
Figure Legend Snippet: Loss of mitochondrial function does not prevent ROS accumulation under calcium shortage. ( a ) Expression profile of genes encoding for mitochondrial NADH dehydrogenases and enzymes of the glyoxylate cycle under calcium shortage (obtained by qRT-PCR analysis). Values are means ± SDs of two biological replicates (* p

Techniques Used: Expressing, Quantitative RT-PCR

26) Product Images from "Whole-Genome Analysis of Temporal Gene Expression during Early Transdifferentiation of Human Lung Alveolar Epithelial Type 2 Cells In Vitro"

Article Title: Whole-Genome Analysis of Temporal Gene Expression during Early Transdifferentiation of Human Lung Alveolar Epithelial Type 2 Cells In Vitro

Journal: PLoS ONE

doi: 10.1371/journal.pone.0093413

Validation of a subset of candidate genes by qRT-PCR. RNA was harvested from hAT2 cells cultured on collagen or Matrigel at 12 = 2. The relative expressions of SPOCK2, PLEKHO1, SPRED1, RAB11FIP1, PTRF/CAVIN-1, and RAP1GAP were assessed by TaqMan qRT-PCR and normalized to GAPDH and TBP. The fold-changes in relative expression over time are shown as graphs. The smaller, inset graphs show the expression results obtained from the Illumina BeadChip analysis, for comparison.
Figure Legend Snippet: Validation of a subset of candidate genes by qRT-PCR. RNA was harvested from hAT2 cells cultured on collagen or Matrigel at 12 = 2. The relative expressions of SPOCK2, PLEKHO1, SPRED1, RAB11FIP1, PTRF/CAVIN-1, and RAP1GAP were assessed by TaqMan qRT-PCR and normalized to GAPDH and TBP. The fold-changes in relative expression over time are shown as graphs. The smaller, inset graphs show the expression results obtained from the Illumina BeadChip analysis, for comparison.

Techniques Used: Quantitative RT-PCR, Cell Culture, Expressing

27) Product Images from "In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good."

Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.

Journal: PLoS Biology

doi: 10.1371/journal.pbio.2005840

Protospacer and 5’-triphosphate determine the intensity of the gRNA-mediated IFNβ response. (A) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with equal amounts of gRNAs containing different 20-nucleotide protospacers. gRNAs were ordered by decreasing levels of IFNB1 activation. gRNA1 refers to the gRNA that has been used in all previous experiments. (B) qRT-PCR analysis of ISG15 transcript levels in primary HSPCs nucleofected with equal amounts of gRNA 1, 3, 6, 8, and 11 from panel A. Average values of two biological replicates +/−SD are shown. (C) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with synthetic (“syn”), IVT, and phosphatase-treated IVT gRNAs (gRNA1). (D) Viability of human primary HSPCs 24 h postnucleofection with no RNP and Cas9 or dCas9 RNPs. dCas9 or Cas9 were complexed with synthetic (“syn”) or IVT gRNA targeting the HBB gene. Viability was determined by trypan blue exclusion test. (E) qRT-PCR analysis of ISG15 and DDX58 (RIG-I) transcript levels in human primary HSPCs 16 h postnucleofection. dCas9 or Cas9 were complexed with synthetic or IVT gRNA targeting the HBB gene, respectively. Ct values were normalized against Ct of mock-nucleofected cells. Average values of two biological replicates +/−SD are shown. (F) Viability of human primary HSPCs 16 h posttransfection with RNPs. RNPs consisted of dCas9 complexed with synthetic, IVT, or CIP-treated IVT gRNAs targeting a noncoding intron of JAK2 (left panel) or Cas9 complexed with gRNAs targeting exon 1 of HBB (right panel). Viability was determined by trypan blue exclusion test. (G) Editing outcomes in HSPCs 48 h after nucleofection with RNPs targeting the HBB locus. Indel frequencies were determined by amplicon NGS. Statistical significances were calculated by unpaired t test (* p
Figure Legend Snippet: Protospacer and 5’-triphosphate determine the intensity of the gRNA-mediated IFNβ response. (A) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with equal amounts of gRNAs containing different 20-nucleotide protospacers. gRNAs were ordered by decreasing levels of IFNB1 activation. gRNA1 refers to the gRNA that has been used in all previous experiments. (B) qRT-PCR analysis of ISG15 transcript levels in primary HSPCs nucleofected with equal amounts of gRNA 1, 3, 6, 8, and 11 from panel A. Average values of two biological replicates +/−SD are shown. (C) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with synthetic (“syn”), IVT, and phosphatase-treated IVT gRNAs (gRNA1). (D) Viability of human primary HSPCs 24 h postnucleofection with no RNP and Cas9 or dCas9 RNPs. dCas9 or Cas9 were complexed with synthetic (“syn”) or IVT gRNA targeting the HBB gene. Viability was determined by trypan blue exclusion test. (E) qRT-PCR analysis of ISG15 and DDX58 (RIG-I) transcript levels in human primary HSPCs 16 h postnucleofection. dCas9 or Cas9 were complexed with synthetic or IVT gRNA targeting the HBB gene, respectively. Ct values were normalized against Ct of mock-nucleofected cells. Average values of two biological replicates +/−SD are shown. (F) Viability of human primary HSPCs 16 h posttransfection with RNPs. RNPs consisted of dCas9 complexed with synthetic, IVT, or CIP-treated IVT gRNAs targeting a noncoding intron of JAK2 (left panel) or Cas9 complexed with gRNAs targeting exon 1 of HBB (right panel). Viability was determined by trypan blue exclusion test. (G) Editing outcomes in HSPCs 48 h after nucleofection with RNPs targeting the HBB locus. Indel frequencies were determined by amplicon NGS. Statistical significances were calculated by unpaired t test (* p

Techniques Used: Quantitative RT-PCR, Transfection, Activation Assay, Amplification, Next-Generation Sequencing

Transfection of IVT gRNAs into HEK293 cells triggers a type I interferon response. (A) qRT-PCR analysis of IFNB1 and ISG15 transcript levels in HEK293 cells transfected with increasing amounts of gRNA with and without Cas9 protein. In the samples with Cas9, gRNAs were complexed with constant amounts (100 pmol, 100 nM final concentration) of Cas9 protein. Cells were harvested for RNA extraction 30 h after transfection using CRISPRMAX transfection reagent. Ct values were normalized to Ct values of mock-transfected HEK293 cells to determine fold activation. (B) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with equimolar amounts (50 nM) of IVT gRNA, SeV DI RNA, or HCV PAMP, respectively. (C) qRT-PCR analysis of IFNB1 and ISG15 transcript levels in HEK293 cells over a 48-h time course after transfection with 50 nM via lipofection (Lipofectamine2000 or RNAiMAX) or nucleofection, respectively. For all panels, average values of 3 biological replicates +/−SD are shown. The underlying data for this figure can be found in S1 Data . Cas9, CRISPR-associated 9; Ct, cycle threshold; gRNA, guide RNA; HCV, hepatitis C virus; HEK 293, human embryonic kidney 293; IFNB1 , interferon beta 1 ; IVT, in vitro–transcribed; PAMP, pathogen-associated molecular pattern; qRT-PCR, quantitative real-time PCR; SeV DI, Sendai virus defective interfering.
Figure Legend Snippet: Transfection of IVT gRNAs into HEK293 cells triggers a type I interferon response. (A) qRT-PCR analysis of IFNB1 and ISG15 transcript levels in HEK293 cells transfected with increasing amounts of gRNA with and without Cas9 protein. In the samples with Cas9, gRNAs were complexed with constant amounts (100 pmol, 100 nM final concentration) of Cas9 protein. Cells were harvested for RNA extraction 30 h after transfection using CRISPRMAX transfection reagent. Ct values were normalized to Ct values of mock-transfected HEK293 cells to determine fold activation. (B) qRT-PCR analysis of IFNB1 transcript levels in HEK293 cells transfected with equimolar amounts (50 nM) of IVT gRNA, SeV DI RNA, or HCV PAMP, respectively. (C) qRT-PCR analysis of IFNB1 and ISG15 transcript levels in HEK293 cells over a 48-h time course after transfection with 50 nM via lipofection (Lipofectamine2000 or RNAiMAX) or nucleofection, respectively. For all panels, average values of 3 biological replicates +/−SD are shown. The underlying data for this figure can be found in S1 Data . Cas9, CRISPR-associated 9; Ct, cycle threshold; gRNA, guide RNA; HCV, hepatitis C virus; HEK 293, human embryonic kidney 293; IFNB1 , interferon beta 1 ; IVT, in vitro–transcribed; PAMP, pathogen-associated molecular pattern; qRT-PCR, quantitative real-time PCR; SeV DI, Sendai virus defective interfering.

Techniques Used: Transfection, Quantitative RT-PCR, Concentration Assay, RNA Extraction, Activation Assay, CRISPR, In Vitro, Real-time Polymerase Chain Reaction

IVT gRNAs are recognized via the RIG-I pathway. (A) qRT-PCR analysis of increase in IFNB1 transcript levels (left) and transcript levels of the two main cytosolic RIG-I-like receptors ( DDX58 and IFIH1 ) after introduction of IVT gRNA. Cell lines were ordered by responsiveness to gRNA-mediated induction of IFNB1 transcript levels. Cells were harvested for RNA extraction 30 h after transfection. Ct values were normalized to Ct values of mock-transfected cells for each cell line to determine fold activation. IFNB1 levels for K562 cells were too low to be determined (n.d.). (B) Western blot analysis for RIG-I and MDA5 expression of mock-transfected and gRNA-transfected HEK293 cells after 48 h. (C) qRT-PCR analysis of IFNB1 transcript levels in HEK293 RIG-I (left), MDA5 (middle), and MAVS (right) KO cells. Shown are three biological replicates of three clonal populations of RIG-I, MDA5, or MAVS KO cells, respectively. IFNB1 levels for RIG-I KO clone #5 were too low to be determined (n.d.). For panels A and C, cells were harvested for RNA extraction 30 h after transfection using RNAiMAX transfection reagent. Average values of three biological replicates +/−SD are shown. Statistical significances were calculated by unpaired t test (* p
Figure Legend Snippet: IVT gRNAs are recognized via the RIG-I pathway. (A) qRT-PCR analysis of increase in IFNB1 transcript levels (left) and transcript levels of the two main cytosolic RIG-I-like receptors ( DDX58 and IFIH1 ) after introduction of IVT gRNA. Cell lines were ordered by responsiveness to gRNA-mediated induction of IFNB1 transcript levels. Cells were harvested for RNA extraction 30 h after transfection. Ct values were normalized to Ct values of mock-transfected cells for each cell line to determine fold activation. IFNB1 levels for K562 cells were too low to be determined (n.d.). (B) Western blot analysis for RIG-I and MDA5 expression of mock-transfected and gRNA-transfected HEK293 cells after 48 h. (C) qRT-PCR analysis of IFNB1 transcript levels in HEK293 RIG-I (left), MDA5 (middle), and MAVS (right) KO cells. Shown are three biological replicates of three clonal populations of RIG-I, MDA5, or MAVS KO cells, respectively. IFNB1 levels for RIG-I KO clone #5 were too low to be determined (n.d.). For panels A and C, cells were harvested for RNA extraction 30 h after transfection using RNAiMAX transfection reagent. Average values of three biological replicates +/−SD are shown. Statistical significances were calculated by unpaired t test (* p

Techniques Used: Quantitative RT-PCR, RNA Extraction, Transfection, Activation Assay, Western Blot, Expressing

28) Product Images from "Selective Activation of Striatal NGF-TrkA/p75NTR/MAPK Intracellular Signaling in Rats That Show Suppression of Methamphetamine Intake 30 Days following Drug Abstinence"

Article Title: Selective Activation of Striatal NGF-TrkA/p75NTR/MAPK Intracellular Signaling in Rats That Show Suppression of Methamphetamine Intake 30 Days following Drug Abstinence

Journal: International Journal of Neuropsychopharmacology

doi: 10.1093/ijnp/pyx105

Distinct neurotrophin, neuropeptide, and immediate early genes (IEGs) expression in the dorsal striatum of shock-resistant (SR) and shock-sensitive (SS) rats. (a) Independent qRT-PCR analyses for neurotrophin mRNA levels in the dorsal striatum with increased expression of Bdnf in both SR and SS rats, decrease TrkA levels in SS rats, and increased Gfra2 levels also in SS rats. (b) Differential expression neuropeptide-related genes and receptors in the dorsal striatum, with SS rats having increased mRNA levels for crhr1 , crhbp , and unc2 compared with saline controls and SR rats. (c) Altered mRNA levels of IEGs in the dorsal striatum of SR and SS rats. Both SR and SS rats had increased expression of c-fos mRNA levels compared with saline controls, while only SR rats had increased egr1 and egr2 mRNA levels compared with saline and SS rats. Key to statistics: * P
Figure Legend Snippet: Distinct neurotrophin, neuropeptide, and immediate early genes (IEGs) expression in the dorsal striatum of shock-resistant (SR) and shock-sensitive (SS) rats. (a) Independent qRT-PCR analyses for neurotrophin mRNA levels in the dorsal striatum with increased expression of Bdnf in both SR and SS rats, decrease TrkA levels in SS rats, and increased Gfra2 levels also in SS rats. (b) Differential expression neuropeptide-related genes and receptors in the dorsal striatum, with SS rats having increased mRNA levels for crhr1 , crhbp , and unc2 compared with saline controls and SR rats. (c) Altered mRNA levels of IEGs in the dorsal striatum of SR and SS rats. Both SR and SS rats had increased expression of c-fos mRNA levels compared with saline controls, while only SR rats had increased egr1 and egr2 mRNA levels compared with saline and SS rats. Key to statistics: * P

Techniques Used: Expressing, Quantitative RT-PCR

Transcriptional alterations 30 days after the punishment phase of methamphetamine (METH) self-administration (SA) in the dorsal striatum of shock-resistant (SR) and shock-sensitive (SS) rats. (a) The graph shows neurotrophic- and neuropeptide-associated genes that were differentially expressed between SR and SS rats as determined by RT 2 Profiler PCR Arrays. (b) The figure shows transcriptional responses obtained by Profiler Arrays (“x” axis) and individual qRT-PCRs (“y” axis) for upregulated genes in the dorsal striatum of SR rats (in grey circles) and SS rats (in black circles). Data are presented as fold-changes relative to saline control rats. A significant correlation was observed between the 2 analyses ( P = .001). Key to statistics: # P
Figure Legend Snippet: Transcriptional alterations 30 days after the punishment phase of methamphetamine (METH) self-administration (SA) in the dorsal striatum of shock-resistant (SR) and shock-sensitive (SS) rats. (a) The graph shows neurotrophic- and neuropeptide-associated genes that were differentially expressed between SR and SS rats as determined by RT 2 Profiler PCR Arrays. (b) The figure shows transcriptional responses obtained by Profiler Arrays (“x” axis) and individual qRT-PCRs (“y” axis) for upregulated genes in the dorsal striatum of SR rats (in grey circles) and SS rats (in black circles). Data are presented as fold-changes relative to saline control rats. A significant correlation was observed between the 2 analyses ( P = .001). Key to statistics: # P

Techniques Used: Polymerase Chain Reaction

29) Product Images from "The AMT1 Arginine Methyltransferase Gene Is Important for Plant Infection and Normal Hyphal Growth in Fusarium graminearum"

Article Title: The AMT1 Arginine Methyltransferase Gene Is Important for Plant Infection and Normal Hyphal Growth in Fusarium graminearum

Journal: PLoS ONE

doi: 10.1371/journal.pone.0038324

Assays for the effects of Δ amt1 mutation on other PRMT genes and genes adjacent to the telomere. RNA samples were isolated from germlings of the wild-type (PH-1) and Δ amt1 mutant strains grown in liquid YEPD for 6 h. The expression levels of ( A ) three other PRMT genes, AMT2 , AMT3 , and AMT4 , and ( B ) three predicted genes located in the telomeric region of chromosome 4 (FGSG_14027, FGSG_11614, and FGSG_11613) were assayed by qRT-PCR.
Figure Legend Snippet: Assays for the effects of Δ amt1 mutation on other PRMT genes and genes adjacent to the telomere. RNA samples were isolated from germlings of the wild-type (PH-1) and Δ amt1 mutant strains grown in liquid YEPD for 6 h. The expression levels of ( A ) three other PRMT genes, AMT2 , AMT3 , and AMT4 , and ( B ) three predicted genes located in the telomeric region of chromosome 4 (FGSG_14027, FGSG_11614, and FGSG_11613) were assayed by qRT-PCR.

Techniques Used: Mutagenesis, Isolation, Expressing, Quantitative RT-PCR

30) Product Images from "Genome-Wide Identification and Expression Analysis of NRAMP Family Genes in Soybean (Glycine Max L.)"

Article Title: Genome-Wide Identification and Expression Analysis of NRAMP Family Genes in Soybean (Glycine Max L.)

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2017.01436

Expression profiles of GmNRAMP genes under nitrogen, phosphorus or potassium deficiency conditions. Ten-day-old soybean seedlings were subjected to nitrogen (LN), phosphorous (LP), or potassium (LK) deficiency conditions for 14 days, during which time obvious nutrient deficiency symptoms developed. Leaves and roots were separately harvested for qRT-PCR analysis. Fold-changes of GmNRAMP gene expression were normalized against the reference gene TefS1 using 2 −ΔCt values. Differential expression was determined for four biological replicates in FDR adjusted t -tests of 2 −ΔCt values from nutrient deficient tissues vs. corresponding control tissues. The heat map displays 2 −ΔΔCt values to show relative expression of nutrient deficient samples vs. controls, with significant differences between treatment and control marked as follows, * 0.01
Figure Legend Snippet: Expression profiles of GmNRAMP genes under nitrogen, phosphorus or potassium deficiency conditions. Ten-day-old soybean seedlings were subjected to nitrogen (LN), phosphorous (LP), or potassium (LK) deficiency conditions for 14 days, during which time obvious nutrient deficiency symptoms developed. Leaves and roots were separately harvested for qRT-PCR analysis. Fold-changes of GmNRAMP gene expression were normalized against the reference gene TefS1 using 2 −ΔCt values. Differential expression was determined for four biological replicates in FDR adjusted t -tests of 2 −ΔCt values from nutrient deficient tissues vs. corresponding control tissues. The heat map displays 2 −ΔΔCt values to show relative expression of nutrient deficient samples vs. controls, with significant differences between treatment and control marked as follows, * 0.01

Techniques Used: Expressing, Quantitative RT-PCR

Expression of GmNRAMPs in response to Fe or S deficiency. Ten-day-old soybean seedlings were subjected to Fe or S deficiency for 14 days. Leaves and roots were separately harvested for qRT-PCR analysis. Fold-changes of GmNRAMP gene expression were normalized against the reference gene TefS1 using 2- ΔCt values. Each bar is the mean of four biological replicates with standard error. “ * ” indicates significant differences between soybean without and with rhizobia inoculation in young leaves, stems, and roots in one-way analysis of variance, * P
Figure Legend Snippet: Expression of GmNRAMPs in response to Fe or S deficiency. Ten-day-old soybean seedlings were subjected to Fe or S deficiency for 14 days. Leaves and roots were separately harvested for qRT-PCR analysis. Fold-changes of GmNRAMP gene expression were normalized against the reference gene TefS1 using 2- ΔCt values. Each bar is the mean of four biological replicates with standard error. “ * ” indicates significant differences between soybean without and with rhizobia inoculation in young leaves, stems, and roots in one-way analysis of variance, * P

Techniques Used: Expressing, Quantitative RT-PCR

31) Product Images from "Ancestral exposure to stress epigenetically programs preterm birth risk and adverse maternal and newborn outcomes"

Article Title: Ancestral exposure to stress epigenetically programs preterm birth risk and adverse maternal and newborn outcomes

Journal: BMC Medicine

doi: 10.1186/s12916-014-0121-6

Ancestral stress alters brain miRNA expression. (A) Heat map of miRNA expression modulated by multigenerational stress in brains of F2-SSS dams. (B) Confirmation of miRNA level changes in brains of F0-S and F2-SSS compared to non-stress F0-N rats by qRT-PCR. Ancestral programming by stress particularly involved the miR-200 family. Sno202, U6 and 5 s rRNA were used as references. Asterisks indicate significances: * P
Figure Legend Snippet: Ancestral stress alters brain miRNA expression. (A) Heat map of miRNA expression modulated by multigenerational stress in brains of F2-SSS dams. (B) Confirmation of miRNA level changes in brains of F0-S and F2-SSS compared to non-stress F0-N rats by qRT-PCR. Ancestral programming by stress particularly involved the miR-200 family. Sno202, U6 and 5 s rRNA were used as references. Asterisks indicate significances: * P

Techniques Used: Expressing, Quantitative RT-PCR

32) Product Images from "Translational profiling identifies a cascade of damage initiated in motor neurons and spreading to glia in mutant SOD1-mediated ALS"

Article Title: Translational profiling identifies a cascade of damage initiated in motor neurons and spreading to glia in mutant SOD1-mediated ALS

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.1520639112

Gene expression changes in oligodendrocytes. ( A ) Number of gene expression changes in oligodendrocytes at disease onset and early symptomatic stage, comparing SOD1 G37R transgenic mice with nontransgenic mice. ( B ) Number of gene expression changes above 2-, 5-, and 10-fold in SOD1 G37R oligodendrocytes at an early symptomatic stage. ( C ) qRT-PCR validation of gene changes in SOD1 G37R oligodendrocytes at early symptomatic stage. Error bars represent SEM in three or four biological replicates. * P
Figure Legend Snippet: Gene expression changes in oligodendrocytes. ( A ) Number of gene expression changes in oligodendrocytes at disease onset and early symptomatic stage, comparing SOD1 G37R transgenic mice with nontransgenic mice. ( B ) Number of gene expression changes above 2-, 5-, and 10-fold in SOD1 G37R oligodendrocytes at an early symptomatic stage. ( C ) qRT-PCR validation of gene changes in SOD1 G37R oligodendrocytes at early symptomatic stage. Error bars represent SEM in three or four biological replicates. * P

Techniques Used: Expressing, Transgenic Assay, Mouse Assay, Quantitative RT-PCR

Cell type-specific transcriptome changes induced by SOD1 G37R mutation. ( A ) Scatterplots of average gene expression from multiple biological replicates of immunoprecipitated mRNA from motor neurons versus astrocytes ( Top ), oligodendrocytes versus motor neurons ( Middle ), and astrocytes versus oligodendrocytes ( Bottom ). The dots representing the cell type marker genes are labeled in the figures. ( B ) qRT-PCR of mouse SOD1 in motor neurons, astrocytes, and oligodendrocytes. The relative level is normalized to internal control Dnaja2. Error bars represent SD in three or four biological replicates. ( C ) qRT-PCR of human SOD1 in motor neurons, astrocytes, and oligodendrocytes. The relative level is normalized to internal control Dnaja2. Error bars represent SD in three or four biological replicates. ( D ) Number of gene expression changes in the three cell types, comparing SOD1 G37R transgenic mice and nontransgenic mice. ( E ) Number of overlapped gene changes induced by SOD1 G37R in motor neurons, astrocytes, and oligodendrocytes. ( F ) RNA-seq reads from SOD1 G37R transgenic mice and nontransgenic controls in the three cell types, showing the specific up-regulation of Acsbg1 mRNA in motor neurons.
Figure Legend Snippet: Cell type-specific transcriptome changes induced by SOD1 G37R mutation. ( A ) Scatterplots of average gene expression from multiple biological replicates of immunoprecipitated mRNA from motor neurons versus astrocytes ( Top ), oligodendrocytes versus motor neurons ( Middle ), and astrocytes versus oligodendrocytes ( Bottom ). The dots representing the cell type marker genes are labeled in the figures. ( B ) qRT-PCR of mouse SOD1 in motor neurons, astrocytes, and oligodendrocytes. The relative level is normalized to internal control Dnaja2. Error bars represent SD in three or four biological replicates. ( C ) qRT-PCR of human SOD1 in motor neurons, astrocytes, and oligodendrocytes. The relative level is normalized to internal control Dnaja2. Error bars represent SD in three or four biological replicates. ( D ) Number of gene expression changes in the three cell types, comparing SOD1 G37R transgenic mice and nontransgenic mice. ( E ) Number of overlapped gene changes induced by SOD1 G37R in motor neurons, astrocytes, and oligodendrocytes. ( F ) RNA-seq reads from SOD1 G37R transgenic mice and nontransgenic controls in the three cell types, showing the specific up-regulation of Acsbg1 mRNA in motor neurons.

Techniques Used: Mutagenesis, Expressing, Immunoprecipitation, Marker, Labeling, Quantitative RT-PCR, Transgenic Assay, Mouse Assay, RNA Sequencing Assay

The bacTRAP methodology for isolating cell type-specific translational mRNAs. ( A ) The experimental design to identify cell type-specific damages in motor neurons, astrocytes, and oligodendrocytes caused by the SOD1 G37R mutant, coupling the bacTRAP methodology and high-throughput RNA sequencing. The polyribosome-associated translational mRNAs were isolated by EGFP immunoprecipitation from specifically labeled cell types in the spinal cord of bacTRAP reporter mice. ( B ) The disease course of the SOD1 G37R transgenic mouse. To identify early changes, RNA from all three cell types was first isolated at disease onset (∼8 mo; red). RNA from oligodendrocytes was also examined at an early symptomatic stage (∼10.5 mo; purple). ( C ) Direct fluorescence of GFP (for motor neuron reporter) or double immunostaining of mouse spinal cord with an anti-GFP antibody (green, for astrocyte and oligodendrocyte reporters) and antibodies for motor neuron marker Chat (red), astrocyte marker GFAP (red), and marker for oligodendrocytes CC1 (red). ( D ) Average amount of GFP-immunoprecipitated RNA from each spinal cord of the three EGFP-Rpl10a reporter mice and mice without the GFP transgene. ( E ) The quality of RNA after immunoprecipitation was measured with a Bioanalyzer. The intact 18S and 28S bands demonstrate that the RNA was not degraded. ( F ) qRT-PCR for motor neuron markers Chat and Slcl18a3 (VAChT), astrocyte markers Aldh1 and Gfap , and oligodendrocyte markers Cnp1 and Mbp .
Figure Legend Snippet: The bacTRAP methodology for isolating cell type-specific translational mRNAs. ( A ) The experimental design to identify cell type-specific damages in motor neurons, astrocytes, and oligodendrocytes caused by the SOD1 G37R mutant, coupling the bacTRAP methodology and high-throughput RNA sequencing. The polyribosome-associated translational mRNAs were isolated by EGFP immunoprecipitation from specifically labeled cell types in the spinal cord of bacTRAP reporter mice. ( B ) The disease course of the SOD1 G37R transgenic mouse. To identify early changes, RNA from all three cell types was first isolated at disease onset (∼8 mo; red). RNA from oligodendrocytes was also examined at an early symptomatic stage (∼10.5 mo; purple). ( C ) Direct fluorescence of GFP (for motor neuron reporter) or double immunostaining of mouse spinal cord with an anti-GFP antibody (green, for astrocyte and oligodendrocyte reporters) and antibodies for motor neuron marker Chat (red), astrocyte marker GFAP (red), and marker for oligodendrocytes CC1 (red). ( D ) Average amount of GFP-immunoprecipitated RNA from each spinal cord of the three EGFP-Rpl10a reporter mice and mice without the GFP transgene. ( E ) The quality of RNA after immunoprecipitation was measured with a Bioanalyzer. The intact 18S and 28S bands demonstrate that the RNA was not degraded. ( F ) qRT-PCR for motor neuron markers Chat and Slcl18a3 (VAChT), astrocyte markers Aldh1 and Gfap , and oligodendrocyte markers Cnp1 and Mbp .

Techniques Used: Mutagenesis, High Throughput Screening Assay, RNA Sequencing Assay, Isolation, Immunoprecipitation, Labeling, Mouse Assay, Transgenic Assay, Fluorescence, Double Immunostaining, Marker, Quantitative RT-PCR

Gene expression changes in astrocytes at disease onset. ( A ) Number of gene expression changes above 2-, 5-, and 10-fold in SOD1 G37R astrocytes at disease onset. ( B ) Candidate transcription factors of coregulated genes in SOD1 G37R astrocytes, as predicted by the web server DiRE. ( C ) Diagram of PPAR and LXR functions and how they are altered by the SOD1 G37R mutant in astrocytes (red). ( D ) qRT-PCR of inflammatory genes up-regulated in SOD1 G37R astrocytes. Error bars represent SEM in three or four biological replicates. * P
Figure Legend Snippet: Gene expression changes in astrocytes at disease onset. ( A ) Number of gene expression changes above 2-, 5-, and 10-fold in SOD1 G37R astrocytes at disease onset. ( B ) Candidate transcription factors of coregulated genes in SOD1 G37R astrocytes, as predicted by the web server DiRE. ( C ) Diagram of PPAR and LXR functions and how they are altered by the SOD1 G37R mutant in astrocytes (red). ( D ) qRT-PCR of inflammatory genes up-regulated in SOD1 G37R astrocytes. Error bars represent SEM in three or four biological replicates. * P

Techniques Used: Expressing, Mutagenesis, Quantitative RT-PCR

Activation of ER stress specifically in motor neurons at disease onset. ( A ) Candidate transcription factors of coregulated genes in SOD1 G37R motor neurons, as predicted by the web server DiRE. ( B ) qRT-PCR of genes involved in the UPR-activated ER stress pathway in SOD1 G37R-expressed motor neurons compared with nontransgenic controls. Error bars represent SEM in three or four biological replicates. * P
Figure Legend Snippet: Activation of ER stress specifically in motor neurons at disease onset. ( A ) Candidate transcription factors of coregulated genes in SOD1 G37R motor neurons, as predicted by the web server DiRE. ( B ) qRT-PCR of genes involved in the UPR-activated ER stress pathway in SOD1 G37R-expressed motor neurons compared with nontransgenic controls. Error bars represent SEM in three or four biological replicates. * P

Techniques Used: Activation Assay, Quantitative RT-PCR

33) Product Images from "Medroxyprogesterone Acetate Impairs Amyloid Beta Degradation in a Matrix Metalloproteinase-9 Dependent Manner"

Article Title: Medroxyprogesterone Acetate Impairs Amyloid Beta Degradation in a Matrix Metalloproteinase-9 Dependent Manner

Journal: Frontiers in Aging Neuroscience

doi: 10.3389/fnagi.2020.00092

The effect of MPA treatment on MMP-2/-9 mRNA in C6 glial cells. (A) The mRNA levels of MMP-2 and MMP-9 were measured by qRT-PCR in C6 glial cells treated with MPA for 12-h, using MMP-2 and MMP-9 specific primers. (B) At 24-h, the suppression of MMP-9 mRNA levels is no longer detected. Data are represented by the mean ± SEM of three independent qRT-PCR experiments performed in duplicates. The expression levels are represented relative to the GAPDH reference gene. Results are representative of five independent experiments. * p
Figure Legend Snippet: The effect of MPA treatment on MMP-2/-9 mRNA in C6 glial cells. (A) The mRNA levels of MMP-2 and MMP-9 were measured by qRT-PCR in C6 glial cells treated with MPA for 12-h, using MMP-2 and MMP-9 specific primers. (B) At 24-h, the suppression of MMP-9 mRNA levels is no longer detected. Data are represented by the mean ± SEM of three independent qRT-PCR experiments performed in duplicates. The expression levels are represented relative to the GAPDH reference gene. Results are representative of five independent experiments. * p

Techniques Used: Quantitative RT-PCR, Expressing

34) Product Images from "Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck"

Article Title: Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck

Journal: PLoS ONE

doi: 10.1371/journal.pone.0086150

Validation of miRNA expression by qRT-PCR.
Figure Legend Snippet: Validation of miRNA expression by qRT-PCR.

Techniques Used: Expressing, Quantitative RT-PCR

35) Product Images from "Dipeptide repeat proteins activate a heat shock response found in C9ORF72-ALS/FTLD patients"

Article Title: Dipeptide repeat proteins activate a heat shock response found in C9ORF72-ALS/FTLD patients

Journal: Acta Neuropathologica Communications

doi: 10.1186/s40478-018-0555-8

DPRs induce expression of C9ORF72 signature transcripts in human neurons. a Diagram of generation of human neurons from stem cells. b Viability dose response curve of human stem cells and stem-cell derived neurons exposed to various DPRs ( n = 6). c, d qRT-PCR of C9ORF72-chaperome transcripts ( c ) and HSF1 ( d ) in human stem cell-derived motor neurons following treatment with DPRs (poly-GA, poly-GP, poly-GR) or a scrambled poly-GAPR (5 uM for 24 h) normalized to control (DMSO-treated) neurons (mean ± SD, n = 3, one-way ANOVA with Dunnett’s post-hoc test for upregulated genes in DPR-treated neurons compared to control, * p
Figure Legend Snippet: DPRs induce expression of C9ORF72 signature transcripts in human neurons. a Diagram of generation of human neurons from stem cells. b Viability dose response curve of human stem cells and stem-cell derived neurons exposed to various DPRs ( n = 6). c, d qRT-PCR of C9ORF72-chaperome transcripts ( c ) and HSF1 ( d ) in human stem cell-derived motor neurons following treatment with DPRs (poly-GA, poly-GP, poly-GR) or a scrambled poly-GAPR (5 uM for 24 h) normalized to control (DMSO-treated) neurons (mean ± SD, n = 3, one-way ANOVA with Dunnett’s post-hoc test for upregulated genes in DPR-treated neurons compared to control, * p

Techniques Used: Expressing, Derivative Assay, Quantitative RT-PCR

36) Product Images from "Postnatal exposure to trichloroethylene alters glutathione redox homeostasis, methylation potential, and neurotrophin expression in the mouse hippocampus"

Article Title: Postnatal exposure to trichloroethylene alters glutathione redox homeostasis, methylation potential, and neurotrophin expression in the mouse hippocampus

Journal: Neurotoxicology

doi: 10.1016/j.neuro.2012.02.017

TCE exposure decreases neurotrophic factor gene expression in hippocampus. qRT-PCR was performed using hippocampus samples from 6 mice in each treatment group collected at PND42. *Statistically different from results obtained from control mice for each
Figure Legend Snippet: TCE exposure decreases neurotrophic factor gene expression in hippocampus. qRT-PCR was performed using hippocampus samples from 6 mice in each treatment group collected at PND42. *Statistically different from results obtained from control mice for each

Techniques Used: Expressing, Quantitative RT-PCR, Mouse Assay

37) Product Images from "The Expression of Sphingosine Kinase-1 in Head and Neck Carcinoma"

Article Title: The Expression of Sphingosine Kinase-1 in Head and Neck Carcinoma

Journal: Cells, Tissues, Organs

doi: 10.1159/000318173

SPHK1 mRNA expression in OSCC patients. Total RNA was prepared from cancerous or non-malignant epithelial tissues obtained by LCM of samples belonging to 4 OSCC patients, reverse-transcribed and subjected to qRT-PCR using oligonucleotide primers specific
Figure Legend Snippet: SPHK1 mRNA expression in OSCC patients. Total RNA was prepared from cancerous or non-malignant epithelial tissues obtained by LCM of samples belonging to 4 OSCC patients, reverse-transcribed and subjected to qRT-PCR using oligonucleotide primers specific

Techniques Used: Expressing, Laser Capture Microdissection, Quantitative RT-PCR

38) Product Images from "Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis"

Article Title: Dachsous1b cadherin regulates actin and microtubule cytoskeleton during early zebrafish embryogenesis

Journal: Development (Cambridge, England)

doi: 10.1242/dev.119800

Spatiotemporal expression and mutations in zebrafish dchs genes leading to pleiotropic defects during embryogenesis. (A) qRT-PCR analysis of the expression of all three zebrafish dchs genes at maternal and zygotic stages normalized to gapdh transcripts.
Figure Legend Snippet: Spatiotemporal expression and mutations in zebrafish dchs genes leading to pleiotropic defects during embryogenesis. (A) qRT-PCR analysis of the expression of all three zebrafish dchs genes at maternal and zygotic stages normalized to gapdh transcripts.

Techniques Used: Expressing, Quantitative RT-PCR

39) Product Images from "LSD1-mediated enhancer silencing attenuates retinoic acid signalling during pancreatic endocrine cell development"

Article Title: LSD1-mediated enhancer silencing attenuates retinoic acid signalling during pancreatic endocrine cell development

Journal: Nature Communications

doi: 10.1038/s41467-020-16017-x

Endocrine cell formation requires LSD1 activity during a short window in early pancreatic development. a Schematic of the human embryonic stem cell (hESC) differentiation protocol to the endocrine cell stage (EN) and experimental plan for LSD1 inhibition. b Immunofluorescent staining for pancreatic hormones insulin (INS), glucagon (GCG) and somatostatin (SST) or PDX1 and NKX6.1 in control EN cells compared to EN cells with early (LSD1i early ) and late (LSD1i late ) LSD1 inhibition (representative images, n = 10 independent differentiations). Scale bar, 50 µm. c qRT-PCR analysis for INS , GCG and SST in control, LSD1i early and LSD1i late EN cells. Data are shown as mean ± S.E.M. ( n = 3 replicates from independent differentiations with n = 3 technical replicates per sample; source data are provided as a Source Data file). P = 7.93 e−4, 1.42 e−2, 2.32 e−4, 8.71 e−4, 3.5 e−2, and 1.52 e−3, respectively, Student’s t -test, 2 sided. d Flow cytometry analysis at EN stage for NKX6.1, PDX1 and INS comparing control, LSD1i early and LSD1i late cells. Isotype control for each antibody is shown in red and target protein staining in green. Percentage of cells expressing each protein is indicated (representative experiment, n = 2 independent differentiations). D, day; AA, activin A; ITS, insulin-transferrin-selenium; TGFBi, TGFβ R1 kinase inhibitor; KC, KAAD-cyclopamine; KGF, keratinocyte growth factor; RA, retinoic acid; EGF, epidermal growth factor; ES, human embryonic stem cells; DE, definitive endoderm; GT, primitive gut tube; PP1, early pancreatic progenitors; PP2, late pancreatic progenitors; EN, endocrine cell stage; FSC-A, forward scatter area.
Figure Legend Snippet: Endocrine cell formation requires LSD1 activity during a short window in early pancreatic development. a Schematic of the human embryonic stem cell (hESC) differentiation protocol to the endocrine cell stage (EN) and experimental plan for LSD1 inhibition. b Immunofluorescent staining for pancreatic hormones insulin (INS), glucagon (GCG) and somatostatin (SST) or PDX1 and NKX6.1 in control EN cells compared to EN cells with early (LSD1i early ) and late (LSD1i late ) LSD1 inhibition (representative images, n = 10 independent differentiations). Scale bar, 50 µm. c qRT-PCR analysis for INS , GCG and SST in control, LSD1i early and LSD1i late EN cells. Data are shown as mean ± S.E.M. ( n = 3 replicates from independent differentiations with n = 3 technical replicates per sample; source data are provided as a Source Data file). P = 7.93 e−4, 1.42 e−2, 2.32 e−4, 8.71 e−4, 3.5 e−2, and 1.52 e−3, respectively, Student’s t -test, 2 sided. d Flow cytometry analysis at EN stage for NKX6.1, PDX1 and INS comparing control, LSD1i early and LSD1i late cells. Isotype control for each antibody is shown in red and target protein staining in green. Percentage of cells expressing each protein is indicated (representative experiment, n = 2 independent differentiations). D, day; AA, activin A; ITS, insulin-transferrin-selenium; TGFBi, TGFβ R1 kinase inhibitor; KC, KAAD-cyclopamine; KGF, keratinocyte growth factor; RA, retinoic acid; EGF, epidermal growth factor; ES, human embryonic stem cells; DE, definitive endoderm; GT, primitive gut tube; PP1, early pancreatic progenitors; PP2, late pancreatic progenitors; EN, endocrine cell stage; FSC-A, forward scatter area.

Techniques Used: Activity Assay, Inhibition, Staining, Quantitative RT-PCR, Flow Cytometry, Expressing

40) Product Images from "MiR-16-5p regulates postmenopausal osteoporosis by directly targeting VEGFA"

Article Title: MiR-16-5p regulates postmenopausal osteoporosis by directly targeting VEGFA

Journal: Aging (Albany NY)

doi: 10.18632/aging.103223

High miR-16-5p levels inhibit osteogenic differentiation in osteoporosis patients and hMSCs. ( A ) QRT-PCR analysis of miR-16-5p levels in postmenopausal patients with or without osteoporosis (n=10 per group). ( B ) QRT-PCR analysis of miR-16-5p levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p is shown. ( C ) QRT-PCR analysis shows the relative expression of osteogenic marker genes, ALP, OCN and RUNX2, in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p. ( D , E ) Alizarin red staining shows calcium deposition in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p for 21 days. Scale bar = 10 mm. Note: The data are represented as means ± SD. *p
Figure Legend Snippet: High miR-16-5p levels inhibit osteogenic differentiation in osteoporosis patients and hMSCs. ( A ) QRT-PCR analysis of miR-16-5p levels in postmenopausal patients with or without osteoporosis (n=10 per group). ( B ) QRT-PCR analysis of miR-16-5p levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p is shown. ( C ) QRT-PCR analysis shows the relative expression of osteogenic marker genes, ALP, OCN and RUNX2, in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p. ( D , E ) Alizarin red staining shows calcium deposition in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p for 21 days. Scale bar = 10 mm. Note: The data are represented as means ± SD. *p

Techniques Used: Quantitative RT-PCR, Transfection, Expressing, Marker, Staining

miR-16-5p directly targets VEGFA. ( A ) QRT-PCR analysis of VEGFA levels in postmenopausal patients with or without osteoporosis (n=10 per group). ( B , C ) Dual luciferase reporter assay results show firefly luciferase activity relative to Renilla luciferase activity in hMSCs transfected with dual luciferase vectors containing VEGFA-WT-3’UTR or VEGFA-MUT-3’UTR and miR-16-5p agonist (agomiR-16-5p) or negative control (agomiR-NC). ( D ) QRT-PCR analysis shows relative VEGFA mRNA levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p. ( E ) Western blotting analysis shows relative VEGFA protein levels expression in hMSCs transfected with siRNA-NC, and siRNA-VEGFA. ( F ) QRT-PCR analysis shows relative expression of osteogenic marker genes, ALP, OCN and RUNX2, in hMSCs transfected with siRNA-NC, and siRNA-VEGFA. ( G , H ) Alizarin red staining shows calcium deposition in hMSCs transfected with siRNA-NC, and siRNA-VEGFA for 21 days. Scale bar = 10 mm. The data are means ± SD. *p
Figure Legend Snippet: miR-16-5p directly targets VEGFA. ( A ) QRT-PCR analysis of VEGFA levels in postmenopausal patients with or without osteoporosis (n=10 per group). ( B , C ) Dual luciferase reporter assay results show firefly luciferase activity relative to Renilla luciferase activity in hMSCs transfected with dual luciferase vectors containing VEGFA-WT-3’UTR or VEGFA-MUT-3’UTR and miR-16-5p agonist (agomiR-16-5p) or negative control (agomiR-NC). ( D ) QRT-PCR analysis shows relative VEGFA mRNA levels in control hMSCs and hMSCs transfected with agomiR-NC, agomiR-16-5p, antagomiR-NC, and antagomiR-16-5p. ( E ) Western blotting analysis shows relative VEGFA protein levels expression in hMSCs transfected with siRNA-NC, and siRNA-VEGFA. ( F ) QRT-PCR analysis shows relative expression of osteogenic marker genes, ALP, OCN and RUNX2, in hMSCs transfected with siRNA-NC, and siRNA-VEGFA. ( G , H ) Alizarin red staining shows calcium deposition in hMSCs transfected with siRNA-NC, and siRNA-VEGFA for 21 days. Scale bar = 10 mm. The data are means ± SD. *p

Techniques Used: Quantitative RT-PCR, Luciferase, Reporter Assay, Activity Assay, Transfection, Negative Control, Western Blot, Expressing, Marker, Staining

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Maternal Stress Induces Epigenetic Signatures of Psychiatric and Neurological Diseases in the Offspring
Article Snippet: .. The generation of cDNAs from the total RNA samples was performed using M-MuLV Reverse Transcriptase, NEB#M0253S (New England Biolab, Ipswich, MA; see for RT primers). qRT-PCR reactions were conducted with Bio-Rad CFX96™ Real-Time PCR Systems, using SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON) reaction premix added to the cDNAs templates and specific primers, according to the manufacturer’s protocol (see for primer reference). .. A total volume of 12 µl was used, with 2.5 µl of cDNA template, 400 nM forward primer, 400 nM reverse primer, and 6 µl of SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON).

Article Title: Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves
Article Snippet: .. Melting curve analysis was performed for each primer pair prior to further analyses. qRT-PCR reactions were performed with the SYBR Green Real Master Mix (Bio-RAD, Foster, CA, USA) in the ABI 7500 fast Real-Time PCR system (Applied Biosystems, Foster, CA, USA). .. The expression level was calculated using our protocol . qRT-PCR results were obtained from three biological replicates and three technical repeats for each gene and sample.

Article Title: In TCR-Stimulated T-cells, N-ras Regulates Specific Genes and Signal Transduction Pathways
Article Snippet: .. All qRT-PCR reactions used the iQ SYBR Green Supermix (Biorad) and were performed in a Biorad iCycler, which was coupled to a Biorad MyiQ Single Color Real-Time PCR Detection System. .. The qRT-PCR primers used for testing candidate genes from the microarray are listed in .

Isolation:

Article Title: OTUB1 enhances TGF? signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3
Article Snippet: .. Complementary DNA was made from 1 μg of the isolated RNA using the I-Script cDNA kit (Bio-Rad) according to the manufacturer’s protocol. qRT-PCR reactions were performed in quadruplicates according to the manufacturer’s protocol in a CFX 384 Real-time System qRT-PCR machine (Bio-Rad). .. All primers were designed using PerlPrimer and were purchased from Invitrogen.

SYBR Green Assay:

Article Title: Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells
Article Snippet: .. All reagents were purchased from Invitrogen, UK. qRT-PCR reactions were assembled containing 2 µl cDNA diluted 100 fold using molecular biology grade ddH2 O, 0.5 µl sense primer (100 µM), 0.5 µl antisense primer (100 µM), 7.5 µl Sybr green single tube PCR master mix (Bio-Rad, UK) and 4.5 µl molecular biology grade ddH2 O. Primers for gene of interest (CD90) and reference gene (β-actin) were designed in house. (CD90 sense: CTGCTGAGCCTTTGTGGAC , anti-sense; GCATCTTTATTGAGTGTG , TA: 50.1°C. β-actin: sense; GGGACCTGACTGACTACCTC , anti-sense; GCCATCTCTTGCTCGAAG , TA: 53.9°C). .. For all qRT-PCR reactions n = 3/sample.

Article Title: HDAC inhibition ameliorates cone survival in retinitis pigmentosa mice
Article Snippet: .. RNA extractions were performed using an RNeasy Micro Kit (Qiagen), followed by cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen). qRT-PCR reactions were performed in technical duplicates of 4 biological samples of TSA-treated and control retinas, on BioRad CFX96 real-time system using QuantiTect SYBR Green PCR Kit (Qiagen) along with gene specific forward (fwd) and reverse (rev) primers (250 nM). ..

Article Title: Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves
Article Snippet: .. Melting curve analysis was performed for each primer pair prior to further analyses. qRT-PCR reactions were performed with the SYBR Green Real Master Mix (Bio-RAD, Foster, CA, USA) in the ABI 7500 fast Real-Time PCR system (Applied Biosystems, Foster, CA, USA). .. The expression level was calculated using our protocol . qRT-PCR results were obtained from three biological replicates and three technical repeats for each gene and sample.

Article Title: In TCR-Stimulated T-cells, N-ras Regulates Specific Genes and Signal Transduction Pathways
Article Snippet: .. All qRT-PCR reactions used the iQ SYBR Green Supermix (Biorad) and were performed in a Biorad iCycler, which was coupled to a Biorad MyiQ Single Color Real-Time PCR Detection System. .. The qRT-PCR primers used for testing candidate genes from the microarray are listed in .

Quantitative RT-PCR:

Article Title: OTUB1 enhances TGF? signalling by inhibiting the ubiquitylation and degradation of active SMAD2/3
Article Snippet: .. Complementary DNA was made from 1 μg of the isolated RNA using the I-Script cDNA kit (Bio-Rad) according to the manufacturer’s protocol. qRT-PCR reactions were performed in quadruplicates according to the manufacturer’s protocol in a CFX 384 Real-time System qRT-PCR machine (Bio-Rad). .. All primers were designed using PerlPrimer and were purchased from Invitrogen.

Article Title: Maternal Stress Induces Epigenetic Signatures of Psychiatric and Neurological Diseases in the Offspring
Article Snippet: .. The generation of cDNAs from the total RNA samples was performed using M-MuLV Reverse Transcriptase, NEB#M0253S (New England Biolab, Ipswich, MA; see for RT primers). qRT-PCR reactions were conducted with Bio-Rad CFX96™ Real-Time PCR Systems, using SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON) reaction premix added to the cDNAs templates and specific primers, according to the manufacturer’s protocol (see for primer reference). .. A total volume of 12 µl was used, with 2.5 µl of cDNA template, 400 nM forward primer, 400 nM reverse primer, and 6 µl of SsoFast™ EvaGreen® Supermix (Bio-Rad, Mississauga, ON).

Article Title: Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells
Article Snippet: .. All reagents were purchased from Invitrogen, UK. qRT-PCR reactions were assembled containing 2 µl cDNA diluted 100 fold using molecular biology grade ddH2 O, 0.5 µl sense primer (100 µM), 0.5 µl antisense primer (100 µM), 7.5 µl Sybr green single tube PCR master mix (Bio-Rad, UK) and 4.5 µl molecular biology grade ddH2 O. Primers for gene of interest (CD90) and reference gene (β-actin) were designed in house. (CD90 sense: CTGCTGAGCCTTTGTGGAC , anti-sense; GCATCTTTATTGAGTGTG , TA: 50.1°C. β-actin: sense; GGGACCTGACTGACTACCTC , anti-sense; GCCATCTCTTGCTCGAAG , TA: 53.9°C). .. For all qRT-PCR reactions n = 3/sample.

Article Title: HDAC inhibition ameliorates cone survival in retinitis pigmentosa mice
Article Snippet: .. RNA extractions were performed using an RNeasy Micro Kit (Qiagen), followed by cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen). qRT-PCR reactions were performed in technical duplicates of 4 biological samples of TSA-treated and control retinas, on BioRad CFX96 real-time system using QuantiTect SYBR Green PCR Kit (Qiagen) along with gene specific forward (fwd) and reverse (rev) primers (250 nM). ..

Article Title: Physiological and transcriptomic analyses reveal a response mechanism to cold stress in Santalum album L. leaves
Article Snippet: .. Melting curve analysis was performed for each primer pair prior to further analyses. qRT-PCR reactions were performed with the SYBR Green Real Master Mix (Bio-RAD, Foster, CA, USA) in the ABI 7500 fast Real-Time PCR system (Applied Biosystems, Foster, CA, USA). .. The expression level was calculated using our protocol . qRT-PCR results were obtained from three biological replicates and three technical repeats for each gene and sample.

Article Title: In TCR-Stimulated T-cells, N-ras Regulates Specific Genes and Signal Transduction Pathways
Article Snippet: .. All qRT-PCR reactions used the iQ SYBR Green Supermix (Biorad) and were performed in a Biorad iCycler, which was coupled to a Biorad MyiQ Single Color Real-Time PCR Detection System. .. The qRT-PCR primers used for testing candidate genes from the microarray are listed in .

Article Title: Non-digestible oligosaccharides directly regulate host kinome to modulate host inflammatory responses without alterations in the gut microbiota
Article Snippet: .. All extracted RNA samples were standardized to 50 ng/μl and reverse-transcribed to cDNA samples using iScript cDNA synthesis system (Bio-Rad, Hercules, CA) as described previously [ ]. qRT-PCR reactions were performed on a CFX96 C1000 Thermal Cycler (Bio-Rad) using Ssofast Evagreen Supermix (Bio-Rad). ..

Article Title: Comparative transcriptome provides molecular insight into defense-associated mechanisms against spider mite in resistant and susceptible common bean cultivars
Article Snippet: .. The 20 μL qRT-PCR solutions contained EvaGreen Master Mix (Solis Biodyne, 5x), 0.3 μL forward and 0.3 μL reverse primers, and 30 ng of cDNA template. qRT-PCR reactions (95 °C, 3 min; 95 °C, 5 s; 60 °C, 34 s; 40 cycles) were carried out on a Bio-Rad iQ5 Optical System (Bio-Rad Laboratories, CA, USA). .. Finally, relative gene expression was calculated using 2-ΔΔCT formula and REST software [ ].

Polymerase Chain Reaction:

Article Title: Evaluation of a Novel Non-Destructive Catch and Release Technology for Harvesting Autologous Adult Stem Cells
Article Snippet: .. All reagents were purchased from Invitrogen, UK. qRT-PCR reactions were assembled containing 2 µl cDNA diluted 100 fold using molecular biology grade ddH2 O, 0.5 µl sense primer (100 µM), 0.5 µl antisense primer (100 µM), 7.5 µl Sybr green single tube PCR master mix (Bio-Rad, UK) and 4.5 µl molecular biology grade ddH2 O. Primers for gene of interest (CD90) and reference gene (β-actin) were designed in house. (CD90 sense: CTGCTGAGCCTTTGTGGAC , anti-sense; GCATCTTTATTGAGTGTG , TA: 50.1°C. β-actin: sense; GGGACCTGACTGACTACCTC , anti-sense; GCCATCTCTTGCTCGAAG , TA: 53.9°C). .. For all qRT-PCR reactions n = 3/sample.

Article Title: HDAC inhibition ameliorates cone survival in retinitis pigmentosa mice
Article Snippet: .. RNA extractions were performed using an RNeasy Micro Kit (Qiagen), followed by cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen). qRT-PCR reactions were performed in technical duplicates of 4 biological samples of TSA-treated and control retinas, on BioRad CFX96 real-time system using QuantiTect SYBR Green PCR Kit (Qiagen) along with gene specific forward (fwd) and reverse (rev) primers (250 nM). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Bio-Rad qrt pcr analysis
    Validation of RNA-seq results by <t>qRT-PCR.</t> Left and right y-axes indicate FPKM values from RNA-seq (blue bar) and relative transcript abundance from qRT-PCR (orange bar). D and S on the x-axis represent Daewonkong and SS0903-2B-21-1-2, respectively. Bars indicate means and standard deviation of three biological replicates. Asterisk above each bar indicates statistical difference between genotypes, as determined by Student’s t-test ( p
    Qrt Pcr Analysis, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 498 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/Bio-Rad
    Average 94 stars, based on 498 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    91
    Bio-Rad ddh2 o qrt pcr
    <t>qRT-PCR</t> results of expression of the JH related genes. The expression patterns of 8 genes related to JH in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.
    Ddh2 O Qrt Pcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ddh2 o qrt pcr/product/Bio-Rad
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ddh2 o qrt pcr - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    Bio-Rad qrt rtpcr
    Genotoxic agents induce TP73 expression and apoptosis in medulloblastoma cell lines . (A) Chemotherapeutic agents (cisplatin (CDDP) 1 µM, etoposide (VP-16) 10 µM, and doxorubicin (DOXO) 1 µM) induce TP73 expression in Daoy cells, especially ΔN’p73 species, as determined by <t>qRT-RTPCR</t> normalized to GAPDH expression. (B) CDDP-treated (1, 5, and 25 µM) D283 cells display induction of TP53 and TP73 RNA expression (including ΔN’p73 species) - similar to results observed in CDDP-treated Daoy cells. Western immunoblots reveal that (C) Daoy cells and (D) D283 cells transiently transfected with p53-GFP expression plasmid increase expression of tagged p53-GFP protein (at a higher apparent molecular weight than native p53), as well as the p53/p73 target, p21 Waf1 (arrows, upper panels) . Treatment with etoposide (VP-16, 1.5 µM) stabilizes wild-type p53 protein. Transient transfection with either TAp73 or ΔNp73 expression plasmids also increased respective protein levels, normalized to ß-actin loading control. (arrows lower panels).
    Qrt Rtpcr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt rtpcr/product/Bio-Rad
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    qrt rtpcr - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Validation of RNA-seq results by qRT-PCR. Left and right y-axes indicate FPKM values from RNA-seq (blue bar) and relative transcript abundance from qRT-PCR (orange bar). D and S on the x-axis represent Daewonkong and SS0903-2B-21-1-2, respectively. Bars indicate means and standard deviation of three biological replicates. Asterisk above each bar indicates statistical difference between genotypes, as determined by Student’s t-test ( p

    Journal: Scientific Reports

    Article Title: Comprehensive RNA sequencing and co-expression network analysis to complete the biosynthetic pathway of coumestrol, a phytoestrogen

    doi: 10.1038/s41598-018-38219-6

    Figure Lengend Snippet: Validation of RNA-seq results by qRT-PCR. Left and right y-axes indicate FPKM values from RNA-seq (blue bar) and relative transcript abundance from qRT-PCR (orange bar). D and S on the x-axis represent Daewonkong and SS0903-2B-21-1-2, respectively. Bars indicate means and standard deviation of three biological replicates. Asterisk above each bar indicates statistical difference between genotypes, as determined by Student’s t-test ( p

    Article Snippet: qRT-PCR validation of DEGs Gene-specific primers for qRT-PCR analysis were designed based on the nucleotide sequences of selected DEGs using Primer3 ( http://primer3plus.com/ ) (Supplementary Table ). cDNA was synthesized using an iScript™ cDNA Synthesis Kit (Cat. 170-8891; Bio-Rad, Hercules, CA, USA). qRT-PCR was conducted using an iQ™ SYBR Green Supermix kit (Cat. 170-8882; Bio-Rad) on a LightCycler® 480 (Roche Diagnostics, Laval, QC, Canada).

    Techniques: RNA Sequencing Assay, Quantitative RT-PCR, Standard Deviation

    Genetic organization of flhBAFG and fliA genes, and flhF gene expression at 28°C. A . Genetic organization and transcriptional units of flhBAFG and fliA , with arrows showing the direction of transcription. Recognition sites for Eco RI and Stu I are indicated by E and S, respectively. Vertical bars on the map denote the positions and orientation of the Tn 3 - gusA insertion. The two lines with arrowheads beneath the restriction enzyme map indicate the direction and extent of transcription. cDNA synthesized by reverse transcriptase with primers RT1 and RT2 was analyzed by PCR. Thick bars indicate the six expected PCR products, which were verified by electrophoresis on 1.5% agarose gel. B . Photographs of swim assay plates showing the swimming motility of the BGR1 mutant fliA ::Tn 3 - gusA45 and complementation with pBGFA carrying the fliA gene at 28°C and 37°C. C . Expression levels of the flhF gene in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9, and the flhC mutant BGF41 at 28°C, based on qRT-PCR analysis. Vertical lines indicate the standard deviations of three independent experiments.

    Journal: PLoS ONE

    Article Title: Quorum Sensing Controls Flagellar Morphogenesis in Burkholderia glumae

    doi: 10.1371/journal.pone.0084831

    Figure Lengend Snippet: Genetic organization of flhBAFG and fliA genes, and flhF gene expression at 28°C. A . Genetic organization and transcriptional units of flhBAFG and fliA , with arrows showing the direction of transcription. Recognition sites for Eco RI and Stu I are indicated by E and S, respectively. Vertical bars on the map denote the positions and orientation of the Tn 3 - gusA insertion. The two lines with arrowheads beneath the restriction enzyme map indicate the direction and extent of transcription. cDNA synthesized by reverse transcriptase with primers RT1 and RT2 was analyzed by PCR. Thick bars indicate the six expected PCR products, which were verified by electrophoresis on 1.5% agarose gel. B . Photographs of swim assay plates showing the swimming motility of the BGR1 mutant fliA ::Tn 3 - gusA45 and complementation with pBGFA carrying the fliA gene at 28°C and 37°C. C . Expression levels of the flhF gene in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9, and the flhC mutant BGF41 at 28°C, based on qRT-PCR analysis. Vertical lines indicate the standard deviations of three independent experiments.

    Article Snippet: For qRT-PCR analysis, the primers of flhC-cDNA, flhF-cDNA, flhC-qRTF, flhC-qRTR, flhF-qRTF, and flhF-qRTR were used ( ). qRT-PCR analysis was performed according to the manufacturer's instructions except using SsoFast™ EvaGreen Supermix (Bio-Rad) with 25 ng of cDNA as template. qRT-PCR was performed using a thermal cycler (Model C1000™; Bio-Rad) under the following conditions: 98°C for 2 min, followed by 35 cycles at 98°C for 20 s, 65°C for 30 s, and 72°C for 30 s. The 16S rRNA gene was used for data normalization.

    Techniques: Expressing, Synthesized, Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis, Mutagenesis, Quantitative RT-PCR

    Expression of flhC and other flagellar genes in the QS mutants at 28°C and 37°C. A . Expression levels of flhC in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9 at 28°C, based on qRT-PCR analysis. Vertical lines indicate the standard deviations of three independent experiments. B . Expression levels of fliC and flgK genes were assessed in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9 at 28°C and 37°C. BGF49, BGR1 fliC ::Tn 3 - gusA49 ; S2F49, BGS2 fliC ::Tn 3 - gusA49 ; S9F49, BGS9 fliC ::Tn 3 - gusA49 ; BGF28, BGR1 flgK ::Tn 3 - gusA28 ; S2F28, BGS2 flgK ::Tn 3 - gusA28 ; S9F28, BGS9 flgK ::Tn 3 - gusA28 .

    Journal: PLoS ONE

    Article Title: Quorum Sensing Controls Flagellar Morphogenesis in Burkholderia glumae

    doi: 10.1371/journal.pone.0084831

    Figure Lengend Snippet: Expression of flhC and other flagellar genes in the QS mutants at 28°C and 37°C. A . Expression levels of flhC in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9 at 28°C, based on qRT-PCR analysis. Vertical lines indicate the standard deviations of three independent experiments. B . Expression levels of fliC and flgK genes were assessed in the wild-type BGR1, the tofI mutant BGS2, and the qsmR mutant BGS9 at 28°C and 37°C. BGF49, BGR1 fliC ::Tn 3 - gusA49 ; S2F49, BGS2 fliC ::Tn 3 - gusA49 ; S9F49, BGS9 fliC ::Tn 3 - gusA49 ; BGF28, BGR1 flgK ::Tn 3 - gusA28 ; S2F28, BGS2 flgK ::Tn 3 - gusA28 ; S9F28, BGS9 flgK ::Tn 3 - gusA28 .

    Article Snippet: For qRT-PCR analysis, the primers of flhC-cDNA, flhF-cDNA, flhC-qRTF, flhC-qRTR, flhF-qRTF, and flhF-qRTR were used ( ). qRT-PCR analysis was performed according to the manufacturer's instructions except using SsoFast™ EvaGreen Supermix (Bio-Rad) with 25 ng of cDNA as template. qRT-PCR was performed using a thermal cycler (Model C1000™; Bio-Rad) under the following conditions: 98°C for 2 min, followed by 35 cycles at 98°C for 20 s, 65°C for 30 s, and 72°C for 30 s. The 16S rRNA gene was used for data normalization.

    Techniques: Expressing, Mutagenesis, Quantitative RT-PCR

    qRT-PCR results of expression of the JH related genes. The expression patterns of 8 genes related to JH in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

    Journal: Scientific Reports

    Article Title: Transcriptomic analysis of the prothoracic gland from two lepidopteran insects, domesticated silkmoth Bombyx mori and wild silkmoth Antheraea pernyi

    doi: 10.1038/s41598-019-41864-0

    Figure Lengend Snippet: qRT-PCR results of expression of the JH related genes. The expression patterns of 8 genes related to JH in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

    Article Snippet: The total volume of qRT-PCR reactions was 10 µl, containing 3.6 µl of TB Green Premix Ex Taq (TaKaRa), 0.4 µl of specific primers (10 µM), 1 µl of cDNA and 5 µl of ddH2 O. qRT-PCR was performed with a BIO-RAD CFX Connect Real-Time System, and the conditions were as follows: 95 °C for 30 s followed by 40 cycles in 95 °C for 5 s and 60 °C for 30 s. Gene-specific primers used for qRT-PCR analysis are listed in Additional file: Table .

    Techniques: Quantitative RT-PCR, Expressing

    qRT-PCR results of expression of the clock genes. The expression patterns of 12 genes related to clock in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

    Journal: Scientific Reports

    Article Title: Transcriptomic analysis of the prothoracic gland from two lepidopteran insects, domesticated silkmoth Bombyx mori and wild silkmoth Antheraea pernyi

    doi: 10.1038/s41598-019-41864-0

    Figure Lengend Snippet: qRT-PCR results of expression of the clock genes. The expression patterns of 12 genes related to clock in B. mori PG during development in whole fifth larval instar. The relative expression levels were normalized to the Bmrp49 levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR.

    Article Snippet: The total volume of qRT-PCR reactions was 10 µl, containing 3.6 µl of TB Green Premix Ex Taq (TaKaRa), 0.4 µl of specific primers (10 µM), 1 µl of cDNA and 5 µl of ddH2 O. qRT-PCR was performed with a BIO-RAD CFX Connect Real-Time System, and the conditions were as follows: 95 °C for 30 s followed by 40 cycles in 95 °C for 5 s and 60 °C for 30 s. Gene-specific primers used for qRT-PCR analysis are listed in Additional file: Table .

    Techniques: Quantitative RT-PCR, Expressing

    Genotoxic agents induce TP73 expression and apoptosis in medulloblastoma cell lines . (A) Chemotherapeutic agents (cisplatin (CDDP) 1 µM, etoposide (VP-16) 10 µM, and doxorubicin (DOXO) 1 µM) induce TP73 expression in Daoy cells, especially ΔN’p73 species, as determined by qRT-RTPCR normalized to GAPDH expression. (B) CDDP-treated (1, 5, and 25 µM) D283 cells display induction of TP53 and TP73 RNA expression (including ΔN’p73 species) - similar to results observed in CDDP-treated Daoy cells. Western immunoblots reveal that (C) Daoy cells and (D) D283 cells transiently transfected with p53-GFP expression plasmid increase expression of tagged p53-GFP protein (at a higher apparent molecular weight than native p53), as well as the p53/p73 target, p21 Waf1 (arrows, upper panels) . Treatment with etoposide (VP-16, 1.5 µM) stabilizes wild-type p53 protein. Transient transfection with either TAp73 or ΔNp73 expression plasmids also increased respective protein levels, normalized to ß-actin loading control. (arrows lower panels).

    Journal: BMC Cancer

    Article Title: Overexpressed TP73 induces apoptosis in medulloblastoma

    doi: 10.1186/1471-2407-7-127

    Figure Lengend Snippet: Genotoxic agents induce TP73 expression and apoptosis in medulloblastoma cell lines . (A) Chemotherapeutic agents (cisplatin (CDDP) 1 µM, etoposide (VP-16) 10 µM, and doxorubicin (DOXO) 1 µM) induce TP73 expression in Daoy cells, especially ΔN’p73 species, as determined by qRT-RTPCR normalized to GAPDH expression. (B) CDDP-treated (1, 5, and 25 µM) D283 cells display induction of TP53 and TP73 RNA expression (including ΔN’p73 species) - similar to results observed in CDDP-treated Daoy cells. Western immunoblots reveal that (C) Daoy cells and (D) D283 cells transiently transfected with p53-GFP expression plasmid increase expression of tagged p53-GFP protein (at a higher apparent molecular weight than native p53), as well as the p53/p73 target, p21 Waf1 (arrows, upper panels) . Treatment with etoposide (VP-16, 1.5 µM) stabilizes wild-type p53 protein. Transient transfection with either TAp73 or ΔNp73 expression plasmids also increased respective protein levels, normalized to ß-actin loading control. (arrows lower panels).

    Article Snippet: RNA was analyzed by qRT-RTPCR performed with the Bio-Rad iQ4 Multicolor Real-Time iCycler (Bio-Rad Laboratories, Hercules, CA).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, RNA Expression, Western Blot, Transfection, Plasmid Preparation, Molecular Weight

    Primary medulloblastoma specimens and medulloblastoma cell lines overexpress TAp73 and ΔNp73 RNA species relative to TP53 . (A) TP73 gene and relative location of isoform-specific primers for qRT-RTPCR of TP73 . Exons are depicted as boxes with overlying arrows corresponding to location of primers for PCR. (B) Established medulloblastoma cell lines, Daoy and D283MED (D283), and human adult cerebellum (Cbl) express high levels of TAp73 and amino-terminal splice variants encoding ΔNp73 in comparison to human fetal brain. Primary medulloblastoma (MB) samples from patients (n = 34) display similar overexpression of TAp73 and ΔNp73 RNA species. (C) Primary medulloblastoma samples from patients (n = 34) display overexpression of TAp73 and amino-terminal truncated TP73 RNA variants, relative to human fetal brain and normalized to GAPDH expression. By comparison, TP53 RNA is relatively underexpressed. Total ΔNp73 represents the sum of expression of all amino-terminal-truncated TP73 RNA variants (ΔNp73, ΔN'p73, ΔEx2p73, and ΔEx2/3p73). Columns , mean expression of at least 2 experiments; error bars , ± S.E.M. Y-axis , RNA expression relative to human fetal brain and normalized to GAPDH expression (N.B. log-scale).

    Journal: BMC Cancer

    Article Title: Overexpressed TP73 induces apoptosis in medulloblastoma

    doi: 10.1186/1471-2407-7-127

    Figure Lengend Snippet: Primary medulloblastoma specimens and medulloblastoma cell lines overexpress TAp73 and ΔNp73 RNA species relative to TP53 . (A) TP73 gene and relative location of isoform-specific primers for qRT-RTPCR of TP73 . Exons are depicted as boxes with overlying arrows corresponding to location of primers for PCR. (B) Established medulloblastoma cell lines, Daoy and D283MED (D283), and human adult cerebellum (Cbl) express high levels of TAp73 and amino-terminal splice variants encoding ΔNp73 in comparison to human fetal brain. Primary medulloblastoma (MB) samples from patients (n = 34) display similar overexpression of TAp73 and ΔNp73 RNA species. (C) Primary medulloblastoma samples from patients (n = 34) display overexpression of TAp73 and amino-terminal truncated TP73 RNA variants, relative to human fetal brain and normalized to GAPDH expression. By comparison, TP53 RNA is relatively underexpressed. Total ΔNp73 represents the sum of expression of all amino-terminal-truncated TP73 RNA variants (ΔNp73, ΔN'p73, ΔEx2p73, and ΔEx2/3p73). Columns , mean expression of at least 2 experiments; error bars , ± S.E.M. Y-axis , RNA expression relative to human fetal brain and normalized to GAPDH expression (N.B. log-scale).

    Article Snippet: RNA was analyzed by qRT-RTPCR performed with the Bio-Rad iQ4 Multicolor Real-Time iCycler (Bio-Rad Laboratories, Hercules, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Over Expression, Expressing, RNA Expression