qrt pcr primers  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher qrt pcr primers
    Th2 cytokines suppress pro-caspase-1 without affecting levels of pro-IL-1β. (A) Taqman quantitative <t>RT-PCR</t> results showing mRNA expression of pro-IL-1β in THP-1s exposed to 100 μg/mL MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. B) Taqman <t>qRT-PCR</t> results showing mRNA levels of pro-caspase-1 in THP-1s exposed to MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. Statistical analysis was performed using a one-way ANOVA with a post hoc Tukey. ***P
    Qrt Pcr Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr primers/product/Thermo Fisher
    Average 99 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    qrt pcr primers - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1"

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0128888

    Th2 cytokines suppress pro-caspase-1 without affecting levels of pro-IL-1β. (A) Taqman quantitative RT-PCR results showing mRNA expression of pro-IL-1β in THP-1s exposed to 100 μg/mL MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. B) Taqman qRT-PCR results showing mRNA levels of pro-caspase-1 in THP-1s exposed to MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. Statistical analysis was performed using a one-way ANOVA with a post hoc Tukey. ***P
    Figure Legend Snippet: Th2 cytokines suppress pro-caspase-1 without affecting levels of pro-IL-1β. (A) Taqman quantitative RT-PCR results showing mRNA expression of pro-IL-1β in THP-1s exposed to 100 μg/mL MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. B) Taqman qRT-PCR results showing mRNA levels of pro-caspase-1 in THP-1s exposed to MWCNTs with IL-4, IL-13, or IL-4 and IL-13 co-treatment. Statistical analysis was performed using a one-way ANOVA with a post hoc Tukey. ***P

    Techniques Used: Quantitative RT-PCR, Expressing

    2) Product Images from "Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity"

    Article Title: Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.1003115

    Production time course of bat type I and III IFNs on polyI:C transfection in the bat lung PaLuT02 cell line. Cells were stimulated with polyI:C and collected at the indicated time points. IFN-λ mRNA was measured by qRT-PCR. The data were normalized against the housekeeping gene 18s rRNA.
    Figure Legend Snippet: Production time course of bat type I and III IFNs on polyI:C transfection in the bat lung PaLuT02 cell line. Cells were stimulated with polyI:C and collected at the indicated time points. IFN-λ mRNA was measured by qRT-PCR. The data were normalized against the housekeeping gene 18s rRNA.

    Techniques Used: Transfection, Quantitative RT-PCR

    Expression of type I and type III IFNs on polyI:C stimulation in fresh bat splenocytes. The fresh splenocytes were treated ( A ) or transfected ( B ) with 10 μg/ml polyI:C and collected at the indicated time points. IFN mRNA was measured in qRT-PCR and normalized against the housekeeping gene GAPDH. The data shown represent the mean of two and three individual bats, respectively, for the treated and transfected cells, and the error bars indicate SDs.
    Figure Legend Snippet: Expression of type I and type III IFNs on polyI:C stimulation in fresh bat splenocytes. The fresh splenocytes were treated ( A ) or transfected ( B ) with 10 μg/ml polyI:C and collected at the indicated time points. IFN mRNA was measured in qRT-PCR and normalized against the housekeeping gene GAPDH. The data shown represent the mean of two and three individual bats, respectively, for the treated and transfected cells, and the error bars indicate SDs.

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR

    Expression of type I and type III IFNs on polyI:C stimulation in bat primary cell lines. Primary cell lines from lung ( A ), liver ( B ), heart ( C ), kidney ( D ), small intestine ( E ), brain ( F ), and salivary gland ( G ) were stimulated with 33 μg/ml polyI:C for 3 h. IFN mRNA was measured by qRT-PCR and normalized against 18s RNA. A–G , Data are mean values of two separate experiments, and the error bars represent SEs.
    Figure Legend Snippet: Expression of type I and type III IFNs on polyI:C stimulation in bat primary cell lines. Primary cell lines from lung ( A ), liver ( B ), heart ( C ), kidney ( D ), small intestine ( E ), brain ( F ), and salivary gland ( G ) were stimulated with 33 μg/ml polyI:C for 3 h. IFN mRNA was measured by qRT-PCR and normalized against 18s RNA. A–G , Data are mean values of two separate experiments, and the error bars represent SEs.

    Techniques Used: Expressing, Quantitative RT-PCR

    Expression of type I and III IFNs in fresh bat splenocytes in response to TioPV. Fresh splenocytes from four individual bats (bats 1–4) were challenged with TioPV for 3 h at a multiplicity of infection 0.1. The cellular RNA was extracted and IFN mRNA level was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the virus challenged and mock challenge group. The gene expression level had been normalized against GAPDH.
    Figure Legend Snippet: Expression of type I and III IFNs in fresh bat splenocytes in response to TioPV. Fresh splenocytes from four individual bats (bats 1–4) were challenged with TioPV for 3 h at a multiplicity of infection 0.1. The cellular RNA was extracted and IFN mRNA level was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the virus challenged and mock challenge group. The gene expression level had been normalized against GAPDH.

    Techniques Used: Expressing, Infection, Quantitative RT-PCR

    Bat IFN-λ2 displays IFN-λike activities. A , Protection of bat PaFeT05 cells from PulV infection after pretreatment with bat IFN-λ2. Cells were treated with 1:2, 1:4, 1:8, and 1:16 diluted IFN-λ2 containing (or 1:2 diluted mock containing) 293T cell medium for 24 h and then infected with PulV for another 24 h. PulV replication levels were determined by measurement of PulV in the supernatant by TCID 50 . B , Induction of ISGs by bat IFN-λ2 in cloned PaFeT05 cells. The cells were stimulated with 1:2 diluted IFN-λ2 containing (or mock containing) 293T cell medium for 6 h. The cellular RNA was extracted and mRNA level of ISG56 and RIG-I was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the IFN-λ2 stimulated and normal 293T culture medium. The gene expression level had been normalized against GAPDH.
    Figure Legend Snippet: Bat IFN-λ2 displays IFN-λike activities. A , Protection of bat PaFeT05 cells from PulV infection after pretreatment with bat IFN-λ2. Cells were treated with 1:2, 1:4, 1:8, and 1:16 diluted IFN-λ2 containing (or 1:2 diluted mock containing) 293T cell medium for 24 h and then infected with PulV for another 24 h. PulV replication levels were determined by measurement of PulV in the supernatant by TCID 50 . B , Induction of ISGs by bat IFN-λ2 in cloned PaFeT05 cells. The cells were stimulated with 1:2 diluted IFN-λ2 containing (or mock containing) 293T cell medium for 6 h. The cellular RNA was extracted and mRNA level of ISG56 and RIG-I was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the IFN-λ2 stimulated and normal 293T culture medium. The gene expression level had been normalized against GAPDH.

    Techniques Used: Infection, Clone Assay, Quantitative RT-PCR, Expressing

    3) Product Images from "The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿"

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00112-09

    NAPRT1 status of human tumor cell lines. (A) Frequency of rescue from GMX1778 cytotoxicity (30 nM) by 10 μM NA or 10 μM NAMN in a panel of human tumor cell lines. Cytotoxicity was measured at 72 h. (B) NAPRT1 mRNA levels measured by qRT-PCR and normalized to GAPDH mRNA expression. Statistical significance was determined by Student's t test with Welch's correction; P values are indicated. (C) Western blot of NAPRT1 protein expression in cytosolic extracts (30 μg) from human tumor cell lines that were rescued or not rescued from GMX1778 cytotoxicity by NA as indicated.
    Figure Legend Snippet: NAPRT1 status of human tumor cell lines. (A) Frequency of rescue from GMX1778 cytotoxicity (30 nM) by 10 μM NA or 10 μM NAMN in a panel of human tumor cell lines. Cytotoxicity was measured at 72 h. (B) NAPRT1 mRNA levels measured by qRT-PCR and normalized to GAPDH mRNA expression. Statistical significance was determined by Student's t test with Welch's correction; P values are indicated. (C) Western blot of NAPRT1 protein expression in cytosolic extracts (30 μg) from human tumor cell lines that were rescued or not rescued from GMX1778 cytotoxicity by NA as indicated.

    Techniques Used: Quantitative RT-PCR, Expressing, Western Blot

    NAPRT1 mRNA and protein expression in primary human tumor tissues. (A) Comparison of NAPRT1 mRNA levels in normal tissue to levels in malignant tissue of the same origin. Levels of NAPRT1 mRNA from normal, carcinoma, brain, normal brain, glioblastoma, oligodendroglioma, and neuroblastoma frozen tissue samples were measured by qRT-PCR. Values were normalized to ribosomal protein-large P0 mRNA levels; solid bars indicate the means. Statistical significance was determined by Student's t test with Welch's correction; P values are indicated. (B) Immunohistochemical detection of NAPRT1 protein in lung, glioblastoma, and neuroblastoma tumor tissue sections. Upper panel, sections (5 μm) were stained with a rabbit polyclonal NAPRT1 antibody. Lower panel, sequential sections were stained with hematoxylin and eosin (H E) to reveal cellular structures. Scale bars, 100 μm.
    Figure Legend Snippet: NAPRT1 mRNA and protein expression in primary human tumor tissues. (A) Comparison of NAPRT1 mRNA levels in normal tissue to levels in malignant tissue of the same origin. Levels of NAPRT1 mRNA from normal, carcinoma, brain, normal brain, glioblastoma, oligodendroglioma, and neuroblastoma frozen tissue samples were measured by qRT-PCR. Values were normalized to ribosomal protein-large P0 mRNA levels; solid bars indicate the means. Statistical significance was determined by Student's t test with Welch's correction; P values are indicated. (B) Immunohistochemical detection of NAPRT1 protein in lung, glioblastoma, and neuroblastoma tumor tissue sections. Upper panel, sections (5 μm) were stained with a rabbit polyclonal NAPRT1 antibody. Lower panel, sequential sections were stained with hematoxylin and eosin (H E) to reveal cellular structures. Scale bars, 100 μm.

    Techniques Used: Expressing, Quantitative RT-PCR, Immunohistochemistry, Staining

    4) Product Images from "Long lasting transcriptional refractoriness triggered by a single exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrimidine"

    Article Title: Long lasting transcriptional refractoriness triggered by a single exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrimidine

    Journal: Neuroscience

    doi: 10.1016/j.neuroscience.2012.03.047

    Quantitative assessment of Cdkn1a mRNA changes in the striatum of C57BL/6J mice treated with the subchronic MPTP regimen MPTP-sensitive C57BL/6J mice were injected according to the schematic shown on the top of the bar graph. Animals were injected daily with a single dose of 40 mg/kg MPTP and sacrificed 5 or 24 hr after each injection. Control animals were injected with saline (white bar). Levels of mRNA for Cdkn1a were determined by qRT-PCR using the ΔΔCt relative expression method. Data are presented as mean ± S.E.M. of 10 animals for each condition. Differences versus control (white bar) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Quantitative assessment of Cdkn1a mRNA changes in the striatum of C57BL/6J mice treated with the subchronic MPTP regimen MPTP-sensitive C57BL/6J mice were injected according to the schematic shown on the top of the bar graph. Animals were injected daily with a single dose of 40 mg/kg MPTP and sacrificed 5 or 24 hr after each injection. Control animals were injected with saline (white bar). Levels of mRNA for Cdkn1a were determined by qRT-PCR using the ΔΔCt relative expression method. Data are presented as mean ± S.E.M. of 10 animals for each condition. Differences versus control (white bar) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR, Expressing

    Comparison of the MPTP-induced refractory state between MPTP-sensitive C57BL/6J and MPTP-resistant SWR strains of mice C57BL/6J and SWR mice were injected with either 30 mg/kg MPTP or saline (control) on day zero. After 9 days they were injected again with either a single injection of 30 mg/kg MPTP or saline and sacrificed 5, 24 and 72 hour later and striata collected. Levels of mRNA for candidate genes of the intermediate ( Hmox1 , Edg3, Tnfrsf12a and Pdlim4 ) response phase were evaluated by qRT-PCR. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 5 to 6 animals per condition. Differences versus control (S-S) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Comparison of the MPTP-induced refractory state between MPTP-sensitive C57BL/6J and MPTP-resistant SWR strains of mice C57BL/6J and SWR mice were injected with either 30 mg/kg MPTP or saline (control) on day zero. After 9 days they were injected again with either a single injection of 30 mg/kg MPTP or saline and sacrificed 5, 24 and 72 hour later and striata collected. Levels of mRNA for candidate genes of the intermediate ( Hmox1 , Edg3, Tnfrsf12a and Pdlim4 ) response phase were evaluated by qRT-PCR. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 5 to 6 animals per condition. Differences versus control (S-S) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR

    Dose dependency and time course of the latency period caused by a single injection of MPTP Panel A: MPTP-sensitive C57BL/6J mice were injected according to the schematic on the top of the bar graph. Animals received a single injection of MPTP (1, 5, 10, 20 or 40 mg/kg) on day 0. Some animals were sacrificed 24 h later (blue bars) while remaining animals were injected a second time with 40 mg/kg MPTP after 7 days and sacrificed after 24 hours (brown bars). Control animals were injected with saline using the same schedules. Levels of mRNA for Hmox1 were determined by qRT-PCR using the ΔΔCt relative expression method. Data are presented as mean ± S.E.M. of 6 to 9 animals for each condition. Differences versus control (Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Dose dependency and time course of the latency period caused by a single injection of MPTP Panel A: MPTP-sensitive C57BL/6J mice were injected according to the schematic on the top of the bar graph. Animals received a single injection of MPTP (1, 5, 10, 20 or 40 mg/kg) on day 0. Some animals were sacrificed 24 h later (blue bars) while remaining animals were injected a second time with 40 mg/kg MPTP after 7 days and sacrificed after 24 hours (brown bars). Control animals were injected with saline using the same schedules. Levels of mRNA for Hmox1 were determined by qRT-PCR using the ΔΔCt relative expression method. Data are presented as mean ± S.E.M. of 6 to 9 animals for each condition. Differences versus control (Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Injection, Mouse Assay, Quantitative RT-PCR, Expressing

    Comparison of the MPTP-induced refractory state between MPTP-sensitive C57BL/6J and MPTP-resistant SWR strains of mice C57BL/6J and SWR mice were injected with either 30 mg/kg MPTP or saline on day zero. After 9 days they were injected again with either a single injection of 30 mg/kg MPTP or saline and sacrificed 5, 24 and 72 hour later and striata collected. Levels of mRNA for candidate genes of the early ( Cdkn1a , Fosb, Gadd45b and NFkBia ) response phase were evaluated by qRT-PCR. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 5 to 6 animals per condition. Differences versus control (S-S) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Comparison of the MPTP-induced refractory state between MPTP-sensitive C57BL/6J and MPTP-resistant SWR strains of mice C57BL/6J and SWR mice were injected with either 30 mg/kg MPTP or saline on day zero. After 9 days they were injected again with either a single injection of 30 mg/kg MPTP or saline and sacrificed 5, 24 and 72 hour later and striata collected. Levels of mRNA for candidate genes of the early ( Cdkn1a , Fosb, Gadd45b and NFkBia ) response phase were evaluated by qRT-PCR. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 5 to 6 animals per condition. Differences versus control (S-S) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR

    Quantitative assessment of striatal mRNA changes of genes of the early phase in the striatum of C57BL/6J mice previously exposed to 40mg/kg MPTP MPTP sensitive C57BL/6J mice were injected at time zero with a single priming dose of 40 mg/kg MPTP or saline. Mice received a second exposure to either saline or the acute MPTP regimen starting 9 days after the priming injection, and animals were sacrificed and striatum harvested 5 (3 injections), 24 or 72 hours later. Levels of mRNA for candidate genes of the early ( Cdkn1a , NFkBia , FosB , Gadd45b and Nr4a1 ) response phase were evaluated by qRT-PCR using the absolute quantitative method. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 4 (saline-treated) and 3 (MPTP-treated) animals. Differences versus control (Saline-Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Quantitative assessment of striatal mRNA changes of genes of the early phase in the striatum of C57BL/6J mice previously exposed to 40mg/kg MPTP MPTP sensitive C57BL/6J mice were injected at time zero with a single priming dose of 40 mg/kg MPTP or saline. Mice received a second exposure to either saline or the acute MPTP regimen starting 9 days after the priming injection, and animals were sacrificed and striatum harvested 5 (3 injections), 24 or 72 hours later. Levels of mRNA for candidate genes of the early ( Cdkn1a , NFkBia , FosB , Gadd45b and Nr4a1 ) response phase were evaluated by qRT-PCR using the absolute quantitative method. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 4 (saline-treated) and 3 (MPTP-treated) animals. Differences versus control (Saline-Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR

    Quantitative assessment of striatal mRNA changes of genes of the intermediate phase in the striatum of C57BL/6J mice previously exposed to 40 mg/kg MPTP MPTP-sensitive C57BL/6J mice were injected at time zero with a single priming dose of 40 mg/kg MPTP or saline. Mice received a second exposure to either saline or the acute MPTP regimen starting 9 days after the priming injection, and animals were sacrificed and striatum harvested 5 (3 injections), 24 or 72 hours later. Levels of mRNA for candidate genes of the intermediate ( Hmox1 , Tnfrsf12a , Edg3, Pdlim4, Hbegf, Tnf- α and Mcp1/Ccl2 ) response phase were evaluated by qRT-PCR using the absolute quantitative method. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 4 (control) and 3 (MPTP-treated) animals. Differences versus control (Saline-Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P
    Figure Legend Snippet: Quantitative assessment of striatal mRNA changes of genes of the intermediate phase in the striatum of C57BL/6J mice previously exposed to 40 mg/kg MPTP MPTP-sensitive C57BL/6J mice were injected at time zero with a single priming dose of 40 mg/kg MPTP or saline. Mice received a second exposure to either saline or the acute MPTP regimen starting 9 days after the priming injection, and animals were sacrificed and striatum harvested 5 (3 injections), 24 or 72 hours later. Levels of mRNA for candidate genes of the intermediate ( Hmox1 , Tnfrsf12a , Edg3, Pdlim4, Hbegf, Tnf- α and Mcp1/Ccl2 ) response phase were evaluated by qRT-PCR using the absolute quantitative method. Results are expressed as the number of copies of a specific mRNA normalized versus the number of copies of Gapdh mRNA. Data are presented as mean ± S.E.M. of 4 (control) and 3 (MPTP-treated) animals. Differences versus control (Saline-Saline) were analyzed by one-way ANOVA followed by Bonferroni post-hoc tests and are indicated with asterisks (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR

    Comparison of mRNA changes of Hmox1 in the striatum C57BL/6J mice treated with the acute or subchronic MPTP regimens Panel A: Schematic representation of the different MPTP injection schedules used in this study. Animals treated according to the acute regimen received 4 injections of 20 mg/kg MPTP-HCl (MPTP) spaced 2 hours apart during a single day. The subchronic model consisted of daily injections of 40 mg/kg MPTP for 4 consecutive days. Panel B: quantitative assessment of Hmox1 mRNA levels after a single variable dose of MPTP in the striatum of MPTP-sensitive C57BL/6J mice. Animals were injected at time zero with a single dose of MPTP (10, 20 or 40 mg/kg) or saline as control, and sacrificed at 24 h. Levels of mRNA for Hmox1 was determined by qRT-PCR using the ΔΔCt relative expression method as described in the Materials and Methods section. Data are presented as mean ± S.E.M. of 4 animals for each condition. Differences versus control (saline, white bar) were analyzed with one-way ANOVA and Bonferroni post-hoc tests (*** P
    Figure Legend Snippet: Comparison of mRNA changes of Hmox1 in the striatum C57BL/6J mice treated with the acute or subchronic MPTP regimens Panel A: Schematic representation of the different MPTP injection schedules used in this study. Animals treated according to the acute regimen received 4 injections of 20 mg/kg MPTP-HCl (MPTP) spaced 2 hours apart during a single day. The subchronic model consisted of daily injections of 40 mg/kg MPTP for 4 consecutive days. Panel B: quantitative assessment of Hmox1 mRNA levels after a single variable dose of MPTP in the striatum of MPTP-sensitive C57BL/6J mice. Animals were injected at time zero with a single dose of MPTP (10, 20 or 40 mg/kg) or saline as control, and sacrificed at 24 h. Levels of mRNA for Hmox1 was determined by qRT-PCR using the ΔΔCt relative expression method as described in the Materials and Methods section. Data are presented as mean ± S.E.M. of 4 animals for each condition. Differences versus control (saline, white bar) were analyzed with one-way ANOVA and Bonferroni post-hoc tests (*** P

    Techniques Used: Mouse Assay, Injection, Quantitative RT-PCR, Expressing

    5) Product Images from "Micro-scaled topographies direct differentiation of human epidermal stem cells"

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells

    Journal: Acta Biomaterialia

    doi: 10.1016/j.actbio.2018.12.003

    Validation of hits using fabricated polysterene topographies. A) Fluorescent microscopic images (20× objective) from TopoUnits that were chosen for further validation based on the analyses presented in Fig. 3 . The first row represents composite images of all fluorescent channels; the second row an overlay of F-Actin (green) and DAPI staining (blue); and the last row an overlay of TGM1 (red) and DAPI staining. The first column represents the TopoUnit on which topography 1 was based. The second column represents the TopoUnit on which topography 2 was based. B) Scanning electron microscopy (SEM) images and C) height profiles of the fabricated topographies. In B) the first column represents top-view SEM images, while the second column represents images from a tilted (30°) view. D) Schematic overview of production of polystyrene (PS) topographies. Production starts with a silicon (Si) wafer, which is coated with polydimethylsiloxane (PDMS) to create a negative mould of the topographies after curing ( > 5h at 80 °C). The negative mould is then coated with PS that is dissolved in γ-butyrolactone (GBL). Upon evaporation of the solvent (4 h at 95 °C, followed by > 12 h at 150 °C) this creates solid PS topographies that can be used for cell culture. E) Fluorescent microscopic images (20x) showing staining for TGM1 (green) and IVL (red) on flat and topography surfaces after 24 h of culture. Images represent overlays of DAPI (blue), TGM1 (green) and IVL (red). F) Quantification of the proportion of differentiated cells after 1 h versus 24 h of culture. G) Relative expression of the differentiation markers IVL, suprabasin, envoplakin and periplakin after 24 h of culture as determined by qRT-PCR. In F) differentiated cells are cells positive for TGM1. Scale bars represent 50 μm in A and E and 20 μm in B. Results in F and G are from 3 independent experiments. Results in A and E are representative images from five and three independent experiments, respectively. ns: not significant, *p
    Figure Legend Snippet: Validation of hits using fabricated polysterene topographies. A) Fluorescent microscopic images (20× objective) from TopoUnits that were chosen for further validation based on the analyses presented in Fig. 3 . The first row represents composite images of all fluorescent channels; the second row an overlay of F-Actin (green) and DAPI staining (blue); and the last row an overlay of TGM1 (red) and DAPI staining. The first column represents the TopoUnit on which topography 1 was based. The second column represents the TopoUnit on which topography 2 was based. B) Scanning electron microscopy (SEM) images and C) height profiles of the fabricated topographies. In B) the first column represents top-view SEM images, while the second column represents images from a tilted (30°) view. D) Schematic overview of production of polystyrene (PS) topographies. Production starts with a silicon (Si) wafer, which is coated with polydimethylsiloxane (PDMS) to create a negative mould of the topographies after curing ( > 5h at 80 °C). The negative mould is then coated with PS that is dissolved in γ-butyrolactone (GBL). Upon evaporation of the solvent (4 h at 95 °C, followed by > 12 h at 150 °C) this creates solid PS topographies that can be used for cell culture. E) Fluorescent microscopic images (20x) showing staining for TGM1 (green) and IVL (red) on flat and topography surfaces after 24 h of culture. Images represent overlays of DAPI (blue), TGM1 (green) and IVL (red). F) Quantification of the proportion of differentiated cells after 1 h versus 24 h of culture. G) Relative expression of the differentiation markers IVL, suprabasin, envoplakin and periplakin after 24 h of culture as determined by qRT-PCR. In F) differentiated cells are cells positive for TGM1. Scale bars represent 50 μm in A and E and 20 μm in B. Results in F and G are from 3 independent experiments. Results in A and E are representative images from five and three independent experiments, respectively. ns: not significant, *p

    Techniques Used: Staining, Electron Microscopy, Evaporation, Cell Culture, Expressing, Quantitative RT-PCR

    6) Product Images from "Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons"

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2018.00285

    Overexpression of dominant negative NRF-1 attenuates the increase in β1 subunit mRNA levels in response to neuronal stimulation of primary cortical neurons. Primary cortical neurons were transfected with empty vector (pcDNA3) or dominant negative NRF-1 (NRF-1 DN; using Nucleofection™) and plated in 6-well plates. DIV7 cells were treated with either vehicle or 20 mM KCl for 6 h. Total mRNA was isolated from cells and quantified by TaqMan qRT-PCR. Gabrb1 mRNA expression was normalized to Cyclophilin A mRNA levels and is presented relative to its levels in pcDNA3 transfected neurons that were treated with vehicle (expressed as 1). Data represent the average ± SEM of n = 3 independent primary neuronal cultures. Two-way ANOVA was performed (comparison between treatments, p = 0.0148; comparison between transfected DNA conditions, p = 0.0031) with Bonferroni post hoc analysis (adjusted p value = 0.0263 for KCl vs. water with pcDNA transfection, not significant for NRF-1 DN).
    Figure Legend Snippet: Overexpression of dominant negative NRF-1 attenuates the increase in β1 subunit mRNA levels in response to neuronal stimulation of primary cortical neurons. Primary cortical neurons were transfected with empty vector (pcDNA3) or dominant negative NRF-1 (NRF-1 DN; using Nucleofection™) and plated in 6-well plates. DIV7 cells were treated with either vehicle or 20 mM KCl for 6 h. Total mRNA was isolated from cells and quantified by TaqMan qRT-PCR. Gabrb1 mRNA expression was normalized to Cyclophilin A mRNA levels and is presented relative to its levels in pcDNA3 transfected neurons that were treated with vehicle (expressed as 1). Data represent the average ± SEM of n = 3 independent primary neuronal cultures. Two-way ANOVA was performed (comparison between treatments, p = 0.0148; comparison between transfected DNA conditions, p = 0.0031) with Bonferroni post hoc analysis (adjusted p value = 0.0263 for KCl vs. water with pcDNA transfection, not significant for NRF-1 DN).

    Techniques Used: Over Expression, Dominant Negative Mutation, Transfection, Plasmid Preparation, Isolation, Quantitative RT-PCR, Expressing

    7) Product Images from "Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus"

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0117278

    Temporal distributions of four isoforms of CasEcRs with CasAK , as a reference gene (A) and levels of CasEcR1 expression in eyestalk ganglia during a juvenile molt using qRT-PCR assay. Specific primers of each isoform are listed in Table 1 . Sample cDNAs each containing 25 ng total RNA equivalent were assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE (n = 6–8). All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P
    Figure Legend Snippet: Temporal distributions of four isoforms of CasEcRs with CasAK , as a reference gene (A) and levels of CasEcR1 expression in eyestalk ganglia during a juvenile molt using qRT-PCR assay. Specific primers of each isoform are listed in Table 1 . Sample cDNAs each containing 25 ng total RNA equivalent were assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE (n = 6–8). All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P

    Techniques Used: Expressing, Quantitative RT-PCR

    Levels of CasMIH in eyestalk ganglia (A, n = 7–8) and in the sinus gland (B, n = 7–21) during juvenile molt by qRT-PCR assay and ELISA, respectively. Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE. Native CasMIH for ELISA standards was prepared as described [ 75 ]. All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P
    Figure Legend Snippet: Levels of CasMIH in eyestalk ganglia (A, n = 7–8) and in the sinus gland (B, n = 7–21) during juvenile molt by qRT-PCR assay and ELISA, respectively. Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE. Native CasMIH for ELISA standards was prepared as described [ 75 ]. All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P

    Techniques Used: Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Expressing

    Expression levels of CasMIH in the eyestalk ganglia (A) and molt interval (B) after being administered with dsRNAs (15 μg each injection, ~30 times over 60 days) by qRT-PCR assay. Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE (n = 5–9). All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P
    Figure Legend Snippet: Expression levels of CasMIH in the eyestalk ganglia (A) and molt interval (B) after being administered with dsRNAs (15 μg each injection, ~30 times over 60 days) by qRT-PCR assay. Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE (n = 5–9). All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P

    Techniques Used: Expressing, Injection, Quantitative RT-PCR

    Transcriptional levels of CasMIH in eyestalk ganglia after incubation with different concentrations (A) and ratios (B) of active ecdysteroids by qRT-PCR assay. A) CasMIH levels (black bar, n = 5–8) in eyestalk ganglia that were incubated with different ecdysteroid concentrations composed of a 3:1 ratio (w:w) of PoA: 20-HE. The ecdysteroid concentrations of 75, 150, and 250 ng/ml mimic the D o , D 1 , and D 2 stages, respectively. C . sapidus arginine kinase ( CasAK ) expression (open gray circle, n = 6–8) was quantified in the same cDNA samples. B) CasMIH levels in eyestalk ganglia incubated with different ratios (w:w) of PoA and 20-HE: 3:1 (black bar, n = 3–9) and 1 to 3 (gray bar, n = 3–9). Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE. All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P
    Figure Legend Snippet: Transcriptional levels of CasMIH in eyestalk ganglia after incubation with different concentrations (A) and ratios (B) of active ecdysteroids by qRT-PCR assay. A) CasMIH levels (black bar, n = 5–8) in eyestalk ganglia that were incubated with different ecdysteroid concentrations composed of a 3:1 ratio (w:w) of PoA: 20-HE. The ecdysteroid concentrations of 75, 150, and 250 ng/ml mimic the D o , D 1 , and D 2 stages, respectively. C . sapidus arginine kinase ( CasAK ) expression (open gray circle, n = 6–8) was quantified in the same cDNA samples. B) CasMIH levels in eyestalk ganglia incubated with different ratios (w:w) of PoA and 20-HE: 3:1 (black bar, n = 3–9) and 1 to 3 (gray bar, n = 3–9). Each cDNA sample containing 25 ng total RNA equivalent was assayed in duplicate. The expression levels are represented as copies/μg total RNA. The data are presented as mean ± SE. All data were subjected to a normality test using the Shapiro-Wilk test (SigmaPlot). Statistical significance was accepted at P

    Techniques Used: Incubation, Quantitative RT-PCR, Expressing

    8) Product Images from "Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer"

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer

    Journal: Innate Immunity

    doi: 10.1177/1753425919840702

    PTEN is directly suppressed by miR-301a. (a) qRT-PCR verified the PTEN expression in a separate random cohort of cervical carcinoma tissues compared to paired non-carcinoma tissues ( n = 12). Bars represent the mean ± SE, * P
    Figure Legend Snippet: PTEN is directly suppressed by miR-301a. (a) qRT-PCR verified the PTEN expression in a separate random cohort of cervical carcinoma tissues compared to paired non-carcinoma tissues ( n = 12). Bars represent the mean ± SE, * P

    Techniques Used: Quantitative RT-PCR, Expressing

    miR-301a is overexpressed in cervical cancer. qRT-PCR verified the miR-301a level in a separate random cohort of cervical carcinoma tissues compared to paired non-carcinoma tissues ( n = 12). Bars represent the mean ± SE, * P
    Figure Legend Snippet: miR-301a is overexpressed in cervical cancer. qRT-PCR verified the miR-301a level in a separate random cohort of cervical carcinoma tissues compared to paired non-carcinoma tissues ( n = 12). Bars represent the mean ± SE, * P

    Techniques Used: Quantitative RT-PCR

    9) Product Images from "A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver"

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver

    Journal: Hepatology (Baltimore, Md.)

    doi: 10.1002/hep.27379

    AAV8-Ttr-Cre-injected Dicer1 fl/fl mice allow bias-free analysis of the effects of global miRNA deficiency in adult hepatocytes. ( A ) qRT-PCR shows loss of Dicer1 expression in livers of Dicer1 fl/fl mice beginning 1 week (wk) after injection of AAV8-Ttr-Cre.
    Figure Legend Snippet: AAV8-Ttr-Cre-injected Dicer1 fl/fl mice allow bias-free analysis of the effects of global miRNA deficiency in adult hepatocytes. ( A ) qRT-PCR shows loss of Dicer1 expression in livers of Dicer1 fl/fl mice beginning 1 week (wk) after injection of AAV8-Ttr-Cre.

    Techniques Used: Injection, Mouse Assay, Quantitative RT-PCR, Expressing

    MiR-29a inhibits lipid uptake into livers of mice fed HFD. ( A ) qRT-PCR shows increased Lpl mRNA levels in livers of HFD-fed mice injected with anti-miR-29a as compared to HFD-fed mice injected with anti-miR-control for 3 weeks (n = ≥ 4 per group).
    Figure Legend Snippet: MiR-29a inhibits lipid uptake into livers of mice fed HFD. ( A ) qRT-PCR shows increased Lpl mRNA levels in livers of HFD-fed mice injected with anti-miR-29a as compared to HFD-fed mice injected with anti-miR-control for 3 weeks (n = ≥ 4 per group).

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Injection

    10) Product Images from "Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto"

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0025385

    IFNλR1 is a functional receptor of IFN-λ2. Bat cloned and immortalized cell line PaKiT01 cells were transfected with IFNλR1 expression plasmid or empty vector for 24 hours, followed by IFN-λ2 treatment (or mock treatment) for another 6 hours. After which, cells were collected and total RNA was extracted for qRT-PCR analysis. IFNλR1, ISG56 and RIG-I mRNA expression were tested and indicated by relative expression (mean of two experiments). The error bars represent standard errors.
    Figure Legend Snippet: IFNλR1 is a functional receptor of IFN-λ2. Bat cloned and immortalized cell line PaKiT01 cells were transfected with IFNλR1 expression plasmid or empty vector for 24 hours, followed by IFN-λ2 treatment (or mock treatment) for another 6 hours. After which, cells were collected and total RNA was extracted for qRT-PCR analysis. IFNλR1, ISG56 and RIG-I mRNA expression were tested and indicated by relative expression (mean of two experiments). The error bars represent standard errors.

    Techniques Used: Functional Assay, Clone Assay, Transfection, Expressing, Plasmid Preparation, Quantitative RT-PCR

    qRT-PCR detection of IFNλR1 (A) and IL10R2 (B) mRNA expression in P. alecto . PBMC: peripheral blood mononuclear cells. The expression level was normalized to housekeeping gene 18s rRNA. n = 3 individual apparently healthy wild-caught bats. The error bars represent standard deviation in (A) and (B).
    Figure Legend Snippet: qRT-PCR detection of IFNλR1 (A) and IL10R2 (B) mRNA expression in P. alecto . PBMC: peripheral blood mononuclear cells. The expression level was normalized to housekeeping gene 18s rRNA. n = 3 individual apparently healthy wild-caught bats. The error bars represent standard deviation in (A) and (B).

    Techniques Used: Quantitative RT-PCR, Expressing, Standard Deviation

    Responsiveness of P. alecto splenocytes to IFN-λ2 treatment and the relative expression level of IFNλR1. Cells were treated for 6 hours before they were collected for RNA extraction and qRT-PCR analysis. The left axis shows the relative expression level of IFNλR1 (mean of three experiments). The right axis shows the ISG56 and RIG-I fold induction in response to IFN-λ2 treatment (mean of three experiments). The expression level was normalized to the housekeeping gene 18s rRNA. The error bars represent standard errors.
    Figure Legend Snippet: Responsiveness of P. alecto splenocytes to IFN-λ2 treatment and the relative expression level of IFNλR1. Cells were treated for 6 hours before they were collected for RNA extraction and qRT-PCR analysis. The left axis shows the relative expression level of IFNλR1 (mean of three experiments). The right axis shows the ISG56 and RIG-I fold induction in response to IFN-λ2 treatment (mean of three experiments). The expression level was normalized to the housekeeping gene 18s rRNA. The error bars represent standard errors.

    Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

    The responsiveness of P. alecto non-haematopoietic cell lines to IFN-λ2 treatment correlates with IFNλR1 expression and proportions of epithelial cells. (A) Relative expression level of IFNλR1 by qRT-PCR (mean of two experiments). The expression level was normalized to the housekeeping gene 18s rRNA. (B/C) Responsiveness of P. alecto kidney, small intestine, brain, liver and lung primary cells. The histogram shows the (B) RIG-I or (C) ISG56 fold induction in response to IFN-λ2 treatment (mean of two experiments). The error bars represent standard errors in (A), (B) and (C).(D) The relative proportion of epithelial cells in the primary cell cultures as demonstrated by Western blotting using an anti-cytokeratin antibody. The housekeeping gene, GAPDH was used as a loading control.
    Figure Legend Snippet: The responsiveness of P. alecto non-haematopoietic cell lines to IFN-λ2 treatment correlates with IFNλR1 expression and proportions of epithelial cells. (A) Relative expression level of IFNλR1 by qRT-PCR (mean of two experiments). The expression level was normalized to the housekeeping gene 18s rRNA. (B/C) Responsiveness of P. alecto kidney, small intestine, brain, liver and lung primary cells. The histogram shows the (B) RIG-I or (C) ISG56 fold induction in response to IFN-λ2 treatment (mean of two experiments). The error bars represent standard errors in (A), (B) and (C).(D) The relative proportion of epithelial cells in the primary cell cultures as demonstrated by Western blotting using an anti-cytokeratin antibody. The housekeeping gene, GAPDH was used as a loading control.

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

    11) Product Images from "miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1"

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.00275

    miR-203 inhibited hepatocyte lipids accumulation in vitro . (A) Transfection effect of miR-203 mimics was confirmed by qRT-PCR. (B) The cellular Oil Red staining (x200). (C) The cellular TG and TCH levels. (D,E) qRT-PCR and “Western blot” analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNP-α. ∗ p
    Figure Legend Snippet: miR-203 inhibited hepatocyte lipids accumulation in vitro . (A) Transfection effect of miR-203 mimics was confirmed by qRT-PCR. (B) The cellular Oil Red staining (x200). (C) The cellular TG and TCH levels. (D,E) qRT-PCR and “Western blot” analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNP-α. ∗ p

    Techniques Used: In Vitro, Transfection, Quantitative RT-PCR, Staining, Expressing

    miR-203 inhibited liver lipids accumulation in vivo . (A) Lenti-mir-203 and Lenti-NC expression in mice liver. (B) Expression of miR-203 was confirmed by qRT-PCR. (C) The liver tissues H E and Oil Red O staining (x100). (D) Liver triglyceride (TG) levels. (E,F) qRT-PCR and Western blot analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNF-α. ∗ p
    Figure Legend Snippet: miR-203 inhibited liver lipids accumulation in vivo . (A) Lenti-mir-203 and Lenti-NC expression in mice liver. (B) Expression of miR-203 was confirmed by qRT-PCR. (C) The liver tissues H E and Oil Red O staining (x100). (D) Liver triglyceride (TG) levels. (E,F) qRT-PCR and Western blot analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNF-α. ∗ p

    Techniques Used: In Vivo, Expressing, Mouse Assay, Quantitative RT-PCR, Staining, Western Blot

    miR-203 was down-regulated in EtOH-fed mice and EtOH-induced AML-12 cells. (A) Representative hematoxylin and eosin (H E) staining of liver tissues (×400). (B) Body weights and the liver to body weight ratio after ethanol feeding. (C) Hepatic triglyceride (TG) and total cholesterol (TCH) levels. (D) Serum ALT and AST levels. (E) One-step qRT-PCR for miR-203 expression in EtOH-fed mice liver tissues compared to normal liver tissues and AML-12 cell line. (F) AML-12 cell line was treated with ethanol (0, 50, 75, 100, 150, 200) mM for 24 h the cell viability. ∗ p
    Figure Legend Snippet: miR-203 was down-regulated in EtOH-fed mice and EtOH-induced AML-12 cells. (A) Representative hematoxylin and eosin (H E) staining of liver tissues (×400). (B) Body weights and the liver to body weight ratio after ethanol feeding. (C) Hepatic triglyceride (TG) and total cholesterol (TCH) levels. (D) Serum ALT and AST levels. (E) One-step qRT-PCR for miR-203 expression in EtOH-fed mice liver tissues compared to normal liver tissues and AML-12 cell line. (F) AML-12 cell line was treated with ethanol (0, 50, 75, 100, 150, 200) mM for 24 h the cell viability. ∗ p

    Techniques Used: Mouse Assay, Staining, AST Assay, Quantitative RT-PCR, Expressing

    12) Product Images from "0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein"

    Article Title: 0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein

    Journal:

    doi: 10.1016/j.bbrc.2007.12.035

    Tnrip-1 expression in mouse testes during postnatal development and its predominant expression in spermatogenic cells of adult mouse testes. (A) QRT-PCR analyses showing the developmentally regulated Tnrip-1 expression in mouse testes. Tnrip-1 mRNA levels
    Figure Legend Snippet: Tnrip-1 expression in mouse testes during postnatal development and its predominant expression in spermatogenic cells of adult mouse testes. (A) QRT-PCR analyses showing the developmentally regulated Tnrip-1 expression in mouse testes. Tnrip-1 mRNA levels

    Techniques Used: Expressing, Quantitative RT-PCR

    13) Product Images from "Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination"

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination

    Journal: BMC Plant Biology

    doi: 10.1186/1471-2229-12-31

    Quantitative expression analysis of CcCPI1, CcCPI2, CcCPI3 and CcCPI4 in leaves at different maturation stages for Arabica T2308 . The expression of each gene was measured in two independent sets of leaf samples during development and senescence. The expression levels were obtained using QRT-PCR. RQ is the expression level of each gene relative to the constitutively expressed gene RPL39. Symbols: VYL, very young leaves; YL, young leaves; ML, mature leaves; OL, old leaves.
    Figure Legend Snippet: Quantitative expression analysis of CcCPI1, CcCPI2, CcCPI3 and CcCPI4 in leaves at different maturation stages for Arabica T2308 . The expression of each gene was measured in two independent sets of leaf samples during development and senescence. The expression levels were obtained using QRT-PCR. RQ is the expression level of each gene relative to the constitutively expressed gene RPL39. Symbols: VYL, very young leaves; YL, young leaves; ML, mature leaves; OL, old leaves.

    Techniques Used: Expressing, Quantitative RT-PCR

    14) Product Images from "Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis"

    Article Title: Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-15-820

    Expression of the selected 12 transcription factors by qRT-PCR. Expression patterns of the selected 12 transcription factors in the wing disc at indicated six developmental stages, which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3). (A) Bm_nscaf2589_261 (probable nuclear hormone receptor HR38). (B) Bm_nscaf1898_501 (D-ETS-4-like isoform X2). (C) B m_nscaf2876_46 (bHLH protein 15-like). (D) Bm_nscaf2847_349 (protein escargot-like). (E) Bm_nscaf2888_249 (nuclear receptor GRF). (F) Bm_nscaf2902_040 (helix-loop-helix protein delilah-like). (G) Bm_nscaf3090_4 (chorion specific C/EBP). (H) Bm_scaffold316_2 (protein embryonic gonad-like). (I) Bm_nscaf1898_212 (ets DNA-binding protein pokkuri-like). (J) Bm_nscaf2770_58 (transcription factor SOX-4-like). (K) Bm_nscaf2847_110 (Krueppel-like factor 10-like). (L) Bm_nscaf2930_060 (enhancer of split mbeta). The relative expression levels were normalized to the Bmβ-actin levels. The values are mean ± SEM (n = 3). Different letters indicate statistical significance (p
    Figure Legend Snippet: Expression of the selected 12 transcription factors by qRT-PCR. Expression patterns of the selected 12 transcription factors in the wing disc at indicated six developmental stages, which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3). (A) Bm_nscaf2589_261 (probable nuclear hormone receptor HR38). (B) Bm_nscaf1898_501 (D-ETS-4-like isoform X2). (C) B m_nscaf2876_46 (bHLH protein 15-like). (D) Bm_nscaf2847_349 (protein escargot-like). (E) Bm_nscaf2888_249 (nuclear receptor GRF). (F) Bm_nscaf2902_040 (helix-loop-helix protein delilah-like). (G) Bm_nscaf3090_4 (chorion specific C/EBP). (H) Bm_scaffold316_2 (protein embryonic gonad-like). (I) Bm_nscaf1898_212 (ets DNA-binding protein pokkuri-like). (J) Bm_nscaf2770_58 (transcription factor SOX-4-like). (K) Bm_nscaf2847_110 (Krueppel-like factor 10-like). (L) Bm_nscaf2930_060 (enhancer of split mbeta). The relative expression levels were normalized to the Bmβ-actin levels. The values are mean ± SEM (n = 3). Different letters indicate statistical significance (p

    Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay

    qRT-PCR results of 5 genes relevant to chitin synthesis. The expression patterns of five selected chitin synthesis related genes in the wing disc at six developmental stages. which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3). (A) Bm_nscaf3027_063 (hexokinase type 2-like isoform X3). (B) Bm_nscaf2887_059 (glutamine: fructose-6-phosphate aminotransferase). (C) Bm_nscaf2823_132 (glucosamine-6-phosphate N-acetyltransferase). (D) Bm_nscaf2589_266 (chitin synthase A). (E) Bm_nscaf2589_269 (chitin synthase B). The relative expression levels were normalized to the Bmβ-actin levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR. Different letters indicate statistical significance (p
    Figure Legend Snippet: qRT-PCR results of 5 genes relevant to chitin synthesis. The expression patterns of five selected chitin synthesis related genes in the wing disc at six developmental stages. which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3). (A) Bm_nscaf3027_063 (hexokinase type 2-like isoform X3). (B) Bm_nscaf2887_059 (glutamine: fructose-6-phosphate aminotransferase). (C) Bm_nscaf2823_132 (glucosamine-6-phosphate N-acetyltransferase). (D) Bm_nscaf2589_266 (chitin synthase A). (E) Bm_nscaf2589_269 (chitin synthase B). The relative expression levels were normalized to the Bmβ-actin levels. The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR. Different letters indicate statistical significance (p

    Techniques Used: Quantitative RT-PCR, Expressing

    qRT-PCR results of expression of the chitin degradation related genes. The expression patterns of two chitin degradation genes in the wing disc at six developmental stages, which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3) The relative expression levels were normalized to the Bmβ-actin levels. (A) Bm_nscaf2993_229 (chitin deacetylase 4). (B) Bm_nscaf3031_201 (β-N-acetylglucosaminidase 1 precursor). The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR. Different letters indicate statistical significance (p
    Figure Legend Snippet: qRT-PCR results of expression of the chitin degradation related genes. The expression patterns of two chitin degradation genes in the wing disc at six developmental stages, which are 3-day-old fifth instar larvae (L5D3), L5D6, 1-day-old wandering (W1), PP, P0 and 3-day-old pupae (P3) The relative expression levels were normalized to the Bmβ-actin levels. (A) Bm_nscaf2993_229 (chitin deacetylase 4). (B) Bm_nscaf3031_201 (β-N-acetylglucosaminidase 1 precursor). The values are the mean ± SEM (n = 3) of three repeat experiments using qRT-PCR. Different letters indicate statistical significance (p

    Techniques Used: Quantitative RT-PCR, Expressing, Histone Deacetylase Assay

    15) Product Images from "BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo"

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2016.01.016

    The AGM Contains Two HSC Types in Explant Culture (A) Percentage donor cell chimerism in peripheral blood (PB) of adult irradiated transplant recipients at 4 months after injection of unsorted cells from E11 AGM explants (AGM ex ) cultured in serum-containing (+) or serum-free (−) medium with BMP4 and/or Shh, as shown below the graph. On to three AGM embryo equivalents (ee) were transplanted per recipient (n = 2 or 5; 1 or 4 mice transplanted/experiment). See Table S2 . Each dot represents one recipient mouse. p = 0.0005 by z test for proportions. (B) Percentage donor cell chimerism in the PB of adult irradiated transplant recipients at 4 months after injection of E11 AGM ex BRE GFP + (+) or BRE GFP − (−) cells (2–4 ee transplanted/recipient; 1 or 2 mice transplanted/experiment; n = 7, 4, or 3). See Table S2 . Culture conditions with cyclopamine and/or VEGF are indicated below the graph. p = 0.06 and p = 0.02 by z test for proportions. For (A) and (B), positive repopulation was considered to be > 5% chimerism, as denoted by the gray dashed line. (C) qRT-PCR results for Ihh, Gli1 , and Vegf expression in unsorted cells from AGM in (white bars) and AGM ex (black bars). Error bars show ±SEM, with p value by t test (n = 3). (D) Gli1 transcript levels (FPKMs) in AGM cell fractions as detected by RNA sequencing. E11 AGM BRE GFP hematopoietic progenitor/stem cells (HPSC; CD31 + cKit + ), endothelial cells (EC, CD31 + cKit − ), and “other” non-HPSC, non-EC cells (OC; CD31 − ) were sorted by flow cytometry into GFP + and GFP − fractions from AGM in (white bars), AGM ex (black bars), and AGM ex,cyclopamine (gray bars).
    Figure Legend Snippet: The AGM Contains Two HSC Types in Explant Culture (A) Percentage donor cell chimerism in peripheral blood (PB) of adult irradiated transplant recipients at 4 months after injection of unsorted cells from E11 AGM explants (AGM ex ) cultured in serum-containing (+) or serum-free (−) medium with BMP4 and/or Shh, as shown below the graph. On to three AGM embryo equivalents (ee) were transplanted per recipient (n = 2 or 5; 1 or 4 mice transplanted/experiment). See Table S2 . Each dot represents one recipient mouse. p = 0.0005 by z test for proportions. (B) Percentage donor cell chimerism in the PB of adult irradiated transplant recipients at 4 months after injection of E11 AGM ex BRE GFP + (+) or BRE GFP − (−) cells (2–4 ee transplanted/recipient; 1 or 2 mice transplanted/experiment; n = 7, 4, or 3). See Table S2 . Culture conditions with cyclopamine and/or VEGF are indicated below the graph. p = 0.06 and p = 0.02 by z test for proportions. For (A) and (B), positive repopulation was considered to be > 5% chimerism, as denoted by the gray dashed line. (C) qRT-PCR results for Ihh, Gli1 , and Vegf expression in unsorted cells from AGM in (white bars) and AGM ex (black bars). Error bars show ±SEM, with p value by t test (n = 3). (D) Gli1 transcript levels (FPKMs) in AGM cell fractions as detected by RNA sequencing. E11 AGM BRE GFP hematopoietic progenitor/stem cells (HPSC; CD31 + cKit + ), endothelial cells (EC, CD31 + cKit − ), and “other” non-HPSC, non-EC cells (OC; CD31 − ) were sorted by flow cytometry into GFP + and GFP − fractions from AGM in (white bars), AGM ex (black bars), and AGM ex,cyclopamine (gray bars).

    Techniques Used: Irradiation, Injection, Cell Culture, Mouse Assay, Quantitative RT-PCR, Expressing, RNA Sequencing Assay, Flow Cytometry, Cytometry

    16) Product Images from "Global analysis of proliferation and cell cycle gene expression in the regulation of hematopoietic stem and progenitor cell fates"

    Article Title: Global analysis of proliferation and cell cycle gene expression in the regulation of hematopoietic stem and progenitor cell fates

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20050967

    Proliferation index and status of cell cycle machinery during HSC mobilization. (A) Semilogarithmic plot giving the proportion of BrdU-negative HSC in untreated mice and mice that received D2 and D4 Cy/G treatment. (B) Schematic and color-coded representation correlating the proliferation index of each HSC population following D2 and D4 Cy/G treatment with their pool size in vivo. (C) Analysis by qRT-PCR of the expression levels of various components and regulators of the cell cycle machinery following D2 and D4 Cy/G treatment. Results represent means ± SD of duplicate measurement performed on three independently sorted sets of HSC populations. Each value has been standardized for β-actin expression levels and is expressed as fold induction compared with the levels (set to 1) detected in untreated BM HSC. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05.
    Figure Legend Snippet: Proliferation index and status of cell cycle machinery during HSC mobilization. (A) Semilogarithmic plot giving the proportion of BrdU-negative HSC in untreated mice and mice that received D2 and D4 Cy/G treatment. (B) Schematic and color-coded representation correlating the proliferation index of each HSC population following D2 and D4 Cy/G treatment with their pool size in vivo. (C) Analysis by qRT-PCR of the expression levels of various components and regulators of the cell cycle machinery following D2 and D4 Cy/G treatment. Results represent means ± SD of duplicate measurement performed on three independently sorted sets of HSC populations. Each value has been standardized for β-actin expression levels and is expressed as fold induction compared with the levels (set to 1) detected in untreated BM HSC. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05.

    Techniques Used: Mouse Assay, In Vivo, Quantitative RT-PCR, Expressing

    Proliferation index and status of the cell cycle machinery during hematopoietic differentiation. (A) Semilogarithmic plot giving the proportion of BrdU-negative stem and progenitor cells. (B) Schematic and color coded representation correlating the proliferation index (right) of each stem and progenitor compartment with their frequency in vivo (left). The different lineages of mature cells produced by each progenitor population are also indicated. B, B lymphocytes; T, T lymphocytes; NK: natural killer cells; E: erythrocytes; Mk: megakaryocytes; MΦ: macrophages. (C) Analysis by qRT-PCR of the expression levels of various components and regulators of the cell cycle machinery during hematopoietic differentiation. Each value has been standardized for β-actin expression levels. For each gene, the relative expression levels in stem, progenitor (prog), and mature cell (mature) populations are expressed as fold induction compared with the levels (set to 1) detected in LT-HSC (except for cyclin B1, in which ST-HSC F was used instead). Results (means ± SD) are obtained from three independently sorted sets of populations. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05. nd, not detectable.
    Figure Legend Snippet: Proliferation index and status of the cell cycle machinery during hematopoietic differentiation. (A) Semilogarithmic plot giving the proportion of BrdU-negative stem and progenitor cells. (B) Schematic and color coded representation correlating the proliferation index (right) of each stem and progenitor compartment with their frequency in vivo (left). The different lineages of mature cells produced by each progenitor population are also indicated. B, B lymphocytes; T, T lymphocytes; NK: natural killer cells; E: erythrocytes; Mk: megakaryocytes; MΦ: macrophages. (C) Analysis by qRT-PCR of the expression levels of various components and regulators of the cell cycle machinery during hematopoietic differentiation. Each value has been standardized for β-actin expression levels. For each gene, the relative expression levels in stem, progenitor (prog), and mature cell (mature) populations are expressed as fold induction compared with the levels (set to 1) detected in LT-HSC (except for cyclin B1, in which ST-HSC F was used instead). Results (means ± SD) are obtained from three independently sorted sets of populations. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05. nd, not detectable.

    Techniques Used: In Vivo, Produced, Quantitative RT-PCR, Expressing

    Molecular control of quiescence. Analysis by qRT-PCR of the expression levels of various regulators of G 0 or G 0 /G 1 phase transition in homeostatic proliferation during LT-HSC differentiation toward ST-HSC F and MPP F and stress-induced HSC self-renewing proliferation following D2 and D4 Cy/G treatment. The results represent the means ± SD of duplicate measurements performed on three independently sorted sets of populations. Each value has been standardized for β-actin expression levels and is expressed as fold induction compared with the levels (set to 1) detected in LT-HSC or untreated BM HSC. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05.
    Figure Legend Snippet: Molecular control of quiescence. Analysis by qRT-PCR of the expression levels of various regulators of G 0 or G 0 /G 1 phase transition in homeostatic proliferation during LT-HSC differentiation toward ST-HSC F and MPP F and stress-induced HSC self-renewing proliferation following D2 and D4 Cy/G treatment. The results represent the means ± SD of duplicate measurements performed on three independently sorted sets of populations. Each value has been standardized for β-actin expression levels and is expressed as fold induction compared with the levels (set to 1) detected in LT-HSC or untreated BM HSC. *, P ≤ 0.001; Δ , P ≤ 0.01; o , P ≤ 0.05.

    Techniques Used: Quantitative RT-PCR, Expressing, Sublimation

    17) Product Images from "PhMYB4 fine-tunes the floral volatile signature of Petunia×hybrida through PhC4H"

    Article Title: PhMYB4 fine-tunes the floral volatile signature of Petunia×hybrida through PhC4H

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erq342

    PhC4H1 and PhC4H2 floral developmental transcript accumulation analysis (one-step qRT-PCR). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00 h. Gene-specific primers were designed and optimized as well as template concentration, which was identified as 50 ng total RNA per reaction. PhFBP1 and Ph18S were used as endogenous control transcripts. Shown are representative histograms from multiple biological replications using ΔΔCt method (mean ±se; n =3).
    Figure Legend Snippet: PhC4H1 and PhC4H2 floral developmental transcript accumulation analysis (one-step qRT-PCR). Floral developmental analysis used MD flowers from 11 sequential stages collected on one day at 16.00 h. Gene-specific primers were designed and optimized as well as template concentration, which was identified as 50 ng total RNA per reaction. PhFBP1 and Ph18S were used as endogenous control transcripts. Shown are representative histograms from multiple biological replications using ΔΔCt method (mean ±se; n =3).

    Techniques Used: Quantitative RT-PCR, Concentration Assay

    Comparative transcript accumulation analysis between MD and the homozygous ir-PhMYB4 lines (two-step qRT-PCR). All cDNA templates were 1/10 dilutions of cDNA stock samples generated from 2 μg total RNA isolated from stage 8 flowers at 16.00 h. Histograms are representative of multiple experiments and multiple biological replicates, and analysed by ΔΔCt method with PhFBP1 and Ph18S as the internal references. Individual petunia transcripts analysed are PhMYB4 (A, B); PhC4H1 and PhC4H2 (B); PhODO1 , PhCM1 , PhPAL1 , and PhPAL2 (C).
    Figure Legend Snippet: Comparative transcript accumulation analysis between MD and the homozygous ir-PhMYB4 lines (two-step qRT-PCR). All cDNA templates were 1/10 dilutions of cDNA stock samples generated from 2 μg total RNA isolated from stage 8 flowers at 16.00 h. Histograms are representative of multiple experiments and multiple biological replicates, and analysed by ΔΔCt method with PhFBP1 and Ph18S as the internal references. Individual petunia transcripts analysed are PhMYB4 (A, B); PhC4H1 and PhC4H2 (B); PhODO1 , PhCM1 , PhPAL1 , and PhPAL2 (C).

    Techniques Used: Quantitative RT-PCR, Generated, Isolation

    18) Product Images from "The first characterization of multidrug and toxin extrusion (MATE/SLC47) proteins in zebrafish (Danio rerio)"

    Article Title: The first characterization of multidrug and toxin extrusion (MATE/SLC47) proteins in zebrafish (Danio rerio)

    Journal: Scientific Reports

    doi: 10.1038/srep28937

    Expression pattern of Slc47 genes in embryos and tissues of adult zebrafish. ( A ) Mate genes in early developmental stages of zebrafish embryos. Results of three to five independent determinations for each developmental stage (three to five pools of 15–30 embryos) are presented, except for 120 hours post fertilization (hpf) where two independent experiments were performed. Data represent MNE (mean normalized expression) ± SE normalized to the Ef1α . ( B ) Mate genes in specific tissues of female and male zebrafish, quantified with qRT-PCR. Results of two to three independent experiments for females and males (two to three pools of five individuals) are given, while the kidney expression data results from two pools of 15 individuals. Data represent MNE ± SE normalized to the Ef1α .
    Figure Legend Snippet: Expression pattern of Slc47 genes in embryos and tissues of adult zebrafish. ( A ) Mate genes in early developmental stages of zebrafish embryos. Results of three to five independent determinations for each developmental stage (three to five pools of 15–30 embryos) are presented, except for 120 hours post fertilization (hpf) where two independent experiments were performed. Data represent MNE (mean normalized expression) ± SE normalized to the Ef1α . ( B ) Mate genes in specific tissues of female and male zebrafish, quantified with qRT-PCR. Results of two to three independent experiments for females and males (two to three pools of five individuals) are given, while the kidney expression data results from two pools of 15 individuals. Data represent MNE ± SE normalized to the Ef1α .

    Techniques Used: Expressing, Quantitative RT-PCR

    19) Product Images from "Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons"

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2018.00285

    Overexpression of dominant negative NRF-1 attenuates the increase in β1 subunit mRNA levels in response to neuronal stimulation of primary cortical neurons. Primary cortical neurons were transfected with empty vector (pcDNA3) or dominant negative NRF-1 (NRF-1 DN; using Nucleofection™) and plated in 6-well plates. DIV7 cells were treated with either vehicle or 20 mM KCl for 6 h. Total mRNA was isolated from cells and quantified by TaqMan qRT-PCR. Gabrb1 mRNA expression was normalized to Cyclophilin A mRNA levels and is presented relative to its levels in pcDNA3 transfected neurons that were treated with vehicle (expressed as 1). Data represent the average ± SEM of n = 3 independent primary neuronal cultures. Two-way ANOVA was performed (comparison between treatments, p = 0.0148; comparison between transfected DNA conditions, p = 0.0031) with Bonferroni post hoc analysis (adjusted p value = 0.0263 for KCl vs. water with pcDNA transfection, not significant for NRF-1 DN).
    Figure Legend Snippet: Overexpression of dominant negative NRF-1 attenuates the increase in β1 subunit mRNA levels in response to neuronal stimulation of primary cortical neurons. Primary cortical neurons were transfected with empty vector (pcDNA3) or dominant negative NRF-1 (NRF-1 DN; using Nucleofection™) and plated in 6-well plates. DIV7 cells were treated with either vehicle or 20 mM KCl for 6 h. Total mRNA was isolated from cells and quantified by TaqMan qRT-PCR. Gabrb1 mRNA expression was normalized to Cyclophilin A mRNA levels and is presented relative to its levels in pcDNA3 transfected neurons that were treated with vehicle (expressed as 1). Data represent the average ± SEM of n = 3 independent primary neuronal cultures. Two-way ANOVA was performed (comparison between treatments, p = 0.0148; comparison between transfected DNA conditions, p = 0.0031) with Bonferroni post hoc analysis (adjusted p value = 0.0263 for KCl vs. water with pcDNA transfection, not significant for NRF-1 DN).

    Techniques Used: Over Expression, Dominant Negative Mutation, Transfection, Plasmid Preparation, Isolation, Quantitative RT-PCR, Expressing

    20) Product Images from "Data of expression status of miR- 29a and its putative target mitochondrial apoptosis regulatory gene DRP1 upon miR-15a and miR-214 inhibition"

    Article Title: Data of expression status of miR- 29a and its putative target mitochondrial apoptosis regulatory gene DRP1 upon miR-15a and miR-214 inhibition

    Journal: Data in Brief

    doi: 10.1016/j.dib.2017.12.040

    Expression of miR-29a and DRP1 in neonatal cardiomyocytes transfected with miRNA 15a inhibitor. miRNA and genes expression was performed by qRT-PCR. A. The relative expression of miR-29a after transfection with anti miR-15a. B. The relative expression level of DRP1 in inhibitor treated cardiomyocytes as compared to control.
    Figure Legend Snippet: Expression of miR-29a and DRP1 in neonatal cardiomyocytes transfected with miRNA 15a inhibitor. miRNA and genes expression was performed by qRT-PCR. A. The relative expression of miR-29a after transfection with anti miR-15a. B. The relative expression level of DRP1 in inhibitor treated cardiomyocytes as compared to control.

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR

    21) Product Images from "Cilia-associated oxysterols activate Smoothened"

    Article Title: Cilia-associated oxysterols activate Smoothened

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2018.08.034

    Cilia-associated oxysterols and the SMOM2 substitution function through the CBP. (A and B) Florescence polarization anisotropy of human SMO and SMOΔCRD in response to 20 nM CYA-BODIPY (A) or 50 nM 24k-C-BODIPY (B). Data are shown in a.u. CYA-BODIPY binding to SMO is positively cooperative (Hill coefficient 1.6) with higher affinity than to SMOΔCRD (Hill coefficient 0.8). 24k-C-BODIPY binds to SMO and SMOΔCRD (Hill coefficients 1) with equivalent affinities. (C) Schematic of SMO with relative positions of CRD (red) and a predicted oxysterol binding pocket at the membrane-proximal cytoplasmic surface (CBP, aqua) within the HHB (gray). The C-terminal domain (CTD) is also depicted in gray. Residue numbers demarcating domains are indicated. (D–F) Docking of 24k-C and 24( S ),25-EC against human SMO (PDB: 5L7D) predicts oxysterol binding to the CBP (gray mesh encompasses residues in aqua). The CBP is composed of intracellular loops and portions of transmembrane domains (TMDs) 1 (T251-I266), 3 (W339-L346), 6 (N446-I454), and 7 (W535-T553) and is distant from the CRD (red). Residues D255 and N446 (corresponding to D259 and N450 in mouse SMO) are predicted to form hydrogen bonds (dashed lines) with the carbon 3 hydroxyl and iso-octyl tail oxygens, respectively, of 24k-C (E) and 24( S ),25-EC (F). Hydrogen bond lengths are shown in angstroms (Å). (G) qRT-PCR assessment of Gli1 expression in ciliated Smo − / − MEFs expressing wild-type mouse SMO, SMO Y134F , SMO D259R , SMO N450D , or SMO Y134F, D259R and treated with vehicle (ethanol), 100 nM SAG, or 30 μM 7β-DHC or 24( S ),25-EC. Data are normalized to Gli1 expression in wild-type SMO-expressing cells treated with vehicle. Y134F substitution in the CRD attenuates the ability of 7β-DHC and 24( S ),25-EC to induce Gli1 , whereas D259R and N450D substitutions in the CBP attenuate the effect of 24( S ),25-EC. Combined substitutions in the CRD and CBP block the effects of cilia-associated oxysterols and attenuate the effect of SAG. (H) Ciliary fluorescence intensity of NIH/3T3 cells stably expressing mouse SMO-, SMO Y134F -, SMO D259R -, SMO N450D -, or SMO Y134F, D259R -EGFP treated with vehicle (ethanol), 100 nM SAG, 1 μg/mL SHH, or 30 μM 7β-DHC or 24( S ),25-EC. Data are from 2 separate cell lines normalized to the average intensity in cells expressing wild-type SMO-EGFP and treated with vehicle. Y134F substitution in the CRD specifically blocks the ability of 7β-DHC to induce SMO accumulation in cilia, whereas the D259R and N450D substitutions in the CBP block the effect 24( S ),25-EC. Combined substitutions in the CRD and CBP block the effect of cilia-associated oxysterols and SHH and substantially attenuate the effect of SAG. (I) Docking of 24( S ),25-EC against human SMO predicts van der Waals interactions between cilia-associated oxysterols and W535 of the CBP, the residue mutated in SMOM2. Interaction lengths are shown in Å. (J) Luciferase activity of ciliated Smo − / − MEFs co-transfected with Gli -luciferase reporter and oncogenic constitutively active form of SMO, SMOM2 (SMO W535L ), SMOM2 Y134F , SMOM2 D259R , or SMOM2 Y134F, D259R . Data are normalized to SMOM2 activity. Y134F substitution in the CRD, D259R substitution in the CBP, and combined substitutions in the CRD and CBP inhibit the activity of SMOM2. (K) Ciliary fluorescence intensity of NIH/3T3 cells stably expressing mouse SMOM2- or SMOM2 Y134F, D259R -EGFP. Data are from 2 separate cell lines normalized to the average ciliary intensity of cells expressing SMOM2-EGFP. Combined substitutions in the CRD and CBP block SMOM2 accumulation in cilia. .
    Figure Legend Snippet: Cilia-associated oxysterols and the SMOM2 substitution function through the CBP. (A and B) Florescence polarization anisotropy of human SMO and SMOΔCRD in response to 20 nM CYA-BODIPY (A) or 50 nM 24k-C-BODIPY (B). Data are shown in a.u. CYA-BODIPY binding to SMO is positively cooperative (Hill coefficient 1.6) with higher affinity than to SMOΔCRD (Hill coefficient 0.8). 24k-C-BODIPY binds to SMO and SMOΔCRD (Hill coefficients 1) with equivalent affinities. (C) Schematic of SMO with relative positions of CRD (red) and a predicted oxysterol binding pocket at the membrane-proximal cytoplasmic surface (CBP, aqua) within the HHB (gray). The C-terminal domain (CTD) is also depicted in gray. Residue numbers demarcating domains are indicated. (D–F) Docking of 24k-C and 24( S ),25-EC against human SMO (PDB: 5L7D) predicts oxysterol binding to the CBP (gray mesh encompasses residues in aqua). The CBP is composed of intracellular loops and portions of transmembrane domains (TMDs) 1 (T251-I266), 3 (W339-L346), 6 (N446-I454), and 7 (W535-T553) and is distant from the CRD (red). Residues D255 and N446 (corresponding to D259 and N450 in mouse SMO) are predicted to form hydrogen bonds (dashed lines) with the carbon 3 hydroxyl and iso-octyl tail oxygens, respectively, of 24k-C (E) and 24( S ),25-EC (F). Hydrogen bond lengths are shown in angstroms (Å). (G) qRT-PCR assessment of Gli1 expression in ciliated Smo − / − MEFs expressing wild-type mouse SMO, SMO Y134F , SMO D259R , SMO N450D , or SMO Y134F, D259R and treated with vehicle (ethanol), 100 nM SAG, or 30 μM 7β-DHC or 24( S ),25-EC. Data are normalized to Gli1 expression in wild-type SMO-expressing cells treated with vehicle. Y134F substitution in the CRD attenuates the ability of 7β-DHC and 24( S ),25-EC to induce Gli1 , whereas D259R and N450D substitutions in the CBP attenuate the effect of 24( S ),25-EC. Combined substitutions in the CRD and CBP block the effects of cilia-associated oxysterols and attenuate the effect of SAG. (H) Ciliary fluorescence intensity of NIH/3T3 cells stably expressing mouse SMO-, SMO Y134F -, SMO D259R -, SMO N450D -, or SMO Y134F, D259R -EGFP treated with vehicle (ethanol), 100 nM SAG, 1 μg/mL SHH, or 30 μM 7β-DHC or 24( S ),25-EC. Data are from 2 separate cell lines normalized to the average intensity in cells expressing wild-type SMO-EGFP and treated with vehicle. Y134F substitution in the CRD specifically blocks the ability of 7β-DHC to induce SMO accumulation in cilia, whereas the D259R and N450D substitutions in the CBP block the effect 24( S ),25-EC. Combined substitutions in the CRD and CBP block the effect of cilia-associated oxysterols and SHH and substantially attenuate the effect of SAG. (I) Docking of 24( S ),25-EC against human SMO predicts van der Waals interactions between cilia-associated oxysterols and W535 of the CBP, the residue mutated in SMOM2. Interaction lengths are shown in Å. (J) Luciferase activity of ciliated Smo − / − MEFs co-transfected with Gli -luciferase reporter and oncogenic constitutively active form of SMO, SMOM2 (SMO W535L ), SMOM2 Y134F , SMOM2 D259R , or SMOM2 Y134F, D259R . Data are normalized to SMOM2 activity. Y134F substitution in the CRD, D259R substitution in the CBP, and combined substitutions in the CRD and CBP inhibit the activity of SMOM2. (K) Ciliary fluorescence intensity of NIH/3T3 cells stably expressing mouse SMOM2- or SMOM2 Y134F, D259R -EGFP. Data are from 2 separate cell lines normalized to the average ciliary intensity of cells expressing SMOM2-EGFP. Combined substitutions in the CRD and CBP block SMOM2 accumulation in cilia. .

    Techniques Used: Binding Assay, Quantitative RT-PCR, Expressing, Blocking Assay, Fluorescence, Stable Transfection, Luciferase, Activity Assay, Transfection

    Cilia contain oxysterols that bind the CRD, activate the Hedgehog pathway and cause SMO to accumulate in cilia. (A) Immunofluorescence of a sea urchin embryo stained for cilia (acetylated tubulin [Tub Ac ], red) and nuclei (DAPI, blue). The scale bar represents 10μm. (B) Immunoblot of lysates from sea urchin cilia, de-ciliated embryos, and whole sea urchin embryos. The ciliary fraction is enriched for Tub Ac and does not contain detectable components of the cytoplasm (β -actin). (C) HPLC-MS/MS quantitation of oxysterols extracted from de-ciliated sea urchin embryos (black) and isolated cilia (green). Data are normalized to protein concentration and plotted relative to oxysterol levels in whole embryos (dashed line). 7k-C, 7β-DHC, 24k-C, and 24( S ),25-EC are enriched in sea urchin embryo cilia. (D) Anti-Myc immunoblot of detergent-solubilized membranes from HEK293S cells expressing SMO-Myc and incubated with 20( S )-yne affinity resin in the presence of 50 mM 20( S )-OHC, 7β-DHC, or 24( S ),25-EC in ethanol. 20( S )-OHC, 7β-DHC, and 24( S ),25-EC all interfere with the binding of SMO-Myc to 20( S )-yne affinity resin, indicating that they bind the CRD. (E–H) qRT-PCR assessment of Gli1 (E and G) and Ptch1 (F and H) expression by ciliated NIH/3T3 cells treated with vehicle (ethanol), 100 nM SAG, 7β-DHC (E and F), or 24( S ),25-EC (G and H). Data are normalized to vehicle control. 7β-DHC and 24( S ),25-EC activate the HH pathway in a dose-dependent manner. (I) qRT-PCR assessment of Gli1 expression by ciliated NIH/3T3 cells treated with vehicle (ethanol), 10 mM 7β-DHC, 10 mM 24( S ),25-EC, or both. Data are normalized to vehicle control. 7β-DHC and 24( S ),25-EC synergistically activate the HH pathway. (J) Luciferase activity in ciliated Smo − / − MEFs co-transfected with Gli- luciferase reporter and empty vector (EV), SMO, or SMOΔCRD and treated with vehicle (ethanol), SHHN conditioned media, 10 nm SAG1.5, or ethanol complexed with 30 mM 7β-DHC. Data are normalized to activity in cells expressing SMO and treated with vehicle control. 7β-DHC requires the CRD to activate the HH pathway.. (K) Luciferase activity in ciliated Smo − / − MEFs co-transfected with Gli- luciferase reporter and EV, SMO, or SMOΔCRD and treated with vehicle (1 mM MβCD) or MβCD complexed with 30 μM cilia-associated oxysterols. Data are normalized to activity in cells expressing SMO and treated with vehicle control. 24k-C and 24( S ),25-EC do not require the CRD to activate the HH pathway. (L and M) Ciliary fluorescence intensity from NIH/3T3 cells stably expressing SMO-EGFP or SMOY134F-EGFP and treated with vehicle (ethanol) or 30 mM 7β,27-DHC (L) or 24( S ),25-EC (M). Data are from 2 separate stable cell lines normalized to the average ciliary intensity of SMO-EGFP of cells treated with vehicle. Cilia-associated oxysterols induce SMO accumulation in cilia. Y134F substitution in the CRD blocks the effect of 7β,27-OHC, but not 24( S ),25-EC, on ciliary accumulation, further suggesting that 24( S ),25-EC can activate SMO independently of the CRD. .
    Figure Legend Snippet: Cilia contain oxysterols that bind the CRD, activate the Hedgehog pathway and cause SMO to accumulate in cilia. (A) Immunofluorescence of a sea urchin embryo stained for cilia (acetylated tubulin [Tub Ac ], red) and nuclei (DAPI, blue). The scale bar represents 10μm. (B) Immunoblot of lysates from sea urchin cilia, de-ciliated embryos, and whole sea urchin embryos. The ciliary fraction is enriched for Tub Ac and does not contain detectable components of the cytoplasm (β -actin). (C) HPLC-MS/MS quantitation of oxysterols extracted from de-ciliated sea urchin embryos (black) and isolated cilia (green). Data are normalized to protein concentration and plotted relative to oxysterol levels in whole embryos (dashed line). 7k-C, 7β-DHC, 24k-C, and 24( S ),25-EC are enriched in sea urchin embryo cilia. (D) Anti-Myc immunoblot of detergent-solubilized membranes from HEK293S cells expressing SMO-Myc and incubated with 20( S )-yne affinity resin in the presence of 50 mM 20( S )-OHC, 7β-DHC, or 24( S ),25-EC in ethanol. 20( S )-OHC, 7β-DHC, and 24( S ),25-EC all interfere with the binding of SMO-Myc to 20( S )-yne affinity resin, indicating that they bind the CRD. (E–H) qRT-PCR assessment of Gli1 (E and G) and Ptch1 (F and H) expression by ciliated NIH/3T3 cells treated with vehicle (ethanol), 100 nM SAG, 7β-DHC (E and F), or 24( S ),25-EC (G and H). Data are normalized to vehicle control. 7β-DHC and 24( S ),25-EC activate the HH pathway in a dose-dependent manner. (I) qRT-PCR assessment of Gli1 expression by ciliated NIH/3T3 cells treated with vehicle (ethanol), 10 mM 7β-DHC, 10 mM 24( S ),25-EC, or both. Data are normalized to vehicle control. 7β-DHC and 24( S ),25-EC synergistically activate the HH pathway. (J) Luciferase activity in ciliated Smo − / − MEFs co-transfected with Gli- luciferase reporter and empty vector (EV), SMO, or SMOΔCRD and treated with vehicle (ethanol), SHHN conditioned media, 10 nm SAG1.5, or ethanol complexed with 30 mM 7β-DHC. Data are normalized to activity in cells expressing SMO and treated with vehicle control. 7β-DHC requires the CRD to activate the HH pathway.. (K) Luciferase activity in ciliated Smo − / − MEFs co-transfected with Gli- luciferase reporter and EV, SMO, or SMOΔCRD and treated with vehicle (1 mM MβCD) or MβCD complexed with 30 μM cilia-associated oxysterols. Data are normalized to activity in cells expressing SMO and treated with vehicle control. 24k-C and 24( S ),25-EC do not require the CRD to activate the HH pathway. (L and M) Ciliary fluorescence intensity from NIH/3T3 cells stably expressing SMO-EGFP or SMOY134F-EGFP and treated with vehicle (ethanol) or 30 mM 7β,27-DHC (L) or 24( S ),25-EC (M). Data are from 2 separate stable cell lines normalized to the average ciliary intensity of SMO-EGFP of cells treated with vehicle. Cilia-associated oxysterols induce SMO accumulation in cilia. Y134F substitution in the CRD blocks the effect of 7β,27-OHC, but not 24( S ),25-EC, on ciliary accumulation, further suggesting that 24( S ),25-EC can activate SMO independently of the CRD. .

    Techniques Used: Immunofluorescence, Staining, High Performance Liquid Chromatography, Mass Spectrometry, Quantitation Assay, Isolation, Protein Concentration, Expressing, Incubation, Binding Assay, Quantitative RT-PCR, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Fluorescence, Stable Transfection

    HSD11β2 promotes Hedgehog pathway activation and cause SMO to accumulate in cilia in a manner that requires the CRD. (A) RNA sequencing of medulloblastomas from P35 Math1-Cre SmoM2 c/WT mice compared to control cerebella of P35 SmoM2 c/WT littermates indicates that HSD11β2 expression is 864 ± 82-fold higher in HH pathway-associated medulloblastoma. (B) Re-analysis of human transcriptome data SPR008292 indicates that HSD11β2 expression is highest in HH pathway-associated medulloblastoma. Data are shown in a.u. (C) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − and Sufu − / − MEFs treated with vehicle (water) or 1% MβCD and 20 μM pravastatin to deplete sterols. Data are normalized to vehicle treatment. Sterol depletion inhibits HH pathway activation caused by loss of PTCH1, but not loss of SUFU, consistent with a critical role for sterols in SMO activation. (D) qRT-PCR assessment of HSD11β2 and Gli1 expression in ciliated Ptch1 − / − MEFs transduced with 1 of 2 different HSD11β2 shRNAs. Data are normalized to expression in scrambled shRNA control-transduced cells. HSD11β2 knockdown (KD) inhibits HH pathway activation downstream of PTCH1. (E) qRT-PCR assessment of HSD11β2 and Gli1 expression in ciliated Sufu − / − MEFs transduced with HSD11β2 shRNAs. Data are normalized to expression in scrambled shRNA control-transduced cells. HSD11β2 KD does not inhibit HH pathway activation caused by loss of SUFU, consistent with HSD11β2 acting at the level of SMO. (F) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs treated with vehicle (water) or CNX. Data are normalized to expression in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 inhibits HH signaling downstream of PTCH1 in a dose-dependent manner. (G) qRT-PCR assessment of Gli1 expression in ciliated Sufu − / − MEFs treated with vehicle (water) or 400 nM CNX. Data are normalized to expression in vehicle- treated cells. Pharmacologic inhibition of HSD11β2 does not inhibit HH pathway activation caused by loss of SUFU. (H) Luciferase activity of ciliated Smo − / − MEFs co-transfected with Gli -luciferase reporter and SMO or SMOΔCRD and treated with vehicle (water) or 1 μg/mL SHH, with or without 400 nM CNX. Data are normalized to luciferase activity of SMO-expressing cells treated with vehicle. The CRD is required for CNX to block HH pathway stimulation by SHH. (I) qRT-PCR assessment of Gli1 expression in ciliated NIH/3T3 cells treated with vehicle (water), 1 μg/mL SHH, or 100 nM SAG, with or without 400 nM CNX. Data are normalized to expression in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 blocks HH pathway stimulation by SHH or SAG. (J) Immunofluorescence of endogenous SMO (red) localization to cilia (ARL13B, green) in NIH/3T3 cells treated with vehicle (water), 1 μg/mL SHH, or 100 nM SAG, with or without 400 nM CNX. The scale bar represents 1 μm. (K) Quantitation of SMO ciliary immunofluorescence normalized to intensity in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 blocks SMO accumulation in cilia by SHH or SAG. .
    Figure Legend Snippet: HSD11β2 promotes Hedgehog pathway activation and cause SMO to accumulate in cilia in a manner that requires the CRD. (A) RNA sequencing of medulloblastomas from P35 Math1-Cre SmoM2 c/WT mice compared to control cerebella of P35 SmoM2 c/WT littermates indicates that HSD11β2 expression is 864 ± 82-fold higher in HH pathway-associated medulloblastoma. (B) Re-analysis of human transcriptome data SPR008292 indicates that HSD11β2 expression is highest in HH pathway-associated medulloblastoma. Data are shown in a.u. (C) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − and Sufu − / − MEFs treated with vehicle (water) or 1% MβCD and 20 μM pravastatin to deplete sterols. Data are normalized to vehicle treatment. Sterol depletion inhibits HH pathway activation caused by loss of PTCH1, but not loss of SUFU, consistent with a critical role for sterols in SMO activation. (D) qRT-PCR assessment of HSD11β2 and Gli1 expression in ciliated Ptch1 − / − MEFs transduced with 1 of 2 different HSD11β2 shRNAs. Data are normalized to expression in scrambled shRNA control-transduced cells. HSD11β2 knockdown (KD) inhibits HH pathway activation downstream of PTCH1. (E) qRT-PCR assessment of HSD11β2 and Gli1 expression in ciliated Sufu − / − MEFs transduced with HSD11β2 shRNAs. Data are normalized to expression in scrambled shRNA control-transduced cells. HSD11β2 KD does not inhibit HH pathway activation caused by loss of SUFU, consistent with HSD11β2 acting at the level of SMO. (F) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs treated with vehicle (water) or CNX. Data are normalized to expression in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 inhibits HH signaling downstream of PTCH1 in a dose-dependent manner. (G) qRT-PCR assessment of Gli1 expression in ciliated Sufu − / − MEFs treated with vehicle (water) or 400 nM CNX. Data are normalized to expression in vehicle- treated cells. Pharmacologic inhibition of HSD11β2 does not inhibit HH pathway activation caused by loss of SUFU. (H) Luciferase activity of ciliated Smo − / − MEFs co-transfected with Gli -luciferase reporter and SMO or SMOΔCRD and treated with vehicle (water) or 1 μg/mL SHH, with or without 400 nM CNX. Data are normalized to luciferase activity of SMO-expressing cells treated with vehicle. The CRD is required for CNX to block HH pathway stimulation by SHH. (I) qRT-PCR assessment of Gli1 expression in ciliated NIH/3T3 cells treated with vehicle (water), 1 μg/mL SHH, or 100 nM SAG, with or without 400 nM CNX. Data are normalized to expression in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 blocks HH pathway stimulation by SHH or SAG. (J) Immunofluorescence of endogenous SMO (red) localization to cilia (ARL13B, green) in NIH/3T3 cells treated with vehicle (water), 1 μg/mL SHH, or 100 nM SAG, with or without 400 nM CNX. The scale bar represents 1 μm. (K) Quantitation of SMO ciliary immunofluorescence normalized to intensity in vehicle-treated cells. Pharmacologic inhibition of HSD11β2 blocks SMO accumulation in cilia by SHH or SAG. .

    Techniques Used: Activation Assay, RNA Sequencing Assay, Mouse Assay, Expressing, Quantitative RT-PCR, Transduction, shRNA, Inhibition, Luciferase, Activity Assay, Transfection, Blocking Assay, Immunofluorescence, Quantitation Assay

    HSD11β2 and CYP27A1 participate in the biosynthesis of SMO-activating oxysterols. (A) Anti-Myc immunoblot of detergent-solubilized membranes from HEK293S cells expressing Myc-tagged SMO and incubated with 20( S )-yne affinity resin in the presence of 50 mM of the indicated oxysterols. 7β-DHC and 7k,27-OHC, but not 7k-C, compete for occupancy of 20( S )-yne affinity resin, indicating that 7β-DHC and 7k,27-OHC bind the CRD. (B) HPLC-MS/MS measurement of 7k-C in HEK293T cells transfected with empty vector or expressing HSD11β2 and incubated with vehicle (ethanol) or 10 mM 7a-OHC or 7β-OHC, with or without 400 nM CNX. Data are normalized to deuterated 7k-C internal standards and vehicle-treated cells transfected by CNX. (C) Immunofluorescence of a primary cilium (ARL13B, green), basal body (γ-tubulin, red), and nucleus (DAPI, blue) of a LLC-PK1 cell. The scale bar represents 5 μm. (D) Immunoblot of lysates from LLC-PK1 cells and isolated cilia. The ciliary fraction is enriched for the ciliary component acetylated tubulin (TubAc) and does not contain detectable components of the cytoplasm (β-actin) or Golgi (GM130) or HSD11β2. (E) HPLC-MS/MS measurement of 7k-C in LLC-PK1 cells and isolated cilia treated with vehicle (ethanol) or 400 nM CNX. Data are normalized to protein concentration in each sample relative to 7k-C of cells treated with vehicle. LLC-PK1 cilia are enriched in 7k-C, and pharmacologic inhibition of HSD11β2 reduces cellular and ciliary 7k-C. (F) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs transduced with scrambled control or HSD11β2 shRNAs and treated with 1 mM MβCD vehicle or 30 μM of the indicated oxysterols. Data are normalized to expression in cells transduced with scrambled shRNA and treated with vehicle. 7k-C, 7β-DHC, and 7k,27-OHC restore HH signaling to HSD11β2 -depleted cells. (G) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 −/− MEFs treated with 1 mM MβCD vehicle, 400 nM CNX, and 30 μM of the indicated oxysterols. Data are normalized to Gli1 expression in vehicle-treated cells. 7k-C, 7b,27-DHC, and 7k,27-OHC restore HH signaling after pharmacologic inhibition of HSD11β2. (H) HPLC-MS/MS measurement of 7k,27-OHC in HEK293S cells transfected with empty vector or expressing CYP27A1 and incubated with vehicle (ethanol) or 10 μM 7k-C. Data are normalized to deuterated 7k,27-OHC internal standards and vehicle-treated cells transfected with empty vector. CYP27A1 converts 7k-C to 7k,27-OHC. (I) Luciferase activity of ciliated LLC-PK1 cells co-transfected with Gli -luciferase reporter and empty vector or CYP27A1. Data are normalized to activity in empty vector transfected cells. CYP27A1 expression in LLC-PK1 cells is sufficient to activate HH pathway activity. (J) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs transduced with scrambled control or Cyp27a1 shRNAs and treated with 1 mM MβCD vehicle or 30 μM of the indicated oxysterols. Data are normalized to expression in cells transduced with scrambled shRNA and treated with vehicle. 7β-DHC and 7k,27-OHC, but not 7k-C, restore HH pathway activity in Cyp27a1 -depleted cells. (K) Model of the biosynthesis of SMO-activating oxysterols. .
    Figure Legend Snippet: HSD11β2 and CYP27A1 participate in the biosynthesis of SMO-activating oxysterols. (A) Anti-Myc immunoblot of detergent-solubilized membranes from HEK293S cells expressing Myc-tagged SMO and incubated with 20( S )-yne affinity resin in the presence of 50 mM of the indicated oxysterols. 7β-DHC and 7k,27-OHC, but not 7k-C, compete for occupancy of 20( S )-yne affinity resin, indicating that 7β-DHC and 7k,27-OHC bind the CRD. (B) HPLC-MS/MS measurement of 7k-C in HEK293T cells transfected with empty vector or expressing HSD11β2 and incubated with vehicle (ethanol) or 10 mM 7a-OHC or 7β-OHC, with or without 400 nM CNX. Data are normalized to deuterated 7k-C internal standards and vehicle-treated cells transfected by CNX. (C) Immunofluorescence of a primary cilium (ARL13B, green), basal body (γ-tubulin, red), and nucleus (DAPI, blue) of a LLC-PK1 cell. The scale bar represents 5 μm. (D) Immunoblot of lysates from LLC-PK1 cells and isolated cilia. The ciliary fraction is enriched for the ciliary component acetylated tubulin (TubAc) and does not contain detectable components of the cytoplasm (β-actin) or Golgi (GM130) or HSD11β2. (E) HPLC-MS/MS measurement of 7k-C in LLC-PK1 cells and isolated cilia treated with vehicle (ethanol) or 400 nM CNX. Data are normalized to protein concentration in each sample relative to 7k-C of cells treated with vehicle. LLC-PK1 cilia are enriched in 7k-C, and pharmacologic inhibition of HSD11β2 reduces cellular and ciliary 7k-C. (F) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs transduced with scrambled control or HSD11β2 shRNAs and treated with 1 mM MβCD vehicle or 30 μM of the indicated oxysterols. Data are normalized to expression in cells transduced with scrambled shRNA and treated with vehicle. 7k-C, 7β-DHC, and 7k,27-OHC restore HH signaling to HSD11β2 -depleted cells. (G) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 −/− MEFs treated with 1 mM MβCD vehicle, 400 nM CNX, and 30 μM of the indicated oxysterols. Data are normalized to Gli1 expression in vehicle-treated cells. 7k-C, 7b,27-DHC, and 7k,27-OHC restore HH signaling after pharmacologic inhibition of HSD11β2. (H) HPLC-MS/MS measurement of 7k,27-OHC in HEK293S cells transfected with empty vector or expressing CYP27A1 and incubated with vehicle (ethanol) or 10 μM 7k-C. Data are normalized to deuterated 7k,27-OHC internal standards and vehicle-treated cells transfected with empty vector. CYP27A1 converts 7k-C to 7k,27-OHC. (I) Luciferase activity of ciliated LLC-PK1 cells co-transfected with Gli -luciferase reporter and empty vector or CYP27A1. Data are normalized to activity in empty vector transfected cells. CYP27A1 expression in LLC-PK1 cells is sufficient to activate HH pathway activity. (J) qRT-PCR assessment of Gli1 expression in ciliated Ptch1 − / − MEFs transduced with scrambled control or Cyp27a1 shRNAs and treated with 1 mM MβCD vehicle or 30 μM of the indicated oxysterols. Data are normalized to expression in cells transduced with scrambled shRNA and treated with vehicle. 7β-DHC and 7k,27-OHC, but not 7k-C, restore HH pathway activity in Cyp27a1 -depleted cells. (K) Model of the biosynthesis of SMO-activating oxysterols. .

    Techniques Used: Expressing, Incubation, High Performance Liquid Chromatography, Mass Spectrometry, Transfection, Plasmid Preparation, Immunofluorescence, Isolation, Protein Concentration, Inhibition, Quantitative RT-PCR, Transduction, shRNA, Luciferase, Activity Assay

    22) Product Images from "Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets"

    Article Title: Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets

    Journal: PLoS Computational Biology

    doi: 10.1371/journal.pcbi.1003856

    Expression profiles of the S. japonicum cathepsin family at four developmental stages. (A) The heat map shows the hierarchical clustering of 21 S. japonicum cathepsin genes in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; M, adult male worms; F, adult female worms). The data were obtained from our microarray data. The color scale represents relative expression levels, with red as up-regulated and green as down-regulated. (B) The expression of 16 selected S. japonicum cathepsins at the four developmental stages was quantified by qRT-PCR analysis. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent the standard deviation for three technical replicates. The corresponding microarray gene expression data are presented below the bar graphs as heat maps, with up-regulated genes shown in red, down-regulated genes shown in green, and unchanged genes shown in black.
    Figure Legend Snippet: Expression profiles of the S. japonicum cathepsin family at four developmental stages. (A) The heat map shows the hierarchical clustering of 21 S. japonicum cathepsin genes in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; M, adult male worms; F, adult female worms). The data were obtained from our microarray data. The color scale represents relative expression levels, with red as up-regulated and green as down-regulated. (B) The expression of 16 selected S. japonicum cathepsins at the four developmental stages was quantified by qRT-PCR analysis. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent the standard deviation for three technical replicates. The corresponding microarray gene expression data are presented below the bar graphs as heat maps, with up-regulated genes shown in red, down-regulated genes shown in green, and unchanged genes shown in black.

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR, Software, Standard Deviation

    Expression analysis of six stage- and gender-specific or predominantly expressed genes using qRT-PCR. The expression was validated in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; M, adult male worms; F, adult female worms) by qRT-PCR analysis. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent the standard deviation for three technical replicates.
    Figure Legend Snippet: Expression analysis of six stage- and gender-specific or predominantly expressed genes using qRT-PCR. The expression was validated in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; M, adult male worms; F, adult female worms) by qRT-PCR analysis. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent the standard deviation for three technical replicates.

    Techniques Used: Expressing, Quantitative RT-PCR, Software, Standard Deviation

    Expression profiles of the S. japonicum 20S proteasome in the four developmental stages. (A) The transcriptional profile of the S. japonicum 20S proteasome consisted of 14 subunits in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; A, adult worm pairs; M, adult male worms; F, adult female worms). The data was obtained from our microarray dataset. The bar graphs represent the mean normalized fluorescent intensity values ( Table S5 ) for the subunits. * Subunits selected for further validation by qRT-PCR. (B) The expression of two subunits of the S. japonicum 20S proteasome was validated by qRT-PCR analysis in the four developmental stages. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent standard deviation for three technical replicates.
    Figure Legend Snippet: Expression profiles of the S. japonicum 20S proteasome in the four developmental stages. (A) The transcriptional profile of the S. japonicum 20S proteasome consisted of 14 subunits in the four developmental stages (E, eggs; C, cercariae; S, hepatic schistosomula; A, adult worm pairs; M, adult male worms; F, adult female worms). The data was obtained from our microarray dataset. The bar graphs represent the mean normalized fluorescent intensity values ( Table S5 ) for the subunits. * Subunits selected for further validation by qRT-PCR. (B) The expression of two subunits of the S. japonicum 20S proteasome was validated by qRT-PCR analysis in the four developmental stages. The relative expression levels of genes were calculated using SDS v1.4 software (Applied Biosystems). The error bars represent standard deviation for three technical replicates.

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR, Software, Standard Deviation

    23) Product Images from "Bidirectional Signaling through EphrinA2-EphA2 Enhances Osteoclastogenesis and Suppresses Osteoblastogenesis *Bidirectional Signaling through EphrinA2-EphA2 Enhances Osteoclastogenesis and Suppresses Osteoblastogenesis * S⃞"

    Article Title: Bidirectional Signaling through EphrinA2-EphA2 Enhances Osteoclastogenesis and Suppresses Osteoblastogenesis *Bidirectional Signaling through EphrinA2-EphA2 Enhances Osteoclastogenesis and Suppresses Osteoblastogenesis * S⃞

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M807598200

    c-Fos-dependent, NFATc1-independent induction of ephrinA2. A, qRT-PCR analysis of ephrinA2 expression. Wild-type ( WT ) and Fos KO splenocytes and WT bone marrow cells ( BM ) were cultured in the presence of RANKL for 1-3 days. ** , p
    Figure Legend Snippet: c-Fos-dependent, NFATc1-independent induction of ephrinA2. A, qRT-PCR analysis of ephrinA2 expression. Wild-type ( WT ) and Fos KO splenocytes and WT bone marrow cells ( BM ) were cultured in the presence of RANKL for 1-3 days. ** , p

    Techniques Used: Quantitative RT-PCR, Expressing, Cell Culture

    24) Product Images from "Viral delivery of shRNA to amygdala neurons leads to neurotoxicity and deficits in Pavlovian fear conditioning"

    Article Title: Viral delivery of shRNA to amygdala neurons leads to neurotoxicity and deficits in Pavlovian fear conditioning

    Journal: Neurobiology of learning and memory

    doi: 10.1016/j.nlm.2015.07.005

    Viral mediated shRNA expression within the BLA interferes with fear conditioning and leads to dysregulation of gene expression ( A ) AAV genome maps depicting viral genomes for viruses designed to: not express an shRNA (GFP only), contain shLuc or shArc with H1 promoter mutations (shArc(H1Δ), shLuc(H1Δ)), contain one copy of shLuc or shArc, or contain 4 copies of shLuc and shArc (shLuc(4), shArc(4)). ( B ) 293FT cells were transfected with plasmids designed to express AAV-shArc or AAV-shArc(4) and were harvested 48 hrs post-transfection to examine shArc RNA levels via qRT-PCR. AAV-shArc displayed less shRNA expression compared to shArc(4) (p = 0.00164). ( C ) 293FT cells were co-transfected with a plasmid designed to express Arc-RFP and the AAV viral plasmids depicted in A and these were imaged for GFP(ii, iv, vi, viii, x, xii, xiv) and Arc-RFP(i, iii, v, vii, ix, xi, xiii) 96 hrs post-transfection. An observable decrease in Arc-RFP signal is only observed in cells transfected with either shArc or shArc(4), as compared to all other groups. ( D ) 293FT cells were transfected with a plasmid designed to express Arc-RFP and either shArc, shArc(4), shLuc or shLuc(4) plasmids. Forty eight hrs post-transfection, the cells were harvested and Arc mRNA levels were assessed via qRT-PCR. ShArc and shArc(4) exhibited lower Arc mRNA levels compared to the shLuc and shLuc(4) groups (p
    Figure Legend Snippet: Viral mediated shRNA expression within the BLA interferes with fear conditioning and leads to dysregulation of gene expression ( A ) AAV genome maps depicting viral genomes for viruses designed to: not express an shRNA (GFP only), contain shLuc or shArc with H1 promoter mutations (shArc(H1Δ), shLuc(H1Δ)), contain one copy of shLuc or shArc, or contain 4 copies of shLuc and shArc (shLuc(4), shArc(4)). ( B ) 293FT cells were transfected with plasmids designed to express AAV-shArc or AAV-shArc(4) and were harvested 48 hrs post-transfection to examine shArc RNA levels via qRT-PCR. AAV-shArc displayed less shRNA expression compared to shArc(4) (p = 0.00164). ( C ) 293FT cells were co-transfected with a plasmid designed to express Arc-RFP and the AAV viral plasmids depicted in A and these were imaged for GFP(ii, iv, vi, viii, x, xii, xiv) and Arc-RFP(i, iii, v, vii, ix, xi, xiii) 96 hrs post-transfection. An observable decrease in Arc-RFP signal is only observed in cells transfected with either shArc or shArc(4), as compared to all other groups. ( D ) 293FT cells were transfected with a plasmid designed to express Arc-RFP and either shArc, shArc(4), shLuc or shLuc(4) plasmids. Forty eight hrs post-transfection, the cells were harvested and Arc mRNA levels were assessed via qRT-PCR. ShArc and shArc(4) exhibited lower Arc mRNA levels compared to the shLuc and shLuc(4) groups (p

    Techniques Used: shRNA, Expressing, Transfection, Quantitative RT-PCR, Plasmid Preparation

    Virally mediated RNAi induced depletion of GluN2A within BLA neurons impairs Pavlovian fear conditioning, as compared to the GFP only, shLuc, shArc and shEgr1 groups ( A ) AAV genome maps depicting viral genomes for viruses designed to express GFP only, or in addition, one of the following shRNAs expression cassettes: shLuc, shCntrl, shArc, shEgr1, shGluN2A. ( B i–iv) 293FT cells were co-transfected with plasmids designed to express Egr1-RFP and shEgr1 (i, ii) or Egr1-RFP and shScram (iii, iv) and were imaged for GFP(ii, iv) and Egr1-RFP(i, iii) 96 hrs post-transfection. AAV-shEgr1 causes an observable decrease in Egr1-RFP signal compared to AAV-shScram (i vs. iii). ( C ) 293FT cells were treated in a similar manner as in B, but they were harvested 48 hrs post-transfection and used to asses Egr1 mRNA levels via qRT-PCR. Cells transfected with AAV-shEgr1 exhibited a decrease in Egr1 mRNA levels compared to cells that received AAV-shScram. ( D ) 293FT cells were co-transfected with plasmids designed to express GluN2A and shGluN2A or GluN2A and shLuc. Forty eight hours later, cells were harvested and GluN2A mRNA levels were measured by qRT-PCR. GluN2A mRNA levels were significantly lower in cells transfected with AAV-shGluN2A as compared to cells transfected with AAV-shLuc (p = 0.0107). ( E–G ) Viruses from the above mentioned AAV plasmids were generated and infused bilaterally into the BLA at a titer of 1.60E+12 GC/mL. Twenty one days post infusion, the brains were extracted and processed via LMD/qRT-PCR to examine Arc, Egr1 and GluN2A mRNA levels. (GFP n = 6, shLuc n = 6, shCntrl n = 6, shArc n = 6, shEgr1 n = 8, shGluN2A n = 6). ( E ) Arc mRNA levels were relatively the same across all groups and were not significant across groups. ( F ) Egr1 mRNA levels were significantly lower in the shEgr1 group, compared to the GFP, shLuc, shArc, and shGluN2A groups (p
    Figure Legend Snippet: Virally mediated RNAi induced depletion of GluN2A within BLA neurons impairs Pavlovian fear conditioning, as compared to the GFP only, shLuc, shArc and shEgr1 groups ( A ) AAV genome maps depicting viral genomes for viruses designed to express GFP only, or in addition, one of the following shRNAs expression cassettes: shLuc, shCntrl, shArc, shEgr1, shGluN2A. ( B i–iv) 293FT cells were co-transfected with plasmids designed to express Egr1-RFP and shEgr1 (i, ii) or Egr1-RFP and shScram (iii, iv) and were imaged for GFP(ii, iv) and Egr1-RFP(i, iii) 96 hrs post-transfection. AAV-shEgr1 causes an observable decrease in Egr1-RFP signal compared to AAV-shScram (i vs. iii). ( C ) 293FT cells were treated in a similar manner as in B, but they were harvested 48 hrs post-transfection and used to asses Egr1 mRNA levels via qRT-PCR. Cells transfected with AAV-shEgr1 exhibited a decrease in Egr1 mRNA levels compared to cells that received AAV-shScram. ( D ) 293FT cells were co-transfected with plasmids designed to express GluN2A and shGluN2A or GluN2A and shLuc. Forty eight hours later, cells were harvested and GluN2A mRNA levels were measured by qRT-PCR. GluN2A mRNA levels were significantly lower in cells transfected with AAV-shGluN2A as compared to cells transfected with AAV-shLuc (p = 0.0107). ( E–G ) Viruses from the above mentioned AAV plasmids were generated and infused bilaterally into the BLA at a titer of 1.60E+12 GC/mL. Twenty one days post infusion, the brains were extracted and processed via LMD/qRT-PCR to examine Arc, Egr1 and GluN2A mRNA levels. (GFP n = 6, shLuc n = 6, shCntrl n = 6, shArc n = 6, shEgr1 n = 8, shGluN2A n = 6). ( E ) Arc mRNA levels were relatively the same across all groups and were not significant across groups. ( F ) Egr1 mRNA levels were significantly lower in the shEgr1 group, compared to the GFP, shLuc, shArc, and shGluN2A groups (p

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Generated, Laser Capture Microdissection

    Viral delivery of RNAi to the rat amygdala results in relatively weak fear conditioning ( A ) AAV genome maps for AAV-shLuc and AAV-shArc. ITR = inverted terminal repeats ( B ) 293FT cells were co-transfected with plasmids designed to express Arc-RFP and AAV-shLuc (i, ii) or Arc-RFP and AAV-shArc (iii, iv) and were imaged for GFP(ii, iv) and Arc-RFP(i, iii) 96 hrs post-transfection. AAV-shArc causes an observable decrease in Arc RFP signal compared to AAV-shLuc (i vs. iii). ( C ) 293FT cells were treated in a similar manner as in B, but they were harvested 48 hrs post-transfection and used to asses Arc mRNA levels via qRT-PCR. Cells transfected with AAV-shARC exhibited a decrease in Arc mRNA levels compared to cells that received AAV-shLuc (p = 0.0006). ( D ) Images of the BLA that received AAV2/DJ8 virus designed to express GFP; brightfield image (i), GFP fluorescence (ii). ( E ) Similar images as described in D, at different stages of laser microdissection of viral transduced BLA tissue. Brightfield and GFP images before LMD (i, ii) and after LMD (iii, iv). ( F ) AVV-shLuc and AAV-shArc viruses were infused into the BLA and 21 days post infusion the brains were extracted and processed via LMD/qRT-PCR to examine Arc mRNA levels (shArc, n = 6; shLuc, n = 5). Quantitative RT-PCR revealed a significant decrease of Arc mRNA in tissue transduced with the shArc virus compared to tissue transduced with shLuc virus (p = 0.0007). ( G–H ) Animals infused with either shLuc virus or shArc virus (shLuc n = 9, shArc n = 10) did not exhibit significant differences in freezing during STM ( G ) and LTM ( H ). Error bars represent standard error of the mean (SEM) (*** = p
    Figure Legend Snippet: Viral delivery of RNAi to the rat amygdala results in relatively weak fear conditioning ( A ) AAV genome maps for AAV-shLuc and AAV-shArc. ITR = inverted terminal repeats ( B ) 293FT cells were co-transfected with plasmids designed to express Arc-RFP and AAV-shLuc (i, ii) or Arc-RFP and AAV-shArc (iii, iv) and were imaged for GFP(ii, iv) and Arc-RFP(i, iii) 96 hrs post-transfection. AAV-shArc causes an observable decrease in Arc RFP signal compared to AAV-shLuc (i vs. iii). ( C ) 293FT cells were treated in a similar manner as in B, but they were harvested 48 hrs post-transfection and used to asses Arc mRNA levels via qRT-PCR. Cells transfected with AAV-shARC exhibited a decrease in Arc mRNA levels compared to cells that received AAV-shLuc (p = 0.0006). ( D ) Images of the BLA that received AAV2/DJ8 virus designed to express GFP; brightfield image (i), GFP fluorescence (ii). ( E ) Similar images as described in D, at different stages of laser microdissection of viral transduced BLA tissue. Brightfield and GFP images before LMD (i, ii) and after LMD (iii, iv). ( F ) AVV-shLuc and AAV-shArc viruses were infused into the BLA and 21 days post infusion the brains were extracted and processed via LMD/qRT-PCR to examine Arc mRNA levels (shArc, n = 6; shLuc, n = 5). Quantitative RT-PCR revealed a significant decrease of Arc mRNA in tissue transduced with the shArc virus compared to tissue transduced with shLuc virus (p = 0.0007). ( G–H ) Animals infused with either shLuc virus or shArc virus (shLuc n = 9, shArc n = 10) did not exhibit significant differences in freezing during STM ( G ) and LTM ( H ). Error bars represent standard error of the mean (SEM) (*** = p

    Techniques Used: Transfection, Quantitative RT-PCR, Fluorescence, Laser Capture Microdissection, Transduction

    25) Product Images from "Ibrutinib inhibits BTK-driven NF-κB p65 activity to overcome bortezomib-resistance in multiple myeloma"

    Article Title: Ibrutinib inhibits BTK-driven NF-κB p65 activity to overcome bortezomib-resistance in multiple myeloma

    Journal: Cell Cycle

    doi: 10.1080/15384101.2014.998067

    BTK inhibition via lenti-viral miRNA targeting enhances sensitivity to bortezomib in bortezomib-naïve and bortezomib-resistant MM cells. ( A ) qRT-PCR analysis of basal BTK mRNA expression in bortezomib-naïve and bortezomib-resistant MM
    Figure Legend Snippet: BTK inhibition via lenti-viral miRNA targeting enhances sensitivity to bortezomib in bortezomib-naïve and bortezomib-resistant MM cells. ( A ) qRT-PCR analysis of basal BTK mRNA expression in bortezomib-naïve and bortezomib-resistant MM

    Techniques Used: Inhibition, Quantitative RT-PCR, Expressing

    26) Product Images from "Genome-Wide Investigation and Expression Analyses of WD40 Protein Family in the Model Plant Foxtail Millet (Setaria italica L.)"

    Article Title: Genome-Wide Investigation and Expression Analyses of WD40 Protein Family in the Model Plant Foxtail Millet (Setaria italica L.)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0086852

    The relative expression ratio of 13 candidate SiWD40 genes analyzed using qRT-PCR under (A) dehydration stress, (B) salinity stress, (C) ABA treatment (D) Cold stress for 0, 1, 3, 6, 12, 24 and 48 h. The relative expression ratio of each gene was calculated relative to its expression in control sample (0 h). Act2 was used as an internal control to normalize the data. The error bars representing standard deviation were calculated based on three technical replicates for each biological duplicates.
    Figure Legend Snippet: The relative expression ratio of 13 candidate SiWD40 genes analyzed using qRT-PCR under (A) dehydration stress, (B) salinity stress, (C) ABA treatment (D) Cold stress for 0, 1, 3, 6, 12, 24 and 48 h. The relative expression ratio of each gene was calculated relative to its expression in control sample (0 h). Act2 was used as an internal control to normalize the data. The error bars representing standard deviation were calculated based on three technical replicates for each biological duplicates.

    Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

    27) Product Images from "Sendai virus, an RNA virus with no risk of genomic integration, delivers CRISPR/Cas9 for efficient gene editing"

    Article Title: Sendai virus, an RNA virus with no risk of genomic integration, delivers CRISPR/Cas9 for efficient gene editing

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1038/mtm.2016.57

    Sendai virus incorporating Cas9 and a guide RNA flanked by self-cleaving ribozymes replicates to high titer. ( a ) The negative-sense RNA genome is flanked by virus promoters (the 3’ leader (le), which serves as the genomic promoter, and the 5’ trailer (tr), which serves as the antigenomic promoter). Shown are the Sendai virus genes N (nucleoprotein), P (phosphoprotein), M (matrix), F (fusion protein), HN (attachment protein), and L (large RNA-dependent RNA polymerase). An EGFP-P2A-Cas9 cassette (5.1 kb) was inserted between N and P, and a guide RNA flanked by self-cleaving ribozymes (rbz 1 and 2) (0.2 kb total) was inserted between P and M (see Materials and Methods for further details). The ribozymes are only functional in the positive-sense, or 5’-to-3’, orientation. Genome may be transcribed from 3’ to 5’ into either full length antigenome or individual capped and polyadenylated mRNAs. These mRNAs are produced in a polar transcriptional gradient, with N mRNAs being the most abundant, and L mRNAs being the least abundant. ( b ) The self-cleaving hammerhead ribozyme sequences and structures are shown. The chimeric guide RNA is shown in orange, corresponding to the orange highlight in panel a . Arrows indicate sites of cleavage. ( c ) The self-cleavage activity of the ribozymes was assayed by qRT-PCR as described in Materials and Methods. Error bars represent standard deviation from 3 independent experiments. ( d ) rSeV-Cas9 (WT), or rSeV-Cas9 with both ribozymes mutated to abolish self-cleavage (Mut) (see Supplementary Figure S1 for mutations), was rescued from plasmid DNA as described in Materials and Methods. As EGFP is only expressed upon conversion of transfected antigenome to genome and subsequent virus mRNA production, rescue efficiency was determined by observing GFP+ cells (rescue events) by flow cytometry at 1–2 days post-transfection (dpt). Error bars represent standard deviation from 3 replicates. ns, not significant. ( e ) BSR-T7 cells were infected at a multiplicity of infection (MOI) of 0.01. The parental SeV has the EGFP reporter but lacks Cas9 and the guide RNA cassette. Error bars represent standard deviation from three replicates. There was no significant difference ( P > 0.05) between WT and Mut at any time point, two-way ANOVA followed by Bonferroni post-tests. ( f ) HEK293 cells in six-well were transfected with 2 ug px330 (from which the FLAG-tagged Cas9 in rSeV-Cas9 was derived) 6 or infected with rSeV-Cas9 at a MOI of 10. Cell lysates were collected 2 days later and processed via SDS-PAGE and Western blot analysis for detection of the FLAG epitope on Cas9. COX IV represents the loading control.
    Figure Legend Snippet: Sendai virus incorporating Cas9 and a guide RNA flanked by self-cleaving ribozymes replicates to high titer. ( a ) The negative-sense RNA genome is flanked by virus promoters (the 3’ leader (le), which serves as the genomic promoter, and the 5’ trailer (tr), which serves as the antigenomic promoter). Shown are the Sendai virus genes N (nucleoprotein), P (phosphoprotein), M (matrix), F (fusion protein), HN (attachment protein), and L (large RNA-dependent RNA polymerase). An EGFP-P2A-Cas9 cassette (5.1 kb) was inserted between N and P, and a guide RNA flanked by self-cleaving ribozymes (rbz 1 and 2) (0.2 kb total) was inserted between P and M (see Materials and Methods for further details). The ribozymes are only functional in the positive-sense, or 5’-to-3’, orientation. Genome may be transcribed from 3’ to 5’ into either full length antigenome or individual capped and polyadenylated mRNAs. These mRNAs are produced in a polar transcriptional gradient, with N mRNAs being the most abundant, and L mRNAs being the least abundant. ( b ) The self-cleaving hammerhead ribozyme sequences and structures are shown. The chimeric guide RNA is shown in orange, corresponding to the orange highlight in panel a . Arrows indicate sites of cleavage. ( c ) The self-cleavage activity of the ribozymes was assayed by qRT-PCR as described in Materials and Methods. Error bars represent standard deviation from 3 independent experiments. ( d ) rSeV-Cas9 (WT), or rSeV-Cas9 with both ribozymes mutated to abolish self-cleavage (Mut) (see Supplementary Figure S1 for mutations), was rescued from plasmid DNA as described in Materials and Methods. As EGFP is only expressed upon conversion of transfected antigenome to genome and subsequent virus mRNA production, rescue efficiency was determined by observing GFP+ cells (rescue events) by flow cytometry at 1–2 days post-transfection (dpt). Error bars represent standard deviation from 3 replicates. ns, not significant. ( e ) BSR-T7 cells were infected at a multiplicity of infection (MOI) of 0.01. The parental SeV has the EGFP reporter but lacks Cas9 and the guide RNA cassette. Error bars represent standard deviation from three replicates. There was no significant difference ( P > 0.05) between WT and Mut at any time point, two-way ANOVA followed by Bonferroni post-tests. ( f ) HEK293 cells in six-well were transfected with 2 ug px330 (from which the FLAG-tagged Cas9 in rSeV-Cas9 was derived) 6 or infected with rSeV-Cas9 at a MOI of 10. Cell lysates were collected 2 days later and processed via SDS-PAGE and Western blot analysis for detection of the FLAG epitope on Cas9. COX IV represents the loading control.

    Techniques Used: Functional Assay, Produced, Activity Assay, Quantitative RT-PCR, Standard Deviation, Plasmid Preparation, Transfection, Flow Cytometry, Cytometry, Infection, Derivative Assay, SDS Page, Western Blot, FLAG-tag

    28) Product Images from "High KRT8 expression promotes tumor progression and metastasis of gastric cancer"

    Article Title: High KRT8 expression promotes tumor progression and metastasis of gastric cancer

    Journal: Cancer Science

    doi: 10.1111/cas.13120

    The expression of KRT 8 in gastric cancer tissues and paired adjacent normal tissues and cell lines. (a) KRT 8 mRNA expression analysis in GC tissues ( n = 50) and normal tissues ( n = 36) by using ONCOMINE . (b) The mRNA level of KRT 8 in 50 pairs of GC and normal tissue was detected by qRT ‐ PCR . Upregulation of KRT 8 was found in 68% (34/50) of the selected patients. (c) Representative immunohistochemical staining of KRT 8 in gastric cancer tissues (middle) and adjacent normal tissues (left) (Original magnification ×200) and H E staining (Original magnification ×100). (d) Expression levels of KRT 8were checked in a panel of five human GC cell lines using immunoblotting. (Scale bar: 100 μM.) ** P
    Figure Legend Snippet: The expression of KRT 8 in gastric cancer tissues and paired adjacent normal tissues and cell lines. (a) KRT 8 mRNA expression analysis in GC tissues ( n = 50) and normal tissues ( n = 36) by using ONCOMINE . (b) The mRNA level of KRT 8 in 50 pairs of GC and normal tissue was detected by qRT ‐ PCR . Upregulation of KRT 8 was found in 68% (34/50) of the selected patients. (c) Representative immunohistochemical staining of KRT 8 in gastric cancer tissues (middle) and adjacent normal tissues (left) (Original magnification ×200) and H E staining (Original magnification ×100). (d) Expression levels of KRT 8were checked in a panel of five human GC cell lines using immunoblotting. (Scale bar: 100 μM.) ** P

    Techniques Used: Expressing, Quantitative RT-PCR, Immunohistochemistry, Staining

    29) Product Images from "Analysis of the in planta transcriptome expressed by the corn pathogen Pantoea stewartii subsp. stewartii via RNA-Seq"

    Article Title: Analysis of the in planta transcriptome expressed by the corn pathogen Pantoea stewartii subsp. stewartii via RNA-Seq

    Journal: PeerJ

    doi: 10.7717/peerj.3237

    Differential mRNA expression in planta. Whole transcriptome data (averaged normalized RPM) of the P. stewartii DC283 strain grown in planta versus the pre-inoculum in vitro liquid culture (A) or an in vitro plate culture (B). A gray filled circle is used to represent each gene. The green and red lines represent the four-fold expression ratio cutoff, where any points that fall outside of them are considered upregulated (green) or downregulated (red) in planta . Genes validated through qRT-PCR are represented as filled green (upregulated), red (downregulated), or black (below the four-fold regulation parameter) circles.
    Figure Legend Snippet: Differential mRNA expression in planta. Whole transcriptome data (averaged normalized RPM) of the P. stewartii DC283 strain grown in planta versus the pre-inoculum in vitro liquid culture (A) or an in vitro plate culture (B). A gray filled circle is used to represent each gene. The green and red lines represent the four-fold expression ratio cutoff, where any points that fall outside of them are considered upregulated (green) or downregulated (red) in planta . Genes validated through qRT-PCR are represented as filled green (upregulated), red (downregulated), or black (below the four-fold regulation parameter) circles.

    Techniques Used: Expressing, In Vitro, Quantitative RT-PCR

    Relative gene expression from the RNA-Seq and qRT-PCR data. Changes in expression of ten select genes were compared between the RNA-Seq RPM analysis (white) and qRT-PCR analysis (black). Results are shown for the in planta culture data and the pre-inoculum in vitro liquid culture data (A and B) or plate in vitro culture data (C and D). The fold activation (A and C) or repression (B and D) for the in planta data is represented on a logarithmic scale. RNA-Seq results are averages of two experimental samples and qRT-PCR data represent two experimental samples analyzed in triplicate. For both RNA-Seq and qRT-PCR, the error bars were estimated using the sample standard error of the fold-change across the two independent biological replicates. The recF gene was used as the reference for normalization of the qRT-PCR results.
    Figure Legend Snippet: Relative gene expression from the RNA-Seq and qRT-PCR data. Changes in expression of ten select genes were compared between the RNA-Seq RPM analysis (white) and qRT-PCR analysis (black). Results are shown for the in planta culture data and the pre-inoculum in vitro liquid culture data (A and B) or plate in vitro culture data (C and D). The fold activation (A and C) or repression (B and D) for the in planta data is represented on a logarithmic scale. RNA-Seq results are averages of two experimental samples and qRT-PCR data represent two experimental samples analyzed in triplicate. For both RNA-Seq and qRT-PCR, the error bars were estimated using the sample standard error of the fold-change across the two independent biological replicates. The recF gene was used as the reference for normalization of the qRT-PCR results.

    Techniques Used: Expressing, RNA Sequencing Assay, Quantitative RT-PCR, In Vitro, Activation Assay

    30) Product Images from "Characterization of a knock-in mouse model of the homozygous p.V37I variant in Gjb2"

    Article Title: Characterization of a knock-in mouse model of the homozygous p.V37I variant in Gjb2

    Journal: Scientific Reports

    doi: 10.1038/srep33279

    Differential expression of Fcer1g, Lars2, Nnmt and Cuedc1 in the homozygous p.V37I knock-in (KI) mice. qRT-PCR was performed in inner ear cDNA samples of KI and WT mice (n = 6 each). Expression levels of Fcer1g, Lars2, Nnmt and Cuedc1 were normalized to that of the endogenous Gapdh controls.
    Figure Legend Snippet: Differential expression of Fcer1g, Lars2, Nnmt and Cuedc1 in the homozygous p.V37I knock-in (KI) mice. qRT-PCR was performed in inner ear cDNA samples of KI and WT mice (n = 6 each). Expression levels of Fcer1g, Lars2, Nnmt and Cuedc1 were normalized to that of the endogenous Gapdh controls.

    Techniques Used: Expressing, Knock-In, Mouse Assay, Quantitative RT-PCR

    31) Product Images from "miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1"

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1

    Journal: Frontiers in Pharmacology

    doi: 10.3389/fphar.2018.00275

    miR-203 inhibited hepatocyte lipids accumulation in vitro . (A) Transfection effect of miR-203 mimics was confirmed by qRT-PCR. (B) The cellular Oil Red staining (x200). (C) The cellular TG and TCH levels. (D,E) qRT-PCR and “Western blot” analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNP-α. ∗ p
    Figure Legend Snippet: miR-203 inhibited hepatocyte lipids accumulation in vitro . (A) Transfection effect of miR-203 mimics was confirmed by qRT-PCR. (B) The cellular Oil Red staining (x200). (C) The cellular TG and TCH levels. (D,E) qRT-PCR and “Western blot” analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNP-α. ∗ p

    Techniques Used: In Vitro, Transfection, Quantitative RT-PCR, Staining, Expressing

    miR-203 inhibited liver lipids accumulation in vivo . (A) Lenti-mir-203 and Lenti-NC expression in mice liver. (B) Expression of miR-203 was confirmed by qRT-PCR. (C) The liver tissues H E and Oil Red O staining (x100). (D) Liver triglyceride (TG) levels. (E,F) qRT-PCR and Western blot analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNF-α. ∗ p
    Figure Legend Snippet: miR-203 inhibited liver lipids accumulation in vivo . (A) Lenti-mir-203 and Lenti-NC expression in mice liver. (B) Expression of miR-203 was confirmed by qRT-PCR. (C) The liver tissues H E and Oil Red O staining (x100). (D) Liver triglyceride (TG) levels. (E,F) qRT-PCR and Western blot analysis for mRNA and protein expression of lipid metabolism markers PPAR-α ∗ SREBP-1, inflammation markers IL-6, TNF-α. ∗ p

    Techniques Used: In Vivo, Expressing, Mouse Assay, Quantitative RT-PCR, Staining, Western Blot

    miR-203 was down-regulated in EtOH-fed mice and EtOH-induced AML-12 cells. (A) Representative hematoxylin and eosin (H E) staining of liver tissues (×400). (B) Body weights and the liver to body weight ratio after ethanol feeding. (C) Hepatic triglyceride (TG) and total cholesterol (TCH) levels. (D) Serum ALT and AST levels. (E) One-step qRT-PCR for miR-203 expression in EtOH-fed mice liver tissues compared to normal liver tissues and AML-12 cell line. (F) AML-12 cell line was treated with ethanol (0, 50, 75, 100, 150, 200) mM for 24 h the cell viability. ∗ p
    Figure Legend Snippet: miR-203 was down-regulated in EtOH-fed mice and EtOH-induced AML-12 cells. (A) Representative hematoxylin and eosin (H E) staining of liver tissues (×400). (B) Body weights and the liver to body weight ratio after ethanol feeding. (C) Hepatic triglyceride (TG) and total cholesterol (TCH) levels. (D) Serum ALT and AST levels. (E) One-step qRT-PCR for miR-203 expression in EtOH-fed mice liver tissues compared to normal liver tissues and AML-12 cell line. (F) AML-12 cell line was treated with ethanol (0, 50, 75, 100, 150, 200) mM for 24 h the cell viability. ∗ p

    Techniques Used: Mouse Assay, Staining, AST Assay, Quantitative RT-PCR, Expressing

    32) Product Images from "Interferon-Lambda3 (IFN-?3) and Its Cognate Receptor Subunits in Tree Shrews (Tupaia belangeri): Genomic Sequence Retrieval, Molecular Identification and Expression Analysis"

    Article Title: Interferon-Lambda3 (IFN-?3) and Its Cognate Receptor Subunits in Tree Shrews (Tupaia belangeri): Genomic Sequence Retrieval, Molecular Identification and Expression Analysis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0060048

    Induction of ISGs by tsIFN-λ3 in TS-K5 cells. Cells were stimulated with tsIFN-λ3 containing (or mock containing) TS-K5 cell medium for 6h. Cellular RNA was extracted and mRNA level of tsOAS1 (A) and tsMx1 (B) was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the tsIFN-λ3 stimulated and normal lipofectamine™ 2000-treated culture medium.
    Figure Legend Snippet: Induction of ISGs by tsIFN-λ3 in TS-K5 cells. Cells were stimulated with tsIFN-λ3 containing (or mock containing) TS-K5 cell medium for 6h. Cellular RNA was extracted and mRNA level of tsOAS1 (A) and tsMx1 (B) was measured by qRT-PCR. Data are shown as fold change of expression obtained from comparison of the tsIFN-λ3 stimulated and normal lipofectamine™ 2000-treated culture medium.

    Techniques Used: Quantitative RT-PCR, Expressing

    Tissue distributions of tsIFNλR1 and tsIL10R2 in healthy tree shrews. Tissues including liver, heart, brain, lung, intestine, kidney, spleen, and stomach were collected from two male tree shrews. Relative amounts of (A) tsIFNλR1 and (B) tsIL10R2 mRNA were measured by qRT-PCR and normalized against GAPDH.
    Figure Legend Snippet: Tissue distributions of tsIFNλR1 and tsIL10R2 in healthy tree shrews. Tissues including liver, heart, brain, lung, intestine, kidney, spleen, and stomach were collected from two male tree shrews. Relative amounts of (A) tsIFNλR1 and (B) tsIL10R2 mRNA were measured by qRT-PCR and normalized against GAPDH.

    Techniques Used: Quantitative RT-PCR

    Expression patterns of tsIFN-λ3 on poly I:C transfection in TS-K5 cells. Cells were transfected with poly I:C and collected at the indicated times. tsIFN-λ3 mRNA was measured by qRT-PCR. Data were normalized against the house-keeping gene GAPDH. Data are mean values of two separate experiments, and the error bars represent SEMs.
    Figure Legend Snippet: Expression patterns of tsIFN-λ3 on poly I:C transfection in TS-K5 cells. Cells were transfected with poly I:C and collected at the indicated times. tsIFN-λ3 mRNA was measured by qRT-PCR. Data were normalized against the house-keeping gene GAPDH. Data are mean values of two separate experiments, and the error bars represent SEMs.

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR

    33) Product Images from "EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]"

    Article Title: EOBII Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] Controls Flower Opening by Functioning as a General Transcriptomic Switch 1 [C] [W]

    Journal: Plant Physiology

    doi: 10.1104/pp.111.176248

    qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental
    Figure Legend Snippet: qRT-PCR transcript accumulation analysis of PhEOBII from MD plants. A, Spatial analysis used total RNA from root, stem, stigma, anther, leaf, petal (P.) tube, petal (P.) limb, and sepal tissues collected at 4 pm (mean ± se ; n = 3). B, Floral developmental

    Techniques Used: Quantitative RT-PCR

    34) Product Images from "Genome-Wide Identification and Expression, Protein–Protein Interaction and Evolutionary Analysis of the Seed Plant-Specific BIG GRAIN and BIG GRAIN LIKE Gene Family"

    Article Title: Genome-Wide Identification and Expression, Protein–Protein Interaction and Evolutionary Analysis of the Seed Plant-Specific BIG GRAIN and BIG GRAIN LIKE Gene Family

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.01812

    Tissue and developmental stage-specific expression analysis of A. thaliana BG and BGL genes. (A) Heat map showing the expression of A. thaliana BG and BGL genes in different tissues and developmental stages (B) The qRT-PCR expression analysis of AthBG2 in different developmental stages and tissues. The expression in radicle stage was taken as control to compare the expression in other stages and tissues. UBQ10 was used as the endogenous control. The graph was plotted from the values of two biological replicates with three technical replicates each. The abbreviation of samples: RS, seeding radicle stage; CS, seeding cotyledon stage; seedling two-leaf stage; R22, rosette 22 days old; R32, rosette 32 days old; FB, flower bud; FO, flower open; MS, mature silique; MR, mature root. (C) Promoter activity of AthBG2 in different tissues and developmental stages of A. thaliana . (D) Promoter activity of AthBG2 during lateral root development.
    Figure Legend Snippet: Tissue and developmental stage-specific expression analysis of A. thaliana BG and BGL genes. (A) Heat map showing the expression of A. thaliana BG and BGL genes in different tissues and developmental stages (B) The qRT-PCR expression analysis of AthBG2 in different developmental stages and tissues. The expression in radicle stage was taken as control to compare the expression in other stages and tissues. UBQ10 was used as the endogenous control. The graph was plotted from the values of two biological replicates with three technical replicates each. The abbreviation of samples: RS, seeding radicle stage; CS, seeding cotyledon stage; seedling two-leaf stage; R22, rosette 22 days old; R32, rosette 32 days old; FB, flower bud; FO, flower open; MS, mature silique; MR, mature root. (C) Promoter activity of AthBG2 in different tissues and developmental stages of A. thaliana . (D) Promoter activity of AthBG2 during lateral root development.

    Techniques Used: Expressing, Quantitative RT-PCR, Mass Spectrometry, Activity Assay

    Promoter analysis and auxin-responsive expression study of BG and BGL genes. (A) Auxin-responsive elements in the BG and BGL promoters A. trichopoda, A. thaliana and O. sativa along with the Bayesian phylogram of proteins. (B) Heat map showing the auxin-dependent expression of A. thaliana BG and BGL genes. (C) The qRT-PCR expression analysis of AthBG2 in response to IAA treatments. Asterisk indicates a significant difference in expression in treatment in comparison to untreated control ( P
    Figure Legend Snippet: Promoter analysis and auxin-responsive expression study of BG and BGL genes. (A) Auxin-responsive elements in the BG and BGL promoters A. trichopoda, A. thaliana and O. sativa along with the Bayesian phylogram of proteins. (B) Heat map showing the auxin-dependent expression of A. thaliana BG and BGL genes. (C) The qRT-PCR expression analysis of AthBG2 in response to IAA treatments. Asterisk indicates a significant difference in expression in treatment in comparison to untreated control ( P

    Techniques Used: Expressing, Quantitative RT-PCR

    Related Articles

    Amplification:

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. .. In order to use the method of relative quantification, it was necessary to show that the amplification efficiency for the different gene sequences were roughly equivalent to the amplification efficiency of the reference sequence (rpl39 cDNA sequence) using each specifically defined primer and probe sets.

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ). .. MiRNAs were analyzed using TaqMan miRNA assays (Applied Biosystems) or Exiqon miRNA qPCR SYBR Green assays.

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’. .. Statistical Analysis Data analysis was performed using the statistical package included with Microsoft Excel (V16.11.1) or Prism software (Version 7.0d).

    Synthesized:

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1
    Article Snippet: Total RNA, including miRNA was extracted from mouse liver tissues, AML-12 cells using TRIzol reagents (Invitrogen, United States), and the first-strand cDNA was synthesized using transcriptor first-strand cDNA synthesis kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. .. Real-time quantitative PCR analyses for mRNA of Lipin1, PPAR-α, SREBP-1, IL-6, TNF-α, and GAPDH were performed in a detection system with SYBR-Green Master Mix (TaKaRa, Shiga, Japan). qRT-PCR primers were purchased from Invitrogen.

    Quantitative RT-PCR:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument. .. The expression of arginine kinase (CasAK) was determined in the same sample cDNAs as a reference gene for endpoint PCR and qRT-PCR assays.

    Article Title: Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity
    Article Snippet: .. In brief, total RNA was extracted as described for RACE PCR and used for the synthesis of cDNA using the Quantitect reverse transcription kit for real-time PCR (Qiagen). qRT-PCR primers were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: .. The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. ..

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ). .. MiRNAs were analyzed using TaqMan miRNA assays (Applied Biosystems) or Exiqon miRNA qPCR SYBR Green assays.

    Article Title: 0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein
    Article Snippet: .. The QRT-PCR primers and Taqman® probes for Tnrip-1 are primers 5′-GAAGGAGCTGTGCGGTCTGT-3′ and 5′-GGATCACCCCCTTGCAGTT-3′, and probe 5′-FAM- AAAGAAACACTCAACAGCCAGTTCGTGGA -TAMRA-3′ (Biosource International, Inc. Camarillo, CA), respectively. .. Recombinant His-tagged truncated Tnrip-1 protein (amino acid 40—187) was generated in E. coli , purified with Qiagen nickel-chelating resin (QIAGEN Inc., Valencia, CA), and then injected into rabbits to generate anti-Tnrip-1 polyclonal antibodies.

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: .. All qRT-PCR primers were purchased from Life Technologies. .. Each sample was analyzed in duplicate and the StepOne Plus software used to calculate relative quantitation values and express them as fold-change over controls.

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Article Title: Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis
    Article Snippet: .. Detail information of qRT-PCR Primers were provided in Additional file . qRT-PCR was performed with an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA), using the following condition: 95°C for 30 s followed by 40 cycles in 95°C for 5 s, 60°C for 30 s and 72°C for 31 s. The mRNA quantity of each gene was calculated with the 2-△△Ct method and normalized to the abundance of a house-keeping gene, Bmβ-actin (GenBank NO: EU780706.1). .. The relative mRNA levels of each gene were represented as folds over the expression levels of Bmβ-actin .

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto
    Article Snippet: .. RNA from IFN-λ2 treated bat PaKiT02 cells and primary cells lines derived from kidney, small intestine, brain, liver and lung was also extracted as described for RACE PCR. qRT-PCR primers for IFNλR1 and IL10R2 were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’. .. Statistical Analysis Data analysis was performed using the statistical package included with Microsoft Excel (V16.11.1) or Prism software (Version 7.0d).

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1
    Article Snippet: .. Real-time quantitative PCR analyses for mRNA of Lipin1, PPAR-α, SREBP-1, IL-6, TNF-α, and GAPDH were performed in a detection system with SYBR-Green Master Mix (TaKaRa, Shiga, Japan). qRT-PCR primers were purchased from Invitrogen. ..

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: .. Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies). .. QRT-PCR reactions were run on a CFX384 Real-Time System (Bio-Rad) with RPL-13, GAPDH and TBP as housekeeping genes for normalization.

    Article Title: Long lasting transcriptional refractoriness triggered by a single exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrimidine
    Article Snippet: .. The authors would like to thank the Hartwell Center for Bioinformatics and Biotechnology for the synthesis of qRT-PCR primers and probes, sequencing and for processing samples for Affymetrix GeneChip technology. ..

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer
    Article Snippet: .. Reverse transcription was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA). miR-301a and gene quantitation was determined by TaqMan™ analysis run on a QuantStudio 6 Flex PCR system (Thermo Fisher). qRT-PCR primers for gene and miR-301a expression were commercially available from Applied Biosystems (Foster City, CA). .. GAPDH and U6 small nuclear RNA (snRNA) were used as internal controls for gene and miRNA quantitation, respectively.

    SYBR Green Assay:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument. .. The expression of arginine kinase (CasAK) was determined in the same sample cDNAs as a reference gene for endpoint PCR and qRT-PCR assays.

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: MRNAs were analyzed after cDNA synthesis using Superscript II (Invitrogen) or qScript cDNA SuperMix (Quanta BioSciences) in a Viia7 real time-PCR system using SYBR green (both Applied Biosystems). .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ).

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto
    Article Snippet: RNA from IFN-λ2 treated bat PaKiT02 cells and primary cells lines derived from kidney, small intestine, brain, liver and lung was also extracted as described for RACE PCR. qRT-PCR primers for IFNλR1 and IL10R2 were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . .. Reactions were carried out using EXPRESS SYBR® GreenER™ qPCR Supermix Universal (Invitrogen) for cDNA and SuperScript® III Platinum® SYBR® Green One-Step qRT-PCR Kit (Invitrogen) for RNA in an Applied Biosystems 7500 Fast Real-Time qPCR instrument.

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1
    Article Snippet: .. Real-time quantitative PCR analyses for mRNA of Lipin1, PPAR-α, SREBP-1, IL-6, TNF-α, and GAPDH were performed in a detection system with SYBR-Green Master Mix (TaKaRa, Shiga, Japan). qRT-PCR primers were purchased from Invitrogen. ..

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: .. Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies). .. QRT-PCR reactions were run on a CFX384 Real-Time System (Bio-Rad) with RPL-13, GAPDH and TBP as housekeeping genes for normalization.

    Random Hexamer Labeling:

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Expressing:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: Paragraph title: Expression levels of ecdysone receptor (EcR ) and molt-inhibiting hormone (MIH ) using qRT-PCR assays ... The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument.

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ). .. Relative changes in mRNA and miRNA expression were determined using the 2−ΔΔCt method.

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: THP-1 and mouse lung mRNA expression were normalized against the endogenous control β-2-microglobulin for either human (Hs00984230_m1) or mouse (Mm00437762_m1), respectively, and measured relative to vehicle-treated controls for both cell culture and mouse samples. .. All qRT-PCR primers were purchased from Life Technologies.

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Article Title: Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis
    Article Snippet: Detail information of qRT-PCR Primers were provided in Additional file . qRT-PCR was performed with an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA), using the following condition: 95°C for 30 s followed by 40 cycles in 95°C for 5 s, 60°C for 30 s and 72°C for 31 s. The mRNA quantity of each gene was calculated with the 2-△△Ct method and normalized to the abundance of a house-keeping gene, Bmβ-actin (GenBank NO: EU780706.1). .. The relative mRNA levels of each gene were represented as folds over the expression levels of Bmβ-actin .

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. Differential expression was analyzed using Cuffquant with fragment-bias and multi-read corrections, and normalized across all samples using Cuffnorm with geometric library-size normalization ( ).

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: Relative gene expression was quantified using 2(−ΔΔCT) and a standard curve was generated based on the amplification of total RNA extracted from untreated cultured neurons. .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies). .. Relative fold expression levels of relevant genes were calculated using the Livak method .

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer
    Article Snippet: .. Reverse transcription was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA). miR-301a and gene quantitation was determined by TaqMan™ analysis run on a QuantStudio 6 Flex PCR system (Thermo Fisher). qRT-PCR primers for gene and miR-301a expression were commercially available from Applied Biosystems (Foster City, CA). .. GAPDH and U6 small nuclear RNA (snRNA) were used as internal controls for gene and miRNA quantitation, respectively.

    Derivative Assay:

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto
    Article Snippet: .. RNA from IFN-λ2 treated bat PaKiT02 cells and primary cells lines derived from kidney, small intestine, brain, liver and lung was also extracted as described for RACE PCR. qRT-PCR primers for IFNλR1 and IL10R2 were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    High Performance Liquid Chromatography:

    Article Title: Long lasting transcriptional refractoriness triggered by a single exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrimidine
    Article Snippet: The authors would like to thank the Hartwell Center for Bioinformatics and Biotechnology for the synthesis of qRT-PCR primers and probes, sequencing and for processing samples for Affymetrix GeneChip technology. .. The measurement of monoamine neurotransmitters in microdialysis perfusates using HPLC-ECD.

    Incubation:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: Expression levels of ecdysone receptor (EcR ) and molt-inhibiting hormone (MIH ) using qRT-PCR assays The eyestalk ganglia at different molt stages, from incubation and dsRNA injection experiments, were initially homogenized in 150 μl of ice-cold DEPC-treated PBS. .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument.

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Northern Blot:

    Article Title: 0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein
    Article Snippet: Northern Blot analyses were performed using full-length Tnrip-1 coding cDNA as the probe, as described previously [ ]. .. The QRT-PCR primers and Taqman® probes for Tnrip-1 are primers 5′-GAAGGAGCTGTGCGGTCTGT-3′ and 5′-GGATCACCCCCTTGCAGTT-3′, and probe 5′-FAM- AAAGAAACACTCAACAGCCAGTTCGTGGA -TAMRA-3′ (Biosource International, Inc. Camarillo, CA), respectively.

    Cell Culture:

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: THP-1 and mouse lung mRNA expression were normalized against the endogenous control β-2-microglobulin for either human (Hs00984230_m1) or mouse (Mm00437762_m1), respectively, and measured relative to vehicle-treated controls for both cell culture and mouse samples. .. All qRT-PCR primers were purchased from Life Technologies.

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: Relative gene expression was quantified using 2(−ΔΔCT) and a standard curve was generated based on the amplification of total RNA extracted from untreated cultured neurons. .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.

    Generated:

    Article Title: 0610009K11Rik, a testis-specific and germ cell nuclear receptor-interacting protein
    Article Snippet: Sense or antisense 35 S-labeled cRNA probes were generated using appropriate polymerases from a mouse-specific cDNA for Tnrip-1 (154-657 nucleotides of 0610009K11Rik). .. The QRT-PCR primers and Taqman® probes for Tnrip-1 are primers 5′-GAAGGAGCTGTGCGGTCTGT-3′ and 5′-GGATCACCCCCTTGCAGTT-3′, and probe 5′-FAM- AAAGAAACACTCAACAGCCAGTTCGTGGA -TAMRA-3′ (Biosource International, Inc. Camarillo, CA), respectively.

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: Relative gene expression was quantified using 2(−ΔΔCT) and a standard curve was generated based on the amplification of total RNA extracted from untreated cultured neurons. .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: Complementary DNA was generated with the QuantiTect Reverse Transcription kit (Qiagen). .. Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument. .. The expression of arginine kinase (CasAK) was determined in the same sample cDNAs as a reference gene for endpoint PCR and qRT-PCR assays.

    Article Title: Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity
    Article Snippet: .. In brief, total RNA was extracted as described for RACE PCR and used for the synthesis of cDNA using the Quantitect reverse transcription kit for real-time PCR (Qiagen). qRT-PCR primers were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ). .. MiRNAs were analyzed using TaqMan miRNA assays (Applied Biosystems) or Exiqon miRNA qPCR SYBR Green assays.

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto
    Article Snippet: .. RNA from IFN-λ2 treated bat PaKiT02 cells and primary cells lines derived from kidney, small intestine, brain, liver and lung was also extracted as described for RACE PCR. qRT-PCR primers for IFNλR1 and IL10R2 were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: The PCR reaction conditions were: 15 s denaturation at 95°C and coupled annealing and extension for 1 min at 60°C for 40 cycles. .. The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer
    Article Snippet: .. Reverse transcription was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA). miR-301a and gene quantitation was determined by TaqMan™ analysis run on a QuantStudio 6 Flex PCR system (Thermo Fisher). qRT-PCR primers for gene and miR-301a expression were commercially available from Applied Biosystems (Foster City, CA). .. GAPDH and U6 small nuclear RNA (snRNA) were used as internal controls for gene and miRNA quantitation, respectively.

    Injection:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: Expression levels of ecdysone receptor (EcR ) and molt-inhibiting hormone (MIH ) using qRT-PCR assays The eyestalk ganglia at different molt stages, from incubation and dsRNA injection experiments, were initially homogenized in 150 μl of ice-cold DEPC-treated PBS. .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument.

    RNA Sequencing Assay:

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Isolation:

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: Total RNA was isolated with Trizol or the miRNeasy Mini Kit (Qiagen). .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ).

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: Frozen tissue samples were from the Brain Tumor Tissue Bank (London, Canada) and ProteoGenex, Inc. Total RNA was isolated using an RNeasy Plus Mini kit (Qiagen) per the manufacturer's instructions and quantified by measurement at an optical density of 260 nm. .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems).

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1
    Article Snippet: Paragraph title: RNA Isolation and Quantitative Real-Time PCR ... Real-time quantitative PCR analyses for mRNA of Lipin1, PPAR-α, SREBP-1, IL-6, TNF-α, and GAPDH were performed in a detection system with SYBR-Green Master Mix (TaKaRa, Shiga, Japan). qRT-PCR primers were purchased from Invitrogen.

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: 2.6 Real time quantitative RT-PCR analysis RNA was isolated from keratinocytes using the RNeasy kit (Qiagen). .. Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies).

    Labeling:

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: .. Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Purification:

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: Paragraph title: RNA purification, cDNA preparation, and qRT-PCR. ... Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems).

    Sequencing:

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. .. In order to use the method of relative quantification, it was necessary to show that the amplification efficiency for the different gene sequences were roughly equivalent to the amplification efficiency of the reference sequence (rpl39 cDNA sequence) using each specifically defined primer and probe sets.

    Article Title: Long lasting transcriptional refractoriness triggered by a single exposure to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrimidine
    Article Snippet: .. The authors would like to thank the Hartwell Center for Bioinformatics and Biotechnology for the synthesis of qRT-PCR primers and probes, sequencing and for processing samples for Affymetrix GeneChip technology. ..

    Plasmid Preparation:

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. .. To determine this relative equivalence, plasmid DNA containing the appropriate cDNA sequences were diluted 1/1000, 1/10,000, 1/100,000, and 1/1,000,000 fold, and using the QPCR conditions described above, the efficiencies of amplification were calculated.

    Software:

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: .. The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. ..

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: .. PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ). .. MiRNAs were analyzed using TaqMan miRNA assays (Applied Biosystems) or Exiqon miRNA qPCR SYBR Green assays.

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: All qRT-PCR primers were purchased from Life Technologies. .. Each sample was analyzed in duplicate and the StepOne Plus software used to calculate relative quantitation values and express them as fold-change over controls.

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Real-time Polymerase Chain Reaction:

    Article Title: Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity
    Article Snippet: .. In brief, total RNA was extracted as described for RACE PCR and used for the synthesis of cDNA using the Quantitect reverse transcription kit for real-time PCR (Qiagen). qRT-PCR primers were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . ..

    Article Title: Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination
    Article Snippet: The QRT-PCR primers and TaqMan probes were designed using Primer Express® software v2.0 from Applied Biosystems and are listed in Table , below. .. To determine this relative equivalence, plasmid DNA containing the appropriate cDNA sequences were diluted 1/1000, 1/10,000, 1/100,000, and 1/1,000,000 fold, and using the QPCR conditions described above, the efficiencies of amplification were calculated.

    Article Title: A Screen in Mice Uncovers Repression of Lipoprotein Lipase by MicroRNA-29a as a Mechanism for Lipid Distribution Away From the Liver
    Article Snippet: Paragraph title: Quantitative PCR ... PCR amplification was performed at 50°C for 2 minutes and 95°C for 10 minutes, followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. qRT-PCR primers were designed using Primer Express software (Applied Biosystems) ( ).

    Article Title: Transcriptomic analysis of developmental features of Bombyx mori wing disc during metamorphosis
    Article Snippet: .. Detail information of qRT-PCR Primers were provided in Additional file . qRT-PCR was performed with an ABI7300 real-time PCR system (Applied Biosystems, Foster City, CA), using the following condition: 95°C for 30 s followed by 40 cycles in 95°C for 5 s, 60°C for 30 s and 72°C for 31 s. The mRNA quantity of each gene was calculated with the 2-△△Ct method and normalized to the abundance of a house-keeping gene, Bmβ-actin (GenBank NO: EU780706.1). .. The relative mRNA levels of each gene were represented as folds over the expression levels of Bmβ-actin .

    Article Title: Type III IFN Receptor Expression and Functional Characterisation in the Pteropid Bat, Pteropus alecto
    Article Snippet: RNA from IFN-λ2 treated bat PaKiT02 cells and primary cells lines derived from kidney, small intestine, brain, liver and lung was also extracted as described for RACE PCR. qRT-PCR primers for IFNλR1 and IL10R2 were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . .. Reactions were carried out using EXPRESS SYBR® GreenER™ qPCR Supermix Universal (Invitrogen) for cDNA and SuperScript® III Platinum® SYBR® Green One-Step qRT-PCR Kit (Invitrogen) for RNA in an Applied Biosystems 7500 Fast Real-Time qPCR instrument.

    Article Title: miR-203 Inhibits Alcohol-Induced Hepatic Steatosis by Targeting Lipin1
    Article Snippet: .. Real-time quantitative PCR analyses for mRNA of Lipin1, PPAR-α, SREBP-1, IL-6, TNF-α, and GAPDH were performed in a detection system with SYBR-Green Master Mix (TaKaRa, Shiga, Japan). qRT-PCR primers were purchased from Invitrogen. ..

    Article Title: Micro-scaled topographies direct differentiation of human epidermal stem cells
    Article Snippet: Quantitive (q)RT-PCR analysis was performed using qRT-PCR primers and Fast SYBR green master mix (Life Technologies). .. The following qPCR oligos sequences (forward and reverse sequences) were used: GCCTCAGCCTTACTGTGAGT and TGTTTCATTTGCTCCTGATGG (Involucrin), AAGGCCGGATGCCAGTTTAG and TGCTGAATGGCAACCATCAAA (Suprabasin), TGGAGGACTACCGCCGGTTCC and CGGTGACGGCCAGCCGTTTT (Envoplakin), GCAGAGTGACCTGGCTCGGCT and GCCGCATCCGCCTCTAGCAC (Periplakin), AACAGCTCATGAGGCTACG and AACAATGGAGGAAGGGCAGG (RPL-13), GAAGAGAGAGACCCTCACTGCTG and ACTGTGAGGAGGGGAGATTCAGT (GAPDH), GTGACCCAGCATCACTGTTTC and GAGCATCTCCAGCACACTCT (TBP).

    RNA Extraction:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: Total RNA extraction and cDNA synthesis were carried out as described above. .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument.

    Article Title: Nuclear Respiratory Factor 1 (NRF-1) Controls the Activity Dependent Transcription of the GABA-A Receptor Beta 1 Subunit Gene in Neurons
    Article Snippet: Paragraph title: RNA Extraction and qRT-PCR ... The qRT-PCR primers and probes for rat mRNAs were: NRF-1 , 57 bp amplicon (Assay ID: Rn01455958_m1, ThermoFisher Scientific); Gabrb1 , 81 bp amplicon (Assay ID: Rn00564146_m1, ThermoFisher Scientific); Ppia , 60 bp amplicon, forward primer: 5’- TGCAGACATGGTCAACCCC-3’, reverse primer: 5’- CCCAAGGGCTCGCCA-3’, TaqMan probe with TAMARA quencher: 5’- CCGTGTTCTTCGACATCACGGCTG-3’.

    Quantitation Assay:

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: All qRT-PCR primers were purchased from Life Technologies. .. Each sample was analyzed in duplicate and the StepOne Plus software used to calculate relative quantitation values and express them as fold-change over controls.

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer
    Article Snippet: .. Reverse transcription was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA). miR-301a and gene quantitation was determined by TaqMan™ analysis run on a QuantStudio 6 Flex PCR system (Thermo Fisher). qRT-PCR primers for gene and miR-301a expression were commercially available from Applied Biosystems (Foster City, CA). .. GAPDH and U6 small nuclear RNA (snRNA) were used as internal controls for gene and miRNA quantitation, respectively.

    Spectrophotometry:

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: RNA concentrations for each sample were quantified using a Nanodrop 2000 Spectrophotometer (ThermoFisher Scientific) and each sample was normalized to a final concentration of 25ng/μL in RNAse-free H2 O. qRT-PCR was performed utilizing reagents from the SuperScript III Platinum One-Step qRT-PCR Kit (Life Technologies, Grand Island, NY) on a StepOne Plus instrument (Applied Biosystems, Foster City, CA). .. All qRT-PCR primers were purchased from Life Technologies.

    Article Title: BMP and Hedgehog Regulate Distinct AGM Hematopoietic Stem Cells Ex Vivo
    Article Snippet: .. RNA Preparation, qRT-PCR, and RNA Sequencing For qRT-PCR, total RNA was extracted using TRIzol Reagent (Invitrogen) and quantitated by a NanoDrop 8000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies) or a 2100 Bioanalyzer (Agilent Technologies) with RNA 600 Pico chips (Agilent Technologies). cDNA was generated using SuperScript II Reverse Transcriptase (Invitrogen), from 1 μg of starting material. qRT-PCR primers ( ) were used with SYBR Green (Invitrogen) and Platinum Taq DNA Polymerase (Invitrogen), samples run on a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad), and analyzed with Bio-Rad CFX Manager v2.0 software. β-Actin was used as the internal reference. .. For RNA sequencing, RNA was isolated with the mirVana miRNA Kit and prepared according to SMARTER protocol for the Illumina HiSeq2000 sequencer.

    Article Title: Effect of miR-301a/PTEN pathway on the proliferation and apoptosis of cervical cancer
    Article Snippet: RNA measurements were quantitatively performed using nanodrop spectrophotometry (Thermo Fisher, Waltham, MA). .. Reverse transcription was performed using Moloney murine leukemia virus reverse transcriptase (Invitrogen, Carlsbad, CA). miR-301a and gene quantitation was determined by TaqMan™ analysis run on a QuantStudio 6 Flex PCR system (Thermo Fisher). qRT-PCR primers for gene and miR-301a expression were commercially available from Applied Biosystems (Foster City, CA).

    Concentration Assay:

    Article Title: Ecdysteroids Regulate the Levels of Molt-Inhibiting Hormone (MIH) Expression in the Blue Crab, Callinectes sapidus
    Article Snippet: The cDNA samples were diluted to the final concentration at 12.5 ng total RNA equivalent/μl. .. The eyestalk cDNA samples (25 ng of total RNA equivalent) were assayed in duplicate to estimate the levels of CasMIH and CasEcR1 using Fast SYBR Green Master Mix (Applied Biosystems) and qRT-PCR primers (listed in ) on an Applied Biosystems 7500 instrument.

    Article Title: Type III IFNs in Pteropid Bats: Differential Expression Patterns Provide Evidence for Distinct Roles in Antiviral Immunity
    Article Snippet: In brief, total RNA was extracted as described for RACE PCR and used for the synthesis of cDNA using the Quantitect reverse transcription kit for real-time PCR (Qiagen). qRT-PCR primers were designed using Primer Express 3.0 (Applied Biosystems) with default parameter settings and are listed in . .. For each reaction, 2 μl of 1:5 diluted cDNA and a final concentration of 200 nmol of each primer was used.

    Article Title: An Allergic Lung Microenvironment Suppresses Carbon Nanotube-Induced Inflammasome Activation via STAT6-Dependent Inhibition of Caspase-1
    Article Snippet: RNA concentrations for each sample were quantified using a Nanodrop 2000 Spectrophotometer (ThermoFisher Scientific) and each sample was normalized to a final concentration of 25ng/μL in RNAse-free H2 O. qRT-PCR was performed utilizing reagents from the SuperScript III Platinum One-Step qRT-PCR Kit (Life Technologies, Grand Island, NY) on a StepOne Plus instrument (Applied Biosystems, Foster City, CA). .. All qRT-PCR primers were purchased from Life Technologies.

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. Reactions were prepared using a 20-μl volume with a final concentration consisting of 1× TaqMan gene expression master mix, the NAPRT1 primer pair (225 nM), the RPLP0 primer pair (450 nM), the NAPRT1 probe (62.5 nM), the RPLP0 probe (125 nM), and 2 ng of cDNA.

    Control Assay:

    Article Title: The Small Molecule GMX1778 Is a Potent Inhibitor of NAD+ Biosynthesis: Strategy for Enhanced Therapy in Nicotinic Acid Phosphoribosyltransferase 1-Deficient Tumors ▿
    Article Snippet: Total RNA (0.1 μg) was transcribed using 60 μM random hexamer primers, 2.5 μM anchored oligonucleotide (dT)18 primers, 1 μM deoxynucleotide mix, 1 U/μl protector RNase inhibitor, and 0.5 U of Transcriptor reverse transcriptase (RT) in 20 μl and incubated at 25°C for 10 min, 55°C for 30 min, and 85°C for 5 min in an Mx3005P quantitative RT-PCR (qRT-PCR) system (Stratagene). qRT-PCR primers and probe (labeled with 6-carboxyfluorescein dye and a minor groove binder) were from TaqMan gene expression assays (Applied Biosystems). .. The ribosomal protein-large P0 primers and probe were from a TaqMan endogenous control assay and were labeled with VIC dye and a minor groove binder.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher gene exp gapdh hs02758991 g1
    In Huh-7 cells, goniothalamin stabilized nuclear CDKN1B via downregulation of its E3 ligase SKP2 level. (A) GTN treatment for 24 h upregulated CDKN1B while downregulated SKP2 protein level [DMSO 24 h/Cycloheximide (CHX) 0 h vs. GTN 24 h/CHX, 0 h]. CHX-chase (0, 2, 4, 8 h) along with immunoblotting assays estimated that the half-life of CDKN1B and SKP2 proteins were approximately 6 h. Compared to the DMSO group, GTN treatments prolonged the stabilities of high CDKN1B and low SKP2 protein levels. (B) GTN treatments did not alter CDKN1B and SKP2 mRNA levels in a time course experiment, compared to their corresponding controls (DMSO). (C) MG132 (5 μM) increased SKP2 protein abundance and further restored GTN-inhibited SKP2 protein level. DMSO (control), GTN and MG132 were added at time 0, 0 and 16 h, respectively; the total reaction time was 20 h. (D) GTN treatments for 8, 16 and 24 h downregulated SKP2, nevertheless, did not alter FZR1 (an E3 ligase of SKP2) protein abundance. (E) Fractionation of nuclear and cytosolic proteins and immunoblotting analysis indicated that GTN notably induced nuclear CDKN1B, however, downregulated nuclear SKP2, CCNE1, CDK2, pCDKN1B(T187) protein levels. PARP1 and <t>GAPDH</t> were served as nuclear and cytosolic control, respectively. All experiments were triplicated and results are expressed as mean ± SEM. Representative immunoblotting images are shown. Statistical significance: * P
    Gene Exp Gapdh Hs02758991 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 3239 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02758991 g1/product/Thermo Fisher
    Average 92 stars, based on 3239 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02758991 g1 - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    Image Search Results


    In Huh-7 cells, goniothalamin stabilized nuclear CDKN1B via downregulation of its E3 ligase SKP2 level. (A) GTN treatment for 24 h upregulated CDKN1B while downregulated SKP2 protein level [DMSO 24 h/Cycloheximide (CHX) 0 h vs. GTN 24 h/CHX, 0 h]. CHX-chase (0, 2, 4, 8 h) along with immunoblotting assays estimated that the half-life of CDKN1B and SKP2 proteins were approximately 6 h. Compared to the DMSO group, GTN treatments prolonged the stabilities of high CDKN1B and low SKP2 protein levels. (B) GTN treatments did not alter CDKN1B and SKP2 mRNA levels in a time course experiment, compared to their corresponding controls (DMSO). (C) MG132 (5 μM) increased SKP2 protein abundance and further restored GTN-inhibited SKP2 protein level. DMSO (control), GTN and MG132 were added at time 0, 0 and 16 h, respectively; the total reaction time was 20 h. (D) GTN treatments for 8, 16 and 24 h downregulated SKP2, nevertheless, did not alter FZR1 (an E3 ligase of SKP2) protein abundance. (E) Fractionation of nuclear and cytosolic proteins and immunoblotting analysis indicated that GTN notably induced nuclear CDKN1B, however, downregulated nuclear SKP2, CCNE1, CDK2, pCDKN1B(T187) protein levels. PARP1 and GAPDH were served as nuclear and cytosolic control, respectively. All experiments were triplicated and results are expressed as mean ± SEM. Representative immunoblotting images are shown. Statistical significance: * P

    Journal: Toxicology Reports

    Article Title: Upregulation of cyclin-dependent kinase inhibitors CDKN1B and CDKN1C in hepatocellular carcinoma-derived cells via goniothalamin-mediated protein stabilization and epigenetic modifications

    doi: 10.1016/j.toxrep.2015.01.010

    Figure Lengend Snippet: In Huh-7 cells, goniothalamin stabilized nuclear CDKN1B via downregulation of its E3 ligase SKP2 level. (A) GTN treatment for 24 h upregulated CDKN1B while downregulated SKP2 protein level [DMSO 24 h/Cycloheximide (CHX) 0 h vs. GTN 24 h/CHX, 0 h]. CHX-chase (0, 2, 4, 8 h) along with immunoblotting assays estimated that the half-life of CDKN1B and SKP2 proteins were approximately 6 h. Compared to the DMSO group, GTN treatments prolonged the stabilities of high CDKN1B and low SKP2 protein levels. (B) GTN treatments did not alter CDKN1B and SKP2 mRNA levels in a time course experiment, compared to their corresponding controls (DMSO). (C) MG132 (5 μM) increased SKP2 protein abundance and further restored GTN-inhibited SKP2 protein level. DMSO (control), GTN and MG132 were added at time 0, 0 and 16 h, respectively; the total reaction time was 20 h. (D) GTN treatments for 8, 16 and 24 h downregulated SKP2, nevertheless, did not alter FZR1 (an E3 ligase of SKP2) protein abundance. (E) Fractionation of nuclear and cytosolic proteins and immunoblotting analysis indicated that GTN notably induced nuclear CDKN1B, however, downregulated nuclear SKP2, CCNE1, CDK2, pCDKN1B(T187) protein levels. PARP1 and GAPDH were served as nuclear and cytosolic control, respectively. All experiments were triplicated and results are expressed as mean ± SEM. Representative immunoblotting images are shown. Statistical significance: * P

    Article Snippet: TaqMan® chemistry with primers and probes (Life Technologies): CDKN1B (#4331182; 151 bp, Hs01597588_m1, NM_004064.3 ), CDKN1C (#4331182; 91 bp, Hs00175938_m1, NM_000076.2 , NM_001122630.1 , NM_001122631.1 ), SKP2 (#4331182; 59 bp, Hs01021864_m1, NM_001243120.1 , NM_005983.3 , NM_032637.3 ) and GAPDH (#4453320; 93 bp, Hs02758991_g1, NM_001256799.1 , NM_002046.4 ) were used for quantitative RT-PCR.

    Techniques: Fractionation

    In Hep-3B cells, goniothalamin induced CDKN1C mRNA and subsequent protein levels via upregulation of acetyl-H3 and H3K9/14ac levels. Immunoblotting identified that SKP2 (an CDKN1C-specific E3 ligase) protein level was almost unchanged after GTN treatments for 8, 16 and 24 h. (B) Quantitative RT-PCR showed that GTN upregulated CDKN1C mRNA levels in a time-dependent manner. (C) Treatments with trichostatin A (TSA; 100 ng/mL) and GTN (15 μM) for 24 h but not 5-Aza-2′-deoxycytidine (5-Aza-dC; 10 μM) for 72 h, upregulated CDKN1C mRNA level, compared to the control group (DMSO). Combined treatments of TSA and GTN further upregulated CDKN1C mRNA level, compared to either treatment with TSA or GTN alone. (D) CDKN1C translation was delayed to 28 h when combined treatments with TSA and GTN, compared to its transcription level at 24 h. (E, F) ITSA1 (50 μM, 24 h), a TSA-specific inhibitor, downregulated endogenous and GTN-induced CDKN1C mRNA and protein levels, compared to the controls (DMSO). Similarly, CDKN1C translation was delayed to 28 h when combined treatments with GTN and ITSA1. ITSA1 further downregulated GTN-induced CDKN1C mRNA and protein levels. (G) Immunoblotting analysis demonstrated that TSA and GTN notably upregulated acetyl-H3 but not acetyl-H4 protein level, with an additive effect. (H) Histone extraction and immunoblotting analysis further demonstrated that both TSA and GTN increased H3K9/14-acetylated proteins in Hep-3B cells, with a slightly additive effect. All experiments were triplicated and results are expressed as mean ± SEM. For immunoblotting analysis, representative images are shown. GAPDH, ACTB and H3 were served as loading controls. Statistical significance: * P

    Journal: Toxicology Reports

    Article Title: Upregulation of cyclin-dependent kinase inhibitors CDKN1B and CDKN1C in hepatocellular carcinoma-derived cells via goniothalamin-mediated protein stabilization and epigenetic modifications

    doi: 10.1016/j.toxrep.2015.01.010

    Figure Lengend Snippet: In Hep-3B cells, goniothalamin induced CDKN1C mRNA and subsequent protein levels via upregulation of acetyl-H3 and H3K9/14ac levels. Immunoblotting identified that SKP2 (an CDKN1C-specific E3 ligase) protein level was almost unchanged after GTN treatments for 8, 16 and 24 h. (B) Quantitative RT-PCR showed that GTN upregulated CDKN1C mRNA levels in a time-dependent manner. (C) Treatments with trichostatin A (TSA; 100 ng/mL) and GTN (15 μM) for 24 h but not 5-Aza-2′-deoxycytidine (5-Aza-dC; 10 μM) for 72 h, upregulated CDKN1C mRNA level, compared to the control group (DMSO). Combined treatments of TSA and GTN further upregulated CDKN1C mRNA level, compared to either treatment with TSA or GTN alone. (D) CDKN1C translation was delayed to 28 h when combined treatments with TSA and GTN, compared to its transcription level at 24 h. (E, F) ITSA1 (50 μM, 24 h), a TSA-specific inhibitor, downregulated endogenous and GTN-induced CDKN1C mRNA and protein levels, compared to the controls (DMSO). Similarly, CDKN1C translation was delayed to 28 h when combined treatments with GTN and ITSA1. ITSA1 further downregulated GTN-induced CDKN1C mRNA and protein levels. (G) Immunoblotting analysis demonstrated that TSA and GTN notably upregulated acetyl-H3 but not acetyl-H4 protein level, with an additive effect. (H) Histone extraction and immunoblotting analysis further demonstrated that both TSA and GTN increased H3K9/14-acetylated proteins in Hep-3B cells, with a slightly additive effect. All experiments were triplicated and results are expressed as mean ± SEM. For immunoblotting analysis, representative images are shown. GAPDH, ACTB and H3 were served as loading controls. Statistical significance: * P

    Article Snippet: TaqMan® chemistry with primers and probes (Life Technologies): CDKN1B (#4331182; 151 bp, Hs01597588_m1, NM_004064.3 ), CDKN1C (#4331182; 91 bp, Hs00175938_m1, NM_000076.2 , NM_001122630.1 , NM_001122631.1 ), SKP2 (#4331182; 59 bp, Hs01021864_m1, NM_001243120.1 , NM_005983.3 , NM_032637.3 ) and GAPDH (#4453320; 93 bp, Hs02758991_g1, NM_001256799.1 , NM_002046.4 ) were used for quantitative RT-PCR.

    Techniques: Quantitative RT-PCR

    CD40 ligand (CD40L) gene expression is increased in peripheral blood mononuclear cells (PBMCs) from patients with Behçet’s disease (BD). a Platelet expression of CD40L (mean fluorescence intensity [MFI]) was determined under basal conditions and after 5 minutes with 0.2 IU/ml thrombin by flow cytometry in healthy control subjects (HCs), patients with inactive Behçet’s disease (iBD), and patients with active Behçet’s disease (aBD). b Higher CD40L relative gene expression in PBMCs from patients with BD than in HCs was demonstrated by qRT-PCR, despite an inability to increase CD40L expression in BD cells after 3 h of stimulation with 10 ng/ml phorbol 12-myristate 13-acetate (PMA). c A higher number of CD4 + CD40L + T cells from patients with BD than from HCs after 3-h stimulation with 25 ng/ml PMA + 1.5 μM ionomycin, determined by flow cytometry. d and e The number of Mac-1 + neutrophils was constitutively increased in patients with BD ( d ) and monocytes ( e ), determined by flow cytometry. No difference in CD40 surface expression was observed. f Phosphorylated NF-κB p65 subunit expression in resting neutrophils and monocytes from patients with BD was significantly higher than in HCs. g Plasma from patients with BD exerted a stronger stimulus on phosphorylated NF-κB p65 subunit expression than HC plasma in normal neutrophils and monocytes. Bars represent mean ± SE. Statistical analysis was performed using one-way analysis of variance with the Bonferroni posttest

    Journal: Arthritis Research & Therapy

    Article Title: Soluble CD40L is associated with increased oxidative burst and neutrophil extracellular trap release in Behçet’s disease

    doi: 10.1186/s13075-017-1443-5

    Figure Lengend Snippet: CD40 ligand (CD40L) gene expression is increased in peripheral blood mononuclear cells (PBMCs) from patients with Behçet’s disease (BD). a Platelet expression of CD40L (mean fluorescence intensity [MFI]) was determined under basal conditions and after 5 minutes with 0.2 IU/ml thrombin by flow cytometry in healthy control subjects (HCs), patients with inactive Behçet’s disease (iBD), and patients with active Behçet’s disease (aBD). b Higher CD40L relative gene expression in PBMCs from patients with BD than in HCs was demonstrated by qRT-PCR, despite an inability to increase CD40L expression in BD cells after 3 h of stimulation with 10 ng/ml phorbol 12-myristate 13-acetate (PMA). c A higher number of CD4 + CD40L + T cells from patients with BD than from HCs after 3-h stimulation with 25 ng/ml PMA + 1.5 μM ionomycin, determined by flow cytometry. d and e The number of Mac-1 + neutrophils was constitutively increased in patients with BD ( d ) and monocytes ( e ), determined by flow cytometry. No difference in CD40 surface expression was observed. f Phosphorylated NF-κB p65 subunit expression in resting neutrophils and monocytes from patients with BD was significantly higher than in HCs. g Plasma from patients with BD exerted a stronger stimulus on phosphorylated NF-κB p65 subunit expression than HC plasma in normal neutrophils and monocytes. Bars represent mean ± SE. Statistical analysis was performed using one-way analysis of variance with the Bonferroni posttest

    Article Snippet: CD40L gene expression in PBMCs was determined before and after stimulation with 10 ng/ml PMA for 3 h using the TaqMan® Gene Expression qRT-PCR Assay for CD40L (Thermo Fisher Scientific). cDNA levels were normalized to the expression of glyceraldehyde 3-phosphate dehydrogenase (Thermo Fisher Scientific).

    Techniques: Expressing, Fluorescence, Flow Cytometry, Cytometry, Quantitative RT-PCR

    Effects of SPHK1 and SPHK2 inhibition in the expression of cell cycle genes. (A) Relative changes in the mRNA levels of the indicated cyclins in HMC-1.2 after 24 h treatment with 5 µM SPHK1-I or 50 µM SPHK2-I. Changes in the expression of cyclins were initially determined using a RT 2 Profiler PCR Array and confirmed by Taqman gene expression assays. (B) Heat map of the canonical pathways affected by the treatment of HMC-1.2 with 5 µM SPHK1-I or 50 µM SPHK2-I for 24 h. Changes in expression of 84 genes involved in the cell cycle induced by SPHK1-I or SPHK2-I treatment were determined using a RT 2 Profiler PCR Array. Fold changes in the genes induced by either inhibitor were then analyzed using the ingenuity pathway analysis (IPA) with 1.5-fold as a cutoff. Shown is a comparison analysis done by IPA of the canonical pathways most significantly affected by either inhibitor and sorted by the activation Z score (blue: predicted inhibited and red: predicted activated). In bold, pathways related to DNA damage response cascade.

    Journal: Frontiers in Immunology

    Article Title: Targeting Sphingosine Kinase Isoforms Effectively Reduces Growth and Survival of Neoplastic Mast Cells With D816V-KIT

    doi: 10.3389/fimmu.2018.00631

    Figure Lengend Snippet: Effects of SPHK1 and SPHK2 inhibition in the expression of cell cycle genes. (A) Relative changes in the mRNA levels of the indicated cyclins in HMC-1.2 after 24 h treatment with 5 µM SPHK1-I or 50 µM SPHK2-I. Changes in the expression of cyclins were initially determined using a RT 2 Profiler PCR Array and confirmed by Taqman gene expression assays. (B) Heat map of the canonical pathways affected by the treatment of HMC-1.2 with 5 µM SPHK1-I or 50 µM SPHK2-I for 24 h. Changes in expression of 84 genes involved in the cell cycle induced by SPHK1-I or SPHK2-I treatment were determined using a RT 2 Profiler PCR Array. Fold changes in the genes induced by either inhibitor were then analyzed using the ingenuity pathway analysis (IPA) with 1.5-fold as a cutoff. Shown is a comparison analysis done by IPA of the canonical pathways most significantly affected by either inhibitor and sorted by the activation Z score (blue: predicted inhibited and red: predicted activated). In bold, pathways related to DNA damage response cascade.

    Article Snippet: Changes in expression of cyclin genes were confirmed by using specific TaqMan gene expression assays (Thermo Fisher Scientific).

    Techniques: Inhibition, Expressing, Polymerase Chain Reaction, Indirect Immunoperoxidase Assay, Activation Assay

    Expression levels of ABCC transporter mRNA in PC-9/CDDP and PC-9 cell lines. The relative expression of ABCC transporter mRNA in PC-9 and PC-9/CDDP cells was determined by quantitative real-time polymerase chain reaction, which was performed using TaqMan probes. GAPDH mRNA was also quantified and used to normalize the mRNA levels of the transporters. Each bar represents the mean ± standard deviation of triplicate independent experiments. ABCC, adenosine triphosphate-binding cassette subfamily C; ABCC1-5, ABCC, members 1–5.

    Journal: Oncology Letters

    Article Title: Utilization of arsenic trioxide as a treatment of cisplatin-resistant non-small cell lung cancer PC-9/CDDP and PC-14/CDDP cells

    doi: 10.3892/ol.2015.3352

    Figure Lengend Snippet: Expression levels of ABCC transporter mRNA in PC-9/CDDP and PC-9 cell lines. The relative expression of ABCC transporter mRNA in PC-9 and PC-9/CDDP cells was determined by quantitative real-time polymerase chain reaction, which was performed using TaqMan probes. GAPDH mRNA was also quantified and used to normalize the mRNA levels of the transporters. Each bar represents the mean ± standard deviation of triplicate independent experiments. ABCC, adenosine triphosphate-binding cassette subfamily C; ABCC1-5, ABCC, members 1–5.

    Article Snippet: RT-qPCR was performed using converted cDNA and the following reagents: TaqMan Gene Expression Assays for human ABCC1 (assay ID, Hs00219905_m1), ABCC2 (assay ID, Hs00166123_m1), ABCC3 (assay ID, Hs00978473_m1), ABCC4 (assay ID, Hs00988717_m1), ABCC5 (assay ID, Hs00981087_m1) and GAPDH (assay ID, Hs99999901_s1) genes, and the TaqMan Universal PCR Master Mix, no AmpErase UNG (Thermo Fisher Scientific Inc., Waltham, MA).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Binding Assay