qrt pcr analysis  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher qrt pcr analysis
    Implementation of <t>qRT-PCR</t> with or without enrichment for detection of Salmonella in plants irrigated with low levels of bacteria.
    Qrt Pcr Analysis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 818 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/Thermo Fisher
    Average 99 stars, based on 818 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley"

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00087-12

    Implementation of qRT-PCR with or without enrichment for detection of Salmonella in plants irrigated with low levels of bacteria.
    Figure Legend Snippet: Implementation of qRT-PCR with or without enrichment for detection of Salmonella in plants irrigated with low levels of bacteria.

    Techniques Used: Quantitative RT-PCR

    2) Product Images from "miRNA-34c regulates Notch signaling during bone development"

    Article Title: miRNA-34c regulates Notch signaling during bone development

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/dds129

    miR-34c inhibits osteoblast differentiation and increases osteoclastogenesis. ( A ) Induction of miR-34c was quantified by qRT–PCR after osteoblast differentiation from both WT and miR-34c Tg BMSC ( n = 5 per group). * P
    Figure Legend Snippet: miR-34c inhibits osteoblast differentiation and increases osteoclastogenesis. ( A ) Induction of miR-34c was quantified by qRT–PCR after osteoblast differentiation from both WT and miR-34c Tg BMSC ( n = 5 per group). * P

    Techniques Used: Quantitative RT-PCR

    3) Product Images from "Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF"

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0162321

    PolyIC/dsRBEC induces the expression and secretion of pro-inflammatory cytokines in MDA-MB-468 cells. A) qRT-PCR analysis of IFN-β, CCL5, IP10 and TNFα mRNA expression following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 2 and 4 hours. Data were normalized to GAPDH and are expressed as fold change relative to vehicle-treated samples. A representative experiment out of 3 experiments is shown. Error bars represent RQ max. B) Protein levels of IFN-β, CCL5, IP10 and TNFα were measured by ELISA following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 24 hours. Values are averages of triplicate biological samples from one representative experiment. (***,P
    Figure Legend Snippet: PolyIC/dsRBEC induces the expression and secretion of pro-inflammatory cytokines in MDA-MB-468 cells. A) qRT-PCR analysis of IFN-β, CCL5, IP10 and TNFα mRNA expression following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 2 and 4 hours. Data were normalized to GAPDH and are expressed as fold change relative to vehicle-treated samples. A representative experiment out of 3 experiments is shown. Error bars represent RQ max. B) Protein levels of IFN-β, CCL5, IP10 and TNFα were measured by ELISA following treatment with dsRBEC alone, polyIC alone or polyIC/dsRBEC for 24 hours. Values are averages of triplicate biological samples from one representative experiment. (***,P

    Techniques Used: Expressing, Multiple Displacement Amplification, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

    4) Product Images from "Possible contribution of pannexin-1 to ATP release in human upper airway epithelia"

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia

    Journal: Physiological Reports

    doi: 10.1002/phy2.227

    qRT‐PCR
    Figure Legend Snippet: qRT‐PCR

    Techniques Used: Quantitative RT-PCR

    5) Product Images from "Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b"

    Article Title: Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.900688

    UCA1 is negatively correlated with miR-27b in gastric cancer. ( A ) Microarray data of the most upregulated lncRNAs in six gastric cancer tissues and six paired peritumoral tissues. Data was retrieved from GEO dataset, with the accession No. GSE53137. ( B, C ) QRT-PCR analysis of UCA1 expression ( B ) and miR-27b ( C ) expression in 28 gastric cancer tissues and paired peritumoral tissues. ( D ) Linear regression analysis of the correlation between UCA1 and miR-27b.
    Figure Legend Snippet: UCA1 is negatively correlated with miR-27b in gastric cancer. ( A ) Microarray data of the most upregulated lncRNAs in six gastric cancer tissues and six paired peritumoral tissues. Data was retrieved from GEO dataset, with the accession No. GSE53137. ( B, C ) QRT-PCR analysis of UCA1 expression ( B ) and miR-27b ( C ) expression in 28 gastric cancer tissues and paired peritumoral tissues. ( D ) Linear regression analysis of the correlation between UCA1 and miR-27b.

    Techniques Used: Microarray, Quantitative RT-PCR, Expressing

    Knockdown of UCA1 restores miR-27b expression in the MDR gastric cancer cells. ( A, B ) QRT-PCR analysis of UCA1 expression ( A ) and miR-27b ( B ) expression in SGC-7901 cells, and SGC-7901 derived SGC-7901/ADR, SGC-7901/DDP, and SGC-7901/5-FU cells. ( C ) Predicted binding sites between UCA1 and miR-27b. ( D ) Fluorescence in situ hybridization experiments show that UCA1 and miR-27b (red) display opposite expression levels in SGC-7901 and SGC-7901/ADR cells. ( E, F ) QRT-PCR analysis of UCA1 expression ( E ) and miR-27b ( F ) expression in SGC-7901/ADR, SGC-7901/DDP, and SGC-7901/5-FU cells with or without the transfection of UCA1 siRNA. ** p
    Figure Legend Snippet: Knockdown of UCA1 restores miR-27b expression in the MDR gastric cancer cells. ( A, B ) QRT-PCR analysis of UCA1 expression ( A ) and miR-27b ( B ) expression in SGC-7901 cells, and SGC-7901 derived SGC-7901/ADR, SGC-7901/DDP, and SGC-7901/5-FU cells. ( C ) Predicted binding sites between UCA1 and miR-27b. ( D ) Fluorescence in situ hybridization experiments show that UCA1 and miR-27b (red) display opposite expression levels in SGC-7901 and SGC-7901/ADR cells. ( E, F ) QRT-PCR analysis of UCA1 expression ( E ) and miR-27b ( F ) expression in SGC-7901/ADR, SGC-7901/DDP, and SGC-7901/5-FU cells with or without the transfection of UCA1 siRNA. ** p

    Techniques Used: Expressing, Quantitative RT-PCR, Derivative Assay, Binding Assay, Fluorescence, In Situ Hybridization, Transfection

    6) Product Images from "Detection of Zika virus in mouse mammary gland and breast milk"

    Article Title: Detection of Zika virus in mouse mammary gland and breast milk

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0007080

    ZIKV replication in mammary glands of AG129 mice. Postpartum 8-week-old AG129 dams were retro-orbitally inoculated with 1 x 10 2 FFU of ZIKV FSS13025 or 10% FBS-PBS as Mock within 24 hours of parturition. (A-D) Viral titers in mammary gland, brain, spleen and serum were determined via qRT-PCR at 5, 7, 9 and 11 days post infection (dpi). (E) Levels of infectious ZIKV in mammary gland were determined by FFA at 5, 7, 9 and 11 dpi. Negative controls were evaluated at 5 days after mock-infection (A-E). n = 3 mice per time point in each panel. Data represent two independent experiments.
    Figure Legend Snippet: ZIKV replication in mammary glands of AG129 mice. Postpartum 8-week-old AG129 dams were retro-orbitally inoculated with 1 x 10 2 FFU of ZIKV FSS13025 or 10% FBS-PBS as Mock within 24 hours of parturition. (A-D) Viral titers in mammary gland, brain, spleen and serum were determined via qRT-PCR at 5, 7, 9 and 11 days post infection (dpi). (E) Levels of infectious ZIKV in mammary gland were determined by FFA at 5, 7, 9 and 11 dpi. Negative controls were evaluated at 5 days after mock-infection (A-E). n = 3 mice per time point in each panel. Data represent two independent experiments.

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Infection

    Transmission of ZIKV RNA in mouse breast milk. Postpartum AG129 dams were retro-orbitally inoculated with 1 x 10 2 FFU of ZIKV FSS13025 or 10% FBS-PBS as Mock within 24 hours of parturition. Pups were sacrificed on d1, d3, d5 and d7 after birth. (A and B) Levels of ZIKV RNA in the head and the rest of the body were measured by qRT-PCR (n = 6 mice, each day). (C and D) ZIKV RNA levels in stomach milk clots (SMC) and stomach tissues were quantified via qRT-PCR (n = 3 mice, each day). (E and F) Presence of infectious ZIKV in SMC and stomach was assessed using FFA (n = 3 mice, each day). Data represent two independent experiments.
    Figure Legend Snippet: Transmission of ZIKV RNA in mouse breast milk. Postpartum AG129 dams were retro-orbitally inoculated with 1 x 10 2 FFU of ZIKV FSS13025 or 10% FBS-PBS as Mock within 24 hours of parturition. Pups were sacrificed on d1, d3, d5 and d7 after birth. (A and B) Levels of ZIKV RNA in the head and the rest of the body were measured by qRT-PCR (n = 6 mice, each day). (C and D) ZIKV RNA levels in stomach milk clots (SMC) and stomach tissues were quantified via qRT-PCR (n = 3 mice, each day). (E and F) Presence of infectious ZIKV in SMC and stomach was assessed using FFA (n = 3 mice, each day). Data represent two independent experiments.

    Techniques Used: Transmission Assay, Quantitative RT-PCR, Mouse Assay

    7) Product Images from "miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity"

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity

    Journal: Scientific Reports

    doi: 10.1038/srep18655

    miR-132-3p inhibits osteoblast differentiation in vitro . To study the effects of miR-132-3p on osteoblast differentiation, prOB cells were transfected with either a miR-132-3p mimic (miR-mimic, 60 nM), an inhibitor (anti-miR, 80 nM) or its homologous miRNA negative control (miR-N.C.). ( a ) Representative fluorescent images of prOB cells transfected with a miRNA nucleoside analogue for 24 h. The upper panel shows fluorescence in a dark field, and the lower panel shows the same cells in a bright field (original magnification 200×). ( b,c ) Osteoblast differentiation was confirmed by qRT-PCR analysis of osteoblast marker genes (Runx2, Osx and ALP normalized to GAPDH) and activity analysis of the ALP protein at 48 h. (n = 3). ( d,e ) Western blot analyses of Runx2 and Osx protein expression were performed and quantified using ImageJ software. (n = 4). For each group, values are mean ± SD, * P
    Figure Legend Snippet: miR-132-3p inhibits osteoblast differentiation in vitro . To study the effects of miR-132-3p on osteoblast differentiation, prOB cells were transfected with either a miR-132-3p mimic (miR-mimic, 60 nM), an inhibitor (anti-miR, 80 nM) or its homologous miRNA negative control (miR-N.C.). ( a ) Representative fluorescent images of prOB cells transfected with a miRNA nucleoside analogue for 24 h. The upper panel shows fluorescence in a dark field, and the lower panel shows the same cells in a bright field (original magnification 200×). ( b,c ) Osteoblast differentiation was confirmed by qRT-PCR analysis of osteoblast marker genes (Runx2, Osx and ALP normalized to GAPDH) and activity analysis of the ALP protein at 48 h. (n = 3). ( d,e ) Western blot analyses of Runx2 and Osx protein expression were performed and quantified using ImageJ software. (n = 4). For each group, values are mean ± SD, * P

    Techniques Used: In Vitro, Transfection, Negative Control, Fluorescence, Quantitative RT-PCR, Marker, ALP Assay, Activity Assay, Western Blot, Expressing, Software

    Up-regulation of miR-132-3p both in the bone tissue of HU rat femurs and prOB cells cultured in simulated microgravity. ( a ) Alterations of miRNA expression in the femur bone tissue of CON and HU rats examined by Agilent miRNA arrays. Green represents down-regulated miRNAs, and red represents up-regulated miRNAs, with the color scale in the upper right corner indicating the relative expression levels. ( b ) qRT-PCR analysis of miR-139-3p, -339-3p, -132-3p, -487b, -2985 and -34b levels partly selected from the array data (normalized to internal reference U6). ( c ) Expression levels of miR-139-3p, -339-3p, -132-3p, -487b, -2985 and -34b in prOB cells after exposure to clinorotation (Clino) for 48 h examined by qRT-PCR. The relative ratio is shown with that of cells under static control conditions. ( d ) Time course of miR-132-3p expression in prOB cells after exposure to clinorotation. Fold-increase is provided in comparison to the static control group. For each group, values are mean ± SD, n = 3, * P
    Figure Legend Snippet: Up-regulation of miR-132-3p both in the bone tissue of HU rat femurs and prOB cells cultured in simulated microgravity. ( a ) Alterations of miRNA expression in the femur bone tissue of CON and HU rats examined by Agilent miRNA arrays. Green represents down-regulated miRNAs, and red represents up-regulated miRNAs, with the color scale in the upper right corner indicating the relative expression levels. ( b ) qRT-PCR analysis of miR-139-3p, -339-3p, -132-3p, -487b, -2985 and -34b levels partly selected from the array data (normalized to internal reference U6). ( c ) Expression levels of miR-139-3p, -339-3p, -132-3p, -487b, -2985 and -34b in prOB cells after exposure to clinorotation (Clino) for 48 h examined by qRT-PCR. The relative ratio is shown with that of cells under static control conditions. ( d ) Time course of miR-132-3p expression in prOB cells after exposure to clinorotation. Fold-increase is provided in comparison to the static control group. For each group, values are mean ± SD, n = 3, * P

    Techniques Used: Cell Culture, Expressing, Quantitative RT-PCR

    miR-132-3p directly inhibits Ep300 protein expression in prOB cells exposed to a simulated microgravity environment. ( a ) Schematic representation of luciferase constructs used for reporter assays. The two miR-132-3p target sites within the 3′ UTR of Ep300 are depicted as black boxes. Sequences below indicate putative miR-132-3p target sites on the wild type 3′ UTR, the mutated derivative, and the pairing regions of miR-132-3p. ( b ) The effect of the miR-132-3p mimic, the inhibitor or their negative controls on the luciferase activity of the WT Ep300 3′ UTR or the MUT Ep300 3′ UTR reporter in 293T cells. (n = 3). ( c,d ) Ep300 mRNA (n = 3) and protein expression (n = 4) in prOB cells were examined after transfection with miR-N.C. and miR-mimic for 48 h by qRT-PCR and western blot, respectively. ( e,f ) Ep300 mRNA and protein expression was detected by qRT-PCR and western blot, respectively, after exposure to clinorotation for 48 h. (n = 3). For each group, values are mean ± SD, * P
    Figure Legend Snippet: miR-132-3p directly inhibits Ep300 protein expression in prOB cells exposed to a simulated microgravity environment. ( a ) Schematic representation of luciferase constructs used for reporter assays. The two miR-132-3p target sites within the 3′ UTR of Ep300 are depicted as black boxes. Sequences below indicate putative miR-132-3p target sites on the wild type 3′ UTR, the mutated derivative, and the pairing regions of miR-132-3p. ( b ) The effect of the miR-132-3p mimic, the inhibitor or their negative controls on the luciferase activity of the WT Ep300 3′ UTR or the MUT Ep300 3′ UTR reporter in 293T cells. (n = 3). ( c,d ) Ep300 mRNA (n = 3) and protein expression (n = 4) in prOB cells were examined after transfection with miR-N.C. and miR-mimic for 48 h by qRT-PCR and western blot, respectively. ( e,f ) Ep300 mRNA and protein expression was detected by qRT-PCR and western blot, respectively, after exposure to clinorotation for 48 h. (n = 3). For each group, values are mean ± SD, * P

    Techniques Used: Expressing, Luciferase, Construct, Activity Assay, Transfection, Quantitative RT-PCR, Western Blot

    Down-regulation of endogenous miR-132-3p expression partly attenuates inhibition of osteoblast differentiation by clinorotation in vitro. prOB cells were transfected with miR-N.C. and anti-miR for 12 h and then exposed to clinorotation for 48 h. The relative parameter was detected. ( a ) miR-132-3p expression in prOB cells was analyzed by q RT-PCR. (n = 3). ( b ) Osteoblast differentiation was confirmed by qRT-PCR analysis of osteoblast marker genes (Runx2 and Osx normalized to GAPDH). (n = 3). ( c ) Western blot analysis of Runx2 and Osx protein expression was performed and quantified using ImageJ software. (n = 4). ( d ) ALP gene expression and protein activity were measured. (n = 3). For each group, values are mean ± SD, * P
    Figure Legend Snippet: Down-regulation of endogenous miR-132-3p expression partly attenuates inhibition of osteoblast differentiation by clinorotation in vitro. prOB cells were transfected with miR-N.C. and anti-miR for 12 h and then exposed to clinorotation for 48 h. The relative parameter was detected. ( a ) miR-132-3p expression in prOB cells was analyzed by q RT-PCR. (n = 3). ( b ) Osteoblast differentiation was confirmed by qRT-PCR analysis of osteoblast marker genes (Runx2 and Osx normalized to GAPDH). (n = 3). ( c ) Western blot analysis of Runx2 and Osx protein expression was performed and quantified using ImageJ software. (n = 4). ( d ) ALP gene expression and protein activity were measured. (n = 3). For each group, values are mean ± SD, * P

    Techniques Used: Expressing, Inhibition, In Vitro, Transfection, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Marker, Western Blot, Software, ALP Assay, Activity Assay

    Inhibition of Ep300 expression by miR-132-3p decreases the stability and acetylation levels of Runx2. ( a ) qRT-PCR analysis of Ep300 gene expression in prOB cells was performed after transfection with siRNA-Ep300. (n = 3). ( b ) Western blot examination of Runx2 protein expression in prOB cells in which Ep300 expression was inhibited by siRNA. (n = 4). ( c ) Levels of acetylated Runx2 were detected by immunoprecipitation using an anti-acetyl-lysine antibody (Ac-lys), followed by a western blot with an anti-Runx2 antibody. (n = 3). For each group, values are mean ± SD, * P
    Figure Legend Snippet: Inhibition of Ep300 expression by miR-132-3p decreases the stability and acetylation levels of Runx2. ( a ) qRT-PCR analysis of Ep300 gene expression in prOB cells was performed after transfection with siRNA-Ep300. (n = 3). ( b ) Western blot examination of Runx2 protein expression in prOB cells in which Ep300 expression was inhibited by siRNA. (n = 4). ( c ) Levels of acetylated Runx2 were detected by immunoprecipitation using an anti-acetyl-lysine antibody (Ac-lys), followed by a western blot with an anti-Runx2 antibody. (n = 3). For each group, values are mean ± SD, * P

    Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, Transfection, Western Blot, Immunoprecipitation

    8) Product Images from "Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells"

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-29700-3

    CAP suppressed, but vinexin promoted, adipocyte differentiation. Vinexin- and CAP-depleted ( a – d ) cells, as well as vinexin α re-expressing cells ( e , g , h ) and CAP re-expressing cells ( f , i , j ) were seeded on plastic dishes at a density of 1.2 × 10 5 cells/35 mm dish and induced to differentiate into adipocyte. RNAs were extracted 6 days after MDI treatment, and the mRNAs expression of PPARγ2 and aP2 was quantified by qRT-PCR ( a , e , f ). The expression levels relative to those in control cells are shown. ( b ) Cell were lysed and equal amounts of cell lysates were analyzed by western blotting using the anti-aP2 and anti-vinculin (loading control) antibodies. Blots were cropped from full-size images (see Supplemental Information). ( c , d , g – j ) Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown ( c , g , i ). ( d , h , j ) Nine images were obtained from three independent experiments, and the percentage of area stained were quantified using ImageJ. ( k , l ) Control and CAP depleted cells at the density of 1.0 × 10 5 cells/ 6 well plates were infected with lentiviruses expressing GFP-T12 vinculin. Two days after the infection, cells were induced to differentiate into adipocytes. Differentiated adipocytes were stained with Oil Red O on day 6. (l) Twelve images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. Scale bars: 200 μm. The values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test or Student’s t-test ( e , f , h , j ). *p
    Figure Legend Snippet: CAP suppressed, but vinexin promoted, adipocyte differentiation. Vinexin- and CAP-depleted ( a – d ) cells, as well as vinexin α re-expressing cells ( e , g , h ) and CAP re-expressing cells ( f , i , j ) were seeded on plastic dishes at a density of 1.2 × 10 5 cells/35 mm dish and induced to differentiate into adipocyte. RNAs were extracted 6 days after MDI treatment, and the mRNAs expression of PPARγ2 and aP2 was quantified by qRT-PCR ( a , e , f ). The expression levels relative to those in control cells are shown. ( b ) Cell were lysed and equal amounts of cell lysates were analyzed by western blotting using the anti-aP2 and anti-vinculin (loading control) antibodies. Blots were cropped from full-size images (see Supplemental Information). ( c , d , g – j ) Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown ( c , g , i ). ( d , h , j ) Nine images were obtained from three independent experiments, and the percentage of area stained were quantified using ImageJ. ( k , l ) Control and CAP depleted cells at the density of 1.0 × 10 5 cells/ 6 well plates were infected with lentiviruses expressing GFP-T12 vinculin. Two days after the infection, cells were induced to differentiate into adipocytes. Differentiated adipocytes were stained with Oil Red O on day 6. (l) Twelve images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. Scale bars: 200 μm. The values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test or Student’s t-test ( e , f , h , j ). *p

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Staining, Infection

    CAP promoted osteoblast differentiation and vinexin inhibited calcification. Vinexin- or CAP-depleted ( a , b , c , j , k ) cells and vinexin α re-expressing cells ( d , f , h ) or CAP re-expressing cells seeded on plastic dishes were induced to differentiate into osteoblasts by incubating them with αMEM medium. ( a , d , e ) On day 6, RNAs were extracted and the expression of the ALP mRNA was quantified by qRT-PCR. The relative expression compared to control cells is shown from triplicate experiment. ( b , c , f – i ) On day 4, ALP activity was visualized and six images from each condition were obtained from two independent experiments. Representative images are shown. Scale bars: 400 μm. ( c , h , i ) Total intensity was quantified using ImageJ. ( j , k ) On day 6, cells were stained with Alizarin Red S and six images were obtained from two independent experiments. Representative images are shown. Scale bars: 200 μm. ( k ) The relative stained area was quantified using ImageJ. Values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test ( a , c , k ) and Student’s t-test ( d , e , h , i ). ***p
    Figure Legend Snippet: CAP promoted osteoblast differentiation and vinexin inhibited calcification. Vinexin- or CAP-depleted ( a , b , c , j , k ) cells and vinexin α re-expressing cells ( d , f , h ) or CAP re-expressing cells seeded on plastic dishes were induced to differentiate into osteoblasts by incubating them with αMEM medium. ( a , d , e ) On day 6, RNAs were extracted and the expression of the ALP mRNA was quantified by qRT-PCR. The relative expression compared to control cells is shown from triplicate experiment. ( b , c , f – i ) On day 4, ALP activity was visualized and six images from each condition were obtained from two independent experiments. Representative images are shown. Scale bars: 400 μm. ( c , h , i ) Total intensity was quantified using ImageJ. ( j , k ) On day 6, cells were stained with Alizarin Red S and six images were obtained from two independent experiments. Representative images are shown. Scale bars: 200 μm. ( k ) The relative stained area was quantified using ImageJ. Values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test ( a , c , k ) and Student’s t-test ( d , e , h , i ). ***p

    Techniques Used: Expressing, ALP Assay, Quantitative RT-PCR, Activity Assay, Staining

    Vinexin and CAP regulated differentiation in an ECM stiffness-dependent manner. ( a , b ) Vinexin- or CAP-depleted cells were seeded onto PAA gels coated with collagen and induced to differentiate into adipocytes. Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown. Scale bars: 200 μm. ( b ) Eight images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. ( c , d ) CAP-depleted cells were transfected with negative control (siNC) or TAZ-targeted siRNA. ( c ) TAZ expression was analyzed with western blotting. Blots were cropped from full-size images (see Supplemental Information). ( d ) On day 6 after siRNA transfection, the expression of aP2 and ALP mRNA was quantified by qRT-PCR. The expression relative to control cells transfected with negative control siRNA from triplicate experiments is shown. Values represent the mean ± s.e.m. Each experiment was repeated twice. Statistical significance was determined by one-way ANOVA with Tukey’s test. **p
    Figure Legend Snippet: Vinexin and CAP regulated differentiation in an ECM stiffness-dependent manner. ( a , b ) Vinexin- or CAP-depleted cells were seeded onto PAA gels coated with collagen and induced to differentiate into adipocytes. Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown. Scale bars: 200 μm. ( b ) Eight images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. ( c , d ) CAP-depleted cells were transfected with negative control (siNC) or TAZ-targeted siRNA. ( c ) TAZ expression was analyzed with western blotting. Blots were cropped from full-size images (see Supplemental Information). ( d ) On day 6 after siRNA transfection, the expression of aP2 and ALP mRNA was quantified by qRT-PCR. The expression relative to control cells transfected with negative control siRNA from triplicate experiments is shown. Values represent the mean ± s.e.m. Each experiment was repeated twice. Statistical significance was determined by one-way ANOVA with Tukey’s test. **p

    Techniques Used: Staining, Transfection, Negative Control, Expressing, Western Blot, ALP Assay, Quantitative RT-PCR

    9) Product Images from "Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap"

    Article Title: Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07338-z

    Yap-dependent proliferation in livers with impaired autophagy is potentially druggable. a Controls ( Atg7 F/F ) and Atg7 KO ( Alb-CRE:Atg7 F/F ) mice were treated for 21 days with either Yap/Tead inhibitor verteporfin or vehicle. N = 4 per group. VP, verteporfin; Veh, vehicle. b Immunostaining for Ki67 in liver sections from control and Atg7 KO mice treated with either verteporfin or vehicle. Scale bar 100 µm. Large inserts are enlargements of small inserts. c Quantitation of Ki67 + nuclei per 100x field per mouse treated with either verteporfin or vehicle. Ten 100x fields per mouse were analyzed. d qRT-PCR analysis of whole liver RNA from control and Atg7 KO mice, treated with verteporfin or vehicle. Cyr61 mRNA expression was normalized to Gapdh expression and then normalized to control animals. Data from two independent experiments. e [ 3 H]-thymidine incorporation assay in scram- and shAtg7-AML12 cells after incubation with verteporfin or vehicle. Data from three independent experiments, measurements in triplicates. **** P = 0.0003. f Tead4-Luciferase assay of scram- and shAtg7-infected AML12 cells after incubation with verteporfin or vehicle. Data from two independent experiments Data represent mean ± SD. P -values analyzed by two-way ANOVA and Tukey’s HSD. * P
    Figure Legend Snippet: Yap-dependent proliferation in livers with impaired autophagy is potentially druggable. a Controls ( Atg7 F/F ) and Atg7 KO ( Alb-CRE:Atg7 F/F ) mice were treated for 21 days with either Yap/Tead inhibitor verteporfin or vehicle. N = 4 per group. VP, verteporfin; Veh, vehicle. b Immunostaining for Ki67 in liver sections from control and Atg7 KO mice treated with either verteporfin or vehicle. Scale bar 100 µm. Large inserts are enlargements of small inserts. c Quantitation of Ki67 + nuclei per 100x field per mouse treated with either verteporfin or vehicle. Ten 100x fields per mouse were analyzed. d qRT-PCR analysis of whole liver RNA from control and Atg7 KO mice, treated with verteporfin or vehicle. Cyr61 mRNA expression was normalized to Gapdh expression and then normalized to control animals. Data from two independent experiments. e [ 3 H]-thymidine incorporation assay in scram- and shAtg7-AML12 cells after incubation with verteporfin or vehicle. Data from three independent experiments, measurements in triplicates. **** P = 0.0003. f Tead4-Luciferase assay of scram- and shAtg7-infected AML12 cells after incubation with verteporfin or vehicle. Data from two independent experiments Data represent mean ± SD. P -values analyzed by two-way ANOVA and Tukey’s HSD. * P

    Techniques Used: Mouse Assay, Immunostaining, Quantitation Assay, Quantitative RT-PCR, Expressing, Thymidine Incorporation Assay, Incubation, Luciferase, Infection

    Intact Nrf2 signaling in Atg7/Yap DKO mice; Atg7/Nrf2 DKO mice do not have evidence of increased Yap activation. a Analysis of control ( Atg7 F/F and Atg7 F/F ,Yap F/F ), Atg7 KO ( ERT2-Alb-CRE:Atg7 F/F ), Atg7/Yap DKO ( ERT2-Alb-CRE:Atg7 F/F , Yap F/F ) 4 weeks post TAM injection, Atg7/Nrf2 DKO ( Alb-CRE:Atg7 F/F , Nrf2 −/− ) and Nrf2 KO (Nrf2 − / − ) at 9 weeks of age. b Immunoblot analysis of whole liver lysate from control, Atg7 KO, Atg7/Yap DKO, Atg7/Nrf2 DKO, and Nrf2 KO mice. Immunoblotting for Atg7, LC3, Yap, Nrf2, p62/Sqstm1, β-Tubulin. c qRT-PCR analysis of whole liver RNA for Nqo , Srxn1, Cyr61 , Areg . Data normalized to β-actin expression and fold control. Data from 3 ( Cyr61 , Nqo , Areg ) and 2 ( Srxn1 ) independent experiments, respectively. N = 3–4 animals per group. Mean ± SD. **** P
    Figure Legend Snippet: Intact Nrf2 signaling in Atg7/Yap DKO mice; Atg7/Nrf2 DKO mice do not have evidence of increased Yap activation. a Analysis of control ( Atg7 F/F and Atg7 F/F ,Yap F/F ), Atg7 KO ( ERT2-Alb-CRE:Atg7 F/F ), Atg7/Yap DKO ( ERT2-Alb-CRE:Atg7 F/F , Yap F/F ) 4 weeks post TAM injection, Atg7/Nrf2 DKO ( Alb-CRE:Atg7 F/F , Nrf2 −/− ) and Nrf2 KO (Nrf2 − / − ) at 9 weeks of age. b Immunoblot analysis of whole liver lysate from control, Atg7 KO, Atg7/Yap DKO, Atg7/Nrf2 DKO, and Nrf2 KO mice. Immunoblotting for Atg7, LC3, Yap, Nrf2, p62/Sqstm1, β-Tubulin. c qRT-PCR analysis of whole liver RNA for Nqo , Srxn1, Cyr61 , Areg . Data normalized to β-actin expression and fold control. Data from 3 ( Cyr61 , Nqo , Areg ) and 2 ( Srxn1 ) independent experiments, respectively. N = 3–4 animals per group. Mean ± SD. **** P

    Techniques Used: Mouse Assay, Activation Assay, Injection, Quantitative RT-PCR, Expressing

    10) Product Images from "Delta-Opioid Receptor Analgesia Is Independent of Microglial Activation in a Rat Model of Neuropathic Pain"

    Article Title: Delta-Opioid Receptor Analgesia Is Independent of Microglial Activation in a Rat Model of Neuropathic Pain

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104420

    MOR , DOR , KOR mRNAs in spinal cord and DRGs in vehicle- and minocycline-treated CCI-exposed rats. Minocycline (MC; 30 mg/kg; i.p.) was administered intraperitoneally pre-emptively 16 h and 1 h before CCI, and then repeatedly twice daily for 7 days. On the seventh day, spinal cords (L4–L6) and DRG were collected for the qRT-PCR analysis of MOR (A, B), KOR (C, D) and DOR (E, F) gene expression. The data are presented as the means ± SEM and represent the normalised averages derived from the threshold qRT-PCR cycles from four to eight samples for each group. Intergroup differences were analysed using ANOVAs followed by Bonferroni's multiple comparison tests. * P
    Figure Legend Snippet: MOR , DOR , KOR mRNAs in spinal cord and DRGs in vehicle- and minocycline-treated CCI-exposed rats. Minocycline (MC; 30 mg/kg; i.p.) was administered intraperitoneally pre-emptively 16 h and 1 h before CCI, and then repeatedly twice daily for 7 days. On the seventh day, spinal cords (L4–L6) and DRG were collected for the qRT-PCR analysis of MOR (A, B), KOR (C, D) and DOR (E, F) gene expression. The data are presented as the means ± SEM and represent the normalised averages derived from the threshold qRT-PCR cycles from four to eight samples for each group. Intergroup differences were analysed using ANOVAs followed by Bonferroni's multiple comparison tests. * P

    Techniques Used: Quantitative RT-PCR, Expressing, Derivative Assay

    11) Product Images from "Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis"

    Article Title: Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis

    Journal: Cells

    doi: 10.3390/cells8010050

    Expression of SERK4 in the T-DNA insertion line: ( A ) the exon/intron structure of the SERK4 gene and location of the T-DNA insertion; ( B ) the expression level of SERK4 revealed by qRT-PCR in LS leaves of wildtype and the T-DNA insertion line, the ratios of SERK4 gene expression level were calculated relative to the wildtype leaf. CDS, coding sequence; WT, wildtype. The expression data are means ± SD of three biological repeats. *** p
    Figure Legend Snippet: Expression of SERK4 in the T-DNA insertion line: ( A ) the exon/intron structure of the SERK4 gene and location of the T-DNA insertion; ( B ) the expression level of SERK4 revealed by qRT-PCR in LS leaves of wildtype and the T-DNA insertion line, the ratios of SERK4 gene expression level were calculated relative to the wildtype leaf. CDS, coding sequence; WT, wildtype. The expression data are means ± SD of three biological repeats. *** p

    Techniques Used: Expressing, Quantitative RT-PCR, Sequencing

    12) Product Images from "A cotton miRNA is involved in regulation of plant response to salt stress"

    Article Title: A cotton miRNA is involved in regulation of plant response to salt stress

    Journal: Scientific Reports

    doi: 10.1038/srep19736

    Identification of miRNVL5 target from Arabidopsis through degradome sequencing. ( A ) The red line with a dot indicates the significant signature. The arrow indicates the signature produced by miRNA-directed cleavage. ( B ) Target for miRNVL5 identified from degradome of 35S::miRNVL5 Arabidopsis exposed to minus salt (miR5 − S) and plus salt (miR5 + S). Three week-old Arabidopsis seedlings were treated with 0 (control) and 200 mM NaCl for 1 h and the treated seedlings were used for degradome sequencing and qRT-PCR.
    Figure Legend Snippet: Identification of miRNVL5 target from Arabidopsis through degradome sequencing. ( A ) The red line with a dot indicates the significant signature. The arrow indicates the signature produced by miRNA-directed cleavage. ( B ) Target for miRNVL5 identified from degradome of 35S::miRNVL5 Arabidopsis exposed to minus salt (miR5 − S) and plus salt (miR5 + S). Three week-old Arabidopsis seedlings were treated with 0 (control) and 200 mM NaCl for 1 h and the treated seedlings were used for degradome sequencing and qRT-PCR.

    Techniques Used: Sequencing, Produced, Quantitative RT-PCR

    Sodium (Na + )/potassium (K + ) accumulation and expression of SOS1 , NHX1 , AVP1 and P5CS1 in transgenic and wild-type (WT) plants exposed to NaCl. ( A,C ) Na + in shoots and roots. ( B,D ) K + in shoots and roots of three week-old WT, 35S::miRNVLU5 and 35S::mGhCHR transgenic plants exposed to 200 mM NaCl exposure for 3 d. ( E,F ) K + /Na + ratio in WT and the transgenic plants under −NaCl ( E , F ) and +NaCl ( F ) Condition. ( G – J ) qRT-PCR analysis of the indicated gene expression. Three week-old seedlings were exposed to 200 mM NaCl for 1 h. Vertical bars represent SD of the mean with three replicates. Asterisks indicate that mean values are significantly different between the transgenic plants and WT ( p
    Figure Legend Snippet: Sodium (Na + )/potassium (K + ) accumulation and expression of SOS1 , NHX1 , AVP1 and P5CS1 in transgenic and wild-type (WT) plants exposed to NaCl. ( A,C ) Na + in shoots and roots. ( B,D ) K + in shoots and roots of three week-old WT, 35S::miRNVLU5 and 35S::mGhCHR transgenic plants exposed to 200 mM NaCl exposure for 3 d. ( E,F ) K + /Na + ratio in WT and the transgenic plants under −NaCl ( E , F ) and +NaCl ( F ) Condition. ( G – J ) qRT-PCR analysis of the indicated gene expression. Three week-old seedlings were exposed to 200 mM NaCl for 1 h. Vertical bars represent SD of the mean with three replicates. Asterisks indicate that mean values are significantly different between the transgenic plants and WT ( p

    Techniques Used: Expressing, Transgenic Assay, Quantitative RT-PCR

    13) Product Images from "Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy"

    Article Title: Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.897379

    Puerarin enhances BAG3 expression in rat primary cardiomyocytes after A/RI. ( A, B ) QRT-PCR analysis ( A ) and Western blot analysis ( B ) of BAG3 expression in rat primary cardiomyocytes without A/RI and in the cells with or without pre-treatment of puerarin (50/100/200 μM) after A/RI. * Comparison with NC; # comparison with A/RI. * and # p
    Figure Legend Snippet: Puerarin enhances BAG3 expression in rat primary cardiomyocytes after A/RI. ( A, B ) QRT-PCR analysis ( A ) and Western blot analysis ( B ) of BAG3 expression in rat primary cardiomyocytes without A/RI and in the cells with or without pre-treatment of puerarin (50/100/200 μM) after A/RI. * Comparison with NC; # comparison with A/RI. * and # p

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

    14) Product Images from "Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis"

    Article Title: Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis

    Journal: Cells

    doi: 10.3390/cells8010050

    Expression of SERK4 in the T-DNA insertion line: ( A ) the exon/intron structure of the SERK4 gene and location of the T-DNA insertion; ( B ) the expression level of SERK4 revealed by qRT-PCR in LS leaves of wildtype and the T-DNA insertion line, the ratios of SERK4 gene expression level were calculated relative to the wildtype leaf. CDS, coding sequence; WT, wildtype. The expression data are means ± SD of three biological repeats. *** p
    Figure Legend Snippet: Expression of SERK4 in the T-DNA insertion line: ( A ) the exon/intron structure of the SERK4 gene and location of the T-DNA insertion; ( B ) the expression level of SERK4 revealed by qRT-PCR in LS leaves of wildtype and the T-DNA insertion line, the ratios of SERK4 gene expression level were calculated relative to the wildtype leaf. CDS, coding sequence; WT, wildtype. The expression data are means ± SD of three biological repeats. *** p

    Techniques Used: Expressing, Quantitative RT-PCR, Sequencing

    15) Product Images from "Differential Antioxidant Responses and Perturbed Porphyrin Biosynthesis after Exposure to Oxyfluorfen and Methyl Viologen in Oryza sativa"

    Article Title: Differential Antioxidant Responses and Perturbed Porphyrin Biosynthesis after Exposure to Oxyfluorfen and Methyl Viologen in Oryza sativa

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms160716529

    Expression of genes encoding the porphyrin pathway enzymes in rice plants with the foliar application of MV. ( A ) Common branch; ( B ) Mg-porphyrin branch; and ( C ) Fe-porphyrin branch. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse transcribed. The resultant cDNAs were used as templates for qRT-PCR using Actin as an internal control. The control 1 was used for normalization, with the expression level of the sample set to 1. Error bars represent SE, and representative data from three independent experiments are presented.
    Figure Legend Snippet: Expression of genes encoding the porphyrin pathway enzymes in rice plants with the foliar application of MV. ( A ) Common branch; ( B ) Mg-porphyrin branch; and ( C ) Fe-porphyrin branch. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse transcribed. The resultant cDNAs were used as templates for qRT-PCR using Actin as an internal control. The control 1 was used for normalization, with the expression level of the sample set to 1. Error bars represent SE, and representative data from three independent experiments are presented.

    Techniques Used: Expressing, Purification, Quantitative RT-PCR

    Expression of genes encoding the ROS-scavenging enzymes in rice plants with the foliar application of OF or MV treatment. Total RNAs were purified from plants and reverse transcribed. The resultant cDNAs were used as templates for qRT-PCR using Actin as an internal control. The control was used for normalization, with the expression level of the sample set to 1. Error bars represent SE, and representative data from three independent experiments are presented. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 .
    Figure Legend Snippet: Expression of genes encoding the ROS-scavenging enzymes in rice plants with the foliar application of OF or MV treatment. Total RNAs were purified from plants and reverse transcribed. The resultant cDNAs were used as templates for qRT-PCR using Actin as an internal control. The control was used for normalization, with the expression level of the sample set to 1. Error bars represent SE, and representative data from three independent experiments are presented. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 .

    Techniques Used: Expressing, Purification, Quantitative RT-PCR

    16) Product Images from "The Mevalonate Pathway of Staphylococcus aureus ▿ ▿ †"

    Article Title: The Mevalonate Pathway of Staphylococcus aureus ▿ ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01357-08

    qRT-PCR analysis.
    Figure Legend Snippet: qRT-PCR analysis.

    Techniques Used: Quantitative RT-PCR

    17) Product Images from "Study on expression of lncRNA RGMB-AS1 and repulsive guidance molecule b in non-small cell lung cancer"

    Article Title: Study on expression of lncRNA RGMB-AS1 and repulsive guidance molecule b in non-small cell lung cancer

    Journal: Diagnostic Pathology

    doi: 10.1186/s13000-015-0297-x

    siRNA of lncRNA RGMB-AS1 promoted the expression of RGMB in A549 and SPC-A-1 cells. a Cells were transfected with siRNA of lncRNA RGMB-AS1 and NC. RGMB mRNA level was detected by qRT-PCR assay. RGMB mRNA expression was upregulated in A549 and SPC-A-1 cells after transfection with siRNA of lncRNA RGMB-AS1 and NC respectively (* P
    Figure Legend Snippet: siRNA of lncRNA RGMB-AS1 promoted the expression of RGMB in A549 and SPC-A-1 cells. a Cells were transfected with siRNA of lncRNA RGMB-AS1 and NC. RGMB mRNA level was detected by qRT-PCR assay. RGMB mRNA expression was upregulated in A549 and SPC-A-1 cells after transfection with siRNA of lncRNA RGMB-AS1 and NC respectively (* P

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR

    18) Product Images from "Ntann12 annexin expression is induced by auxin in tobacco roots"

    Article Title: Ntann12 annexin expression is induced by auxin in tobacco roots

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/err112

    Ntann12 expression in 4-week-old plants. (A) pNtann12-GUS expression in whole tobacco plant; bar=1 mm. (B) Close-up of (A) showing pNtann12-GUS expression in the root tip; bar=0.5 mm. (C) GUS staining in a longitudinal section of the root; bar=100 μm. (D) Relative expression of Ntann12 in roots and in aerial parts of plants, as determined by qRT-PCR analysis. (E) Western blot analysis of total protein extracts (10 μg) from roots and leaves using anti-Ntann12 antibodies. EZ, elongation zone; L, leaf; M, molecular marker; MZ, maturation zone; RT, root tip; R, root.
    Figure Legend Snippet: Ntann12 expression in 4-week-old plants. (A) pNtann12-GUS expression in whole tobacco plant; bar=1 mm. (B) Close-up of (A) showing pNtann12-GUS expression in the root tip; bar=0.5 mm. (C) GUS staining in a longitudinal section of the root; bar=100 μm. (D) Relative expression of Ntann12 in roots and in aerial parts of plants, as determined by qRT-PCR analysis. (E) Western blot analysis of total protein extracts (10 μg) from roots and leaves using anti-Ntann12 antibodies. EZ, elongation zone; L, leaf; M, molecular marker; MZ, maturation zone; RT, root tip; R, root.

    Techniques Used: Expressing, Staining, Quantitative RT-PCR, Western Blot, Marker

    19) Product Images from "HOXA4, down-regulated in lung cancer, inhibits the growth, motility and invasion of lung cancer cells"

    Article Title: HOXA4, down-regulated in lung cancer, inhibits the growth, motility and invasion of lung cancer cells

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0497-x

    HOXA4 suppressed the Wnt signaling pathway in lung cancer cells. a , b Western blot analysis of GSK3β, β-catenin, Cyclin D1, c-Myc and Survivin in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression ( a ) and NCI-H1299 cells with HOXA4 silencing ( b ). GAPDH was used as a loading control. c , d qRT-PCR analysis of GSK3β mRNA levels in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression ( c ) and NCI-H1299 cells with HOXA4 silencing ( d ). e A luciferase reporter assay was performed to evaluate GSK3β promoter activity in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression or silencing. f ChIP-qPCR for the GSK3β promoter in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression or silencing. *** P
    Figure Legend Snippet: HOXA4 suppressed the Wnt signaling pathway in lung cancer cells. a , b Western blot analysis of GSK3β, β-catenin, Cyclin D1, c-Myc and Survivin in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression ( a ) and NCI-H1299 cells with HOXA4 silencing ( b ). GAPDH was used as a loading control. c , d qRT-PCR analysis of GSK3β mRNA levels in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression ( c ) and NCI-H1299 cells with HOXA4 silencing ( d ). e A luciferase reporter assay was performed to evaluate GSK3β promoter activity in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression or silencing. f ChIP-qPCR for the GSK3β promoter in NCI-H1975 and NCI-H446 cells with HOXA4 overexpression or silencing. *** P

    Techniques Used: Western Blot, Over Expression, Quantitative RT-PCR, Luciferase, Reporter Assay, Activity Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    20) Product Images from "Upregulation of colonic and hepatic tumor overexpressed gene is significantly associated with the unfavorable prognosis marker of human hepatocellular carcinoma"

    Article Title: Upregulation of colonic and hepatic tumor overexpressed gene is significantly associated with the unfavorable prognosis marker of human hepatocellular carcinoma

    Journal: American Journal of Cancer Research

    doi:

    ch-TOG expression is determined in HCC by qRT-PCR and immunohistochemistry. A. The relative expression of ch-TOG mRNA in 207 paired HCC tissues and matched adjacent noncancerous liver tissues (ANLT) and 12 normal liver tissues was evaluated by qRT-PCR.
    Figure Legend Snippet: ch-TOG expression is determined in HCC by qRT-PCR and immunohistochemistry. A. The relative expression of ch-TOG mRNA in 207 paired HCC tissues and matched adjacent noncancerous liver tissues (ANLT) and 12 normal liver tissues was evaluated by qRT-PCR.

    Techniques Used: Expressing, Quantitative RT-PCR, Immunohistochemistry

    21) Product Images from "MicroRNA-135b Regulates Leucine Zipper Tumor Suppressor 1 in Cutaneous Squamous Cell Carcinoma"

    Article Title: MicroRNA-135b Regulates Leucine Zipper Tumor Suppressor 1 in Cutaneous Squamous Cell Carcinoma

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0125412

    Functional assays of miR-135b inhibition and overexpression. A) Baseline mRNA miR-135b expression in 3 different OTR-derived cSCC cell lines was established by qRT-PCR. B) Effect of miR-135b inhibition on LZTS1 mRNA expression in cSCC lines by qRT-PCR within 48 hours post-transfection. C) Effect of miR-135b overexpression on LZTS1 mRNA expression in cSCC lines by qRT-PCR within 48 hours post-transfection. * indicate p values less than 0.005.
    Figure Legend Snippet: Functional assays of miR-135b inhibition and overexpression. A) Baseline mRNA miR-135b expression in 3 different OTR-derived cSCC cell lines was established by qRT-PCR. B) Effect of miR-135b inhibition on LZTS1 mRNA expression in cSCC lines by qRT-PCR within 48 hours post-transfection. C) Effect of miR-135b overexpression on LZTS1 mRNA expression in cSCC lines by qRT-PCR within 48 hours post-transfection. * indicate p values less than 0.005.

    Techniques Used: Functional Assay, Inhibition, Over Expression, Expressing, Derivative Assay, Quantitative RT-PCR, Transfection

    22) Product Images from "Novel pili-like surface structures of Halobacterium salinarum strain R1 are crucial for surface adhesion"

    Article Title: Novel pili-like surface structures of Halobacterium salinarum strain R1 are crucial for surface adhesion

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2014.00755

    Comparative qRT-PCR analyses of planktonic and surface attached cells. (A) Investigation of two representative housekeeping genes encoding RNA polymerase subunit B' ( rpoB1 ) and the translation elongation factor 2 ( aef2 ). Relative expression was normalized to external standard bgaH RNA. (B) Relative transcriptional quantification of the assembly ATPase encoding genes of the archaellum ( flaI ) and the type IV pilus biogenesis complexes pil-1 ( pilB1 ) and pil-2 ( pilB2 ) as well as the constitutively expressed ferredoxin gene ( fdx) . The bars represent the fold change of gene expression shown in base 2 logarithmic scale in adherent cells compared to the planktonic state, which is defined by the baseline.
    Figure Legend Snippet: Comparative qRT-PCR analyses of planktonic and surface attached cells. (A) Investigation of two representative housekeeping genes encoding RNA polymerase subunit B' ( rpoB1 ) and the translation elongation factor 2 ( aef2 ). Relative expression was normalized to external standard bgaH RNA. (B) Relative transcriptional quantification of the assembly ATPase encoding genes of the archaellum ( flaI ) and the type IV pilus biogenesis complexes pil-1 ( pilB1 ) and pil-2 ( pilB2 ) as well as the constitutively expressed ferredoxin gene ( fdx) . The bars represent the fold change of gene expression shown in base 2 logarithmic scale in adherent cells compared to the planktonic state, which is defined by the baseline.

    Techniques Used: Quantitative RT-PCR, Expressing

    23) Product Images from "Hyphal growth in Candida albicans does not require induction of hyphal-specific gene expression"

    Article Title: Hyphal growth in Candida albicans does not require induction of hyphal-specific gene expression

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E14-08-1312

    The basal level of HGC1 is higher in the h-d mutant but is not significantly induced by GlcNAc. Relative levels of HGC1 were determined by qRT-PCR analysis. Wild-type control (DIC185) and h-d mutant (AG738) cells were grown to log phase at 37°C in pH 4 synthetic medium containing amino acids and 50 mM dextrose, washed, and then resuspended in medium containing 50 mM dextrose (d) or GlcNAc (n) for 2 h.
    Figure Legend Snippet: The basal level of HGC1 is higher in the h-d mutant but is not significantly induced by GlcNAc. Relative levels of HGC1 were determined by qRT-PCR analysis. Wild-type control (DIC185) and h-d mutant (AG738) cells were grown to log phase at 37°C in pH 4 synthetic medium containing amino acids and 50 mM dextrose, washed, and then resuspended in medium containing 50 mM dextrose (d) or GlcNAc (n) for 2 h.

    Techniques Used: Mutagenesis, Quantitative RT-PCR

    GlcNAc stimulates the h-d mutant to form hyphae but does not induce hyphal-specific genes at low ambient pH. qRT-PCR analysis of the relative expression of the indicated genes normalized to the expression of actin ( ACT1 ) in each cell type. Cells were grown at 37°C at low ambient pH (∼pH 4) in synthetic medium containing amino acids. (A, D) wild-type control and h-d strains were grown to log phase in medium containing 50 mM dextrose and amino acids at 37°C, washed, and then incubated in similar medium containing 50 mM dextrose or 50 mM GlcNAc for 2 h. Cells grown in dextrose are labeled d, and those grown with GlcNAc are labeled n. (B, E) Wild-type control and h-d strains were grown in synthetic medium containing 50 mM galactose, and then 50 mM GlcNAc was added to one portion for 2 h. (C, F) Top, morphology of wild-type control and h-d cells grown in dextrose; bottom, cells grown in GlcNAc medium. (G) Summary of microarray analyses carried out in duplicate, showing the relative expression of the most highly induced hyphal-specific genes for the indicated strains and growth conditions. Scale bar on right, (log 2)-fold change in expression. The wild-type control strain was DIC185, and the h-d mutant strain was AG738. Cells were grown at 37°C at low pH (pH 4) in synthetic medium containing amino acids. Error bars on graphs indicate SD.
    Figure Legend Snippet: GlcNAc stimulates the h-d mutant to form hyphae but does not induce hyphal-specific genes at low ambient pH. qRT-PCR analysis of the relative expression of the indicated genes normalized to the expression of actin ( ACT1 ) in each cell type. Cells were grown at 37°C at low ambient pH (∼pH 4) in synthetic medium containing amino acids. (A, D) wild-type control and h-d strains were grown to log phase in medium containing 50 mM dextrose and amino acids at 37°C, washed, and then incubated in similar medium containing 50 mM dextrose or 50 mM GlcNAc for 2 h. Cells grown in dextrose are labeled d, and those grown with GlcNAc are labeled n. (B, E) Wild-type control and h-d strains were grown in synthetic medium containing 50 mM galactose, and then 50 mM GlcNAc was added to one portion for 2 h. (C, F) Top, morphology of wild-type control and h-d cells grown in dextrose; bottom, cells grown in GlcNAc medium. (G) Summary of microarray analyses carried out in duplicate, showing the relative expression of the most highly induced hyphal-specific genes for the indicated strains and growth conditions. Scale bar on right, (log 2)-fold change in expression. The wild-type control strain was DIC185, and the h-d mutant strain was AG738. Cells were grown at 37°C at low pH (pH 4) in synthetic medium containing amino acids. Error bars on graphs indicate SD.

    Techniques Used: Mutagenesis, Quantitative RT-PCR, Expressing, Incubation, Labeling, Microarray

    GlcNAc induction of HWP1 in the h-d mutant is dependent on ambient pH. (A) Wild-type control and h-d strains were grown in synthetic medium buffered to pH 7 with PIPES and containing dextrose and amino acids. Cells were then resuspended in the same medium containing 50 mM dextrose (d) or GlcNAc (n) for 2 h. Samples were analyzed by qRT-PCR. (B) Wild-type control and h-d strains carrying HWP1 -GFP were grown in synthetic medium with amino acids and 50 mM dextrose (Dex) or 50 mM GlcNAc at 37°C for 2 h, and then GFP fluorescence was quantified by fluorescence microscopy and shown as relative units. Culture medium was buffered to the indicated pH using pH 4 sodium citrate, pH 5 succinic acid, pH 6 MES, or pH 7 PIPES. (C) Fluorescence microscope images of the cells carrying the HWP1-GFP reporter gene. Cells were grown in 50 mM GlcNAc medium buffered to the pH indicated on the left. The wild-type control strain was SN969, and the h-d strain was SN971.
    Figure Legend Snippet: GlcNAc induction of HWP1 in the h-d mutant is dependent on ambient pH. (A) Wild-type control and h-d strains were grown in synthetic medium buffered to pH 7 with PIPES and containing dextrose and amino acids. Cells were then resuspended in the same medium containing 50 mM dextrose (d) or GlcNAc (n) for 2 h. Samples were analyzed by qRT-PCR. (B) Wild-type control and h-d strains carrying HWP1 -GFP were grown in synthetic medium with amino acids and 50 mM dextrose (Dex) or 50 mM GlcNAc at 37°C for 2 h, and then GFP fluorescence was quantified by fluorescence microscopy and shown as relative units. Culture medium was buffered to the indicated pH using pH 4 sodium citrate, pH 5 succinic acid, pH 6 MES, or pH 7 PIPES. (C) Fluorescence microscope images of the cells carrying the HWP1-GFP reporter gene. Cells were grown in 50 mM GlcNAc medium buffered to the pH indicated on the left. The wild-type control strain was SN969, and the h-d strain was SN971.

    Techniques Used: Mutagenesis, Quantitative RT-PCR, Fluorescence, Microscopy

    The rim101Δ and dfg16Δ mutants are defective in inducing hyphal-specific genes in response to GlcNAc. (A) The indicated strains were grown in synthetic medium buffered to pH 7 with PIPES and also containing amino acids and 50 mM dextrose. Cells were washed and then resuspended in medium containing 50 mM dextrose (upper top) or 50 mM GlcNAc (bottom) for 2 h at 37°C, and then cells were photographed. (B, C) Relative expression of NGT1 , ECE1 , and HWP1 was determined by qRT-PCR for cells grown as described in A. Wild-type control, rim101Δ , and dfg16Δ strains were grown in medium containing 50 mM dextrose (d) or 50 mM GlcNAc (n) for 2 h, and then cells were harvested for analysis. (D) Summary of microarray results, displaying the relative expression of the most highly induced hyphal-specific genes and GlcNAc catabolic genes for the indicated strains grown in dextrose or GlcNAc media for 2 h. Scale bar on right, log 2 change in expression for cells grown in GlcNAc vs. dextrose. The wild-type control strain was DIC185, the rim101Δ strain was DAY25, and the dfg16Δ strain was KBC048.
    Figure Legend Snippet: The rim101Δ and dfg16Δ mutants are defective in inducing hyphal-specific genes in response to GlcNAc. (A) The indicated strains were grown in synthetic medium buffered to pH 7 with PIPES and also containing amino acids and 50 mM dextrose. Cells were washed and then resuspended in medium containing 50 mM dextrose (upper top) or 50 mM GlcNAc (bottom) for 2 h at 37°C, and then cells were photographed. (B, C) Relative expression of NGT1 , ECE1 , and HWP1 was determined by qRT-PCR for cells grown as described in A. Wild-type control, rim101Δ , and dfg16Δ strains were grown in medium containing 50 mM dextrose (d) or 50 mM GlcNAc (n) for 2 h, and then cells were harvested for analysis. (D) Summary of microarray results, displaying the relative expression of the most highly induced hyphal-specific genes and GlcNAc catabolic genes for the indicated strains grown in dextrose or GlcNAc media for 2 h. Scale bar on right, log 2 change in expression for cells grown in GlcNAc vs. dextrose. The wild-type control strain was DIC185, the rim101Δ strain was DAY25, and the dfg16Δ strain was KBC048.

    Techniques Used: Expressing, Quantitative RT-PCR, Microarray

    24) Product Images from "IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors"

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors

    Journal: Oncotarget

    doi: 10.18632/oncotarget.17586

    TSA inhibits mRNA and protein expression levels of IRF5 A549 ( A ) and THP-1 ( B ) cells were treated with TSA (0, 1, 2.5, or 5 μM) or 0.1% DMSO (control). IRF5 mRNA expression was detected after 24 h by using qRT-PCR (** p
    Figure Legend Snippet: TSA inhibits mRNA and protein expression levels of IRF5 A549 ( A ) and THP-1 ( B ) cells were treated with TSA (0, 1, 2.5, or 5 μM) or 0.1% DMSO (control). IRF5 mRNA expression was detected after 24 h by using qRT-PCR (** p

    Techniques Used: Expressing, Quantitative RT-PCR

    p300 inhibits mRNA and protein expression levels of IRF5 ( A ) A549 cells were transfected with 1 μg p300 wt plasmid, p300 mut plasmid, PCAF wt plasmid, and PCAF mut plasmid; IRF5 mRNA expression was detected after 24 h by qRT-PCR (** p
    Figure Legend Snippet: p300 inhibits mRNA and protein expression levels of IRF5 ( A ) A549 cells were transfected with 1 μg p300 wt plasmid, p300 mut plasmid, PCAF wt plasmid, and PCAF mut plasmid; IRF5 mRNA expression was detected after 24 h by qRT-PCR (** p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Quantitative RT-PCR

    The transcript level of Sp1 or IFN-α correlated with the level of IRF5 in subjects with childhood-onset SLE and healthy controls Expression levels of Sp1, IFN-α, and IRF5 were analyzed by qRT-PCR. Differences in the expression levels of IRF5 ( A ), IFN-α ( B ), or Sp1 ( C ) between childhood-onset SLE and healthy controls were compared using Mann–Whitney U-test (** p
    Figure Legend Snippet: The transcript level of Sp1 or IFN-α correlated with the level of IRF5 in subjects with childhood-onset SLE and healthy controls Expression levels of Sp1, IFN-α, and IRF5 were analyzed by qRT-PCR. Differences in the expression levels of IRF5 ( A ), IFN-α ( B ), or Sp1 ( C ) between childhood-onset SLE and healthy controls were compared using Mann–Whitney U-test (** p

    Techniques Used: Expressing, Quantitative RT-PCR, MANN-WHITNEY

    25) Product Images from "The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma"

    Article Title: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma

    Journal: Endocrine-Related Cancer

    doi: 10.1530/ERC-11-0082

    miRNAs associated with survival of carcinoma patients. (A) Clustering analysis of 11 miRNAs identified by SAM survival analysis of microarray data, and subsequent Kaplan–Meier analysis for cases in cluster 1–3. (B) Kaplan–Meier curves for miR-503 , miR-1202 , and miR-1275 based on qRT-PCR results. Differences in survival were calculated using log-rank test.
    Figure Legend Snippet: miRNAs associated with survival of carcinoma patients. (A) Clustering analysis of 11 miRNAs identified by SAM survival analysis of microarray data, and subsequent Kaplan–Meier analysis for cases in cluster 1–3. (B) Kaplan–Meier curves for miR-503 , miR-1202 , and miR-1275 based on qRT-PCR results. Differences in survival were calculated using log-rank test.

    Techniques Used: Microarray, Quantitative RT-PCR

    Relative expression levels of miR-483-3p, miR-483-5p, miR-210, miR-21, miR-195, miR-497 , and miR-1974 in the different sample groups. Box plots show miRNA expression levels determined by qRT-PCR in adrenocortical carcinomas, adenomas, and adrenal cortices. Statistical significances between the groups were determined with two-tailed unpaired t -test and P
    Figure Legend Snippet: Relative expression levels of miR-483-3p, miR-483-5p, miR-210, miR-21, miR-195, miR-497 , and miR-1974 in the different sample groups. Box plots show miRNA expression levels determined by qRT-PCR in adrenocortical carcinomas, adenomas, and adrenal cortices. Statistical significances between the groups were determined with two-tailed unpaired t -test and P

    Techniques Used: Expressing, Quantitative RT-PCR, Two Tailed Test

    26) Product Images from "Transcriptome-wide analysis of immune-responsive microRNAs against poly (I:C) challenge in Branchiostoma belcheri by deep sequencing and bioinformatics"

    Article Title: Transcriptome-wide analysis of immune-responsive microRNAs against poly (I:C) challenge in Branchiostoma belcheri by deep sequencing and bioinformatics

    Journal: Oncotarget

    doi: 10.18632/oncotarget.20570

    Reliability of deep-sequencing data and functional enrichment analysis A. Heatmap of Pearson correlation coefficient among different samples. The maximum and minimum values are marked by blue and white respectively. A higher value indicates that the two samples are more similar. B. Correlation of Log2 (fold changes) in miRNA expression between deep sequencing and qRT-PCR results. The relative expression fold change between the control and treatment groups is indicated by black dots. C. GO terms enriched among target genes of differently expressed miRNAs. The x-axis indicates the number of target genes, and the y-axis shows the GO terms. All terms are classified into three subcategories marked by different colors.
    Figure Legend Snippet: Reliability of deep-sequencing data and functional enrichment analysis A. Heatmap of Pearson correlation coefficient among different samples. The maximum and minimum values are marked by blue and white respectively. A higher value indicates that the two samples are more similar. B. Correlation of Log2 (fold changes) in miRNA expression between deep sequencing and qRT-PCR results. The relative expression fold change between the control and treatment groups is indicated by black dots. C. GO terms enriched among target genes of differently expressed miRNAs. The x-axis indicates the number of target genes, and the y-axis shows the GO terms. All terms are classified into three subcategories marked by different colors.

    Techniques Used: Sequencing, Functional Assay, Expressing, Quantitative RT-PCR

    27) Product Images from "A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer"

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer

    Journal: PLoS Medicine

    doi: 10.1371/journal.pmed.0030467

    Validation Analyses of Gene Expression Profiling (A) QRT-PCR validations of several candidate survival-related genes. Bars represent fold changes for the selected genes with differential expression between long- ( > 5 y) and short-term survival (
    Figure Legend Snippet: Validation Analyses of Gene Expression Profiling (A) QRT-PCR validations of several candidate survival-related genes. Bars represent fold changes for the selected genes with differential expression between long- ( > 5 y) and short-term survival (

    Techniques Used: Expressing, Quantitative RT-PCR

    28) Product Images from "Upregulated Lipid Biosynthesis at the Expense of Starch Production in Potato (Solanum tuberosum) Vegetative Tissues via Simultaneous Downregulation of ADP-Glucose Pyrophosphorylase and Sugar Dependent1 Expressions"

    Article Title: Upregulated Lipid Biosynthesis at the Expense of Starch Production in Potato (Solanum tuberosum) Vegetative Tissues via Simultaneous Downregulation of ADP-Glucose Pyrophosphorylase and Sugar Dependent1 Expressions

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2019.01444

    Gene expression analysis and total carbon allocation in the potato tubers of WT (open bars) and the two selected WT-derived lines, WT-L5 (hatched bars) and WT-L10 (black bars) at two developmental stages. (A) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) result at the flowering stage; (B) Real-time qRT-PCR result at the mature stage; (C) Total carbon allocation at the flowering stage; (D) Total carbon allocation at the mature stage. The data represent the mean values ± SD of three biological replicates. Letters (a, b, c) above the bars are based on LSD, bars marked with different letters are statistically significantly different at P
    Figure Legend Snippet: Gene expression analysis and total carbon allocation in the potato tubers of WT (open bars) and the two selected WT-derived lines, WT-L5 (hatched bars) and WT-L10 (black bars) at two developmental stages. (A) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) result at the flowering stage; (B) Real-time qRT-PCR result at the mature stage; (C) Total carbon allocation at the flowering stage; (D) Total carbon allocation at the mature stage. The data represent the mean values ± SD of three biological replicates. Letters (a, b, c) above the bars are based on LSD, bars marked with different letters are statistically significantly different at P

    Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Gene expression analysis and total carbon allocation in the potato tubers of the HO69 (open bars) and three super-transformed lines, 69-L1 (bar with upward trend), 69-L2 (hatched bars) and 69-L3 (black bars) at two developmental stages. (A) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) result at the flowering stage; (B) Real-time qRT-PCR result at the mature stage; (C) Total carbon allocation at the flowering stage; (D) Total carbon allocation at the mature stage. The data represent the mean values ± SD of three biological replicates. Letters (a, b, c) above the bars are based on LSD, bars marked with different letters are statistically significantly different at P
    Figure Legend Snippet: Gene expression analysis and total carbon allocation in the potato tubers of the HO69 (open bars) and three super-transformed lines, 69-L1 (bar with upward trend), 69-L2 (hatched bars) and 69-L3 (black bars) at two developmental stages. (A) Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) result at the flowering stage; (B) Real-time qRT-PCR result at the mature stage; (C) Total carbon allocation at the flowering stage; (D) Total carbon allocation at the mature stage. The data represent the mean values ± SD of three biological replicates. Letters (a, b, c) above the bars are based on LSD, bars marked with different letters are statistically significantly different at P

    Techniques Used: Expressing, Transformation Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    29) Product Images from "Exosomes derived from high-glucose–stimulated Schwann cells promote development of diabetic peripheral neuropathy"

    Article Title: Exosomes derived from high-glucose–stimulated Schwann cells promote development of diabetic peripheral neuropathy

    Journal: The FASEB Journal

    doi: 10.1096/fj.201800597R

    The effects of HG exosomes on intraepidermal nerve fibers miR-28, -31a, and -130a and their target proteins. A ) Representative immunofluorescent images of intraepidermal nerve fibers in plantar skin of mice at age of 9 wk and quantitative data of the nerve fiber density of db/m and db/db mice treated with saline or HG exosomes. B ) qRT-PCR analysis shows levels of miR-28, -31a and -130a in SN and DRG tissues of db/db mice at the age of 9 wk after treatment with saline or HG exosomes. C , D ) Representative Western blot images of DNMT3A, NUMB, SNAP25, and GAP43 proteins and quantitative data of these proteins in DRG tissues and SN of db/db mice treated with saline and HG exosomes ( n = 10 /group). Scale bar, 50 μm. * P
    Figure Legend Snippet: The effects of HG exosomes on intraepidermal nerve fibers miR-28, -31a, and -130a and their target proteins. A ) Representative immunofluorescent images of intraepidermal nerve fibers in plantar skin of mice at age of 9 wk and quantitative data of the nerve fiber density of db/m and db/db mice treated with saline or HG exosomes. B ) qRT-PCR analysis shows levels of miR-28, -31a and -130a in SN and DRG tissues of db/db mice at the age of 9 wk after treatment with saline or HG exosomes. C , D ) Representative Western blot images of DNMT3A, NUMB, SNAP25, and GAP43 proteins and quantitative data of these proteins in DRG tissues and SN of db/db mice treated with saline and HG exosomes ( n = 10 /group). Scale bar, 50 μm. * P

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Western Blot

    Diabetic db/db mice at age of 12 wk exhibit elevation of miR-28, -31a, and -130a and reduction of DNMT3A, NUMB, SNAP25, and GAP43 proteins in the SN tissues. A ) qRT-PCR analysis shows levels of miR-28, -31a, and -130a in the SN and DRG tissues of db/db or db/m mice at the age of 12 wk. B ) Representative Western blots showed DNMT3A, NUMB, SNAP25, and GAP43 proteins in the SN and DRG tissues. C–F ) Quantitative data showed proteins of DNMT3A ( C ), NUMB ( D ), SNAP25 ( E ), and GAP43 ( F ) in the SN and DRG tissues of db/m or db/db mice ( n = 4 mice/group). * P
    Figure Legend Snippet: Diabetic db/db mice at age of 12 wk exhibit elevation of miR-28, -31a, and -130a and reduction of DNMT3A, NUMB, SNAP25, and GAP43 proteins in the SN tissues. A ) qRT-PCR analysis shows levels of miR-28, -31a, and -130a in the SN and DRG tissues of db/db or db/m mice at the age of 12 wk. B ) Representative Western blots showed DNMT3A, NUMB, SNAP25, and GAP43 proteins in the SN and DRG tissues. C–F ) Quantitative data showed proteins of DNMT3A ( C ), NUMB ( D ), SNAP25 ( E ), and GAP43 ( F ) in the SN and DRG tissues of db/m or db/db mice ( n = 4 mice/group). * P

    Techniques Used: Mouse Assay, Quantitative RT-PCR, Western Blot

    HG exosomes increase levels of miR-28, -31a, and -130a in DRG neurons. A ) Heat maps of miRs acquired from Taqman miR array analysis show the top 20 highly expressed miRs ranked by C t values in HG exosomes. Levels of these miRs were compared between HG exosomes and control exosomes (left column), and between HG-Schwann cells and control-Schwann cells (right column). B , C ) Asterisks indicate 2-fold change of miRs. qRT-PCR analysis showed that transfection of Schwann cells with siRNAs against miR-28, -31a, and -130a abolished HG-elevated these 3 miRs in HG exosomes ( B ) and in Schwann cells ( C ). D ) Treatment of distal axons with HG exomes derived from Schwann cells transfected with siRNA against these 3 miRs did not increase levels of these 3 miRs within the axons. E , F ) Application of HG exosomes into the distal axons elevated levels of miR-28, -31a, and -130a in distal axons ( E ), but not in cell bodies of DRG neurons ( F ). F–I ) qRT-PCR ( F ) and FISH ( G – I ) analysis showed that application of HG exosomes into cell bodies and distal axons increased miR-28, -31a, and -130a in entire DRG neurons ( n = 6 chambers/3 individual experiments /group). Scale bars, 10 μm. Asterisks denote fold change ≥2 ( A ) or P
    Figure Legend Snippet: HG exosomes increase levels of miR-28, -31a, and -130a in DRG neurons. A ) Heat maps of miRs acquired from Taqman miR array analysis show the top 20 highly expressed miRs ranked by C t values in HG exosomes. Levels of these miRs were compared between HG exosomes and control exosomes (left column), and between HG-Schwann cells and control-Schwann cells (right column). B , C ) Asterisks indicate 2-fold change of miRs. qRT-PCR analysis showed that transfection of Schwann cells with siRNAs against miR-28, -31a, and -130a abolished HG-elevated these 3 miRs in HG exosomes ( B ) and in Schwann cells ( C ). D ) Treatment of distal axons with HG exomes derived from Schwann cells transfected with siRNA against these 3 miRs did not increase levels of these 3 miRs within the axons. E , F ) Application of HG exosomes into the distal axons elevated levels of miR-28, -31a, and -130a in distal axons ( E ), but not in cell bodies of DRG neurons ( F ). F–I ) qRT-PCR ( F ) and FISH ( G – I ) analysis showed that application of HG exosomes into cell bodies and distal axons increased miR-28, -31a, and -130a in entire DRG neurons ( n = 6 chambers/3 individual experiments /group). Scale bars, 10 μm. Asterisks denote fold change ≥2 ( A ) or P

    Techniques Used: Quantitative RT-PCR, Transfection, Derivative Assay, Fluorescence In Situ Hybridization

    MiR-28, -31a and -130a regulate axonal growth. qRT-PCR analysis ( A , D , G ) and axonal length measurements ( B , C , E, F , H , I ) show that axonal local transfection of siRNAs or mimics of miR-28 ( A – C ), -31a ( D – F ), and -130a ( G – I ) significantly reduced and increased, respectively, these 3 miR levels in axons ( A , D , G ), whereas siRNAs and mimics of these miRs significantly augmented and decreased, respectively, axonal growth, as shown by representative images ( B , E , H ) and quantitative measurements ( C , F , I ) ( n = 6 chambers/3 individual experiments /group). Scale bars, 10 μm. * P
    Figure Legend Snippet: MiR-28, -31a and -130a regulate axonal growth. qRT-PCR analysis ( A , D , G ) and axonal length measurements ( B , C , E, F , H , I ) show that axonal local transfection of siRNAs or mimics of miR-28 ( A – C ), -31a ( D – F ), and -130a ( G – I ) significantly reduced and increased, respectively, these 3 miR levels in axons ( A , D , G ), whereas siRNAs and mimics of these miRs significantly augmented and decreased, respectively, axonal growth, as shown by representative images ( B , E , H ) and quantitative measurements ( C , F , I ) ( n = 6 chambers/3 individual experiments /group). Scale bars, 10 μm. * P

    Techniques Used: Quantitative RT-PCR, Transfection

    A–C ) Downregulation of DNMT3A, NUMB, SNAP25, and GAP43 decreases axonal growth. qRT-PCR ( A ) and Western blot ( B ) analyses show that transfection of axons with siRNAs against DNMT3A, NUMB, SNAP25, and GAP43 significantly reduced mRNA ( A ) and protein ( C ) levels of DNMT3A, NUMB, SNAP25, and GAP43 in axons of DRG neurons under regular glucose condition. D , E ) Representative images of distal axons ( D ) and quantitative data of axonal length over DIV3 to -5 ( E ) show that reduction of these proteins resulted in decreases of axonal growth compared to axons transfected by control siRNAs ( n = 6 chambers/3 individual experiments/group). Scale bar, 10 μm. * P
    Figure Legend Snippet: A–C ) Downregulation of DNMT3A, NUMB, SNAP25, and GAP43 decreases axonal growth. qRT-PCR ( A ) and Western blot ( B ) analyses show that transfection of axons with siRNAs against DNMT3A, NUMB, SNAP25, and GAP43 significantly reduced mRNA ( A ) and protein ( C ) levels of DNMT3A, NUMB, SNAP25, and GAP43 in axons of DRG neurons under regular glucose condition. D , E ) Representative images of distal axons ( D ) and quantitative data of axonal length over DIV3 to -5 ( E ) show that reduction of these proteins resulted in decreases of axonal growth compared to axons transfected by control siRNAs ( n = 6 chambers/3 individual experiments/group). Scale bar, 10 μm. * P

    Techniques Used: Quantitative RT-PCR, Western Blot, Transfection

    30) Product Images from "RhoA controls retinoid signaling by ROCK dependent regulation of retinol metabolism"

    Article Title: RhoA controls retinoid signaling by ROCK dependent regulation of retinol metabolism

    Journal: Small GTPases

    doi: 10.1080/21541248.2016.1248272

    ROCK inhibition increases expression of retinoic acid dependent genes in keratinocytes. (A) qRT-PCR of RNA samples from cultured control and RhoA-null keratinocytes. Shown are fold inductions from RhoA-ko compared to control keratinocytes (n > 3; *: p
    Figure Legend Snippet: ROCK inhibition increases expression of retinoic acid dependent genes in keratinocytes. (A) qRT-PCR of RNA samples from cultured control and RhoA-null keratinocytes. Shown are fold inductions from RhoA-ko compared to control keratinocytes (n > 3; *: p

    Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, Cell Culture

    31) Product Images from "Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells"

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-29700-3

    CAP suppressed, but vinexin promoted, adipocyte differentiation. Vinexin- and CAP-depleted ( a – d ) cells, as well as vinexin α re-expressing cells ( e , g , h ) and CAP re-expressing cells ( f , i , j ) were seeded on plastic dishes at a density of 1.2 × 10 5 cells/35 mm dish and induced to differentiate into adipocyte. RNAs were extracted 6 days after MDI treatment, and the mRNAs expression of PPARγ2 and aP2 was quantified by qRT-PCR ( a , e , f ). The expression levels relative to those in control cells are shown. ( b ) Cell were lysed and equal amounts of cell lysates were analyzed by western blotting using the anti-aP2 and anti-vinculin (loading control) antibodies. Blots were cropped from full-size images (see Supplemental Information). ( c , d , g – j ) Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown ( c , g , i ). ( d , h , j ) Nine images were obtained from three independent experiments, and the percentage of area stained were quantified using ImageJ. ( k , l ) Control and CAP depleted cells at the density of 1.0 × 10 5 cells/ 6 well plates were infected with lentiviruses expressing GFP-T12 vinculin. Two days after the infection, cells were induced to differentiate into adipocytes. Differentiated adipocytes were stained with Oil Red O on day 6. (l) Twelve images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. Scale bars: 200 μm. The values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test or Student’s t-test ( e , f , h , j ). *p
    Figure Legend Snippet: CAP suppressed, but vinexin promoted, adipocyte differentiation. Vinexin- and CAP-depleted ( a – d ) cells, as well as vinexin α re-expressing cells ( e , g , h ) and CAP re-expressing cells ( f , i , j ) were seeded on plastic dishes at a density of 1.2 × 10 5 cells/35 mm dish and induced to differentiate into adipocyte. RNAs were extracted 6 days after MDI treatment, and the mRNAs expression of PPARγ2 and aP2 was quantified by qRT-PCR ( a , e , f ). The expression levels relative to those in control cells are shown. ( b ) Cell were lysed and equal amounts of cell lysates were analyzed by western blotting using the anti-aP2 and anti-vinculin (loading control) antibodies. Blots were cropped from full-size images (see Supplemental Information). ( c , d , g – j ) Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown ( c , g , i ). ( d , h , j ) Nine images were obtained from three independent experiments, and the percentage of area stained were quantified using ImageJ. ( k , l ) Control and CAP depleted cells at the density of 1.0 × 10 5 cells/ 6 well plates were infected with lentiviruses expressing GFP-T12 vinculin. Two days after the infection, cells were induced to differentiate into adipocytes. Differentiated adipocytes were stained with Oil Red O on day 6. (l) Twelve images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. Scale bars: 200 μm. The values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test or Student’s t-test ( e , f , h , j ). *p

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Staining, Infection

    CAP promoted osteoblast differentiation and vinexin inhibited calcification. Vinexin- or CAP-depleted ( a , b , c , j , k ) cells and vinexin α re-expressing cells ( d , f , h ) or CAP re-expressing cells seeded on plastic dishes were induced to differentiate into osteoblasts by incubating them with αMEM medium. ( a , d , e ) On day 6, RNAs were extracted and the expression of the ALP mRNA was quantified by qRT-PCR. The relative expression compared to control cells is shown from triplicate experiment. ( b , c , f – i ) On day 4, ALP activity was visualized and six images from each condition were obtained from two independent experiments. Representative images are shown. Scale bars: 400 μm. ( c , h , i ) Total intensity was quantified using ImageJ. ( j , k ) On day 6, cells were stained with Alizarin Red S and six images were obtained from two independent experiments. Representative images are shown. Scale bars: 200 μm. ( k ) The relative stained area was quantified using ImageJ. Values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test ( a , c , k ) and Student’s t-test ( d , e , h , i ). ***p
    Figure Legend Snippet: CAP promoted osteoblast differentiation and vinexin inhibited calcification. Vinexin- or CAP-depleted ( a , b , c , j , k ) cells and vinexin α re-expressing cells ( d , f , h ) or CAP re-expressing cells seeded on plastic dishes were induced to differentiate into osteoblasts by incubating them with αMEM medium. ( a , d , e ) On day 6, RNAs were extracted and the expression of the ALP mRNA was quantified by qRT-PCR. The relative expression compared to control cells is shown from triplicate experiment. ( b , c , f – i ) On day 4, ALP activity was visualized and six images from each condition were obtained from two independent experiments. Representative images are shown. Scale bars: 400 μm. ( c , h , i ) Total intensity was quantified using ImageJ. ( j , k ) On day 6, cells were stained with Alizarin Red S and six images were obtained from two independent experiments. Representative images are shown. Scale bars: 200 μm. ( k ) The relative stained area was quantified using ImageJ. Values represent the mean ± s.e.m. Statistical significance was determined by one-way ANOVA with Tukey’s test ( a , c , k ) and Student’s t-test ( d , e , h , i ). ***p

    Techniques Used: Expressing, ALP Assay, Quantitative RT-PCR, Activity Assay, Staining

    Vinexin and CAP regulated differentiation in an ECM stiffness-dependent manner. ( a , b ) Vinexin- or CAP-depleted cells were seeded onto PAA gels coated with collagen and induced to differentiate into adipocytes. Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown. Scale bars: 200 μm. ( b ) Eight images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. ( c , d ) CAP-depleted cells were transfected with negative control (siNC) or TAZ-targeted siRNA. ( c ) TAZ expression was analyzed with western blotting. Blots were cropped from full-size images (see Supplemental Information). ( d ) On day 6 after siRNA transfection, the expression of aP2 and ALP mRNA was quantified by qRT-PCR. The expression relative to control cells transfected with negative control siRNA from triplicate experiments is shown. Values represent the mean ± s.e.m. Each experiment was repeated twice. Statistical significance was determined by one-way ANOVA with Tukey’s test. **p
    Figure Legend Snippet: Vinexin and CAP regulated differentiation in an ECM stiffness-dependent manner. ( a , b ) Vinexin- or CAP-depleted cells were seeded onto PAA gels coated with collagen and induced to differentiate into adipocytes. Cells were stained with Oil Red O on day 6 after MDI treatment and representative images are shown. Scale bars: 200 μm. ( b ) Eight images were obtained from two independent experiments, and the percentage of the stained area was quantified using ImageJ. ( c , d ) CAP-depleted cells were transfected with negative control (siNC) or TAZ-targeted siRNA. ( c ) TAZ expression was analyzed with western blotting. Blots were cropped from full-size images (see Supplemental Information). ( d ) On day 6 after siRNA transfection, the expression of aP2 and ALP mRNA was quantified by qRT-PCR. The expression relative to control cells transfected with negative control siRNA from triplicate experiments is shown. Values represent the mean ± s.e.m. Each experiment was repeated twice. Statistical significance was determined by one-way ANOVA with Tukey’s test. **p

    Techniques Used: Staining, Transfection, Negative Control, Expressing, Western Blot, ALP Assay, Quantitative RT-PCR

    32) Product Images from "SOX30 is a key regulator of desmosomal gene suppressing tumor growth and metastasis in lung adenocarcinoma"

    Article Title: SOX30 is a key regulator of desmosomal gene suppressing tumor growth and metastasis in lung adenocarcinoma

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/s13046-018-0778-3

    Inhibition of SOX30 promotes tumorigenesis of lung cancer with urethane treatment. a The mRNA expression of DSP, JUP and DSC3 in lung tissues of SOX30-knockout mice were measured by qRT-PCR. b The protein expression of DSP, JUP and DSC3 in lung tissues of SOX30-knockout mice were detected by WB. c Lung tissues were processed and stained with H E for detection of tumor foci. d Tumor extracts were analyzed by WB. ACTIN was used as a loading control. e Schematic diagram of the mechanisms of SOX30 mediated suppression of ADC cell proliferation and metastasis based on our study
    Figure Legend Snippet: Inhibition of SOX30 promotes tumorigenesis of lung cancer with urethane treatment. a The mRNA expression of DSP, JUP and DSC3 in lung tissues of SOX30-knockout mice were measured by qRT-PCR. b The protein expression of DSP, JUP and DSC3 in lung tissues of SOX30-knockout mice were detected by WB. c Lung tissues were processed and stained with H E for detection of tumor foci. d Tumor extracts were analyzed by WB. ACTIN was used as a loading control. e Schematic diagram of the mechanisms of SOX30 mediated suppression of ADC cell proliferation and metastasis based on our study

    Techniques Used: Inhibition, Expressing, Knock-Out, Mouse Assay, Quantitative RT-PCR, Western Blot, Staining

    SOX30 is positive correlated with desmosomal gene expression in ADC, but not in SCC. a Heatmaps for correlations between SOX30 and desmosomal genes in the TCGA lung adenocarcinoma RNAseq (IlluminaHiSeq; n = 571) data set. b Heatmaps for correlations between SOX30 and desmosomal genes in the TCGA lung squamous carcinoma RNAseq (IlluminaHiSeq; n = 553) data set. Correlation coefficient R and P -values were calculated by a Spearman correlation analysis. c qRT-PCR analysis of desmosomal gene expression in A549 and LTEP-a-2 cells transiently transfected with the vector control or SOX30 expression vector. d qRT-PCR analysis of desmosomal gene expression in H520 and H226 cells transiently transfected with the vector control or SOX30 expression vector. ACTIN was used as an internal control. e The protein levels of DSP, and JUP and DSC3 were monitored by WB after SOX30 overexpression in A549 and LTEP-a-2 cells. f The protein levels of DSP, and JUP and DSC3 were monitored by WB after SOX30 overexpression in H520 and H226 cells. g The protein levels of SOX30, DSP, JUP and DSC3 were further monitored by IHC in human ADC tissues. h The protein levels of SOX30, DSP, JUP and DSC3 were further monitored by IHC in human SCC tissues. Scale bar represents 50 mm
    Figure Legend Snippet: SOX30 is positive correlated with desmosomal gene expression in ADC, but not in SCC. a Heatmaps for correlations between SOX30 and desmosomal genes in the TCGA lung adenocarcinoma RNAseq (IlluminaHiSeq; n = 571) data set. b Heatmaps for correlations between SOX30 and desmosomal genes in the TCGA lung squamous carcinoma RNAseq (IlluminaHiSeq; n = 553) data set. Correlation coefficient R and P -values were calculated by a Spearman correlation analysis. c qRT-PCR analysis of desmosomal gene expression in A549 and LTEP-a-2 cells transiently transfected with the vector control or SOX30 expression vector. d qRT-PCR analysis of desmosomal gene expression in H520 and H226 cells transiently transfected with the vector control or SOX30 expression vector. ACTIN was used as an internal control. e The protein levels of DSP, and JUP and DSC3 were monitored by WB after SOX30 overexpression in A549 and LTEP-a-2 cells. f The protein levels of DSP, and JUP and DSC3 were monitored by WB after SOX30 overexpression in H520 and H226 cells. g The protein levels of SOX30, DSP, JUP and DSC3 were further monitored by IHC in human ADC tissues. h The protein levels of SOX30, DSP, JUP and DSC3 were further monitored by IHC in human SCC tissues. Scale bar represents 50 mm

    Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot, Over Expression, Immunohistochemistry

    33) Product Images from "Filament Condition-Specific Response Elements Control the Expression of NRG1 and UME6, Key Transcriptional Regulators of Morphology and Virulence in Candida albicans"

    Article Title: Filament Condition-Specific Response Elements Control the Expression of NRG1 and UME6, Key Transcriptional Regulators of Morphology and Virulence in Candida albicans

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0122775

    Deletion analysis of the NRG1 promoter identifies specific response elements for serum at 37°C and Spider. Strains bearing the indicated NRG1 promoter- lacZ reporter constructs were grown under both non-filament-inducing (YEPD at 30°C) and filament-inducing (YEPD + 10% serum at 37°C or Spider at 30°C) conditions. Cells were harvested from both non-inducing and filament-inducing cultures for total RNA isolation and cDNA synthesis. For the serum and temperature induction experiment (A) cells were harvested at the 30 minute post-induction time point and for the Spider induction experiment (B) cells were harvested at the 6 hr. post-induction time point. lacZ expression was determined by qRT-PCR and normalized to ACT1 levels. Fold down-regulation of lacZ was determined by dividing normalized lacZ values obtained from cells grown under non-filament inducing conditions by normalized lacZ values obtained from cells induced to form filaments under each condition.
    Figure Legend Snippet: Deletion analysis of the NRG1 promoter identifies specific response elements for serum at 37°C and Spider. Strains bearing the indicated NRG1 promoter- lacZ reporter constructs were grown under both non-filament-inducing (YEPD at 30°C) and filament-inducing (YEPD + 10% serum at 37°C or Spider at 30°C) conditions. Cells were harvested from both non-inducing and filament-inducing cultures for total RNA isolation and cDNA synthesis. For the serum and temperature induction experiment (A) cells were harvested at the 30 minute post-induction time point and for the Spider induction experiment (B) cells were harvested at the 6 hr. post-induction time point. lacZ expression was determined by qRT-PCR and normalized to ACT1 levels. Fold down-regulation of lacZ was determined by dividing normalized lacZ values obtained from cells grown under non-filament inducing conditions by normalized lacZ values obtained from cells induced to form filaments under each condition.

    Techniques Used: Construct, Isolation, Expressing, Quantitative RT-PCR

    Identification of hyphal shock response elements in the NRG1 promoter. Strains bearing the indicated NRG1 promoter- lacZ reporter constructs were grown overnight under non-inducing conditions (YEPD at 30°C) and diluted into fresh YEPD medium in the presence or absence of 40 μM farnesol at 30°C. Cells were harvested from both the overnight culture (zero time point) as well as at 30 minutes following dilution for total RNA isolation and cDNA synthesis. lacZ expression values were determined by qRT-PCR and normalized to ACT1 levels. Fold down-regulation of lacZ was determined by dividing normalized lacZ values from cells grown overnight under non-filament inducing conditions (zero time point) by normalized lacZ values from cells diluted into fresh YEPD or YEPD plus 40 μM farnesol.
    Figure Legend Snippet: Identification of hyphal shock response elements in the NRG1 promoter. Strains bearing the indicated NRG1 promoter- lacZ reporter constructs were grown overnight under non-inducing conditions (YEPD at 30°C) and diluted into fresh YEPD medium in the presence or absence of 40 μM farnesol at 30°C. Cells were harvested from both the overnight culture (zero time point) as well as at 30 minutes following dilution for total RNA isolation and cDNA synthesis. lacZ expression values were determined by qRT-PCR and normalized to ACT1 levels. Fold down-regulation of lacZ was determined by dividing normalized lacZ values from cells grown overnight under non-filament inducing conditions (zero time point) by normalized lacZ values from cells diluted into fresh YEPD or YEPD plus 40 μM farnesol.

    Techniques Used: Construct, Isolation, Expressing, Quantitative RT-PCR

    Deletion analysis of the UME6 promoter identifies condition-specific response elements. Strains bearing the indicated UME6 promoter- lacZ reporter constructs were grown under non-inducing conditions (YEPD at 30°C for the serum and temperature induction experiment and Lee’s pH 4.5 medium for the neutral pH induction experiment) and the indicated filament-inducing conditions. Cells were harvested (at 30 minutes for the serum and temperature induction experiment and at 1 hour for the neutral pH induction experiment) for total RNA isolation and cDNA synthesis. lacZ expression values were determined by qRT-PCR and normalized to ACT1 levels. Fold up-regulation of lacZ was determined by dividing normalized lacZ values from cells induced to form filaments under each filament-inducing condition by normalized lacZ values from cells grown under non-filament inducing conditions. Please note that the fold lacZ up-regulation value for the—6.0 kb UME6 promoter construct in 37°C + serum has been reported previously [ 38 ].
    Figure Legend Snippet: Deletion analysis of the UME6 promoter identifies condition-specific response elements. Strains bearing the indicated UME6 promoter- lacZ reporter constructs were grown under non-inducing conditions (YEPD at 30°C for the serum and temperature induction experiment and Lee’s pH 4.5 medium for the neutral pH induction experiment) and the indicated filament-inducing conditions. Cells were harvested (at 30 minutes for the serum and temperature induction experiment and at 1 hour for the neutral pH induction experiment) for total RNA isolation and cDNA synthesis. lacZ expression values were determined by qRT-PCR and normalized to ACT1 levels. Fold up-regulation of lacZ was determined by dividing normalized lacZ values from cells induced to form filaments under each filament-inducing condition by normalized lacZ values from cells grown under non-filament inducing conditions. Please note that the fold lacZ up-regulation value for the—6.0 kb UME6 promoter construct in 37°C + serum has been reported previously [ 38 ].

    Techniques Used: Construct, Isolation, Expressing, Quantitative RT-PCR

    34) Product Images from "Real-time Transcriptional Profiling of Cellular and Viral Gene Expression during Lytic Cytomegalovirus Infection"

    Article Title: Real-time Transcriptional Profiling of Cellular and Viral Gene Expression during Lytic Cytomegalovirus Infection

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002908

    Real-time kinetics of viral gene expression. ( A ) 4sU-tagging allows efficient removal of viral DNA and virion-associated RNA. Newly transcribed RNA was labeled with 200 µM 4sU for 1 h in MCMV-infected NIH-3T3 cells at −1 to 0 (mock), 1–2, 3–4 and 7–8 hpi. As a negative control, Actinomycin-D was added to cells prior to infection to block transcription and thus 4sU-incorporation. Total RNA was isolated, treated with DNaseI and newly transcribed RNA was purified. qRT-PCR analysis was performed on newly transcribed RNA for viral ie1 and cellular Lbr. Shown are the combined data (means +/− SD) of three independent experiments. ( B–F ) Gene expression kinetics of exemplary viral genes. Shown are qRT-PCR measurements of newly transcribed RNA for ie1 ( B ), the early genes m169 ( C ) and m152 ( D ) as well as for the late genes m129/131 ( E ) and M94 ( F ). Synthesis rates were normalized to Lbr expression. Shown are the combined data (means +/− SD) of three independent experiments. ( G ) Contribution of viral transcripts to all coding sequence reads (CDS). RNA-seq was performed on newly transcribed, total and unlabeled pre-existing RNA samples (n = 1). Reads were mapped to both the cellular and viral transcriptome/genome. The contribution of viral reads to all CDS reads at different times of infection is shown.
    Figure Legend Snippet: Real-time kinetics of viral gene expression. ( A ) 4sU-tagging allows efficient removal of viral DNA and virion-associated RNA. Newly transcribed RNA was labeled with 200 µM 4sU for 1 h in MCMV-infected NIH-3T3 cells at −1 to 0 (mock), 1–2, 3–4 and 7–8 hpi. As a negative control, Actinomycin-D was added to cells prior to infection to block transcription and thus 4sU-incorporation. Total RNA was isolated, treated with DNaseI and newly transcribed RNA was purified. qRT-PCR analysis was performed on newly transcribed RNA for viral ie1 and cellular Lbr. Shown are the combined data (means +/− SD) of three independent experiments. ( B–F ) Gene expression kinetics of exemplary viral genes. Shown are qRT-PCR measurements of newly transcribed RNA for ie1 ( B ), the early genes m169 ( C ) and m152 ( D ) as well as for the late genes m129/131 ( E ) and M94 ( F ). Synthesis rates were normalized to Lbr expression. Shown are the combined data (means +/− SD) of three independent experiments. ( G ) Contribution of viral transcripts to all coding sequence reads (CDS). RNA-seq was performed on newly transcribed, total and unlabeled pre-existing RNA samples (n = 1). Reads were mapped to both the cellular and viral transcriptome/genome. The contribution of viral reads to all CDS reads at different times of infection is shown.

    Techniques Used: Expressing, Labeling, Infection, Negative Control, Blocking Assay, Isolation, Purification, Quantitative RT-PCR, Sequencing, RNA Sequencing Assay

    35) Product Images from "The Association between Genetic Polymorphism and the Processing Efficiency of miR-149 Affects the Prognosis of Patients with Head and Neck Squamous Cell Carcinoma"

    Article Title: The Association between Genetic Polymorphism and the Processing Efficiency of miR-149 Affects the Prognosis of Patients with Head and Neck Squamous Cell Carcinoma

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0051606

    miR-149 expression and HNSCC cell migration. SAS and OECM-1 cells were transfected with miR-149 mimic and miR-149 inhibitor. (A) qRT-PCR analysis. This detected increased miR-149 expression and decreased miR-149 expression following transfecting with miR-149 mimic and miR-149 inhibitor, respectively, relative to the controls. (B) Transwell migration assay. This indicated that transient miR-149 expression decreased cell migration, and knockdown of miR-149 expression increased cell migration. The results are means ± SE from at least triplicate analysis; un-paired t -test.
    Figure Legend Snippet: miR-149 expression and HNSCC cell migration. SAS and OECM-1 cells were transfected with miR-149 mimic and miR-149 inhibitor. (A) qRT-PCR analysis. This detected increased miR-149 expression and decreased miR-149 expression following transfecting with miR-149 mimic and miR-149 inhibitor, respectively, relative to the controls. (B) Transwell migration assay. This indicated that transient miR-149 expression decreased cell migration, and knockdown of miR-149 expression increased cell migration. The results are means ± SE from at least triplicate analysis; un-paired t -test.

    Techniques Used: Expressing, Migration, Transfection, Quantitative RT-PCR, Transwell Migration Assay

    36) Product Images from "Candida albicans Isolates from the Gut of Critically Ill Patients Respond to Phosphate Limitation by Expressing Filaments and a Lethal Phenotype"

    Article Title: Candida albicans Isolates from the Gut of Critically Ill Patients Respond to Phosphate Limitation by Expressing Filaments and a Lethal Phenotype

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0030119

    Expression of PHO4 and production of acid phosphatase in response to phosphate limitation. (A) QRT-PCR analysis demonstrating the fold expression of PHO4 in (▪) ICU12 and (□) SN152 growing on low phosphate vs high phosphate solid PNMC medium. n = 3, p
    Figure Legend Snippet: Expression of PHO4 and production of acid phosphatase in response to phosphate limitation. (A) QRT-PCR analysis demonstrating the fold expression of PHO4 in (▪) ICU12 and (□) SN152 growing on low phosphate vs high phosphate solid PNMC medium. n = 3, p

    Techniques Used: Expressing, Quantitative RT-PCR

    37) Product Images from "NF-κB1, c-Rel, and ELK1 inhibit miR-134 expression leading to TAB1 upregulation in paclitaxel-resistant human ovarian cancer"

    Article Title: NF-κB1, c-Rel, and ELK1 inhibit miR-134 expression leading to TAB1 upregulation in paclitaxel-resistant human ovarian cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.15267

    NF-κB1, c-Rel and ELK1 bind directly to the response elements in the putative promoter of miR-134 in ovarian cancer cells A . Five genomic regions (R1–R5) spanning a 2.4 kb sequence upstream of the pre-miR-134. B-D . Binding of NF-κB1, c-Rel and ELK1 to the miR-134 promoter region was validated in SKOV3-TR30 cells by ChIP. Non-immune IgG and input DNA served as negative and positive controls, respectively. The enrichment of the binding of NF-κB1, c-Rel and ELK1 with the R3, R5 and R1 regions was quantified from the corresponding ChIP with qPCR. E . EMSA was performed with nuclear extracts from SKOV3-TR30 cells incubated with 5′-biotin-labeled oligonucleotide sequences containing the binding sites for the NF-κB1, c-Rel and ELK1 transcription factors. Unlabeled competitor sequence was also included to indicate the specificity of the protein-DNA complexes. F . pBI- NF-κB1, pBI- c-Rel and pBI- ELK1 overexpression plasmids were transfected into SKOV3 cells; the transfection efficiency was validated by qRT-PCR and Western blot analyses. G . At 48 h after transfection, luciferase activity was determined and then normalized to Renilla values. H . Sequencing was used to identify that the plasmids including pGL3-promoter-R1 (containing the ELK1 binding site) and its mutant pGL3-promoter-R1-mut, pGL3-promoter-R3 (containing the NF-κB1 binding site) and its mutant pGL3-promoter-R3-mut as well as pGL3-promoter-R5 (containing the c-Rel binding site) and its mutant pGL3-promoter-R5-mut were successfully constructed for luciferase reporter assay. Data represent the mean ± SE of three independent experiments(* P
    Figure Legend Snippet: NF-κB1, c-Rel and ELK1 bind directly to the response elements in the putative promoter of miR-134 in ovarian cancer cells A . Five genomic regions (R1–R5) spanning a 2.4 kb sequence upstream of the pre-miR-134. B-D . Binding of NF-κB1, c-Rel and ELK1 to the miR-134 promoter region was validated in SKOV3-TR30 cells by ChIP. Non-immune IgG and input DNA served as negative and positive controls, respectively. The enrichment of the binding of NF-κB1, c-Rel and ELK1 with the R3, R5 and R1 regions was quantified from the corresponding ChIP with qPCR. E . EMSA was performed with nuclear extracts from SKOV3-TR30 cells incubated with 5′-biotin-labeled oligonucleotide sequences containing the binding sites for the NF-κB1, c-Rel and ELK1 transcription factors. Unlabeled competitor sequence was also included to indicate the specificity of the protein-DNA complexes. F . pBI- NF-κB1, pBI- c-Rel and pBI- ELK1 overexpression plasmids were transfected into SKOV3 cells; the transfection efficiency was validated by qRT-PCR and Western blot analyses. G . At 48 h after transfection, luciferase activity was determined and then normalized to Renilla values. H . Sequencing was used to identify that the plasmids including pGL3-promoter-R1 (containing the ELK1 binding site) and its mutant pGL3-promoter-R1-mut, pGL3-promoter-R3 (containing the NF-κB1 binding site) and its mutant pGL3-promoter-R3-mut as well as pGL3-promoter-R5 (containing the c-Rel binding site) and its mutant pGL3-promoter-R5-mut were successfully constructed for luciferase reporter assay. Data represent the mean ± SE of three independent experiments(* P

    Techniques Used: Sequencing, Binding Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Incubation, Labeling, Over Expression, Transfection, Quantitative RT-PCR, Western Blot, Luciferase, Activity Assay, Mutagenesis, Construct, Reporter Assay

    Correlations between miR-134 levels and expression of NF-κB1, c-Rel and ELK1 in serous EOC specimens A . NF-κB1, c-Rel and ELK1 mRNA expression was analyzed by qRT-PCR in tissue from 24 cases of chemosensitive serous EOC and from 24 cases of chemoresistant serous EOC. NF-κB1 mRNA expression was significantly upregulated in chemoresistant serous EOC tissues, while c-Rel mRNA and ELK1 mRNA were overexpressed in chemoresistant tissues compared with that in chemosensitive tissues. B . Spearman correlation coefficient analyses of the correlations between miR-134 and expression of NF-κB1, c-Rel and ELK1 were performed for data obtained from qRT-PCR results and the correlation coefficient ‘r’ was calculated. C-D . Immunohistochemical staining of NF-κB1, c-Rel and ELK1 in serous epithelial ovarian cancer tissues. C, Expression of NF-κB1, c-Rel and ELK1 in chemoresistant tissue. D, Expression of NF-κB1, c-Rel and ELK1 in chemosensitive tissue. E . Patients with high nucleus NF-κB1, c-Rel and ELK1 expression showed significantly shorter overall survival than those with low nucleus expression. F . The positive cytoplasmic expression of NF-κB1, c-Rel and ELK1 showed no effect on survival in serous EOC patients.
    Figure Legend Snippet: Correlations between miR-134 levels and expression of NF-κB1, c-Rel and ELK1 in serous EOC specimens A . NF-κB1, c-Rel and ELK1 mRNA expression was analyzed by qRT-PCR in tissue from 24 cases of chemosensitive serous EOC and from 24 cases of chemoresistant serous EOC. NF-κB1 mRNA expression was significantly upregulated in chemoresistant serous EOC tissues, while c-Rel mRNA and ELK1 mRNA were overexpressed in chemoresistant tissues compared with that in chemosensitive tissues. B . Spearman correlation coefficient analyses of the correlations between miR-134 and expression of NF-κB1, c-Rel and ELK1 were performed for data obtained from qRT-PCR results and the correlation coefficient ‘r’ was calculated. C-D . Immunohistochemical staining of NF-κB1, c-Rel and ELK1 in serous epithelial ovarian cancer tissues. C, Expression of NF-κB1, c-Rel and ELK1 in chemoresistant tissue. D, Expression of NF-κB1, c-Rel and ELK1 in chemosensitive tissue. E . Patients with high nucleus NF-κB1, c-Rel and ELK1 expression showed significantly shorter overall survival than those with low nucleus expression. F . The positive cytoplasmic expression of NF-κB1, c-Rel and ELK1 showed no effect on survival in serous EOC patients.

    Techniques Used: Expressing, Quantitative RT-PCR, Immunohistochemistry, Staining

    38) Product Images from "Phosphatidylcholine-specific phospholipase C inhibition reduces HER2-overexpression, cell proliferation and in vivo tumor growth in a highly tumorigenic ovarian cancer model"

    Article Title: Phosphatidylcholine-specific phospholipase C inhibition reduces HER2-overexpression, cell proliferation and in vivo tumor growth in a highly tumorigenic ovarian cancer model

    Journal: Oncotarget

    doi: 10.18632/oncotarget.18992

    HER2 downmodulation in SKOV3.ip cells exposed to the PC-PLC inhibitor D609 ( A ) Relative changes of PC-PLC activity measured by Amplex Red assays in cells exposed to D609 (50 μg/mL, gray columns) and in untreated controls (CTR at t = 0, normalized to 1.0). The histograms represent mean values ± SD ( N = 3). ( B ) Example of Western blot analysis of total lysates of cells exposed to D609 compared to untreated controls. The blots were incubated with anti-HER2, anti-PC-PLC and anti-β1-integrin Abs; β-actin was used as quantitative loading control. ( C ) Fold changes of HER2 mRNA levels measured by qRT-PCR (see Methods) in cells exposed to D609 compared with untreated controls (CTR, black columns). The histograms report mean values ± SD ( N = 3). Statistical significance of differences at each time point: 7 h, P = 0.001; 14 h, P = 0.008; 24 h, P = 0.011; 48 h, P = 0.017; 72 h, P = 0.009. ( D ) Relative quantification of HER2 protein expression levels (gray columns) in cells exposed to D609 versus the respective untreated controls. The histograms report mean values ± SD ( N = 6). Statistical significance of differences at each time point versus controls: 24 h, P = 0.009; 48 h, P = 0.002; 72 h, P = 0.002. ( E – G ) Western blot analyses as in panel B), incubated with anti-HER2 and anti-phospho-HER2 (pHER2, Tyr1221/Tyr1222) Abs (panel E, example of two independent experiments, +/− D609, 24 h, 48 h, 72 h); or with anti-Akt, anti-pAkt and anti-mTOR (panel F, example of two independent experiments, +/− D609, 24 h); or with anti-MAPK, anti-phospho-MAPK (pMAPK) and anti-EGFR Abs (panel G, example of three independent experiments, +/−D609, 24 h, 48 h, 72 h).
    Figure Legend Snippet: HER2 downmodulation in SKOV3.ip cells exposed to the PC-PLC inhibitor D609 ( A ) Relative changes of PC-PLC activity measured by Amplex Red assays in cells exposed to D609 (50 μg/mL, gray columns) and in untreated controls (CTR at t = 0, normalized to 1.0). The histograms represent mean values ± SD ( N = 3). ( B ) Example of Western blot analysis of total lysates of cells exposed to D609 compared to untreated controls. The blots were incubated with anti-HER2, anti-PC-PLC and anti-β1-integrin Abs; β-actin was used as quantitative loading control. ( C ) Fold changes of HER2 mRNA levels measured by qRT-PCR (see Methods) in cells exposed to D609 compared with untreated controls (CTR, black columns). The histograms report mean values ± SD ( N = 3). Statistical significance of differences at each time point: 7 h, P = 0.001; 14 h, P = 0.008; 24 h, P = 0.011; 48 h, P = 0.017; 72 h, P = 0.009. ( D ) Relative quantification of HER2 protein expression levels (gray columns) in cells exposed to D609 versus the respective untreated controls. The histograms report mean values ± SD ( N = 6). Statistical significance of differences at each time point versus controls: 24 h, P = 0.009; 48 h, P = 0.002; 72 h, P = 0.002. ( E – G ) Western blot analyses as in panel B), incubated with anti-HER2 and anti-phospho-HER2 (pHER2, Tyr1221/Tyr1222) Abs (panel E, example of two independent experiments, +/− D609, 24 h, 48 h, 72 h); or with anti-Akt, anti-pAkt and anti-mTOR (panel F, example of two independent experiments, +/− D609, 24 h); or with anti-MAPK, anti-phospho-MAPK (pMAPK) and anti-EGFR Abs (panel G, example of three independent experiments, +/−D609, 24 h, 48 h, 72 h).

    Techniques Used: Planar Chromatography, Activity Assay, Western Blot, Incubation, Quantitative RT-PCR, Expressing

    39) Product Images from "miR-489 inhibits silica-induced pulmonary fibrosis by targeting MyD88 and Smad3 and is negatively regulated by lncRNA CHRF"

    Article Title: miR-489 inhibits silica-induced pulmonary fibrosis by targeting MyD88 and Smad3 and is negatively regulated by lncRNA CHRF

    Journal: Scientific Reports

    doi: 10.1038/srep30921

    Increased miR-489 attenuates silica-induced pulmonary fibrosis in vivo . (A) Mouse model of miR-489 overexpression in silica-induced pulmonary fibrosis. The C57BL/6 mice were co-injected with either miR-489 agomir or miR-NC via intratracheal instillation and via the tail vein at the following three time points: day 7, 14 and 21 after silica treatment. Then, lung tissues were harvested on day 28 ( n = 8 for each group). (B) qRT-PCR analysis of miR-489 levels in mouse lung tissues after injection of saline, silica, silica plus miR-NC and silica plus miR-489 agomir for 28 days with ** P
    Figure Legend Snippet: Increased miR-489 attenuates silica-induced pulmonary fibrosis in vivo . (A) Mouse model of miR-489 overexpression in silica-induced pulmonary fibrosis. The C57BL/6 mice were co-injected with either miR-489 agomir or miR-NC via intratracheal instillation and via the tail vein at the following three time points: day 7, 14 and 21 after silica treatment. Then, lung tissues were harvested on day 28 ( n = 8 for each group). (B) qRT-PCR analysis of miR-489 levels in mouse lung tissues after injection of saline, silica, silica plus miR-NC and silica plus miR-489 agomir for 28 days with ** P

    Techniques Used: In Vivo, Over Expression, Mouse Assay, Injection, Quantitative RT-PCR

    The lncRNA CHRF negatively regulates miR-489 expression. (A) qRT-PCR analysis of CHRF levels in mouse fibrotic lung tissue on day 7, 14, 28 ( n = 8 for each group) with ** P
    Figure Legend Snippet: The lncRNA CHRF negatively regulates miR-489 expression. (A) qRT-PCR analysis of CHRF levels in mouse fibrotic lung tissue on day 7, 14, 28 ( n = 8 for each group) with ** P

    Techniques Used: Expressing, Quantitative RT-PCR

    40) Product Images from "Toxicogenomic assessment of liver responses following subchronic exposure to furan in Fischer F344 rats"

    Article Title: Toxicogenomic assessment of liver responses following subchronic exposure to furan in Fischer F344 rats

    Journal: Archives of Toxicology

    doi: 10.1007/s00204-015-1561-2

    Analysis of miRNA changes using qRT-PCR. RNU6B was used to normalize the expression of the target miRNAs. Three samples from each group were used. Copy number was represented with average ± SD. Experiments were repeated three times and a single representative is shown here. * p ≤ 0.05
    Figure Legend Snippet: Analysis of miRNA changes using qRT-PCR. RNU6B was used to normalize the expression of the target miRNAs. Three samples from each group were used. Copy number was represented with average ± SD. Experiments were repeated three times and a single representative is shown here. * p ≤ 0.05

    Techniques Used: Quantitative RT-PCR, Expressing

    Expression of TH-regulated genes. RNA samples from five female and five male rats in each dose group were examined with qRT-PCR. Each sample was analyzed in dup licate and experiments repeated three times. Representative results are shown. * p ≤ 0.05
    Figure Legend Snippet: Expression of TH-regulated genes. RNA samples from five female and five male rats in each dose group were examined with qRT-PCR. Each sample was analyzed in dup licate and experiments repeated three times. Representative results are shown. * p ≤ 0.05

    Techniques Used: Expressing, Quantitative RT-PCR

    41) Product Images from "Epigenetic Regulation of MicroRNA Genes and the Role of miR-34b in Cell Invasion and Motility in Human Melanoma"

    Article Title: Epigenetic Regulation of MicroRNA Genes and the Role of miR-34b in Cell Invasion and Motility in Human Melanoma

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0024922

    Differential expression of putative miR-34b target genes in miR-34b–expressing melanoma cells. A) A heat-map of the top potential miR-34b targets suggested by TargetScan 5.1, based on fold change and transcript differences between WM1552C/34b cells vs. WM1552C/VO cells. Green boxes indicate gene targets associated with the network of cytoskeletal rearrangement shown in (B). B) Pathway mapping of the top potential miR-34b targets reveals 15 targets all associated with the network of cytoskeletal rearrangement. Targets are indicated in green. C) qRT-PCR validation of the differential expression of putative miR-34b targets CDC42 and FN1 in vector-transfected or miR-34b-transfected WM1552C cells. Values are listed as relative quantities (RQ).
    Figure Legend Snippet: Differential expression of putative miR-34b target genes in miR-34b–expressing melanoma cells. A) A heat-map of the top potential miR-34b targets suggested by TargetScan 5.1, based on fold change and transcript differences between WM1552C/34b cells vs. WM1552C/VO cells. Green boxes indicate gene targets associated with the network of cytoskeletal rearrangement shown in (B). B) Pathway mapping of the top potential miR-34b targets reveals 15 targets all associated with the network of cytoskeletal rearrangement. Targets are indicated in green. C) qRT-PCR validation of the differential expression of putative miR-34b targets CDC42 and FN1 in vector-transfected or miR-34b-transfected WM1552C cells. Values are listed as relative quantities (RQ).

    Techniques Used: Expressing, Quantitative RT-PCR, Plasmid Preparation, Transfection

    42) Product Images from "The Use of Three Long Non-Coding RNAs as Potential Prognostic Indicators of Astrocytoma"

    Article Title: The Use of Three Long Non-Coding RNAs as Potential Prognostic Indicators of Astrocytoma

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0135242

    Cluster analysis of differentially expressed lncRNAs between astrocytomas and NAT samples. The lncRNA expression levels, as measured by qRT-PCR, were normalized, mean-centered, clustered, and plotted as a heat map for the training set (A), the validation set (B), and all samples (C). The dendrogram generated by the cluster analysis shows a clear separation of the astrocytoma and the NAT samples based on the 9 or 7 lncRNA profiles.
    Figure Legend Snippet: Cluster analysis of differentially expressed lncRNAs between astrocytomas and NAT samples. The lncRNA expression levels, as measured by qRT-PCR, were normalized, mean-centered, clustered, and plotted as a heat map for the training set (A), the validation set (B), and all samples (C). The dendrogram generated by the cluster analysis shows a clear separation of the astrocytoma and the NAT samples based on the 9 or 7 lncRNA profiles.

    Techniques Used: Expressing, Quantitative RT-PCR, Generated

    43) Product Images from "A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus"

    Article Title: A cis-regulatory antisense RNA represses translation in Vibrio cholerae through extensive complementarity and proximity to the target locus

    Journal: RNA Biology

    doi: 10.1080/15476286.2015.1017203

    An antisense RNA is transcribed from pReporterFull. Strains of V. cholerae were cultured in M9 minimal medium with glucose (0.4%), at 37°C to an OD 600 of 0.3. Expression from the mtlS promoter should be high under these conditions. qRT-PCR was used to measure the MtlS/MtlS* transcript levels of WT (wild type), Δ mtlS , WT harboring pFull (pReporterFull), Δ mtlS harboring pFull, and WT harboring p5′UTR (pReporter5′UTR) strains of V. cholerae . The relative abundance of MtlS/MtlS* transcript was determined as described in Materials and Methods. Shown are the means and standard deviations from at least 3 independent samples. n.s., p > 0.05; ** p
    Figure Legend Snippet: An antisense RNA is transcribed from pReporterFull. Strains of V. cholerae were cultured in M9 minimal medium with glucose (0.4%), at 37°C to an OD 600 of 0.3. Expression from the mtlS promoter should be high under these conditions. qRT-PCR was used to measure the MtlS/MtlS* transcript levels of WT (wild type), Δ mtlS , WT harboring pFull (pReporterFull), Δ mtlS harboring pFull, and WT harboring p5′UTR (pReporter5′UTR) strains of V. cholerae . The relative abundance of MtlS/MtlS* transcript was determined as described in Materials and Methods. Shown are the means and standard deviations from at least 3 independent samples. n.s., p > 0.05; ** p

    Techniques Used: Cell Culture, Expressing, Quantitative RT-PCR

    44) Product Images from "A direct link between MITF, innate immunity, and hair graying"

    Article Title: A direct link between MITF, innate immunity, and hair graying

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.2003648

    Mitf mi-vga9/+ and Tg(Dct-Sox10)/0; Mitf mi-vga9/+ animals exhibit elevated ISG expression but no change in the density of immune populations within the skin. (A, A′) qRT-PCR analysis of Mitf and ISG expression in skin isolated from adult wild-type, Tg(Dct-Sox10)/0, Mitf mi-vga9/+ , and Tg(Dct-Sox10)/0; Mitf mi-vga9/+ littermates. Each point on the graph represents the expression value from skin of an individual animal. The horizontal bars represent the mean, and the asterisks indicate gene expression changes with a q -value of
    Figure Legend Snippet: Mitf mi-vga9/+ and Tg(Dct-Sox10)/0; Mitf mi-vga9/+ animals exhibit elevated ISG expression but no change in the density of immune populations within the skin. (A, A′) qRT-PCR analysis of Mitf and ISG expression in skin isolated from adult wild-type, Tg(Dct-Sox10)/0, Mitf mi-vga9/+ , and Tg(Dct-Sox10)/0; Mitf mi-vga9/+ littermates. Each point on the graph represents the expression value from skin of an individual animal. The horizontal bars represent the mean, and the asterisks indicate gene expression changes with a q -value of

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation

    45) Product Images from "Identification of pterygium-related mRNA expression profiling by microarray analysis"

    Article Title: Identification of pterygium-related mRNA expression profiling by microarray analysis

    Journal: Eye

    doi: 10.1038/eye.2017.116

    The differential expression of mRNAs between pterygium and paired adjacent normal conjunctival tissues were validated by qRT-PCR. * P
    Figure Legend Snippet: The differential expression of mRNAs between pterygium and paired adjacent normal conjunctival tissues were validated by qRT-PCR. * P

    Techniques Used: Expressing, Quantitative RT-PCR

    46) Product Images from "A distant trophoblast-specific enhancer controls HLA-G expression at the maternal–fetal interface"

    Article Title: A distant trophoblast-specific enhancer controls HLA-G expression at the maternal–fetal interface

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1602886113

    qRT-PCR Analysis.
    Figure Legend Snippet: qRT-PCR Analysis.

    Techniques Used: Quantitative RT-PCR

    47) Product Images from "The FDA-approved anti-cancer drugs, streptozotocin and floxuridine, reduce the virulence of Staphylococcus aureus"

    Article Title: The FDA-approved anti-cancer drugs, streptozotocin and floxuridine, reduce the virulence of Staphylococcus aureus

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20617-5

    The effect of streptozotocin (STZ) and floxuridine (FU) on the transcription in S. aureus USA300. ( a ) Summary of RNA-seq analysis. ( b ) Confirmation of the repression of other virulence regulatory systems by qRT-PCR. Y-axis indicates the mRNA level relative to that of gyrB , whose transcription was not significantly affected by the compounds. -, no treatment. Statistical significance was measured by unpaired, two-tailed Student’s t-test. *p
    Figure Legend Snippet: The effect of streptozotocin (STZ) and floxuridine (FU) on the transcription in S. aureus USA300. ( a ) Summary of RNA-seq analysis. ( b ) Confirmation of the repression of other virulence regulatory systems by qRT-PCR. Y-axis indicates the mRNA level relative to that of gyrB , whose transcription was not significantly affected by the compounds. -, no treatment. Statistical significance was measured by unpaired, two-tailed Student’s t-test. *p

    Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Two Tailed Test

    48) Product Images from "MiR‐21 improves invasion and migration of drug‐resistant lung adenocarcinoma cancer cell and transformation of EMT through targeting HBP1"

    Article Title: MiR‐21 improves invasion and migration of drug‐resistant lung adenocarcinoma cancer cell and transformation of EMT through targeting HBP1

    Journal: Cancer Medicine

    doi: 10.1002/cam4.1294

    The expression level of miR‐21 in A549, A549/DDP, and A549/PTX cells. (A) qRT‐PCR showed that the expression level of miR‐21 in A549/DDP and A549/PTX cells was significantly higher than that in A549 cells. * P
    Figure Legend Snippet: The expression level of miR‐21 in A549, A549/DDP, and A549/PTX cells. (A) qRT‐PCR showed that the expression level of miR‐21 in A549/DDP and A549/PTX cells was significantly higher than that in A549 cells. * P

    Techniques Used: Expressing, Quantitative RT-PCR

    The effect of miR‐21 on EMT of A549 cells treated with DDP. (A) MTT assay showed that A549 cells transfected with miR‐21 mimic increased cell viability after treated with DDP. (B) Western blot illustrated that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. * P
    Figure Legend Snippet: The effect of miR‐21 on EMT of A549 cells treated with DDP. (A) MTT assay showed that A549 cells transfected with miR‐21 mimic increased cell viability after treated with DDP. (B) Western blot illustrated that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. * P

    Techniques Used: MTT Assay, Transfection, Western Blot, Expressing, Quantitative RT-PCR

    The effect of miR‐21 inhibitor on EMT of A549/PTX cells. (A) MTT assay indicated that the cell viability of A549/PTX cells transfected with miR‐21 inhibitor was decreased. (B) According to the results of western blot, A549/PTX cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549/PTX cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. * P
    Figure Legend Snippet: The effect of miR‐21 inhibitor on EMT of A549/PTX cells. (A) MTT assay indicated that the cell viability of A549/PTX cells transfected with miR‐21 inhibitor was decreased. (B) According to the results of western blot, A549/PTX cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549/PTX cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. * P

    Techniques Used: MTT Assay, Transfection, Western Blot, Expressing, Quantitative RT-PCR

    The effect of miR‐21 on EMT of A549 cells treated with PTX. (A) MTT assay showed that A549 cells transfected with miR‐21 mimic increased cell viability after treated with PTX. (B) Western blot illustrated that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. * P
    Figure Legend Snippet: The effect of miR‐21 on EMT of A549 cells treated with PTX. (A) MTT assay showed that A549 cells transfected with miR‐21 mimic increased cell viability after treated with PTX. (B) Western blot illustrated that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549 cells in the miR‐21 mimic group had decreased expression level of E‐cadherin and β ‐catenin and increased expression level of EMT‐related markers except Twist. * P

    Techniques Used: MTT Assay, Transfection, Western Blot, Expressing, Quantitative RT-PCR

    The expression level of EMT‐related markers in A549/DDP and A549/PTX cells. (A) Western blot showed that the expression of E‐cadherin and β ‐catenin in A549/PTX and A549/DDP cells was dramatically downregulated, while the expression of EMT‐related markers except Twist was significantly upregulated. (B) qRT‐PCR showed that the expression of E‐cadherin and β ‐catenin in A549/PTX and A549/DDP cells was dramatically downregulated, while the expression of EMT‐related markers except Twist was significantly upregulated. * P
    Figure Legend Snippet: The expression level of EMT‐related markers in A549/DDP and A549/PTX cells. (A) Western blot showed that the expression of E‐cadherin and β ‐catenin in A549/PTX and A549/DDP cells was dramatically downregulated, while the expression of EMT‐related markers except Twist was significantly upregulated. (B) qRT‐PCR showed that the expression of E‐cadherin and β ‐catenin in A549/PTX and A549/DDP cells was dramatically downregulated, while the expression of EMT‐related markers except Twist was significantly upregulated. * P

    Techniques Used: Expressing, Western Blot, Quantitative RT-PCR

    The effect of miR‐21 inhibitor on EMT of A549/DDP cells. (A) MTT assay indicated that the cell viability of A549/DDP cells transfected with miR‐21 inhibitor was decreased. (B) According to the results of western blot, A549/DDP cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549/DDP cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. * P
    Figure Legend Snippet: The effect of miR‐21 inhibitor on EMT of A549/DDP cells. (A) MTT assay indicated that the cell viability of A549/DDP cells transfected with miR‐21 inhibitor was decreased. (B) According to the results of western blot, A549/DDP cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. (C) qRT‐PCR verified that A549/DDP cells transfected with miR‐21 inhibitor increased the expression level of E‐cadherin and β ‐catenin and decreased the expression level of EMT‐related markers except Twist. * P

    Techniques Used: MTT Assay, Transfection, Western Blot, Expressing, Quantitative RT-PCR

    49) Product Images from "Non-coding RNA Expression, Function, and Variation during Drosophila Embryogenesis"

    Article Title: Non-coding RNA Expression, Function, and Variation during Drosophila Embryogenesis

    Journal: Current Biology

    doi: 10.1016/j.cub.2018.09.026

    Detection of Strain-Specific Transcripts (A) Venn diagram showing intersection between transcripts expressed ( > 1 FPKM) in two genetic backgrounds (twi::EGFP and vas::Cas9). Unique transcripts are biased toward the twi::EGFP line as the transcriptome assembly is based on this line. (B) Expression values for the 67 lncRNA genes with expression > 1 FPKM in the twi::EGFP background. Scatterplot indicates that 27 genes are virtually not expressed in vas::Cas9 line (red dots). (C–E) XLOC_011009 (C), XLOC_010934 (D), and XLOC_013478 (E) are examples of lncRNAs expressed in the twi::EGFP genetic background but completely absent at matching embryonic stages from the vas::Cas9 background. (F) qRT-PCR confirming differences between twi::EGFP and vas::Cas9. Each bar represents an independent biological replicate; error bar is SE (from reaction duplicates). (G) Assessment of strain-specific lncRNA expression across nine inbred Drosophila lines. Heatmap indicates qRT-PCR values. For each transcript line combination, the two tiles correspond to biological replicates.
    Figure Legend Snippet: Detection of Strain-Specific Transcripts (A) Venn diagram showing intersection between transcripts expressed ( > 1 FPKM) in two genetic backgrounds (twi::EGFP and vas::Cas9). Unique transcripts are biased toward the twi::EGFP line as the transcriptome assembly is based on this line. (B) Expression values for the 67 lncRNA genes with expression > 1 FPKM in the twi::EGFP background. Scatterplot indicates that 27 genes are virtually not expressed in vas::Cas9 line (red dots). (C–E) XLOC_011009 (C), XLOC_010934 (D), and XLOC_013478 (E) are examples of lncRNAs expressed in the twi::EGFP genetic background but completely absent at matching embryonic stages from the vas::Cas9 background. (F) qRT-PCR confirming differences between twi::EGFP and vas::Cas9. Each bar represents an independent biological replicate; error bar is SE (from reaction duplicates). (G) Assessment of strain-specific lncRNA expression across nine inbred Drosophila lines. Heatmap indicates qRT-PCR values. For each transcript line combination, the two tiles correspond to biological replicates.

    Techniques Used: Expressing, Quantitative RT-PCR

    50) Product Images from "Vasodilator-stimulated phosphoprotein (VASP), a novel target of miR-4455, promotes gastric cancer cell proliferation, migration, and invasion, through activating the PI3K/AKT signaling pathway"

    Article Title: Vasodilator-stimulated phosphoprotein (VASP), a novel target of miR-4455, promotes gastric cancer cell proliferation, migration, and invasion, through activating the PI3K/AKT signaling pathway

    Journal: Cancer Cell International

    doi: 10.1186/s12935-018-0573-4

    VASP promotes GC cell proliferation by regulating the PI3K/AKT signaling pathway. a , b Protein levels of VASP in MGC-803 cells transfected with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or pcDNA3.1 negative controls (Ctrl), as determined by Western-blot. c The mRNA levels of VASP in MGC-803 cells transfected with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or pcDNA3.1 negative controls (Ctrl), as determined by qRT-PCR. d – f Activation of the PI3K/AKT signaling pathway in MGC-803 cells after transfection with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or negative control plasmid (Ctrl). ** P
    Figure Legend Snippet: VASP promotes GC cell proliferation by regulating the PI3K/AKT signaling pathway. a , b Protein levels of VASP in MGC-803 cells transfected with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or pcDNA3.1 negative controls (Ctrl), as determined by Western-blot. c The mRNA levels of VASP in MGC-803 cells transfected with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or pcDNA3.1 negative controls (Ctrl), as determined by qRT-PCR. d – f Activation of the PI3K/AKT signaling pathway in MGC-803 cells after transfection with VASP knockdown plasmid (shVASP), VASP overexpressed plasmid (VASP) or negative control plasmid (Ctrl). ** P

    Techniques Used: Transfection, Plasmid Preparation, Western Blot, Quantitative RT-PCR, Activation Assay, Negative Control

    The expression of miR-4455 is down-regulated in GC tissues and GC cells. a Expression of miR-4455 was determined by qRT-PCR analysis in 30 pairs of human primary gastric cancer tissues (‘Tumor’) and adjacent normal gastric tissues (‘Normal’). P
    Figure Legend Snippet: The expression of miR-4455 is down-regulated in GC tissues and GC cells. a Expression of miR-4455 was determined by qRT-PCR analysis in 30 pairs of human primary gastric cancer tissues (‘Tumor’) and adjacent normal gastric tissues (‘Normal’). P

    Techniques Used: Expressing, Quantitative RT-PCR

    Gastric cancer cell proliferation is inhibited by miR-4455 in vitro. a qRT-PCR analysis of the expression of miR-4455 in MGC-803 cancer cells transfected with miR-NC, miR-4455 mimic or miR-4455 inhibitor. b MTT analysis of proliferation among MGC-803 cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC. c Annexin V-FITC/PI analysis of apoptosis in MGC-803 cells transfected with miR-NC, miR-4455 mimic or miR-4455 inhibitor. ** P
    Figure Legend Snippet: Gastric cancer cell proliferation is inhibited by miR-4455 in vitro. a qRT-PCR analysis of the expression of miR-4455 in MGC-803 cancer cells transfected with miR-NC, miR-4455 mimic or miR-4455 inhibitor. b MTT analysis of proliferation among MGC-803 cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC. c Annexin V-FITC/PI analysis of apoptosis in MGC-803 cells transfected with miR-NC, miR-4455 mimic or miR-4455 inhibitor. ** P

    Techniques Used: In Vitro, Quantitative RT-PCR, Expressing, Transfection, MTT Assay

    Identification of VASP as the molecular target of miR-4455. a Schematic of wild-type and mutant-type 3′-UTRs of the VASP plasmids, and relative luciferase activity assays of luciferase reporter plasmids containing VASP-wt or VASP-mut 3′-UTR performed in MGC-803 cancer cells. c The mRNA levels of VASP in MGC-803 cells cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC, as determined by qRT-PCR. Beta-actin served as an internal control. b , d Protein levels of VASP in MGC-803 cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC, as determined by Western-blot analysis. Beta-actin served as an internal control. ** P
    Figure Legend Snippet: Identification of VASP as the molecular target of miR-4455. a Schematic of wild-type and mutant-type 3′-UTRs of the VASP plasmids, and relative luciferase activity assays of luciferase reporter plasmids containing VASP-wt or VASP-mut 3′-UTR performed in MGC-803 cancer cells. c The mRNA levels of VASP in MGC-803 cells cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC, as determined by qRT-PCR. Beta-actin served as an internal control. b , d Protein levels of VASP in MGC-803 cells transfected with miR-4455 mimic, miR-4455 inhibitor or miR-NC, as determined by Western-blot analysis. Beta-actin served as an internal control. ** P

    Techniques Used: Mutagenesis, Luciferase, Activity Assay, Transfection, Quantitative RT-PCR, Western Blot

    51) Product Images from "The Hsp70 Gene Family in Solanum tuberosum: Genome-Wide Identification, Phylogeny, and Expression Patterns"

    Article Title: The Hsp70 Gene Family in Solanum tuberosum: Genome-Wide Identification, Phylogeny, and Expression Patterns

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34878-7

    Expression profiles of the potato StHsp70 genes under hormone treatments compared with untreated controls. The expression levels of these StHSP70 genes in response to hormone stresses (IAA, ABA, GA3, and SA) were tested using qRT-PCR. Expression levels were normalized using sesame β-actin as a reference gene 40 . Error bars represent standard deviations from three independent technical replicates. The mean expression levels from three independent biological replicates were analyzed for significance using t-tests (p
    Figure Legend Snippet: Expression profiles of the potato StHsp70 genes under hormone treatments compared with untreated controls. The expression levels of these StHSP70 genes in response to hormone stresses (IAA, ABA, GA3, and SA) were tested using qRT-PCR. Expression levels were normalized using sesame β-actin as a reference gene 40 . Error bars represent standard deviations from three independent technical replicates. The mean expression levels from three independent biological replicates were analyzed for significance using t-tests (p

    Techniques Used: Expressing, Quantitative RT-PCR

    Expression of the potato StHsp70 genes under abiotic stresses compared with untreated controls. The expression levels of these StHSP70 genes in response to salt, drought, heat, and cold were tested using qRT-PCR. Expression levels were normalized using sesame β-actin as a reference gene 40 . Error bars represent standard deviations from three independent technical replicates. The mean expression levels from three independent biological replicates were analyzed for significance using t-tests (p
    Figure Legend Snippet: Expression of the potato StHsp70 genes under abiotic stresses compared with untreated controls. The expression levels of these StHSP70 genes in response to salt, drought, heat, and cold were tested using qRT-PCR. Expression levels were normalized using sesame β-actin as a reference gene 40 . Error bars represent standard deviations from three independent technical replicates. The mean expression levels from three independent biological replicates were analyzed for significance using t-tests (p

    Techniques Used: Expressing, Quantitative RT-PCR

    52) Product Images from "Remodeling of chromatin under low intensity diffuse ultrasound"

    Article Title: Remodeling of chromatin under low intensity diffuse ultrasound

    Journal: The international journal of biochemistry & cell biology

    doi: 10.1016/j.biocel.2012.04.027

    Effect of US stimulation (5.0 MHz, 14 kPa, 51-s/application, 3-applications/day) on the level of expression of early response genes. Cells were stimulated with US and mRNA was isolated at 2 h after the last US exposure. The levels of expression of c-jun, c-fos and c-myc genes were determined by qRT-PCR. Non-stimulated cells served as controls. One way analysis of variance followed by Tukey’s test was used to establish significance at an alpha level of 0.05.
    Figure Legend Snippet: Effect of US stimulation (5.0 MHz, 14 kPa, 51-s/application, 3-applications/day) on the level of expression of early response genes. Cells were stimulated with US and mRNA was isolated at 2 h after the last US exposure. The levels of expression of c-jun, c-fos and c-myc genes were determined by qRT-PCR. Non-stimulated cells served as controls. One way analysis of variance followed by Tukey’s test was used to establish significance at an alpha level of 0.05.

    Techniques Used: Expressing, Isolation, Quantitative RT-PCR

    53) Product Images from "Diabetes impairs wound healing by Dnmt1-dependent dysregulation of hematopoietic stem cells differentiation towards macrophages"

    Article Title: Diabetes impairs wound healing by Dnmt1-dependent dysregulation of hematopoietic stem cells differentiation towards macrophages

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02425-z

    Knockdown of Dnmt1 in db/db HSCs increases wound closure rate. a qRT-PCR quantification of Dnmt1 expression ( n = 6, * p
    Figure Legend Snippet: Knockdown of Dnmt1 in db/db HSCs increases wound closure rate. a qRT-PCR quantification of Dnmt1 expression ( n = 6, * p

    Techniques Used: Quantitative RT-PCR, Expressing

    54) Product Images from "Effects of drought and salt-stresses on gene expression in Caragana korshinskii seedlings revealed by RNA-seq"

    Article Title: Effects of drought and salt-stresses on gene expression in Caragana korshinskii seedlings revealed by RNA-seq

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-2562-0

    Changes in transcript levels of 38 selected genes, as detected by real-time RT-PCR. The black bars represent the relative intensity of qRT-PCR from three independent biological replicates (left Y-axis), and the red bars represent the expression level (RPKM) of the transcript (right Y-axis) ( a and b ). a includes 20 qRT-PCR results, and b includes another 18 qRT-PCR results. The qRT-PCR primers for each contig are listed in Additional file 19 . PM, PD and PS represent that the tested materials were the whole seedlings including leaves, stems, and roots in normal growth condition, under drought treatment, and salt treatment, respectively. RM, RD and RS represents that the tested materials were the roots of the plant in normal growth condition, under drought treatment, and salt treatment, respectively. SM, SD and SS represent that the tested materials were the stems of the plant in normal growth condition, under drought treatment, and salt treatment, respectively. LM, LD and LS represent that the tested materials were the leaves of the plant in normal growth condition, under drought treatment, and salt treatment, respectively
    Figure Legend Snippet: Changes in transcript levels of 38 selected genes, as detected by real-time RT-PCR. The black bars represent the relative intensity of qRT-PCR from three independent biological replicates (left Y-axis), and the red bars represent the expression level (RPKM) of the transcript (right Y-axis) ( a and b ). a includes 20 qRT-PCR results, and b includes another 18 qRT-PCR results. The qRT-PCR primers for each contig are listed in Additional file 19 . PM, PD and PS represent that the tested materials were the whole seedlings including leaves, stems, and roots in normal growth condition, under drought treatment, and salt treatment, respectively. RM, RD and RS represents that the tested materials were the roots of the plant in normal growth condition, under drought treatment, and salt treatment, respectively. SM, SD and SS represent that the tested materials were the stems of the plant in normal growth condition, under drought treatment, and salt treatment, respectively. LM, LD and LS represent that the tested materials were the leaves of the plant in normal growth condition, under drought treatment, and salt treatment, respectively

    Techniques Used: Quantitative RT-PCR, Expressing

    55) Product Images from "Chemotherapy-induced hyaluronan production: a novel chemoresistance mechanism in ovarian cancer"

    Article Title: Chemotherapy-induced hyaluronan production: a novel chemoresistance mechanism in ovarian cancer

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-13-476

    Chemotherapy treatment increases ABCC2 expression in ovarian cancer cells. A . qRT-PCR for ABCC2 expression. Ovarian cancer cells treated with LD 50 CBP for 72 hr. OVCAR-5 cells also treated in presence or absence of HA oligomers (HYA oligo, 250 μg/ml). Relative gene expression was determined by calibration against no CBP control and normalized to the house keeping gene β-actin using the 2 -∆∆CT method. Data represents mean ± SEM from 3 independent experiments performed in triplicate. B . OVCAR-5 treated with LD 50 CBP for 72 hr. Fixed cells were incubated with biotinylated HABP and ABCC2 mouse monoclonal antibody and visualized with Cy3-conjugated streptavidin (red) and FITC-conjugated donkey anti-mouse immunoglobulins (green) respectively. Nuclei are counterstained with DAPI dye (blue).
    Figure Legend Snippet: Chemotherapy treatment increases ABCC2 expression in ovarian cancer cells. A . qRT-PCR for ABCC2 expression. Ovarian cancer cells treated with LD 50 CBP for 72 hr. OVCAR-5 cells also treated in presence or absence of HA oligomers (HYA oligo, 250 μg/ml). Relative gene expression was determined by calibration against no CBP control and normalized to the house keeping gene β-actin using the 2 -∆∆CT method. Data represents mean ± SEM from 3 independent experiments performed in triplicate. B . OVCAR-5 treated with LD 50 CBP for 72 hr. Fixed cells were incubated with biotinylated HABP and ABCC2 mouse monoclonal antibody and visualized with Cy3-conjugated streptavidin (red) and FITC-conjugated donkey anti-mouse immunoglobulins (green) respectively. Nuclei are counterstained with DAPI dye (blue).

    Techniques Used: Expressing, Quantitative RT-PCR, Incubation

    56) Product Images from "Identification of genes expressed in the sex pheromone gland of the black cutworm Agrotis ipsilon with putative roles in sex pheromone biosynthesis and transport"

    Article Title: Identification of genes expressed in the sex pheromone gland of the black cutworm Agrotis ipsilon with putative roles in sex pheromone biosynthesis and transport

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-14-636

    qRT-PCR results showing the expression of A. ipsilon unigenes encoding the putative esterase (CXE) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b, c) above each bar denote significant differences (p > 0.05).
    Figure Legend Snippet: qRT-PCR results showing the expression of A. ipsilon unigenes encoding the putative esterase (CXE) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b, c) above each bar denote significant differences (p > 0.05).

    Techniques Used: Quantitative RT-PCR, Expressing

    qRT-PCR results showing the relative expression of the A. ipsilon unigenes encoding putative chemosensory proteins (CSP) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b) above each bar denote significant differences (p > 0.05).
    Figure Legend Snippet: qRT-PCR results showing the relative expression of the A. ipsilon unigenes encoding putative chemosensory proteins (CSP) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b) above each bar denote significant differences (p > 0.05).

    Techniques Used: Quantitative RT-PCR, Expressing

    qRT-PCR results showing the relative expression levels of the A. ipsilon pheromone biosynthesis related genes between the pheromone gland (PG) and the body (BO). The putative enzyme names are indicated as gene abbreviations followed by Genbank accession numbers. ACC Acetyl-CoA carboxylase, FAS Fatty acid synthase, DES Desaturase, FAR Fatty acyl reductase, AOX alcohol oxidase, AR Aldehyde reductase, ATF Acetyltransferase. The internal control β-actin and ribosomal protein S3 were used to normalize transcript levels in each sample. This figure was presented using β-actin as reference gene to normalize the target gene expression and correct sample-to-sample variation; similar results were also obtained with ribosomal protein S3 as reference gene. The standard error is represented by the error bar, and the different letters (a, b) above each bar denote significant differences (p > 0.05).
    Figure Legend Snippet: qRT-PCR results showing the relative expression levels of the A. ipsilon pheromone biosynthesis related genes between the pheromone gland (PG) and the body (BO). The putative enzyme names are indicated as gene abbreviations followed by Genbank accession numbers. ACC Acetyl-CoA carboxylase, FAS Fatty acid synthase, DES Desaturase, FAR Fatty acyl reductase, AOX alcohol oxidase, AR Aldehyde reductase, ATF Acetyltransferase. The internal control β-actin and ribosomal protein S3 were used to normalize transcript levels in each sample. This figure was presented using β-actin as reference gene to normalize the target gene expression and correct sample-to-sample variation; similar results were also obtained with ribosomal protein S3 as reference gene. The standard error is represented by the error bar, and the different letters (a, b) above each bar denote significant differences (p > 0.05).

    Techniques Used: Quantitative RT-PCR, Expressing

    qRT-PCR results showing the relative expression of the A. ipsilon unigenes encoding putative odorant binding proteins (OBP) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b, c) above each bar denote significant differences (p > 0.05).
    Figure Legend Snippet: qRT-PCR results showing the relative expression of the A. ipsilon unigenes encoding putative odorant binding proteins (OBP) identified in the pheromone gland in the male antennae (MA), the female antennae (FA), the body (BO) and the pheromone gland (PG). The standard error is represented by the error bar, and the different letters (a, b, c) above each bar denote significant differences (p > 0.05).

    Techniques Used: Quantitative RT-PCR, Expressing, Binding Assay

    57) Product Images from "Physiological Analysis and Proteome Quantification of Alligator Weed Stems in Response to Potassium Deficiency Stress"

    Article Title: Physiological Analysis and Proteome Quantification of Alligator Weed Stems in Response to Potassium Deficiency Stress

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms20010221

    Complementation of proteomic results by qRT-PCR.
    Figure Legend Snippet: Complementation of proteomic results by qRT-PCR.

    Techniques Used: Quantitative RT-PCR

    58) Product Images from "Genomic amplification upregulates estrogen-related receptor alpha and its depletion inhibits oral squamous cell carcinoma tumors in vivo"

    Article Title: Genomic amplification upregulates estrogen-related receptor alpha and its depletion inhibits oral squamous cell carcinoma tumors in vivo

    Journal: Scientific Reports

    doi: 10.1038/srep17621

    Genomic amplification of ESRRA and expression of miR-125a. ( A ) The TaqMan ® copy number assay to assess the genomic amplification of ESRRA in 25 matched normal peripheral blood and OSCC DNA samples. ( B ) The qRT-PCR analysis of miR-125a in 10 matched normal oral tissue and OSCC samples. *p
    Figure Legend Snippet: Genomic amplification of ESRRA and expression of miR-125a. ( A ) The TaqMan ® copy number assay to assess the genomic amplification of ESRRA in 25 matched normal peripheral blood and OSCC DNA samples. ( B ) The qRT-PCR analysis of miR-125a in 10 matched normal oral tissue and OSCC samples. *p

    Techniques Used: Amplification, Expressing, TaqMan Copy Number Assay, Quantitative RT-PCR

    Expression of ESRRA in OSCC samples. ( A ) The qRT-PCR analysis of ESRRA in 25 matched normal oral tissue and OSCC samples. Numbers on the X-axis represent matched normal oral tissue and OSCC samples from different patients. T1, T2, T3 and T4 represent different grades of OSCC samples. ( B ) The comparison of combined qRT-PCR data of the ESRRA transcript level between normal oral tissue and OSCC samples. ( C ) The Western blot analysis of ESRRA in 17 matched normal oral tissue and OSCC samples. OSCC samples showing upregulation of ESRRA as compared to their matched normal oral tissues are marked by ^ . N and T represent normal oral tissue and OSCC samples respectively. β-actin was used as a loading control. *p
    Figure Legend Snippet: Expression of ESRRA in OSCC samples. ( A ) The qRT-PCR analysis of ESRRA in 25 matched normal oral tissue and OSCC samples. Numbers on the X-axis represent matched normal oral tissue and OSCC samples from different patients. T1, T2, T3 and T4 represent different grades of OSCC samples. ( B ) The comparison of combined qRT-PCR data of the ESRRA transcript level between normal oral tissue and OSCC samples. ( C ) The Western blot analysis of ESRRA in 17 matched normal oral tissue and OSCC samples. OSCC samples showing upregulation of ESRRA as compared to their matched normal oral tissues are marked by ^ . N and T represent normal oral tissue and OSCC samples respectively. β-actin was used as a loading control. *p

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

    The effect of ESRRA overexpression and knock down on its transcriptional targets. ( A ) The qRT-PCR analysis to assess the level of WNT11 and OPN transcripts in cells transfected with pcDNA3.1(+) and p ESRRA . ( B ) The qRT-PCR analysis to assess the level of WNT11 and OPN transcripts in cells transfected with mock and ESRRA siRNA. *p
    Figure Legend Snippet: The effect of ESRRA overexpression and knock down on its transcriptional targets. ( A ) The qRT-PCR analysis to assess the level of WNT11 and OPN transcripts in cells transfected with pcDNA3.1(+) and p ESRRA . ( B ) The qRT-PCR analysis to assess the level of WNT11 and OPN transcripts in cells transfected with mock and ESRRA siRNA. *p

    Techniques Used: Over Expression, Quantitative RT-PCR, Transfection

    59) Product Images from "Arginine deiminase PEG20 inhibits growth of small cell lung cancers lacking expression of argininosuccinate synthetase"

    Article Title: Arginine deiminase PEG20 inhibits growth of small cell lung cancers lacking expression of argininosuccinate synthetase

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2011.524

    Small cell lung cancer human tumours and cell lines frequently lack expression of ASS: ASS protein expression (brown color, arrows) in normal skin ( A ), colon carcinoma ( B ) and small cell lung cancer ( C ) at high power magnification, identified using anti-ASS antibody 195-21-1 (LICR). Expression of ASS protein was assessed by western blot in a panel of SCLC cell lines and compared with positive control SW1222 colon cancer cells ( D ). Argininosuccinate synthetase protein expression in cell lines was observed to generally correlate with mRNA expression as determined by qRT-PCR ( E ).
    Figure Legend Snippet: Small cell lung cancer human tumours and cell lines frequently lack expression of ASS: ASS protein expression (brown color, arrows) in normal skin ( A ), colon carcinoma ( B ) and small cell lung cancer ( C ) at high power magnification, identified using anti-ASS antibody 195-21-1 (LICR). Expression of ASS protein was assessed by western blot in a panel of SCLC cell lines and compared with positive control SW1222 colon cancer cells ( D ). Argininosuccinate synthetase protein expression in cell lines was observed to generally correlate with mRNA expression as determined by qRT-PCR ( E ).

    Techniques Used: Expressing, Western Blot, Positive Control, Quantitative RT-PCR

    60) Product Images from "FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum"

    Article Title: FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005973

    Assays for the function of the N-terminal 310 aa of FgPrp4. ( A). Conidia, 12 h germlings, and hyphae of the Fgprp4/FgPRP4- GFP transformant (FPN1) were examined by DIC and epifluorescence microscopy. Bar = 20 μm. ( B). The expression level of FgPRP4 was assayed by qRT-PCR with RNA isolated from conidia, 12 h germlings, perithecia at 10 days post-fertilization, and infected wheat heads at 7 days post-inoculation (dpi). Mean and standard deviation were calculated with data from three independent biological replicates. The β-tubulin gene FGSG_06611 of F . graminearum was used as the internal control. ( C). Three-day old PDA cultures of the Fgprp4 mutant (FP1), Fgprp4/FgPRP4 -GFP transformant (FPN1), and Fgprp4/FgPRP4 Δ1-310 -GFP transformant (FPN310). ( D). 12 h germlings of transformant FPN310 were examined by DIC and epifluorescence microscopy. Bar = 20 μm.
    Figure Legend Snippet: Assays for the function of the N-terminal 310 aa of FgPrp4. ( A). Conidia, 12 h germlings, and hyphae of the Fgprp4/FgPRP4- GFP transformant (FPN1) were examined by DIC and epifluorescence microscopy. Bar = 20 μm. ( B). The expression level of FgPRP4 was assayed by qRT-PCR with RNA isolated from conidia, 12 h germlings, perithecia at 10 days post-fertilization, and infected wheat heads at 7 days post-inoculation (dpi). Mean and standard deviation were calculated with data from three independent biological replicates. The β-tubulin gene FGSG_06611 of F . graminearum was used as the internal control. ( C). Three-day old PDA cultures of the Fgprp4 mutant (FP1), Fgprp4/FgPRP4 -GFP transformant (FPN1), and Fgprp4/FgPRP4 Δ1-310 -GFP transformant (FPN310). ( D). 12 h germlings of transformant FPN310 were examined by DIC and epifluorescence microscopy. Bar = 20 μm.

    Techniques Used: Epifluorescence Microscopy, Expressing, Quantitative RT-PCR, Isolation, Infection, Standard Deviation, Mutagenesis

    61) Product Images from "Human Three-Dimensional Endometrial Epithelial Cell Model To Study Host Interactions with Vaginal Bacteria and Neisseria gonorrhoeae"

    Article Title: Human Three-Dimensional Endometrial Epithelial Cell Model To Study Host Interactions with Vaginal Bacteria and Neisseria gonorrhoeae

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01049-16

    Cells in the human 3-D endometrial epithelial cell model express membrane-associated mucins (MUC1, MUC4, MUC17, and MUC20). The EEC aggregates were profiled for mucin expression by qRT-PCR analysis using total RNA from lysed cells. The expression of each
    Figure Legend Snippet: Cells in the human 3-D endometrial epithelial cell model express membrane-associated mucins (MUC1, MUC4, MUC17, and MUC20). The EEC aggregates were profiled for mucin expression by qRT-PCR analysis using total RNA from lysed cells. The expression of each

    Techniques Used: Expressing, Quantitative RT-PCR

    Innate immune response of cells in the human 3-D endometrial epithelial cell model following microbial product exposure. (A) Expression profile of TLR1 to TLR9. EEC aggregates were profiled for TLR1 to TLR9 by qRT-PCR analysis using total RNA from lysed
    Figure Legend Snippet: Innate immune response of cells in the human 3-D endometrial epithelial cell model following microbial product exposure. (A) Expression profile of TLR1 to TLR9. EEC aggregates were profiled for TLR1 to TLR9 by qRT-PCR analysis using total RNA from lysed

    Techniques Used: Expressing, Quantitative RT-PCR

    62) Product Images from "Developing new targeting strategy for androgen receptor variants in castration resistant prostate cancer"

    Article Title: Developing new targeting strategy for androgen receptor variants in castration resistant prostate cancer

    Journal: International journal of cancer

    doi: 10.1002/ijc.30893

    The effect of TSTs on AR gene expression in CRPC cell lines Cells were treated with TST-A at 0, 0.5, 2, 5 nM ( A ) or TST-D at 0, 5, 20, 50 nM ( B ) for 4 hours, total cellular RNA and cell lysates were prepared and subjected to western blot and qRT-PCR analyses. The relative AR-V7 mRNA expression from each treatment was normalized with 18S rRNA then calculated using control (=1). Cells were treated with 5 nM TST-A or 50 nM TST-D, cell pellets were collected 0, 2, 4, 8 hours after treatment. Total cellular RNA and cell lysates were prepared and subjected to qRT-PCR analyses ( C ) or western blot ( D ).
    Figure Legend Snippet: The effect of TSTs on AR gene expression in CRPC cell lines Cells were treated with TST-A at 0, 0.5, 2, 5 nM ( A ) or TST-D at 0, 5, 20, 50 nM ( B ) for 4 hours, total cellular RNA and cell lysates were prepared and subjected to western blot and qRT-PCR analyses. The relative AR-V7 mRNA expression from each treatment was normalized with 18S rRNA then calculated using control (=1). Cells were treated with 5 nM TST-A or 50 nM TST-D, cell pellets were collected 0, 2, 4, 8 hours after treatment. Total cellular RNA and cell lysates were prepared and subjected to qRT-PCR analyses ( C ) or western blot ( D ).

    Techniques Used: Expressing, Western Blot, Quantitative RT-PCR

    63) Product Images from "Perturbations in the Photosynthetic Pigment Status Result in Photooxidation-Induced Crosstalk between Carotenoid and Porphyrin Biosynthetic Pathways"

    Article Title: Perturbations in the Photosynthetic Pigment Status Result in Photooxidation-Induced Crosstalk between Carotenoid and Porphyrin Biosynthetic Pathways

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.01992

    Photooxidation-induced changes in expression of genes encoding enzymes of the porphyrin biosynthetic pathway. (A) Common branch. (B) Mg-porphyrin branch. (C) Fe-porphyrin branch. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse-transcribed. The resulting cDNAs were used as templates for qRT-PCR using the actin gene as an internal control. The untreated control was used for normalization, with the expression level of the sample set to 1. The data represent the mean ± SE of nine replicates from three independent experiments.
    Figure Legend Snippet: Photooxidation-induced changes in expression of genes encoding enzymes of the porphyrin biosynthetic pathway. (A) Common branch. (B) Mg-porphyrin branch. (C) Fe-porphyrin branch. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse-transcribed. The resulting cDNAs were used as templates for qRT-PCR using the actin gene as an internal control. The untreated control was used for normalization, with the expression level of the sample set to 1. The data represent the mean ± SE of nine replicates from three independent experiments.

    Techniques Used: Expressing, Purification, Quantitative RT-PCR

    Photooxidation-induced changes in expression of genes encoding enzymes of the carotenoid biosynthetic pathway. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse-transcribed. The resulting cDNAs were used as templates for qRT-PCR using the actin gene as an internal control. The untreated control was used for normalization, with the expression level of the sample set to 1. The data represent the mean ± SE of nine replicates from three independent experiments.
    Figure Legend Snippet: Photooxidation-induced changes in expression of genes encoding enzymes of the carotenoid biosynthetic pathway. The plants were subjected to the same treatments as in Figure 2 . Treatment notations are the same as in Figure 2 . Total RNAs were purified from plants and reverse-transcribed. The resulting cDNAs were used as templates for qRT-PCR using the actin gene as an internal control. The untreated control was used for normalization, with the expression level of the sample set to 1. The data represent the mean ± SE of nine replicates from three independent experiments.

    Techniques Used: Expressing, Purification, Quantitative RT-PCR

    64) Product Images from "miR-1224-5p Mediates Mitochondrial Damage to Affect Silica-Induced Pulmonary Fibrosis by Targeting BECN1"

    Article Title: miR-1224-5p Mediates Mitochondrial Damage to Affect Silica-Induced Pulmonary Fibrosis by Targeting BECN1

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms18112357

    miR-1224-5p suppresses mitophagy in TGF-β1-exposed fibroblasts. ( A , B ) qRT-PCR analysis of miR-1224-5p levels in fibroblasts (NIH/3T3 and MRC-5) treated with different dose of TGF-β1 for 24 and 48 h, with ** p
    Figure Legend Snippet: miR-1224-5p suppresses mitophagy in TGF-β1-exposed fibroblasts. ( A , B ) qRT-PCR analysis of miR-1224-5p levels in fibroblasts (NIH/3T3 and MRC-5) treated with different dose of TGF-β1 for 24 and 48 h, with ** p

    Techniques Used: Quantitative RT-PCR

    Down-regulated miR-1224-5p attenuates silica-induced pulmonary fibrosis and restores mitophagy in vivo. ( A ) qRT-PCR analysis of miR-1224-5p levels in mouse lung tissues after injection of saline, silica, silica plus antagomir negative control (anta-NC), and silica plus miR-1224-5p antagomir (anta-1224-5p) for 28 days, with ** p
    Figure Legend Snippet: Down-regulated miR-1224-5p attenuates silica-induced pulmonary fibrosis and restores mitophagy in vivo. ( A ) qRT-PCR analysis of miR-1224-5p levels in mouse lung tissues after injection of saline, silica, silica plus antagomir negative control (anta-NC), and silica plus miR-1224-5p antagomir (anta-1224-5p) for 28 days, with ** p

    Techniques Used: In Vivo, Quantitative RT-PCR, Injection, Negative Control

    65) Product Images from "Polycomb Repressive Complex 2 is essential for development and maintenance of a functional TEC compartment"

    Article Title: Polycomb Repressive Complex 2 is essential for development and maintenance of a functional TEC compartment

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32729-z

    Eed deletion impairs TEC proliferation, survival and differentiation. ( a ) Percentage of fetal and newborn Eed CKO versus control TEC that incorporate BrdU after injection into pregnant or newborn mice. ( b ) qRT-PCR analysis of Cdkn2a expression in E17.5 TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( c ) Percentage of cleaved caspase 3 (CC3) positive Foxn1+ TEC in P0 Eed CKO and control thymi. The frequency of apoptotic TEC was determined by counting the total number of Foxn1+ TEC that were positive for CC3 on each of 3 different sections/thymus. Results shown are from three independent experiments. ( d ) Frozen sections from P0 thymi were stained for K8 (green), K5 (red) and K14 (blue). White arrows indicate K8+K5+K14− TEC near the CMJ; this subset is widely distributed in controls, but sparse in mutant thymi. Note also the smaller medullary regions identified by K8−K5+K14+ TEC in Eed CKO thymi. White bar indicates scale (250 μm). ( e ) Representative FACS plots of EpCAM+ CD45− TEC from P0 mice showing the distribution of UEA+Ly51− mTEC and UEA− Ly51+ cTEC subsets in control and Eed CKO thymi. ( f ) Representative FACS plots showing expansion of the MHCII lo TEC subset in P0 Eed CKO thymi. ( g ) Bar graph showing percentage (mean ± SD) of cTEC and mTEC subsets in control and Eed CKO thymi. ( h ) Bar graph showing number (mean ± SD) of cTEC and mTEC in control and Eed CKO thymi. Significance was calculated using an unpaired t test corrected for multiple comparisons using the Holm-Sidak method (* p
    Figure Legend Snippet: Eed deletion impairs TEC proliferation, survival and differentiation. ( a ) Percentage of fetal and newborn Eed CKO versus control TEC that incorporate BrdU after injection into pregnant or newborn mice. ( b ) qRT-PCR analysis of Cdkn2a expression in E17.5 TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( c ) Percentage of cleaved caspase 3 (CC3) positive Foxn1+ TEC in P0 Eed CKO and control thymi. The frequency of apoptotic TEC was determined by counting the total number of Foxn1+ TEC that were positive for CC3 on each of 3 different sections/thymus. Results shown are from three independent experiments. ( d ) Frozen sections from P0 thymi were stained for K8 (green), K5 (red) and K14 (blue). White arrows indicate K8+K5+K14− TEC near the CMJ; this subset is widely distributed in controls, but sparse in mutant thymi. Note also the smaller medullary regions identified by K8−K5+K14+ TEC in Eed CKO thymi. White bar indicates scale (250 μm). ( e ) Representative FACS plots of EpCAM+ CD45− TEC from P0 mice showing the distribution of UEA+Ly51− mTEC and UEA− Ly51+ cTEC subsets in control and Eed CKO thymi. ( f ) Representative FACS plots showing expansion of the MHCII lo TEC subset in P0 Eed CKO thymi. ( g ) Bar graph showing percentage (mean ± SD) of cTEC and mTEC subsets in control and Eed CKO thymi. ( h ) Bar graph showing number (mean ± SD) of cTEC and mTEC in control and Eed CKO thymi. Significance was calculated using an unpaired t test corrected for multiple comparisons using the Holm-Sidak method (* p

    Techniques Used: Injection, Mouse Assay, Quantitative RT-PCR, Expressing, Isolation, FACS, Staining, Mutagenesis

    Eed CKO DEG includes PRC2 and Foxn1 target genes. ( a ) Bar graph showing DEG in Eed CKO . ( b ) qRT-PCR analysis of Foxn1 expression in E17.5 Eed CKO TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( c ) Venn diagram showing the number of overlapping genes between DEG and Foxn1 target genes. ( d ) Heatmap of Foxn1 target genes in Eed CKO and control TEC expressed as Z score of FPKM.
    Figure Legend Snippet: Eed CKO DEG includes PRC2 and Foxn1 target genes. ( a ) Bar graph showing DEG in Eed CKO . ( b ) qRT-PCR analysis of Foxn1 expression in E17.5 Eed CKO TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( c ) Venn diagram showing the number of overlapping genes between DEG and Foxn1 target genes. ( d ) Heatmap of Foxn1 target genes in Eed CKO and control TEC expressed as Z score of FPKM.

    Techniques Used: Quantitative RT-PCR, Expressing, Isolation, FACS

    Overlap between Eed CKO DEG and iTbx1 DEG. ( a ) Venn diagram showing overlap between iTbx1 DEG and Eed CKO DEG. ( b ) Heatmap of log2 fold change of 1321 overlapping DEGs in iTbx1 and Eed CKO TEC. The green bar denotes genes that are regulated in the same direction in iTbx1 and Eed CKO mutant TEC relative to their respective control TEC. ( c ) qRT-PCR analysis of Tbx1 expression in E17.5 Eed CKO TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( d ) Working model showing reciprocal relationship between PRC2 activity and Tbx1 expression.
    Figure Legend Snippet: Overlap between Eed CKO DEG and iTbx1 DEG. ( a ) Venn diagram showing overlap between iTbx1 DEG and Eed CKO DEG. ( b ) Heatmap of log2 fold change of 1321 overlapping DEGs in iTbx1 and Eed CKO TEC. The green bar denotes genes that are regulated in the same direction in iTbx1 and Eed CKO mutant TEC relative to their respective control TEC. ( c ) qRT-PCR analysis of Tbx1 expression in E17.5 Eed CKO TEC isolated by FACS sorting. Expression in Eed CKO TEC is normalized to control TEC. Each sample was analyzed in triplicate and the experiment was repeated twice. ( d ) Working model showing reciprocal relationship between PRC2 activity and Tbx1 expression.

    Techniques Used: Mutagenesis, Quantitative RT-PCR, Expressing, Isolation, FACS, Activity Assay

    66) Product Images from "Identification of cold stress responsive microRNAs in two winter turnip rape (Brassica rapa L.) by high throughput sequencing"

    Article Title: Identification of cold stress responsive microRNAs in two winter turnip rape (Brassica rapa L.) by high throughput sequencing

    Journal: BMC Plant Biology

    doi: 10.1186/s12870-018-1242-4

    qRT-PCR analysis of differentially expressed miRNAs and the target genes
    Figure Legend Snippet: qRT-PCR analysis of differentially expressed miRNAs and the target genes

    Techniques Used: Quantitative RT-PCR

    67) Product Images from "C/EBPβ LIP augments cell death by inducing osteoglycin"

    Article Title: C/EBPβ LIP augments cell death by inducing osteoglycin

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2017.155

    The MAPK/AP-1 axis regulates Ogn expression. ( a and b ) Immunoblot of the indicated proteins in total cell extracts of F10.9-4 cells transfected at time=0 with control siRNA, c-Jun -specific siRNA ( a ), or ATF2 -specific siRNA ( b ), treated with vehicle or Doxy at time=24 h and vehicle or Tm at time=48 h. Cell extracts were isolated 0, 16 and 24 h after Tm treatment. ( c, e and g ) qRT-PCR of Ogn mRNA isolated from F10.9-4 cells pretreated with vehicle or Doxy, followed by vehicle or Tm for the indicated times, in the presence or absence of the ERK1/2 inhibitor AZD6244 ( c ), the JNK inhibitor JNK-IN-8 ( e ) or the p38 inhibitor SCIO469 ( g ). ( d, f and h ) Immunoblot of Ogn in total cell extracts of F10.9-4 cells treated as described in ( c, e and g ). NS, nonspecific band
    Figure Legend Snippet: The MAPK/AP-1 axis regulates Ogn expression. ( a and b ) Immunoblot of the indicated proteins in total cell extracts of F10.9-4 cells transfected at time=0 with control siRNA, c-Jun -specific siRNA ( a ), or ATF2 -specific siRNA ( b ), treated with vehicle or Doxy at time=24 h and vehicle or Tm at time=48 h. Cell extracts were isolated 0, 16 and 24 h after Tm treatment. ( c, e and g ) qRT-PCR of Ogn mRNA isolated from F10.9-4 cells pretreated with vehicle or Doxy, followed by vehicle or Tm for the indicated times, in the presence or absence of the ERK1/2 inhibitor AZD6244 ( c ), the JNK inhibitor JNK-IN-8 ( e ) or the p38 inhibitor SCIO469 ( g ). ( d, f and h ) Immunoblot of Ogn in total cell extracts of F10.9-4 cells treated as described in ( c, e and g ). NS, nonspecific band

    Techniques Used: Expressing, Transfection, Isolation, Quantitative RT-PCR

    ER stress induces Ogn expression. ( a ) qRT-PCR of Ogn mRNA isolated from F10.9-4 cells pretreated with vehicle or Doxy, followed by vehicle or Tm for the indicated times. ( b ) qRT-PCR of Ogn mRNA isolated from parental B16-F10 cells and from B16-F10.9-4 cells treated with vehicle or Doxy. N =2, * P
    Figure Legend Snippet: ER stress induces Ogn expression. ( a ) qRT-PCR of Ogn mRNA isolated from F10.9-4 cells pretreated with vehicle or Doxy, followed by vehicle or Tm for the indicated times. ( b ) qRT-PCR of Ogn mRNA isolated from parental B16-F10 cells and from B16-F10.9-4 cells treated with vehicle or Doxy. N =2, * P

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation

    68) Product Images from "A secretory kinase complex regulates extracellular protein phosphorylation"

    Article Title: A secretory kinase complex regulates extracellular protein phosphorylation

    Journal: eLife

    doi: 10.7554/eLife.06120

    Upregulation and complex formation of Fam20A and Fam20C in the lactating mammary gland. ( A ) mRNA levels of Fam20C family members in the mouse mammary gland. The mammary glands from two non-lactating (Virgin) and two 10-day lactating (Lact) mice were isolated and the mRNA levels of Fam20 family members were determined by quantitative (q)RT-PCR. Data are represented as mean ± SD. ( B ) mRNA levels of Fam20A and Fam20C in the mammary glands of pregnant/lactating female mice at different stages. E−13, 16 or 18: embryonic day 13, 16 or 18; Lact-1, 3 or 7: 1, 3 or 7 days after lactation; Inv-1 or 7: 1 or 7 days after involution. The gestation period of mouse is 18–21 days. mRNA levels of Fam20A and Fam20C were determined by qRT-PCR. Data are represented as mean ± SD. ( C ) Protein levels of Fam20A and Fam20C in the mouse mammary glands. Endogenous Fam20A or Fam20C were detected from whole mammary gland lysate or the Golgi/ER-enriched fractions by western blot. ( D ) Co-immunoprecipitation of endogenous Fam20A and Fam20C from Golgi/ER-enriched fractions of the mouse lactating mammary gland. Polyclonal rabbit anti-Fam20C antibody was used for immunoprecipitating endogenous Fam20C. Normal rabbit IgG was used as control for immunoprecipitation. DOI: http://dx.doi.org/10.7554/eLife.06120.017
    Figure Legend Snippet: Upregulation and complex formation of Fam20A and Fam20C in the lactating mammary gland. ( A ) mRNA levels of Fam20C family members in the mouse mammary gland. The mammary glands from two non-lactating (Virgin) and two 10-day lactating (Lact) mice were isolated and the mRNA levels of Fam20 family members were determined by quantitative (q)RT-PCR. Data are represented as mean ± SD. ( B ) mRNA levels of Fam20A and Fam20C in the mammary glands of pregnant/lactating female mice at different stages. E−13, 16 or 18: embryonic day 13, 16 or 18; Lact-1, 3 or 7: 1, 3 or 7 days after lactation; Inv-1 or 7: 1 or 7 days after involution. The gestation period of mouse is 18–21 days. mRNA levels of Fam20A and Fam20C were determined by qRT-PCR. Data are represented as mean ± SD. ( C ) Protein levels of Fam20A and Fam20C in the mouse mammary glands. Endogenous Fam20A or Fam20C were detected from whole mammary gland lysate or the Golgi/ER-enriched fractions by western blot. ( D ) Co-immunoprecipitation of endogenous Fam20A and Fam20C from Golgi/ER-enriched fractions of the mouse lactating mammary gland. Polyclonal rabbit anti-Fam20C antibody was used for immunoprecipitating endogenous Fam20C. Normal rabbit IgG was used as control for immunoprecipitation. DOI: http://dx.doi.org/10.7554/eLife.06120.017

    Techniques Used: Mouse Assay, Isolation, Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Immunoprecipitation

    69) Product Images from "High co-expression of the SDF1/CXCR4 axis in hepatocarcinoma cells is regulated by AnnexinA7 in vitro and in vivo"

    Article Title: High co-expression of the SDF1/CXCR4 axis in hepatocarcinoma cells is regulated by AnnexinA7 in vitro and in vivo

    Journal: Cell Communication and Signaling : CCS

    doi: 10.1186/s12964-018-0234-1

    The effects of downregulation and upregulation of AnnexinA7 on the expression levels of SDF1/CXCR4 in hepatocarcinoma cells in vitro and in vivo . Transcriptome sequencing heat maps (A1, A2) and cDNA expression (A3) of SDF1/CXCR4 in F A7DOWN /F SHUS and P A7UP /P NCEV cells. qRT-PCR (B1, B2) and Western blot (C1, C2) analysis of SDF1/CXCR4 mRNA and protein expression respectively, in F A7DOWN , F SHUS , P A7UP , and P NCEV cells in vitro (Left) and in vivo (Right) . mRNA expression in F A7DOWN and F SHUS cells (B1, Left) as well as in P A7UP /P NCEV cells (B2, Left) in vitro. mRNA expressions in F A7DOWN and F SHUS cells (B1, Right) as well as in P A7UP /P NCEV cells (B2, right) in vivo. Protein expressions in F A7DOWN and F SHUS cells (C1, Left) as well as in P A7UP , P NCEV cells (C2, Left) in vitro. Protein expressions in F A7DOWN and F SHUS cells (C1, Right) as well as in P A7UP and P NCEV cells (C2, Right) in vivo. mRNA results between different groups in vitro and in vivo (E). Western blot OD densities of SDF1/CXCR4 in F SHUS and F A7DOWN cells (D1, Left) as well as in P A7UP and P NCEV cells ( D2, Left) in vitro. Western blot OD densities of SDF1/CXCR4 in F SHUS and F A7DOWN cells (D1, Right) as well as in P A7UP and P NCEV cells ( D2, Right) in vivo
    Figure Legend Snippet: The effects of downregulation and upregulation of AnnexinA7 on the expression levels of SDF1/CXCR4 in hepatocarcinoma cells in vitro and in vivo . Transcriptome sequencing heat maps (A1, A2) and cDNA expression (A3) of SDF1/CXCR4 in F A7DOWN /F SHUS and P A7UP /P NCEV cells. qRT-PCR (B1, B2) and Western blot (C1, C2) analysis of SDF1/CXCR4 mRNA and protein expression respectively, in F A7DOWN , F SHUS , P A7UP , and P NCEV cells in vitro (Left) and in vivo (Right) . mRNA expression in F A7DOWN and F SHUS cells (B1, Left) as well as in P A7UP /P NCEV cells (B2, Left) in vitro. mRNA expressions in F A7DOWN and F SHUS cells (B1, Right) as well as in P A7UP /P NCEV cells (B2, right) in vivo. Protein expressions in F A7DOWN and F SHUS cells (C1, Left) as well as in P A7UP , P NCEV cells (C2, Left) in vitro. Protein expressions in F A7DOWN and F SHUS cells (C1, Right) as well as in P A7UP and P NCEV cells (C2, Right) in vivo. mRNA results between different groups in vitro and in vivo (E). Western blot OD densities of SDF1/CXCR4 in F SHUS and F A7DOWN cells (D1, Left) as well as in P A7UP and P NCEV cells ( D2, Left) in vitro. Western blot OD densities of SDF1/CXCR4 in F SHUS and F A7DOWN cells (D1, Right) as well as in P A7UP and P NCEV cells ( D2, Right) in vivo

    Techniques Used: Expressing, In Vitro, In Vivo, Sequencing, Quantitative RT-PCR, Western Blot

    The efficiency of AnnexinA7 regulation in stable transfected F A7DOWN /P A7UP and F SHUS /P NCEV cells in vitro as analyzed by transcriptome sequencing, qRT-PCR and Western blotting. Transcriptome sequencing heat maps (A1) and cDNA regulation efficiency (A2) of AnnexinA7 in F A7DOWN /P A7UP and F SHUS /P NCEV cells in vitro . mRNA regulation efficiency of AnnexinA7 in vitro (B). Western blot results and protein regulation efficiency of AnnexinA7 in vitro (C)
    Figure Legend Snippet: The efficiency of AnnexinA7 regulation in stable transfected F A7DOWN /P A7UP and F SHUS /P NCEV cells in vitro as analyzed by transcriptome sequencing, qRT-PCR and Western blotting. Transcriptome sequencing heat maps (A1) and cDNA regulation efficiency (A2) of AnnexinA7 in F A7DOWN /P A7UP and F SHUS /P NCEV cells in vitro . mRNA regulation efficiency of AnnexinA7 in vitro (B). Western blot results and protein regulation efficiency of AnnexinA7 in vitro (C)

    Techniques Used: Transfection, In Vitro, Sequencing, Quantitative RT-PCR, Western Blot

    Expression of SDF1 and CXCR4 in different hepatocarcinoma cells and normal liver cells in vitro and in vivo. Transcriptome sequencing heat maps (A) and cDNA expression (A1) of SDF1/CXCR4 in F/P cells in vitro. qRT-PCR (B, B1) and Western blot (C, C1, C2) analysis of SDF1/CXCR4 mRNA and protein expressions in normal hepatocytes and F/P cells in vitro (Left) and in vivo (Right). mRNA comparison between different groups in vitro and in vivo (B1). Protein expression for in vitro (C, Left) and in vivo (C, Right). Western blot OD densities for in vitro (C1) and in vivo (C2)
    Figure Legend Snippet: Expression of SDF1 and CXCR4 in different hepatocarcinoma cells and normal liver cells in vitro and in vivo. Transcriptome sequencing heat maps (A) and cDNA expression (A1) of SDF1/CXCR4 in F/P cells in vitro. qRT-PCR (B, B1) and Western blot (C, C1, C2) analysis of SDF1/CXCR4 mRNA and protein expressions in normal hepatocytes and F/P cells in vitro (Left) and in vivo (Right). mRNA comparison between different groups in vitro and in vivo (B1). Protein expression for in vitro (C, Left) and in vivo (C, Right). Western blot OD densities for in vitro (C1) and in vivo (C2)

    Techniques Used: Expressing, In Vitro, In Vivo, Sequencing, Quantitative RT-PCR, Western Blot

    70) Product Images from "MicroRNA-221-3p, a TWIST2 target, promotes cervical cancer metastasis by directly targeting THBS2"

    Article Title: MicroRNA-221-3p, a TWIST2 target, promotes cervical cancer metastasis by directly targeting THBS2

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-017-0077-5

    Identification of miR-221-3p as a metastasis-promoting miRNA in cervical cancer a The certified result of microarray analysis. Hierarchical clustering of seven significantly dysregulated miRNA expression profiles in human primary cervical cancer tissues derived from cervical cancer patients with or without lymph node metastasis. b Validation of the selected miRNAs predicted to be dysregulated in cervical cancer with or without lymph node metastasis using qRT-PCR in the same tissues used for microarray analysis. Data are shown from three independent experiments and presented as fold expression normalized to U6 ± SD (standard deviation). c qRT-PCR analysis of the relative tissue expression of miR-221-3p, miR-135b-5p, miR-25-3p, and miR-144-3p in additional 28 (LNM-N = 14; LNM-P = 14) cases of human CC tissues. Each sample was analyzed in triplicate and normalized to U6. * p
    Figure Legend Snippet: Identification of miR-221-3p as a metastasis-promoting miRNA in cervical cancer a The certified result of microarray analysis. Hierarchical clustering of seven significantly dysregulated miRNA expression profiles in human primary cervical cancer tissues derived from cervical cancer patients with or without lymph node metastasis. b Validation of the selected miRNAs predicted to be dysregulated in cervical cancer with or without lymph node metastasis using qRT-PCR in the same tissues used for microarray analysis. Data are shown from three independent experiments and presented as fold expression normalized to U6 ± SD (standard deviation). c qRT-PCR analysis of the relative tissue expression of miR-221-3p, miR-135b-5p, miR-25-3p, and miR-144-3p in additional 28 (LNM-N = 14; LNM-P = 14) cases of human CC tissues. Each sample was analyzed in triplicate and normalized to U6. * p

    Techniques Used: Microarray, Expressing, Derivative Assay, Quantitative RT-PCR, Standard Deviation

    miR-221-3p promoted EMT in vitro a SiHa and HeLa cells were transfected with miR-221-3p mimic, miR-221-3p inhibitor, miR-221-3p mimic-nc, and miR-221-3p inhibitor-nc. Western blotting analysis of E-cadherin, N-cadherin, and Vimentin was performed of the five groups in SiHa and HeLa cells. β-actin was used as loading control. b qRT-PCR analysis of E-cadherin, N-cadherin, and Vimentin of the five groups in SiHa and HeLa cells. c Wound-healing assay of the five groups in SiHa and HeLa cells. d Boyden chamber assay of the five groups in SiHa and HeLa cells. e Cell migration was quantified as percentage of wound-healed area. f Average number of invading cells per field from three independent experiments. Data represent means ± SD of five randomly selected areas. * p
    Figure Legend Snippet: miR-221-3p promoted EMT in vitro a SiHa and HeLa cells were transfected with miR-221-3p mimic, miR-221-3p inhibitor, miR-221-3p mimic-nc, and miR-221-3p inhibitor-nc. Western blotting analysis of E-cadherin, N-cadherin, and Vimentin was performed of the five groups in SiHa and HeLa cells. β-actin was used as loading control. b qRT-PCR analysis of E-cadherin, N-cadherin, and Vimentin of the five groups in SiHa and HeLa cells. c Wound-healing assay of the five groups in SiHa and HeLa cells. d Boyden chamber assay of the five groups in SiHa and HeLa cells. e Cell migration was quantified as percentage of wound-healed area. f Average number of invading cells per field from three independent experiments. Data represent means ± SD of five randomly selected areas. * p

    Techniques Used: In Vitro, Transfection, Western Blot, Quantitative RT-PCR, Wound Healing Assay, Boyden Chamber Assay, Migration

    Candidate transcription factors of the miR-221-3p promoter are identified a Bioinformatic prediction and screening of potential transcription factors of miR-221-3p. b Correlation analysis of TWIST2 and miR-221-3p expression detected by qRT-PCR in 28 additional SCC tissues. The expression levels of TWIST2 were plotted against the expression levels of miR-221-3p. c The certified result of microarray analysis. Hierarchical clustering of eight significantly dysregulated miRNAs expression profiles of the three groups, including SiHa, SiHa-shtw2, and SiHa-tw2 cells. d qRT-PCR analysis of the eight significantly dysregulated miRNAs expressed in SiHa, SiHa-shtw2, and SiHa-tw2 cells, and in HeLa cells transfected with TWIST2 expression vector or TWIST2 siRNA. MiR-221-3p emerged as a highly upregulated miRNA. Data represent means ± SD of five randomly selected areas (* p
    Figure Legend Snippet: Candidate transcription factors of the miR-221-3p promoter are identified a Bioinformatic prediction and screening of potential transcription factors of miR-221-3p. b Correlation analysis of TWIST2 and miR-221-3p expression detected by qRT-PCR in 28 additional SCC tissues. The expression levels of TWIST2 were plotted against the expression levels of miR-221-3p. c The certified result of microarray analysis. Hierarchical clustering of eight significantly dysregulated miRNAs expression profiles of the three groups, including SiHa, SiHa-shtw2, and SiHa-tw2 cells. d qRT-PCR analysis of the eight significantly dysregulated miRNAs expressed in SiHa, SiHa-shtw2, and SiHa-tw2 cells, and in HeLa cells transfected with TWIST2 expression vector or TWIST2 siRNA. MiR-221-3p emerged as a highly upregulated miRNA. Data represent means ± SD of five randomly selected areas (* p

    Techniques Used: Expressing, Quantitative RT-PCR, Microarray, Transfection, Plasmid Preparation

    71) Product Images from "miR-216a rescues dexamethasone suppression of osteogenesis, promotes osteoblast differentiation and enhances bone formation, by regulating c-Cbl-mediated PI3K/AKT pathway"

    Article Title: miR-216a rescues dexamethasone suppression of osteogenesis, promotes osteoblast differentiation and enhances bone formation, by regulating c-Cbl-mediated PI3K/AKT pathway

    Journal: Cell Death and Differentiation

    doi: 10.1038/cdd.2015.99

    Downregulation of miR-216a inhibits the osteogenic differentiation of hAMSCs. ( a ) miR-216a expression was determined by TaqMan qRT-PCR in miR-216a antagomir (anta-216a)-transfected hAMSCs after 48 h compared with that in negative control antagomir
    Figure Legend Snippet: Downregulation of miR-216a inhibits the osteogenic differentiation of hAMSCs. ( a ) miR-216a expression was determined by TaqMan qRT-PCR in miR-216a antagomir (anta-216a)-transfected hAMSCs after 48 h compared with that in negative control antagomir

    Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Negative Control

    miR-216a promotes the osteogenic differentiation and bone formation of hAMSCs. ( a ) miR-216a expression was determined by TaqMan qRT-PCR in lenti-216a-infected hAMSCs compared with that in lenti-NC-infected cells. ( b and c ) qRT-PCR and western blot analyses
    Figure Legend Snippet: miR-216a promotes the osteogenic differentiation and bone formation of hAMSCs. ( a ) miR-216a expression was determined by TaqMan qRT-PCR in lenti-216a-infected hAMSCs compared with that in lenti-NC-infected cells. ( b and c ) qRT-PCR and western blot analyses

    Techniques Used: Expressing, Quantitative RT-PCR, Infection, Western Blot

    Expression pattern of miR-216a. ( a and b ) The dynamic expression profile of miR-216a during osteogenesis in hAMSCs was detected by miRNA microarray and validated by TaqMan qRT-PCR. ( c ) Analysis of miR-216a conservation in mammals. ( d and e ) The tissue
    Figure Legend Snippet: Expression pattern of miR-216a. ( a and b ) The dynamic expression profile of miR-216a during osteogenesis in hAMSCs was detected by miRNA microarray and validated by TaqMan qRT-PCR. ( c ) Analysis of miR-216a conservation in mammals. ( d and e ) The tissue

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR

    72) Product Images from "Generation and Proteome Profiling of PBMC-Originated, iPSC-Derived Corneal Endothelial Cells"

    Article Title: Generation and Proteome Profiling of PBMC-Originated, iPSC-Derived Corneal Endothelial Cells

    Journal: Investigative Ophthalmology & Visual Science

    doi: 10.1167/iovs.17-22927

    Gene expression analysis of CEC- and pluripotency-associated markers during differentiation of human PBMC-originated, iPSCs into CECs. The expression level of seven CE-associated markers (AQP1, COL4A1, COL4A3, COL8A1, COL8A2, FOXC1, SLC16A3) and four pluripotent markers (NANOG, OCT4, SOX2, TRA-1-60) were analyzed by qRT-PCR in H9 hESCs, PBMC-originated iPSCs, iPSC-derived CECs on days 13 (D13), 20 (D20), and 30 (D30), and hCE. Note: Expression of all markers are normalized against GAPDH, and all values are relative to the respective expression of PBMC-originated, iPSCs.
    Figure Legend Snippet: Gene expression analysis of CEC- and pluripotency-associated markers during differentiation of human PBMC-originated, iPSCs into CECs. The expression level of seven CE-associated markers (AQP1, COL4A1, COL4A3, COL8A1, COL8A2, FOXC1, SLC16A3) and four pluripotent markers (NANOG, OCT4, SOX2, TRA-1-60) were analyzed by qRT-PCR in H9 hESCs, PBMC-originated iPSCs, iPSC-derived CECs on days 13 (D13), 20 (D20), and 30 (D30), and hCE. Note: Expression of all markers are normalized against GAPDH, and all values are relative to the respective expression of PBMC-originated, iPSCs.

    Techniques Used: Expressing, Capillary Electrochromatography, Quantitative RT-PCR, Derivative Assay

    Characterization of PBMC-originated, iPSC-derived CECs following cryopreservation. (a) qRT-PCR analysis of CE-associated markers: AQP1, ATP1A1, ATP1A3, COL4A1, COL4A3, COL8A1, COL8A2, FOXC1, and SLC16A3 on day 20 (D20). (b–d) Immunostaining for zona occludens-1 (ZO-1; a tight-junction protein) exhibiting typical hexagonal/polygonal morphology of CECs. The images are 60× magnification, and the scale bar represents 10 μm.
    Figure Legend Snippet: Characterization of PBMC-originated, iPSC-derived CECs following cryopreservation. (a) qRT-PCR analysis of CE-associated markers: AQP1, ATP1A1, ATP1A3, COL4A1, COL4A3, COL8A1, COL8A2, FOXC1, and SLC16A3 on day 20 (D20). (b–d) Immunostaining for zona occludens-1 (ZO-1; a tight-junction protein) exhibiting typical hexagonal/polygonal morphology of CECs. The images are 60× magnification, and the scale bar represents 10 μm.

    Techniques Used: Derivative Assay, Quantitative RT-PCR, Immunostaining

    73) Product Images from "Collapsin Response Mediator Protein-2 Ameliorates Sevoflurane-Mediated Neurocyte Injury by Targeting PI3K-mTOR-S6K Pathway"

    Article Title: Collapsin Response Mediator Protein-2 Ameliorates Sevoflurane-Mediated Neurocyte Injury by Targeting PI3K-mTOR-S6K Pathway

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.909056

    Sevoflurane (SEV) restrained the cell viability of nerve cells, and collapsin response mediator protein-2 (CRMP-2) was overexpressed in nerve cells transfected with CRMP-2. ( A ) CCK-8 assay was carried out to measure the cell viability of nerve cells treated with different concentration of SEV mixed gas (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0%). qRT-PCR ( B ) and western blot ( C ) assays were performed on the expression level of CRMP-2 in nerve cells, nerve cells transfected with empty vector, nerve cells transfected with CRMP-2, nerve cells treated with 3% SEV mixed gas, nerve cells transfected with empty vector and then treated with SEV, and nerve cells transfected with CRMP-2 and then treated with SEV. * P
    Figure Legend Snippet: Sevoflurane (SEV) restrained the cell viability of nerve cells, and collapsin response mediator protein-2 (CRMP-2) was overexpressed in nerve cells transfected with CRMP-2. ( A ) CCK-8 assay was carried out to measure the cell viability of nerve cells treated with different concentration of SEV mixed gas (0.5%, 1.0%, 2.0%, 3.0%, 4.0%, and 5.0%). qRT-PCR ( B ) and western blot ( C ) assays were performed on the expression level of CRMP-2 in nerve cells, nerve cells transfected with empty vector, nerve cells transfected with CRMP-2, nerve cells treated with 3% SEV mixed gas, nerve cells transfected with empty vector and then treated with SEV, and nerve cells transfected with CRMP-2 and then treated with SEV. * P

    Techniques Used: Transfection, CCK-8 Assay, Concentration Assay, Quantitative RT-PCR, Western Blot, Expressing, Plasmid Preparation

    Collapsin response mediator protein-2 (CRMP-2) impacted the expression levels of apoptosis-associated proteins. Nerve cells were transfected with empty vector, transfected with CRMP-2, treated with 3% sevoflurane (SEV) mixed gas, transfected with empty vector and then treated with SEV, and transfected with CRMP-2 and then treated with SEV. ( A ) Colorimetry was performed on the activity of caspase-3 in nerve cells. qRT-PCR ( B ) and western blot ( C ) assays were performed on the expression levels of actived-caspase-3, Bax, and Bcl-2 in nerve cells. * P
    Figure Legend Snippet: Collapsin response mediator protein-2 (CRMP-2) impacted the expression levels of apoptosis-associated proteins. Nerve cells were transfected with empty vector, transfected with CRMP-2, treated with 3% sevoflurane (SEV) mixed gas, transfected with empty vector and then treated with SEV, and transfected with CRMP-2 and then treated with SEV. ( A ) Colorimetry was performed on the activity of caspase-3 in nerve cells. qRT-PCR ( B ) and western blot ( C ) assays were performed on the expression levels of actived-caspase-3, Bax, and Bcl-2 in nerve cells. * P

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Colorimetric Assay, Activity Assay, Quantitative RT-PCR, Western Blot

    74) Product Images from "Establishment of HSV1 Latency in Immunodeficient Mice Facilitates Efficient In Vivo Reactivation"

    Article Title: Establishment of HSV1 Latency in Immunodeficient Mice Facilitates Efficient In Vivo Reactivation

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1004730

    Acute and latent gene expression in HD infected B6-Rag trigeminal ganglia. qRT-PCR analysis of RNA from Tg collected from acute (day 5) PBS (blue bars) or IVIG treated (red) and latent (day 60) IVIG treated (black) HD B6-Rag mice are shown as fold-change relative to LAT expression (A-D) for Immediate Early (A), Early (B), Early/Late (C) and Late (D) genes, and delta-Ct (dCt) values normalized to GAPDH expression for Early, Early/Late and Late genes (E, F, and G, respectively). Tg sections obtained from latently infected LD, HD, and a HD Rag mouse showing signs of HSE were processed for RNA-FISH using a LAT RNA probe (H) . The blue signal stains for LAT, the green signal comes from neuronal cytoplasmic lipofuscin (aggregates) autofluorescence. The dotted lines outline the nuclei. Wide-field imaging. Scale bar = 10 μm. (I) GAPDH normalized dCt values for LAT expression in HD Rag mice determined using RT-PCR (I). Statistical analysis is described in methods.
    Figure Legend Snippet: Acute and latent gene expression in HD infected B6-Rag trigeminal ganglia. qRT-PCR analysis of RNA from Tg collected from acute (day 5) PBS (blue bars) or IVIG treated (red) and latent (day 60) IVIG treated (black) HD B6-Rag mice are shown as fold-change relative to LAT expression (A-D) for Immediate Early (A), Early (B), Early/Late (C) and Late (D) genes, and delta-Ct (dCt) values normalized to GAPDH expression for Early, Early/Late and Late genes (E, F, and G, respectively). Tg sections obtained from latently infected LD, HD, and a HD Rag mouse showing signs of HSE were processed for RNA-FISH using a LAT RNA probe (H) . The blue signal stains for LAT, the green signal comes from neuronal cytoplasmic lipofuscin (aggregates) autofluorescence. The dotted lines outline the nuclei. Wide-field imaging. Scale bar = 10 μm. (I) GAPDH normalized dCt values for LAT expression in HD Rag mice determined using RT-PCR (I). Statistical analysis is described in methods.

    Techniques Used: Expressing, Infection, Quantitative RT-PCR, Mouse Assay, Fluorescence In Situ Hybridization, Imaging, Reverse Transcription Polymerase Chain Reaction

    75) Product Images from "Glutathione S-transferase P1 (GSTP1) directly influences platinum drug chemosensitivity in ovarian tumour cell lines"

    Article Title: Glutathione S-transferase P1 (GSTP1) directly influences platinum drug chemosensitivity in ovarian tumour cell lines

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2014.386

    GSTP1 knockdown is toxic to cisplatin-resistant A2780DPP cells. A2780 and cisplatin-resistant A2780DPP cells were transfected with GSTP1 Mission shRNA plasmids 775 and 776 or an empty vector negative control plasmid, as described in Materials and Methods section, and GSTP1 knockdown cells identified by puromycin selection. ( A ) Viable puromycin-resistant colonies were obtained from all transfections in A2780 cells, but only from A2780DPP cells transfected with an empty vector negative control plasmid. ( B ) qRT–PCR analysis was used to confirm GSTP1 knockdown in A2780DPP cells (illustrated relative to the expression of 18S ribosomal RNA ) following transfection of GSTP1 shRNA clones. Cells from small colonies with limited viability were collected using cloning cylinders, and RNA extracted as described in Materials and Methods section.
    Figure Legend Snippet: GSTP1 knockdown is toxic to cisplatin-resistant A2780DPP cells. A2780 and cisplatin-resistant A2780DPP cells were transfected with GSTP1 Mission shRNA plasmids 775 and 776 or an empty vector negative control plasmid, as described in Materials and Methods section, and GSTP1 knockdown cells identified by puromycin selection. ( A ) Viable puromycin-resistant colonies were obtained from all transfections in A2780 cells, but only from A2780DPP cells transfected with an empty vector negative control plasmid. ( B ) qRT–PCR analysis was used to confirm GSTP1 knockdown in A2780DPP cells (illustrated relative to the expression of 18S ribosomal RNA ) following transfection of GSTP1 shRNA clones. Cells from small colonies with limited viability were collected using cloning cylinders, and RNA extracted as described in Materials and Methods section.

    Techniques Used: Transfection, shRNA, Plasmid Preparation, Negative Control, Selection, Quantitative RT-PCR, Expressing, Clone Assay

    qRT–PCR analysis confirms gene expression changes predicted by Illumina Beadchip microarray analysis of A2780 and A2780/GSTP1 cells. qRT–PCR was performed, as described in Materials and Methods section, to confirm differential expression of selected genes predicted by comparative Illumina HT-12 Beadchip Array analysis to be differentially expressed in A2780 and A2780/GSTP1 cells—( A ) VCAN, ( B ) FOXC1, ( C ) ALX1, ( D ) TM4SF, ( E ) CDH2 and ( F ) LAYN. All samples were analysed in triplicate; gene expression is illustrated relative to the expression of 18S ribosomal RNA.
    Figure Legend Snippet: qRT–PCR analysis confirms gene expression changes predicted by Illumina Beadchip microarray analysis of A2780 and A2780/GSTP1 cells. qRT–PCR was performed, as described in Materials and Methods section, to confirm differential expression of selected genes predicted by comparative Illumina HT-12 Beadchip Array analysis to be differentially expressed in A2780 and A2780/GSTP1 cells—( A ) VCAN, ( B ) FOXC1, ( C ) ALX1, ( D ) TM4SF, ( E ) CDH2 and ( F ) LAYN. All samples were analysed in triplicate; gene expression is illustrated relative to the expression of 18S ribosomal RNA.

    Techniques Used: Quantitative RT-PCR, Expressing, Microarray

    Generation of stable GSTP1 knockdown cell lines. A2780 ovarian tumour cells were transfected with various GSTP1 Mission shRNA constructs (clones 773, 774, 775, 776 and 777) and an empty vector negative control plasmid as described in Materials and Methods section. Following puromycin selection, GSTP1 expression was compared in A2780 cells and in each novel daughter cell line ( A ) by qRT–PCR analysis, relative to 18S ribosomal RNA (significant differences in gene expression ( P
    Figure Legend Snippet: Generation of stable GSTP1 knockdown cell lines. A2780 ovarian tumour cells were transfected with various GSTP1 Mission shRNA constructs (clones 773, 774, 775, 776 and 777) and an empty vector negative control plasmid as described in Materials and Methods section. Following puromycin selection, GSTP1 expression was compared in A2780 cells and in each novel daughter cell line ( A ) by qRT–PCR analysis, relative to 18S ribosomal RNA (significant differences in gene expression ( P

    Techniques Used: Transfection, shRNA, Construct, Plasmid Preparation, Negative Control, Selection, Expressing, Quantitative RT-PCR

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: .. Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. The specificity of amplification was assessed for each sample by melting-curve analysis.

    Article Title: Transcriptome-wide analysis of immune-responsive microRNAs against poly (I:C) challenge in Branchiostoma belcheri by deep sequencing and bioinformatics
    Article Snippet: .. We used TransStart TipGreen qPCR SuperMix (TransGen Biotech, China) to conduct qRT-PCR analysis on an ABI 7300 Real-time PCR system (Applied Biosystems, USA) following reaction conditions suggested by TransGenBiotech. ..

    Article Title: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma
    Article Snippet: .. QRT-PCR analysis of individual miRNAs Selected mature miRNAs were quantified using commercially available TaqMan qRT-PCR assays (Applied Biosystems) and a 7900HT Real-Time PCR System (Applied Biosystems). cDNA was synthesized from 25 ng total RNA using TaqMan mRNA RT Kit (Applied Biosystems) and used for quantification of miR-483-3p (ID 002339), miR-483-5p (ID 002338), miR-497 (ID 001043), miR-195 (ID 000494), miR-1974 (ID 121209_mat), miR-210 (ID 000512), miR-21 (ID 000397), miR-503 (ID 001048), miR-1202 (ID 002858), miR-1275 (ID 002840), miR-638 (ID 001582), miR-1915 (ID 121111_mat), and miR-572 (ID 001614) with normalization against RNU6B (ID 001093). .. All reactions were performed in triplicate, and relative expression levels were determined with the ΔC T method and reported as .

    Article Title: Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap
    Article Snippet: For qRT-PCR analysis, RNA was extracted from snap frozen liver or cells by Trizol (Ambion) followed by purification using the RNeasy Kit (Qiagen). .. IQ SYBR Green Supermix (Biorad) was used for quantitative PCR on the LightCycler480 System (Roche Diagnostics).

    Article Title: Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy
    Article Snippet: QRT-PCR analysis of BAG3 expression Total RNA from primary cardiomyocytes after indicating treatments were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. To measure the level of BAG3 mRNA, qRT-PCR was performed by using the following primers: forward, 5′-CTCCATTCCGGTGATACACGA-3′, reverse, 5′-TGGTGGGTCTGGTACTCCC-3′ and SYBR Premix Ex Taq II (TaKaRa) in an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA).

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: .. Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells
    Article Snippet: .. Briefly, total RNA was extracted using RNeasy mini Kit (QIAGEN, Hilden, Germany), and cDNAs were synthesized using Super Script reverse transcriptase III (Invitrogen). qRT-PCR analysis was carried out with Step OneTM Real-Time PCR Systems (Applied Biosystems) using THUNDERBIRD® SYBR qPCR Mix (TOYOBO, Osaka, Japan). .. Relative expression levels to internal control 36B4 are presented.

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    Article Title: Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis
    Article Snippet: .. Further, the qRT-PCR analysis was conducted using an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, USA) with a 20 μL reaction volume including SYBR (TaKaRa) 10 μL, 10 μM forward/reverse primer 0.4 μL, and 100 ng/μL cDNA 0.2 μL. ..

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: .. The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications. .. The TaqMan Gene Expression Assays for Panx1 (assay identification number: Hs00209790_m1), P2X7 (assay identification number: Hs00175721_m1), and GAPDH (assay identification number: Hs02758991_g1) were purchased from Applied Biosystems.

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. Amplification of each target DNA was performed with SYBR Green master mix in Bio-Rad ( http://www.bio-rad.com ) Single Color Real-Time PCR Detection System according to the protocols provided.

    RNA Extraction:

    Article Title: Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis
    Article Snippet: Paragraph title: 2.3. RNA Extraction and qRT-PCR ... Further, the qRT-PCR analysis was conducted using an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, USA) with a 20 μL reaction volume including SYBR (TaKaRa) 10 μL, 10 μM forward/reverse primer 0.4 μL, and 100 ng/μL cDNA 0.2 μL.

    Amplification:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. The specificity of amplification was assessed for each sample by melting-curve analysis.

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications. .. The mixture was then subjected to PCR amplification with real‐time detection.

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. Amplification of each target DNA was performed with SYBR Green master mix in Bio-Rad ( http://www.bio-rad.com ) Single Color Real-Time PCR Detection System according to the protocols provided.

    Fluorescence:

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. To assess whether two amplicons have the same efficiency, the variation of ΔCT (CT,target – CT,β-actin , where CT is cycle number at which the fluorescence signal exceeds background) with template dilution was evaluated [ ].

    Synthesized:

    Article Title: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma
    Article Snippet: .. QRT-PCR analysis of individual miRNAs Selected mature miRNAs were quantified using commercially available TaqMan qRT-PCR assays (Applied Biosystems) and a 7900HT Real-Time PCR System (Applied Biosystems). cDNA was synthesized from 25 ng total RNA using TaqMan mRNA RT Kit (Applied Biosystems) and used for quantification of miR-483-3p (ID 002339), miR-483-5p (ID 002338), miR-497 (ID 001043), miR-195 (ID 000494), miR-1974 (ID 121209_mat), miR-210 (ID 000512), miR-21 (ID 000397), miR-503 (ID 001048), miR-1202 (ID 002858), miR-1275 (ID 002840), miR-638 (ID 001582), miR-1915 (ID 121111_mat), and miR-572 (ID 001614) with normalization against RNU6B (ID 001093). .. All reactions were performed in triplicate, and relative expression levels were determined with the ΔC T method and reported as .

    Article Title: Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy
    Article Snippet: QRT-PCR analysis of BAG3 expression Total RNA from primary cardiomyocytes after indicating treatments were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. Then, complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Dalian, China).

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells
    Article Snippet: .. Briefly, total RNA was extracted using RNeasy mini Kit (QIAGEN, Hilden, Germany), and cDNAs were synthesized using Super Script reverse transcriptase III (Invitrogen). qRT-PCR analysis was carried out with Step OneTM Real-Time PCR Systems (Applied Biosystems) using THUNDERBIRD® SYBR qPCR Mix (TOYOBO, Osaka, Japan). .. Relative expression levels to internal control 36B4 are presented.

    Article Title: Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b
    Article Snippet: To detect mature miR-27b expression, miRNA specific cDNA was first synthesized using the stem-loop primers and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). .. Then, qRT-PCR analysis was performed using TaqMan MicroRNA Assay Kit (Applied Biosystems).

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    Multiple Displacement Amplification:

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: Total RNA was isolated from MDA-MB-468 cell using the EZ-10 DNA away RNA- Mini-prep Kit (Bio Basic) according to the manufacturer's instructions. .. 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in .

    Isolation:

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: .. Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: Paragraph title: RNA isolation and reverse transcriptase–real time polymerase chain reaction (qRT-PCR) ... 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in .

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    Sequencing:

    Article Title: Transcriptome-wide analysis of immune-responsive microRNAs against poly (I:C) challenge in Branchiostoma belcheri by deep sequencing and bioinformatics
    Article Snippet: Paragraph title: Validation of miRNA deep sequencing data ... We used TransStart TipGreen qPCR SuperMix (TransGen Biotech, China) to conduct qRT-PCR analysis on an ABI 7300 Real-time PCR system (Applied Biosystems, USA) following reaction conditions suggested by TransGenBiotech.

    Quantitative RT-PCR:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: .. Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. The specificity of amplification was assessed for each sample by melting-curve analysis.

    Article Title: Transcriptome-wide analysis of immune-responsive microRNAs against poly (I:C) challenge in Branchiostoma belcheri by deep sequencing and bioinformatics
    Article Snippet: .. We used TransStart TipGreen qPCR SuperMix (TransGen Biotech, China) to conduct qRT-PCR analysis on an ABI 7300 Real-time PCR system (Applied Biosystems, USA) following reaction conditions suggested by TransGenBiotech. ..

    Article Title: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma
    Article Snippet: .. QRT-PCR analysis of individual miRNAs Selected mature miRNAs were quantified using commercially available TaqMan qRT-PCR assays (Applied Biosystems) and a 7900HT Real-Time PCR System (Applied Biosystems). cDNA was synthesized from 25 ng total RNA using TaqMan mRNA RT Kit (Applied Biosystems) and used for quantification of miR-483-3p (ID 002339), miR-483-5p (ID 002338), miR-497 (ID 001043), miR-195 (ID 000494), miR-1974 (ID 121209_mat), miR-210 (ID 000512), miR-21 (ID 000397), miR-503 (ID 001048), miR-1202 (ID 002858), miR-1275 (ID 002840), miR-638 (ID 001582), miR-1915 (ID 121111_mat), and miR-572 (ID 001614) with normalization against RNU6B (ID 001093). .. All reactions were performed in triplicate, and relative expression levels were determined with the ΔC T method and reported as .

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity
    Article Snippet: .. qRT-PCR Analysis For qRT-PCR analysis, total RNA was extracted with TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s protocol. .. The concentration and quality of total RNA were detected by measuring absorbance at 260 and 280 nm using a NanoDrop 1000 Spectrophotometer (Thermo Scientific).

    Article Title: Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap
    Article Snippet: .. For qRT-PCR analysis, RNA was extracted from snap frozen liver or cells by Trizol (Ambion) followed by purification using the RNeasy Kit (Qiagen). .. One to 5 µg RNA were transcribed to cDNA using the RNA to cDNA EcoDry Premix (Clontech).

    Article Title: Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy
    Article Snippet: .. QRT-PCR analysis of BAG3 expression Total RNA from primary cardiomyocytes after indicating treatments were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. Then, complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Dalian, China).

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: .. Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells
    Article Snippet: .. Briefly, total RNA was extracted using RNeasy mini Kit (QIAGEN, Hilden, Germany), and cDNAs were synthesized using Super Script reverse transcriptase III (Invitrogen). qRT-PCR analysis was carried out with Step OneTM Real-Time PCR Systems (Applied Biosystems) using THUNDERBIRD® SYBR qPCR Mix (TOYOBO, Osaka, Japan). .. Relative expression levels to internal control 36B4 are presented.

    Article Title: Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b
    Article Snippet: .. Then, qRT-PCR analysis was performed using TaqMan MicroRNA Assay Kit (Applied Biosystems). .. All qRT-PCR reactions were performed using an ABI Prism 7500 (Applied Biosystems).

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: .. 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in . .. Gene expression was normalized to GAPDH gene expression and compared to samples from vehicle-treated cells.

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    Article Title: Detection of Zika virus in mouse mammary gland and breast milk
    Article Snippet: .. qRT-PCR analysis of viral burdens Mouse organs were collected in 800 μl RNA later (Ambion) and the tissues were transferred to 1% BMe/RLT buffer. ..

    Article Title: Characterization of Somatic Embryogenesis Receptor-Like Kinase 4 as a Negative Regulator of Leaf Senescence in Arabidopsis
    Article Snippet: .. Further, the qRT-PCR analysis was conducted using an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, USA) with a 20 μL reaction volume including SYBR (TaKaRa) 10 μL, 10 μM forward/reverse primer 0.4 μL, and 100 ng/μL cDNA 0.2 μL. ..

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: .. The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications. .. The TaqMan Gene Expression Assays for Panx1 (assay identification number: Hs00209790_m1), P2X7 (assay identification number: Hs00175721_m1), and GAPDH (assay identification number: Hs02758991_g1) were purchased from Applied Biosystems.

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: .. Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. Amplification of each target DNA was performed with SYBR Green master mix in Bio-Rad ( http://www.bio-rad.com ) Single Color Real-Time PCR Detection System according to the protocols provided.

    Mouse Assay:

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    SYBR Green Assay:

    Article Title: Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap
    Article Snippet: For qRT-PCR analysis, RNA was extracted from snap frozen liver or cells by Trizol (Ambion) followed by purification using the RNeasy Kit (Qiagen). .. IQ SYBR Green Supermix (Biorad) was used for quantitative PCR on the LightCycler480 System (Roche Diagnostics).

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: .. Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: .. 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in . .. Gene expression was normalized to GAPDH gene expression and compared to samples from vehicle-treated cells.

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. Amplification of each target DNA was performed with SYBR Green master mix in Bio-Rad ( http://www.bio-rad.com ) Single Color Real-Time PCR Detection System according to the protocols provided.

    Concentration Assay:

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity
    Article Snippet: qRT-PCR Analysis For qRT-PCR analysis, total RNA was extracted with TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s protocol. .. The concentration and quality of total RNA were detected by measuring absorbance at 260 and 280 nm using a NanoDrop 1000 Spectrophotometer (Thermo Scientific).

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: RNA concentration was determined from A260 . .. The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications.

    Spectrophotometry:

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity
    Article Snippet: qRT-PCR Analysis For qRT-PCR analysis, total RNA was extracted with TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s protocol. .. The concentration and quality of total RNA were detected by measuring absorbance at 260 and 280 nm using a NanoDrop 1000 Spectrophotometer (Thermo Scientific).

    Expressing:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. IRF5 expression was normalized to GAPDH and the relative expression was calculated using the comparative Ct method.

    Article Title: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma
    Article Snippet: QRT-PCR analysis of individual miRNAs Selected mature miRNAs were quantified using commercially available TaqMan qRT-PCR assays (Applied Biosystems) and a 7900HT Real-Time PCR System (Applied Biosystems). cDNA was synthesized from 25 ng total RNA using TaqMan mRNA RT Kit (Applied Biosystems) and used for quantification of miR-483-3p (ID 002339), miR-483-5p (ID 002338), miR-497 (ID 001043), miR-195 (ID 000494), miR-1974 (ID 121209_mat), miR-210 (ID 000512), miR-21 (ID 000397), miR-503 (ID 001048), miR-1202 (ID 002858), miR-1275 (ID 002840), miR-638 (ID 001582), miR-1915 (ID 121111_mat), and miR-572 (ID 001614) with normalization against RNU6B (ID 001093). .. All reactions were performed in triplicate, and relative expression levels were determined with the ΔC T method and reported as .

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity
    Article Snippet: qRT-PCR Analysis For qRT-PCR analysis, total RNA was extracted with TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s protocol. .. Expression levels of target genes were determined quantitatively by an ABI 7500 realtime PCR system (Applied Biosystems) using SYBR® Premix Ex TaqTM II (TaKaRa Code: DRR820A) according to conventional protocols.

    Article Title: Puerarin Attenuates Anoxia/Reoxygenation Injury Through Enhancing Bcl-2 Associated Athanogene 3 Expression, a Modulator of Apoptosis and Autophagy
    Article Snippet: .. QRT-PCR analysis of BAG3 expression Total RNA from primary cardiomyocytes after indicating treatments were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. .. Then, complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit (TaKaRa, Dalian, China).

    Article Title: Vinexin family (SORBS) proteins regulate mechanotransduction in mesenchymal stem cells
    Article Snippet: Briefly, total RNA was extracted using RNeasy mini Kit (QIAGEN, Hilden, Germany), and cDNAs were synthesized using Super Script reverse transcriptase III (Invitrogen). qRT-PCR analysis was carried out with Step OneTM Real-Time PCR Systems (Applied Biosystems) using THUNDERBIRD® SYBR qPCR Mix (TOYOBO, Osaka, Japan). .. Relative expression levels to internal control 36B4 are presented.

    Article Title: Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b
    Article Snippet: To detect mature miR-27b expression, miRNA specific cDNA was first synthesized using the stem-loop primers and the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). .. Then, qRT-PCR analysis was performed using TaqMan MicroRNA Assay Kit (Applied Biosystems).

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in . .. Gene expression was normalized to GAPDH gene expression and compared to samples from vehicle-treated cells.

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: .. For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. For miRNA qRT–PCR, TaqMan MicroRNA Assays (Applied Biosystems) were used to quantify the expression of mature miR-34b-5p (Assay ID: 002617) and miR-34c (Assay ID: 000428).

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications. .. The TaqMan Gene Expression Assays for Panx1 (assay identification number: Hs00209790_m1), P2X7 (assay identification number: Hs00175721_m1), and GAPDH (assay identification number: Hs02758991_g1) were purchased from Applied Biosystems.

    Polymerase Chain Reaction:

    Article Title: miRNA-132-3p inhibits osteoblast differentiation by targeting Ep300 in simulated microgravity
    Article Snippet: qRT-PCR Analysis For qRT-PCR analysis, total RNA was extracted with TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s protocol. .. Expression levels of target genes were determined quantitatively by an ABI 7500 realtime PCR system (Applied Biosystems) using SYBR® Premix Ex TaqTM II (TaKaRa Code: DRR820A) according to conventional protocols.

    Article Title: Targeting polyIC to EGFR over-expressing cells using a dsRNA binding protein domain tethered to EGF
    Article Snippet: Paragraph title: RNA isolation and reverse transcriptase–real time polymerase chain reaction (qRT-PCR) ... 1 μg of total RNA was reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and the resulting cDNA was used for qRT-PCR analysis (Fast SYBR Green; Applied Biosystems) using the primer pairs listed in .

    Article Title: miRNA-34c regulates Notch signaling during bone development
    Article Snippet: For qRT–PCR analysis, total RNA from calvaria of P2 mice was extracted with Trizol and cDNA was synthesized using Superscript III First Strand RT-PCR kit (Invitrogen), and the quantitative real-time PCR was performed on a LightCycler instrument (Roche). β2-microglobulin was used as the internal control to normalize gene expression. .. Amplication and detection were performed using 7500HT Fast Real-Time PCR system (Applied Biosystems) and using the TaqMan® Universal PCR Master Mix, without AmpErase® UNG (Applied Biosystems).

    Article Title: Possible contribution of pannexin-1 to ATP release in human upper airway epithelia
    Article Snippet: The qRT‐PCR analysis was performed with an Applied Biosystems StepOnePlus real‐time PCR system using the TaqMan Fast Advanced Master Mix (Applied Biosystems) for Panx1 mRNA, P2X7 mRNA, and for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH ) mRNA as a housekeeping gene, according to the manufacturer's specifications. .. The mixture was then subjected to PCR amplification with real‐time detection.

    Activated Clotting Time Assay:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. The primers used were as follows: IRF5, forward 5′-GGGCTTCAA TGGGTCAACG-3′ and reverse 5′-GCCTTCGGTGT ATTTCCCTG-3′; Sp1, forward 5′-AGTGTCAGAAGCT CCTGTGGC-3′ and reverse 5′-TGAGG CAGTATTCAAG CCTCC-3′; IFN-α, forward 5′-AGTGTCAGAAGCTC CTGTGGC-3′ and reverse 5′-ACTGGTTGCCATCAA ACTCC-3′; GAPDH, forward 5′-TGG TAT CGT GGA AGG ACT CAT GAC -3′ and reverse 5′-TGC CAG TGA GCT TCC CGT TCAGC-3′.

    Purification:

    Article Title: Autophagy is a gatekeeper of hepatic differentiation and carcinogenesis by controlling the degradation of Yap
    Article Snippet: .. For qRT-PCR analysis, RNA was extracted from snap frozen liver or cells by Trizol (Ambion) followed by purification using the RNeasy Kit (Qiagen). .. One to 5 µg RNA were transcribed to cDNA using the RNA to cDNA EcoDry Premix (Clontech).

    Article Title: Presence and Persistence of Salmonella enterica Serotype Typhimurium in the Phyllosphere and Rhizosphere of Spray-Irrigated Parsley
    Article Snippet: Total bacterial DNA was extracted using ZR soil microbe DNA kit (Zymo Research) according to the manufacturer's instructions in a final volume of 50 μl. qRT-PCR analysis was performed using 2 μl of each isolated DNA sample, 175- and 250-nmol/liter concentrations of forward (ACTCGCGTTCAGACAAACTG) and reverse (CGCTATTCGTTCGGTGTA) primers, respectively, targeting the sirA gene, and 5 μl of ABsolute QPCR SYBR green mix (ABgene) in a 10-μl total reaction volume. .. A three-step protocol was used in a Rotor-Gene 3000 (Corbett Research): (i) denaturation (15 min at 95°C), (ii) an amplification and extension program repeated 50 times (1 s at 95°C, 15 s at 57°C, and 20 s at 72°C), and (iii) a melting-curve program of heating from 72 to 99°C, at a heating rate of 1°C per 5 s. The concentration of experimental samples was calculated from the linear regression of a standard curve, obtained by purified DNA (isolated by the same procedure) from bacterial suspensions at known concentrations (5 × 101 to 5 × 105 CFU/ml).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: IRF5 is elevated in childhood-onset SLE and regulated by histone acetyltransferase and histone deacetylase inhibitors
    Article Snippet: Quantitative real-time PCR assays Total RNA was extracted from A549 or THP-1 cells using TRIzol reagent (Invitrogen) and then reverse transcribed use the PrimeScript RT Master Mix Perfect Real Time kit (Takara). qRT-PCR analysis was conducted by using the Step One Plus Real-Time PCR system (Applied Biosystems) with SYBR Premix Ex Taq (Takara) under the following thermocycling conditions: 95°C for 5 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. .. The primers used were as follows: IRF5, forward 5′-GGGCTTCAA TGGGTCAACG-3′ and reverse 5′-GCCTTCGGTGT ATTTCCCTG-3′; Sp1, forward 5′-AGTGTCAGAAGCT CCTGTGGC-3′ and reverse 5′-TGAGG CAGTATTCAAG CCTCC-3′; IFN-α, forward 5′-AGTGTCAGAAGCTC CTGTGGC-3′ and reverse 5′-ACTGGTTGCCATCAA ACTCC-3′; GAPDH, forward 5′-TGG TAT CGT GGA AGG ACT CAT GAC -3′ and reverse 5′-TGC CAG TGA GCT TCC CGT TCAGC-3′.

    TaqMan microRNA Assay:

    Article Title: Long Non-Coding RNA (LncRNA) Urothelial Carcinoma Associated 1 (UCA1) Increases Multi-Drug Resistance of Gastric Cancer via Downregulating miR-27b
    Article Snippet: .. Then, qRT-PCR analysis was performed using TaqMan MicroRNA Assay Kit (Applied Biosystems). .. All qRT-PCR reactions were performed using an ABI Prism 7500 (Applied Biosystems).

    Software:

    Article Title: A Gene Expression Signature Predicts Survival of Patients with Stage I Non-Small Cell Lung Cancer
    Article Snippet: .. Primers for the QRT-PCR analysis ( ) were designed using Primer Express software version 2.0 (Applied Biosystems [ http://www.appliedbiosystems.com ]). .. Amplification of each target DNA was performed with SYBR Green master mix in Bio-Rad ( http://www.bio-rad.com ) Single Color Real-Time PCR Detection System according to the protocols provided.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher quantitative real time rt pcr qrt pcr analysis
    Validation of hub genes. Notes: ( A ) Survival analysis indicated that ITLN1 was a positive prognosis factor in epithelial ovarian cancer, while patients with a higher expression of ITLN1 had significantly longer overall survival compared to those with higher expression ( P =2.593e–02). ( B ) ITLN1 validation using <t>qRT-PCR</t> analysis. ( C, D ) Validation of ITLN1 expression from the GEO databases. Two datasets showed lower expression of ITLN1 in epithelial ovarian cancer tissues compared with normal ovarian tissues ( P
    Quantitative Real Time Rt Pcr Qrt Pcr Analysis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time rt pcr qrt pcr analysis/product/Thermo Fisher
    Average 85 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    quantitative real time rt pcr qrt pcr analysis - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    77
    Thermo Fisher qrt pcr single stranded cdna
    Effects of HWB treatment on the expression of flavonoid biosynthesis-related genes and the occurrence of red lenticel discoloration on mango fruit cv. Shelly. (A) <t>qRT-PCR</t> profile of differentially expressed genes Ugft3, PAL, CFIL and CHSï , which are related to the flavonoid biosynthesis process, naringenin-chalcone synthase activity, and the phenylpropanoid biosynthesis pathway. (B) level of lenticel discoloration of HWB-treated and control fruits, and (C) lenticel discoloration symptoms on mango fruits, cv. Shelly following HWB treatment. qRT-PCR values were normalized to the values obtained in samples from untreated mango fruits at 0 h. Expression data are means of two replicates. Lenticel discoloration was evaluated following 2 weeks of storage at 12°C [ 9 ]. Average values followed by different letters differ significantly at P
    Qrt Pcr Single Stranded Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr single stranded cdna/product/Thermo Fisher
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr single stranded cdna - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    99
    Thermo Fisher qrt pcr analysis
    RIG-I binds U1 snRNA accumulated in the cytoplasm to mediate radiation-induced IFN-beta response A. RIG-I binds diverse non-coding RNA molecules, majority of which are snRNAs. Graphic representation indicating the distribution of non-coding and repetitive RNA molecules bound to RIG-I following exposure to IR as compared to total irradiated cellular RNA. Transcripts were mapped to reference genomes using RepeatMasker. See Methods for further details. B. <t>qRT-PCR</t> quantification of U1 RNA from purified RNA bound to ectopically expressing WT and K858A-K861A mutant RIG-I HEK293 cells exposed to IR (6 Gy) or left untreated. Cells were UV crosslinked at 150mJ/cm 2 48 hours post-IR treatment prior to cell lysis. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. C. U1 RNA levels quantified by qRT-PCR from total cellular and RIG-I pulldowns in RIG-I overexpressing HEK293 and HCT116 cells. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. Time course of cytosolic accumulation of U1 RNA measured by qRT-PCR from purified total cellular RNA following cellular fractionation of nuclear/mitochondrial and cytoplasmic fractions of HEK293 D. and HCT116 cells E. exposed to IR (6 Gy) or left untreated. F. The structure of the U1 snRNA illustrating the four stem loop (SL) regions. G. Relative IFN-beta luciferase reporter activity of HEK293 cells following a 24 hour stimulation with synthetic oligonucleotides corresponding to U1 RNA stem loop (SL) regions I to IV or a combination of SL I + II and SL II + III. H. IFN-b levels in culture supernatant from ICR RIG-I +/+ and RIG-I −/− primary MEFs 24 hours post-stimulation with the same set of synthetic U1 oligonucleotides used in G. The amount of U1 synthetic oligonucleotides used in all stimulation experiments was 1μg. P values were determined using unpaired Student's t -test. Error bars are SEM. *** P
    Qrt Pcr Analysis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 818 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/Thermo Fisher
    Average 99 stars, based on 818 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantitative real time pcr qrt pcr analysis total rna
    Expression pattern of steroidal saponin biosynthesis pathway genes in different tissues. <t>qRT-PCR</t> analysis was performed using elongation factor 1 alpha (EF1α) as reference gene for normalization. X-axis represents tissues and Y-axis is the relative fold change in gene expression by considering rhizome as control tissue.
    Quantitative Real Time Pcr Qrt Pcr Analysis Total Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr analysis total rna/product/Thermo Fisher
    Average 99 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr analysis total rna - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Validation of hub genes. Notes: ( A ) Survival analysis indicated that ITLN1 was a positive prognosis factor in epithelial ovarian cancer, while patients with a higher expression of ITLN1 had significantly longer overall survival compared to those with higher expression ( P =2.593e–02). ( B ) ITLN1 validation using qRT-PCR analysis. ( C, D ) Validation of ITLN1 expression from the GEO databases. Two datasets showed lower expression of ITLN1 in epithelial ovarian cancer tissues compared with normal ovarian tissues ( P

    Journal: Cancer Management and Research

    Article Title: ITLNI identified by comprehensive bioinformatic analysis as a hub candidate biological target in human epithelial ovarian cancer

    doi: 10.2147/CMAR.S189784

    Figure Lengend Snippet: Validation of hub genes. Notes: ( A ) Survival analysis indicated that ITLN1 was a positive prognosis factor in epithelial ovarian cancer, while patients with a higher expression of ITLN1 had significantly longer overall survival compared to those with higher expression ( P =2.593e–02). ( B ) ITLN1 validation using qRT-PCR analysis. ( C, D ) Validation of ITLN1 expression from the GEO databases. Two datasets showed lower expression of ITLN1 in epithelial ovarian cancer tissues compared with normal ovarian tissues ( P

    Article Snippet: Quantitative real-time RT-PCR (qRT-PCR) analysis We extracted total RNA from tissue samples using TRizol reagent (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Expressing, Quantitative RT-PCR

    Effects of HWB treatment on the expression of flavonoid biosynthesis-related genes and the occurrence of red lenticel discoloration on mango fruit cv. Shelly. (A) qRT-PCR profile of differentially expressed genes Ugft3, PAL, CFIL and CHSï , which are related to the flavonoid biosynthesis process, naringenin-chalcone synthase activity, and the phenylpropanoid biosynthesis pathway. (B) level of lenticel discoloration of HWB-treated and control fruits, and (C) lenticel discoloration symptoms on mango fruits, cv. Shelly following HWB treatment. qRT-PCR values were normalized to the values obtained in samples from untreated mango fruits at 0 h. Expression data are means of two replicates. Lenticel discoloration was evaluated following 2 weeks of storage at 12°C [ 9 ]. Average values followed by different letters differ significantly at P

    Journal: BMC Genomics

    Article Title: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

    doi: 10.1186/1471-2164-15-957

    Figure Lengend Snippet: Effects of HWB treatment on the expression of flavonoid biosynthesis-related genes and the occurrence of red lenticel discoloration on mango fruit cv. Shelly. (A) qRT-PCR profile of differentially expressed genes Ugft3, PAL, CFIL and CHSï , which are related to the flavonoid biosynthesis process, naringenin-chalcone synthase activity, and the phenylpropanoid biosynthesis pathway. (B) level of lenticel discoloration of HWB-treated and control fruits, and (C) lenticel discoloration symptoms on mango fruits, cv. Shelly following HWB treatment. qRT-PCR values were normalized to the values obtained in samples from untreated mango fruits at 0 h. Expression data are means of two replicates. Lenticel discoloration was evaluated following 2 weeks of storage at 12°C [ 9 ]. Average values followed by different letters differ significantly at P

    Article Snippet: Analysis by qRT-PCR Single-stranded cDNA was synthesized from 1 μg of total RNA by means of the Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Expressing, Quantitative RT-PCR, Activity Assay

    Shelly. Effect of HWB on differential expression of chlorophyll and anthocyanin accumulation-related genes and color development in mango cv. Shelly. (A, B) qRT-PCR gene-expression profiles of genes related to (A) chlorophyll accumulation ( Thl1ch , LHCIIb, Oxepch and PIRC ) and (B) anthocyanin synthesis ( 85A2 and Anthocyanin5 ). The expression profile comprises data taken from samples of mango tissues sampled from cv. Shelly at four different time points after HWB treatment. (C) Changes in color index after 16 days of storage at 12°C followed by 8 days at 20°C. Vertical bars indicate SD of five replicates. qRT-PCR values were normalized to the values obtained with untreated mango fruit samples at 0 h. Expression data are the means of two replicates.

    Journal: BMC Genomics

    Article Title: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

    doi: 10.1186/1471-2164-15-957

    Figure Lengend Snippet: Shelly. Effect of HWB on differential expression of chlorophyll and anthocyanin accumulation-related genes and color development in mango cv. Shelly. (A, B) qRT-PCR gene-expression profiles of genes related to (A) chlorophyll accumulation ( Thl1ch , LHCIIb, Oxepch and PIRC ) and (B) anthocyanin synthesis ( 85A2 and Anthocyanin5 ). The expression profile comprises data taken from samples of mango tissues sampled from cv. Shelly at four different time points after HWB treatment. (C) Changes in color index after 16 days of storage at 12°C followed by 8 days at 20°C. Vertical bars indicate SD of five replicates. qRT-PCR values were normalized to the values obtained with untreated mango fruit samples at 0 h. Expression data are the means of two replicates.

    Article Snippet: Analysis by qRT-PCR Single-stranded cDNA was synthesized from 1 μg of total RNA by means of the Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Expressing, Quantitative RT-PCR

    Validation of RNA-seq results by means of qRT-PCR. Ten differentially expressed genes (two from each of clusters 1 to 5) were examined by RNA-seq and qRT-PCR at four different time points after HWB treatment: A , B (cluster 1); C , D (cluster 2); E , F (cluster 3); G , H (cluster 4); and I , J (cluster 5). Values were normalized to the values obtained with untreated mango fruit samples at 0 h and the proportional fold-change (FC) was calculated. Expression data are means of two replicates.

    Journal: BMC Genomics

    Article Title: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

    doi: 10.1186/1471-2164-15-957

    Figure Lengend Snippet: Validation of RNA-seq results by means of qRT-PCR. Ten differentially expressed genes (two from each of clusters 1 to 5) were examined by RNA-seq and qRT-PCR at four different time points after HWB treatment: A , B (cluster 1); C , D (cluster 2); E , F (cluster 3); G , H (cluster 4); and I , J (cluster 5). Values were normalized to the values obtained with untreated mango fruit samples at 0 h and the proportional fold-change (FC) was calculated. Expression data are means of two replicates.

    Article Snippet: Analysis by qRT-PCR Single-stranded cDNA was synthesized from 1 μg of total RNA by means of the Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: RNA Sequencing Assay, Quantitative RT-PCR, Expressing

    Differential expressions of genes modulating the mechanism of resistance to A. alternata in naturally infected mango fruits. (A) Effect of HWB on alternaria black spot (ABS) symptom development on mango cvs. Palmer, Kent, Tommy Atkins, Keitt, Lily and Shelly. (B) ABS symptom development on naturally infected fruits cv. Keitt following HWB treatment. (C) qRT-PCR differential expression profiling of genes Syn121 , glutardoxin , IT1K2 and AOS of cv. Shelly. Fruit peel tissues were sampled at four different time points after HWB treatment. RNA was extracted and served as a template for cDNA followed by qRT-PCR analysis of the genes of interest. Proportional increases in relative expression values were normalized against the samples of untreated mango fruits at 0 h. Expression data are means of two replicates. ABS-covered area was evaluated after 4 weeks of storage at 12°C. Average values followed by different letters differ significantly at P

    Journal: BMC Genomics

    Article Title: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

    doi: 10.1186/1471-2164-15-957

    Figure Lengend Snippet: Differential expressions of genes modulating the mechanism of resistance to A. alternata in naturally infected mango fruits. (A) Effect of HWB on alternaria black spot (ABS) symptom development on mango cvs. Palmer, Kent, Tommy Atkins, Keitt, Lily and Shelly. (B) ABS symptom development on naturally infected fruits cv. Keitt following HWB treatment. (C) qRT-PCR differential expression profiling of genes Syn121 , glutardoxin , IT1K2 and AOS of cv. Shelly. Fruit peel tissues were sampled at four different time points after HWB treatment. RNA was extracted and served as a template for cDNA followed by qRT-PCR analysis of the genes of interest. Proportional increases in relative expression values were normalized against the samples of untreated mango fruits at 0 h. Expression data are means of two replicates. ABS-covered area was evaluated after 4 weeks of storage at 12°C. Average values followed by different letters differ significantly at P

    Article Snippet: Analysis by qRT-PCR Single-stranded cDNA was synthesized from 1 μg of total RNA by means of the Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Infection, Quantitative RT-PCR, Expressing

    RIG-I binds U1 snRNA accumulated in the cytoplasm to mediate radiation-induced IFN-beta response A. RIG-I binds diverse non-coding RNA molecules, majority of which are snRNAs. Graphic representation indicating the distribution of non-coding and repetitive RNA molecules bound to RIG-I following exposure to IR as compared to total irradiated cellular RNA. Transcripts were mapped to reference genomes using RepeatMasker. See Methods for further details. B. qRT-PCR quantification of U1 RNA from purified RNA bound to ectopically expressing WT and K858A-K861A mutant RIG-I HEK293 cells exposed to IR (6 Gy) or left untreated. Cells were UV crosslinked at 150mJ/cm 2 48 hours post-IR treatment prior to cell lysis. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. C. U1 RNA levels quantified by qRT-PCR from total cellular and RIG-I pulldowns in RIG-I overexpressing HEK293 and HCT116 cells. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. Time course of cytosolic accumulation of U1 RNA measured by qRT-PCR from purified total cellular RNA following cellular fractionation of nuclear/mitochondrial and cytoplasmic fractions of HEK293 D. and HCT116 cells E. exposed to IR (6 Gy) or left untreated. F. The structure of the U1 snRNA illustrating the four stem loop (SL) regions. G. Relative IFN-beta luciferase reporter activity of HEK293 cells following a 24 hour stimulation with synthetic oligonucleotides corresponding to U1 RNA stem loop (SL) regions I to IV or a combination of SL I + II and SL II + III. H. IFN-b levels in culture supernatant from ICR RIG-I +/+ and RIG-I −/− primary MEFs 24 hours post-stimulation with the same set of synthetic U1 oligonucleotides used in G. The amount of U1 synthetic oligonucleotides used in all stimulation experiments was 1μg. P values were determined using unpaired Student's t -test. Error bars are SEM. *** P

    Journal: Oncotarget

    Article Title: Cancer therapies activate RIG-I-like receptor pathway through endogenous non-coding RNAs

    doi: 10.18632/oncotarget.8420

    Figure Lengend Snippet: RIG-I binds U1 snRNA accumulated in the cytoplasm to mediate radiation-induced IFN-beta response A. RIG-I binds diverse non-coding RNA molecules, majority of which are snRNAs. Graphic representation indicating the distribution of non-coding and repetitive RNA molecules bound to RIG-I following exposure to IR as compared to total irradiated cellular RNA. Transcripts were mapped to reference genomes using RepeatMasker. See Methods for further details. B. qRT-PCR quantification of U1 RNA from purified RNA bound to ectopically expressing WT and K858A-K861A mutant RIG-I HEK293 cells exposed to IR (6 Gy) or left untreated. Cells were UV crosslinked at 150mJ/cm 2 48 hours post-IR treatment prior to cell lysis. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. C. U1 RNA levels quantified by qRT-PCR from total cellular and RIG-I pulldowns in RIG-I overexpressing HEK293 and HCT116 cells. U1 RNA levels were normalized to the geometric average of 3 housekeeping genes (18S rDNA, GAPDH, and β-actin). Fold change was determined relative to un-irradiated controls. Time course of cytosolic accumulation of U1 RNA measured by qRT-PCR from purified total cellular RNA following cellular fractionation of nuclear/mitochondrial and cytoplasmic fractions of HEK293 D. and HCT116 cells E. exposed to IR (6 Gy) or left untreated. F. The structure of the U1 snRNA illustrating the four stem loop (SL) regions. G. Relative IFN-beta luciferase reporter activity of HEK293 cells following a 24 hour stimulation with synthetic oligonucleotides corresponding to U1 RNA stem loop (SL) regions I to IV or a combination of SL I + II and SL II + III. H. IFN-b levels in culture supernatant from ICR RIG-I +/+ and RIG-I −/− primary MEFs 24 hours post-stimulation with the same set of synthetic U1 oligonucleotides used in G. The amount of U1 synthetic oligonucleotides used in all stimulation experiments was 1μg. P values were determined using unpaired Student's t -test. Error bars are SEM. *** P

    Article Snippet: qRT-PCR analysis 1 μg total RNA was subjected to DNase I treatment in a 30 μL reaction volume using DNase I, RNase-free (Thermo Scientific) following the manufacturer's protocol. cDNA was synthesized from 10 μL of the DNase treated RNA using the High-Capacity cDNA Reverse Transcription Kit (LifeTechnologies) following the manufacturer's protocol.

    Techniques: Irradiation, Quantitative RT-PCR, Purification, Expressing, Mutagenesis, Lysis, Cell Fractionation, Luciferase, Activity Assay

    MAVS is necessary for ionizing radiation-induced Type I interferon signaling A. Proposed mechanism of MAVS-dependent activation of Type I IFN signaling in the cellular response to IR. B. Transcriptional profiling of C57BL/6 wild-type (WT) and MAVS −/− primary MEFs demonstrating MAVS-dependent expression of Type I IFN-stimulated genes (ISGs) 48 hours following exposure to IR (6 Gy). Heatmap displays differences in gene expression values between WT and MAVS −/− MEFs; red indicates high expression and blue low expression. Inset shows qRT-PCR validation of Usp18 , Ifit3 , Stat1 , Ddx58 , and Cdkn1a gene expression values in WT and MAVS −/− MEFs after IR treatment. C. Top-ranked cellular pathways (top) and functions (bottom) (Ingenuity Pathway Analysis) activated by IR in WT MEFs. Pie-chart displays the relative abundance of each functional category among all significant functions ( P

    Journal: Oncotarget

    Article Title: Cancer therapies activate RIG-I-like receptor pathway through endogenous non-coding RNAs

    doi: 10.18632/oncotarget.8420

    Figure Lengend Snippet: MAVS is necessary for ionizing radiation-induced Type I interferon signaling A. Proposed mechanism of MAVS-dependent activation of Type I IFN signaling in the cellular response to IR. B. Transcriptional profiling of C57BL/6 wild-type (WT) and MAVS −/− primary MEFs demonstrating MAVS-dependent expression of Type I IFN-stimulated genes (ISGs) 48 hours following exposure to IR (6 Gy). Heatmap displays differences in gene expression values between WT and MAVS −/− MEFs; red indicates high expression and blue low expression. Inset shows qRT-PCR validation of Usp18 , Ifit3 , Stat1 , Ddx58 , and Cdkn1a gene expression values in WT and MAVS −/− MEFs after IR treatment. C. Top-ranked cellular pathways (top) and functions (bottom) (Ingenuity Pathway Analysis) activated by IR in WT MEFs. Pie-chart displays the relative abundance of each functional category among all significant functions ( P

    Article Snippet: qRT-PCR analysis 1 μg total RNA was subjected to DNase I treatment in a 30 μL reaction volume using DNase I, RNase-free (Thermo Scientific) following the manufacturer's protocol. cDNA was synthesized from 10 μL of the DNase treated RNA using the High-Capacity cDNA Reverse Transcription Kit (LifeTechnologies) following the manufacturer's protocol.

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR, Functional Assay

    Expression pattern of steroidal saponin biosynthesis pathway genes in different tissues. qRT-PCR analysis was performed using elongation factor 1 alpha (EF1α) as reference gene for normalization. X-axis represents tissues and Y-axis is the relative fold change in gene expression by considering rhizome as control tissue.

    Journal: Scientific Reports

    Article Title: Spatial transcriptome analysis provides insights of key gene(s) involved in steroidal saponin biosynthesis in medicinally important herb Trillium govanianum

    doi: 10.1038/srep45295

    Figure Lengend Snippet: Expression pattern of steroidal saponin biosynthesis pathway genes in different tissues. qRT-PCR analysis was performed using elongation factor 1 alpha (EF1α) as reference gene for normalization. X-axis represents tissues and Y-axis is the relative fold change in gene expression by considering rhizome as control tissue.

    Article Snippet: Quantitative Real time PCR (qRT-PCR) analysis Total RNA was given DNase I (ThermoScientific, Lithuania ) treatment to remove DNA contamination.

    Techniques: Expressing, Quantitative RT-PCR