Structured Review

TaKaRa qrt pcr analysis
<t>qRT-PCR</t> analysis of secondary cell wall-associated gene expression in PdRanBP -OE, PdRanBP -DR and WT seedlings. Total RNA was isolated from three biological replicates of the wild-type (WT), PdRanBP -OE and PdRanBP -DR plants. The expression of trans-cinnamate 4-hydroxylase 1 ( PtrC4H1 ), cinnamyl alcohol dehydrogenase 10 ( PtrCAD10 ), caffeoyl CoA 3-O-methyltransferase 1 ( PtrCCoAOMT1 ), glycosyltransferase 8 ( PtrGT8 ), cinnamoyl coenzyme A reductase 7 ( PtrCCR7 ), sucrose synthase 1 ( PtrSuS1 ), beta-tubulin 7 ( PtrTUB7 ), fragile fibre 1 ( PtrFRA1 ), and two myeloblastosis (MYB) genes ( PtrMYB90 , PtrMYB18 ) were examined. TUA1 ( a ) and UBQ1 ( b ) were used as reference genes, and the expression level of each gene in the WT background was set to 1. The data are the mean ± standard errors (SE). The asterisks indicate significant differences from WT (* P
Qrt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 86 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qrt pcr analysis/product/TaKaRa
Average 99 stars, based on 86 article reviews
Price from $9.99 to $1999.99
qrt pcr analysis - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar"

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar

Journal: BMC Genetics

doi: 10.1186/s12863-016-0403-4

qRT-PCR analysis of secondary cell wall-associated gene expression in PdRanBP -OE, PdRanBP -DR and WT seedlings. Total RNA was isolated from three biological replicates of the wild-type (WT), PdRanBP -OE and PdRanBP -DR plants. The expression of trans-cinnamate 4-hydroxylase 1 ( PtrC4H1 ), cinnamyl alcohol dehydrogenase 10 ( PtrCAD10 ), caffeoyl CoA 3-O-methyltransferase 1 ( PtrCCoAOMT1 ), glycosyltransferase 8 ( PtrGT8 ), cinnamoyl coenzyme A reductase 7 ( PtrCCR7 ), sucrose synthase 1 ( PtrSuS1 ), beta-tubulin 7 ( PtrTUB7 ), fragile fibre 1 ( PtrFRA1 ), and two myeloblastosis (MYB) genes ( PtrMYB90 , PtrMYB18 ) were examined. TUA1 ( a ) and UBQ1 ( b ) were used as reference genes, and the expression level of each gene in the WT background was set to 1. The data are the mean ± standard errors (SE). The asterisks indicate significant differences from WT (* P
Figure Legend Snippet: qRT-PCR analysis of secondary cell wall-associated gene expression in PdRanBP -OE, PdRanBP -DR and WT seedlings. Total RNA was isolated from three biological replicates of the wild-type (WT), PdRanBP -OE and PdRanBP -DR plants. The expression of trans-cinnamate 4-hydroxylase 1 ( PtrC4H1 ), cinnamyl alcohol dehydrogenase 10 ( PtrCAD10 ), caffeoyl CoA 3-O-methyltransferase 1 ( PtrCCoAOMT1 ), glycosyltransferase 8 ( PtrGT8 ), cinnamoyl coenzyme A reductase 7 ( PtrCCR7 ), sucrose synthase 1 ( PtrSuS1 ), beta-tubulin 7 ( PtrTUB7 ), fragile fibre 1 ( PtrFRA1 ), and two myeloblastosis (MYB) genes ( PtrMYB90 , PtrMYB18 ) were examined. TUA1 ( a ) and UBQ1 ( b ) were used as reference genes, and the expression level of each gene in the WT background was set to 1. The data are the mean ± standard errors (SE). The asterisks indicate significant differences from WT (* P

Techniques Used: Quantitative RT-PCR, Expressing, Isolation

qRT-PCR analysis of the expression of PdRanBP in different vascular tissues and organs of P. deltoides , and detection of immediate and stable expression of GFP -tagged PdRanBP . a , b qRT-PCR analysis of PdRanBP expression in the vascular tissues and other organs of P. deltoides during secondary cell wall development. Aliquots of 1000 ng total RNA were reverse-transcribed into cDNA. The signals were normalized to the constitutively expressed poplar α-tubulin ( TUA1 ) ( a ) and Ubiquitin ( UBQ1 ) ( b ) genes. The values are the mean ± standard error (SE) of three replicates. PdRanBP was predominantly expressed in the leaf buds, immature xylem and immature phloem of P. deltoides . c Nuclear localization of EGFP-PdRanBP fusion protein in onion epidermal cells. Dark-field images were captured for green fluorescence ( e and f ), GFP-only control (g) and the corresponding bright-field images for e , f, g are a, b, c . Bright-field images ( h ) were captured for cell morphology, and the corresponding dark-field images for h is d . i and j , Nuclei counterstained with 4′, 6-diamidino-2-phenylindole (DAPI); the corresponding GFP-only control images of i and j are shown in k . The scale bars are 200 μm in a , c, d, e, g, h, i and k , and 800 μm in b, f , and j
Figure Legend Snippet: qRT-PCR analysis of the expression of PdRanBP in different vascular tissues and organs of P. deltoides , and detection of immediate and stable expression of GFP -tagged PdRanBP . a , b qRT-PCR analysis of PdRanBP expression in the vascular tissues and other organs of P. deltoides during secondary cell wall development. Aliquots of 1000 ng total RNA were reverse-transcribed into cDNA. The signals were normalized to the constitutively expressed poplar α-tubulin ( TUA1 ) ( a ) and Ubiquitin ( UBQ1 ) ( b ) genes. The values are the mean ± standard error (SE) of three replicates. PdRanBP was predominantly expressed in the leaf buds, immature xylem and immature phloem of P. deltoides . c Nuclear localization of EGFP-PdRanBP fusion protein in onion epidermal cells. Dark-field images were captured for green fluorescence ( e and f ), GFP-only control (g) and the corresponding bright-field images for e , f, g are a, b, c . Bright-field images ( h ) were captured for cell morphology, and the corresponding dark-field images for h is d . i and j , Nuclei counterstained with 4′, 6-diamidino-2-phenylindole (DAPI); the corresponding GFP-only control images of i and j are shown in k . The scale bars are 200 μm in a , c, d, e, g, h, i and k , and 800 μm in b, f , and j

Techniques Used: Quantitative RT-PCR, Expressing, Fluorescence

Overexpression of PdRanBP stunted growth and induced sylleptic branches; PdRanBP downregulation produced taller plants with thicker stems. a , b qRT-PCR analysis confirming PdRanBP overexpression in the transgenic poplar lines G9 and G15. TUA1 ( a ) and UBQ1 ( b ) were used as control genes. The error bars represent the standard error (SE) of three replicates. WT: wild poplar; G9, G10 and G15: transgenic poplar lines overexpressing PdRanBP (OE); GA106, GA515, GA516 and GA521: transgenic poplar lines in which PdRanBP is downregulated (DR). The asterisks indicate significant differences between the transgenic lines and WT (* P
Figure Legend Snippet: Overexpression of PdRanBP stunted growth and induced sylleptic branches; PdRanBP downregulation produced taller plants with thicker stems. a , b qRT-PCR analysis confirming PdRanBP overexpression in the transgenic poplar lines G9 and G15. TUA1 ( a ) and UBQ1 ( b ) were used as control genes. The error bars represent the standard error (SE) of three replicates. WT: wild poplar; G9, G10 and G15: transgenic poplar lines overexpressing PdRanBP (OE); GA106, GA515, GA516 and GA521: transgenic poplar lines in which PdRanBP is downregulated (DR). The asterisks indicate significant differences between the transgenic lines and WT (* P

Techniques Used: Over Expression, Produced, Quantitative RT-PCR, Transgenic Assay

2) Product Images from "Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis"

Article Title: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis

Journal: BMC Genomics

doi: 10.1186/1471-2164-15-146

Relative expression analysis of miRNAs in the flower buds of the A line and B line by high-throughput sequencing and qRT-PCR analysis. Relative expression level was normalized to the expression level of 5.8SrRNA in qRT-PCR. All qRT-PCR reactions were prepared in triplicate for each sample. Left indicates the miRNA relative expression level generated from the high-throughput sequencing. Right indicates the miRNA relative expression level obtained by using qRT-PCR analysis.
Figure Legend Snippet: Relative expression analysis of miRNAs in the flower buds of the A line and B line by high-throughput sequencing and qRT-PCR analysis. Relative expression level was normalized to the expression level of 5.8SrRNA in qRT-PCR. All qRT-PCR reactions were prepared in triplicate for each sample. Left indicates the miRNA relative expression level generated from the high-throughput sequencing. Right indicates the miRNA relative expression level obtained by using qRT-PCR analysis.

Techniques Used: Expressing, Next-Generation Sequencing, Quantitative RT-PCR, Generated

3) Product Images from "Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck"

Article Title: Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck

Journal: PLoS ONE

doi: 10.1371/journal.pone.0086150

Validation of miRNA expression by qRT-PCR.
Figure Legend Snippet: Validation of miRNA expression by qRT-PCR.

Techniques Used: Expressing, Quantitative RT-PCR

4) Product Images from "Tomato Sl3-MMP, a member of the Matrix metalloproteinase family, is required for disease resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000"

Article Title: Tomato Sl3-MMP, a member of the Matrix metalloproteinase family, is required for disease resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000

Journal: BMC Plant Biology

doi: 10.1186/s12870-015-0536-z

Transient expression of Sl3-MMP in N. benthamiana conferred an increased resistance to B. cinerea . a Expression of Sl3-MMP . Agrobacteria carrying pFGC-Sl3-MMP or pFGC-eGFP were infiltrated into leaves of N. benthamiana and expression of Sl3-MMP was analyzed by qRT-PCR. Relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after infiltration. b Immunoblot analysis of Sl3-MMP-GFP fusion proteins in N. benthamiana leaves at 48 h after agroinfiltration. A GFP-specific antibody was used for detection of GFP-fusion protein. Equal loading of total proteins was examined by Ponceau staining. c and d Disease symptom and lesion size. e Expression of defense-related genes. Opposite part of the leaves infiltrated with Sl3-MMP - GFP or pFGC-eGFP was inoculated by dropping spore suspension (2 × 10 5 spores/mL) of B. cinerea and lesion sizes were measured at 5 days after inoculation. Data presented in d are the means ± SD from a minimum of 60 lesions. Data presented in a and e are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p
Figure Legend Snippet: Transient expression of Sl3-MMP in N. benthamiana conferred an increased resistance to B. cinerea . a Expression of Sl3-MMP . Agrobacteria carrying pFGC-Sl3-MMP or pFGC-eGFP were infiltrated into leaves of N. benthamiana and expression of Sl3-MMP was analyzed by qRT-PCR. Relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after infiltration. b Immunoblot analysis of Sl3-MMP-GFP fusion proteins in N. benthamiana leaves at 48 h after agroinfiltration. A GFP-specific antibody was used for detection of GFP-fusion protein. Equal loading of total proteins was examined by Ponceau staining. c and d Disease symptom and lesion size. e Expression of defense-related genes. Opposite part of the leaves infiltrated with Sl3-MMP - GFP or pFGC-eGFP was inoculated by dropping spore suspension (2 × 10 5 spores/mL) of B. cinerea and lesion sizes were measured at 5 days after inoculation. Data presented in d are the means ± SD from a minimum of 60 lesions. Data presented in a and e are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p

Techniques Used: Expressing, Quantitative RT-PCR, Staining

Silencing of Sl3-MMP resulted in reduced resistance to B. cinerea . Two-week-old seedlings were infiltrated with agrobacteria carrying pTRV2-Sl-MMP or pTRV2-GUS and were inoculated at 4 weeks after VIGS infiltration by dropping spore suspension (1 × 10 5 spores/mL) on detached leaves or foliar spraying with spore suspension (2 × 10 5 spores/mL) onto leaves of whole plants. a and b Disease phenotype and lesion sizes in leaves of the pTRV2-Sl-MMPs- and pTRV2-GUS-infiltrated plants in detached leaf inoculation assays. Lesion sizes were measured at 3 days after inoculation on a minimum of 20 leaves in each experiment. c and d Disease phenotype on and fungal growth in the pTRV2-Sl3-MMP- and pTRV2-GUS-infiltrated plants in whole plant inoculation assays. Fungal growth in planta was estimated by analyzing the transcript levels of BcActin gene by qRT-PCR using SlActin as an internal control at the indicated time points after inoculation. Data presented in b and d are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p
Figure Legend Snippet: Silencing of Sl3-MMP resulted in reduced resistance to B. cinerea . Two-week-old seedlings were infiltrated with agrobacteria carrying pTRV2-Sl-MMP or pTRV2-GUS and were inoculated at 4 weeks after VIGS infiltration by dropping spore suspension (1 × 10 5 spores/mL) on detached leaves or foliar spraying with spore suspension (2 × 10 5 spores/mL) onto leaves of whole plants. a and b Disease phenotype and lesion sizes in leaves of the pTRV2-Sl-MMPs- and pTRV2-GUS-infiltrated plants in detached leaf inoculation assays. Lesion sizes were measured at 3 days after inoculation on a minimum of 20 leaves in each experiment. c and d Disease phenotype on and fungal growth in the pTRV2-Sl3-MMP- and pTRV2-GUS-infiltrated plants in whole plant inoculation assays. Fungal growth in planta was estimated by analyzing the transcript levels of BcActin gene by qRT-PCR using SlActin as an internal control at the indicated time points after inoculation. Data presented in b and d are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p

Techniques Used: Quantitative RT-PCR

Expression patterns of Sl-MMPs in response to B. cinerea or P. syringae pv. tomato DC3000 treatment. Tomato plants were inoculated by spore suspension (2 × 10 5 spores/ml) of B. cinerea or buffer solution as a mock-inoculation control ( a ) and by vacuum infiltration with P. syringae pv. tomato DC3000 (OD 600 = 0.0002) or sterilized 10 mM MgCl 2 solution as a mock-inoculation control ( b ). Leaf samples were collected at indicated time points and gene expression was analyzed by qRT-PCR. Relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after inoculation and shown as folds of the actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p
Figure Legend Snippet: Expression patterns of Sl-MMPs in response to B. cinerea or P. syringae pv. tomato DC3000 treatment. Tomato plants were inoculated by spore suspension (2 × 10 5 spores/ml) of B. cinerea or buffer solution as a mock-inoculation control ( a ) and by vacuum infiltration with P. syringae pv. tomato DC3000 (OD 600 = 0.0002) or sterilized 10 mM MgCl 2 solution as a mock-inoculation control ( b ). Leaf samples were collected at indicated time points and gene expression was analyzed by qRT-PCR. Relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after inoculation and shown as folds of the actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p

Techniques Used: Expressing, Quantitative RT-PCR

Silencing efficiency and specificity for target genes in silenced plants. Two-week-old tomato seedlings were infiltrated with agrobacteria carrying pTRV2-Sl-MMPs or pTRV2-GUS and leaf samples were collected at 4 weeks after agroinfiltration. Expression levels of each Sl-MMP genes in targeted and nontargeted Sl-MMP -silenced and non-silenced plants were analyzed by qRT-PCR and data obtained were normalized with actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p
Figure Legend Snippet: Silencing efficiency and specificity for target genes in silenced plants. Two-week-old tomato seedlings were infiltrated with agrobacteria carrying pTRV2-Sl-MMPs or pTRV2-GUS and leaf samples were collected at 4 weeks after agroinfiltration. Expression levels of each Sl-MMP genes in targeted and nontargeted Sl-MMP -silenced and non-silenced plants were analyzed by qRT-PCR and data obtained were normalized with actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p

Techniques Used: Expressing, Quantitative RT-PCR

Expression patterns of Sl-MMPs in response to defense signaling hormones. Tomato plants were treated by foliar spraying of 1 mM SA ( a ), 100 μM MeJA ( b ), 100 μM ACC ( c ) or equal volume of solution as a control and leaf samples were collected at indicated time points. Gene expression was analyzed by qRT-PCR and relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after treatment. Relative expression was shown as folds of the actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p
Figure Legend Snippet: Expression patterns of Sl-MMPs in response to defense signaling hormones. Tomato plants were treated by foliar spraying of 1 mM SA ( a ), 100 μM MeJA ( b ), 100 μM ACC ( c ) or equal volume of solution as a control and leaf samples were collected at indicated time points. Gene expression was analyzed by qRT-PCR and relative expression levels were calculated by comparing with the corresponding values at 0 h (as a control) after treatment. Relative expression was shown as folds of the actin transcript values. Data presented are the means ± SD from three independent experiments and different letters above the columns indicate significant differences at p

Techniques Used: Expressing, Quantitative RT-PCR

5) Product Images from "MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS"

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS

Journal: Technology in Cancer Research & Treatment

doi: 10.1177/1533033818793652

MiR-19b is significantly downregulated in cancer tissues. A, Relative miR-19b expression levels were analyzed by qRT-PCR in 37 pairs of human cancer tissues and adjacent normal tissues. U6 RNA level was used as an internal control. B, The miR-19b expression in 3 different grades of cancer samples. According to the pathological classification, the 37 pairs of human cancer tissues were divided into 3 groups: WHO grade I, grade II, and grade III–IV. Data represent mean (SD) of 3 replicates. **Significant difference at P
Figure Legend Snippet: MiR-19b is significantly downregulated in cancer tissues. A, Relative miR-19b expression levels were analyzed by qRT-PCR in 37 pairs of human cancer tissues and adjacent normal tissues. U6 RNA level was used as an internal control. B, The miR-19b expression in 3 different grades of cancer samples. According to the pathological classification, the 37 pairs of human cancer tissues were divided into 3 groups: WHO grade I, grade II, and grade III–IV. Data represent mean (SD) of 3 replicates. **Significant difference at P

Techniques Used: Expressing, Quantitative RT-PCR

The expression of KRAS was inversely correlated with miR-19b expression in human clinical specimens. A, The expression of KRAS in adjacent normal tissues and human cancer specimens was determined by qRT-PCR analysis, and fold changes were obtained from the ratio of KRAS and GAPDH levels. B, Spearman analysis was conducted between expression of miR-19b and KRAS. Data represent mean (SD) of 3 replicates. **Significant difference at P
Figure Legend Snippet: The expression of KRAS was inversely correlated with miR-19b expression in human clinical specimens. A, The expression of KRAS in adjacent normal tissues and human cancer specimens was determined by qRT-PCR analysis, and fold changes were obtained from the ratio of KRAS and GAPDH levels. B, Spearman analysis was conducted between expression of miR-19b and KRAS. Data represent mean (SD) of 3 replicates. **Significant difference at P

Techniques Used: Expressing, Quantitative RT-PCR

MiR-19b inhibits tumorigenesis in vivo . A, B, Tumor growth assay in nude mice. Representative pictures of xenograft tumors. Bar: 2 mm. Tumor growth curve (A) and average of xenograft tumors (B) between the groups of miR-NC and miR-19b. C, The expression levels of KRAS were analyzed in tumor tissues by qRT-PCR. D, Protein levels of KRAS in xenograft tumors. Data were presented by mean (SD). * P
Figure Legend Snippet: MiR-19b inhibits tumorigenesis in vivo . A, B, Tumor growth assay in nude mice. Representative pictures of xenograft tumors. Bar: 2 mm. Tumor growth curve (A) and average of xenograft tumors (B) between the groups of miR-NC and miR-19b. C, The expression levels of KRAS were analyzed in tumor tissues by qRT-PCR. D, Protein levels of KRAS in xenograft tumors. Data were presented by mean (SD). * P

Techniques Used: In Vivo, Growth Assay, Mouse Assay, Expressing, Quantitative RT-PCR

6) Product Images from "Aryl Hydrocarbon Receptor Promotes IL-10 Expression in Inflammatory Macrophages Through Src-STAT3 Signaling Pathway"

Article Title: Aryl Hydrocarbon Receptor Promotes IL-10 Expression in Inflammatory Macrophages Through Src-STAT3 Signaling Pathway

Journal: Frontiers in Immunology

doi: 10.3389/fimmu.2018.02033

AhR upregulated LPS-induced IL-10 expression through Src pathway in macrophages. (A,B) RAW/NC and RAW/AhR cells were untreated or treated with LPS for 1 h and cell lysates then subjected to western blotting analysis with anti-phosphotyrosine Src and Src antibodies. (B) Densitometric analysis of relative abundances of phospho-Src normalized to total Src. Combined results are compared using one-way ANOVA test ( n = 3; control, P = 0.012; LPS, P = 0.039). (C–F) Cells were pre-treated with two different Src inhibitors (PP2 and dasatinib) for 1 h and then stimulated with or without LPS for the indicated times. (C,D) Whole-cell extracts were immunoblotted with specific antibodies. (E) IL-10 mRNA levels were detected with qRT-PCR. Combined results are compared using one-way ANOVA test ( n = 3; PP2, P = 0.015). (F) IL-10 protein levels were detected with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; PP2, P = 0.003; dasatinib, P = 0.002). (G,H) Cells were transfected with scrambled or Src-specific siRNA and then incubated with or without LPS for 12 h. Whole-cell lysates were subjected to western blotting analysis. Combined results are compared using one-way ANOVA test ( n = 4; siSrc-1, P = 0.003; siSrc-2, P = 0.004). IL-10 levels in the supernatant were determined with ELISA. Combined results are compared using one-way ANOVA test (n = 3; siSrc-1, P = 0.011; siSrc-2, P = 0.011). (I) Peritoneal macrophages isolated from WT or AhR-KO mice were stimulated with or without LPS for 6 h. Whole-cell lysates were subjected to western blot analysis. Western blot images are representative of three independent experiments. Data in all bar graphs are mean ± SEM of three independent experiments. Differences were analyzed with one-way ANOVA. * P
Figure Legend Snippet: AhR upregulated LPS-induced IL-10 expression through Src pathway in macrophages. (A,B) RAW/NC and RAW/AhR cells were untreated or treated with LPS for 1 h and cell lysates then subjected to western blotting analysis with anti-phosphotyrosine Src and Src antibodies. (B) Densitometric analysis of relative abundances of phospho-Src normalized to total Src. Combined results are compared using one-way ANOVA test ( n = 3; control, P = 0.012; LPS, P = 0.039). (C–F) Cells were pre-treated with two different Src inhibitors (PP2 and dasatinib) for 1 h and then stimulated with or without LPS for the indicated times. (C,D) Whole-cell extracts were immunoblotted with specific antibodies. (E) IL-10 mRNA levels were detected with qRT-PCR. Combined results are compared using one-way ANOVA test ( n = 3; PP2, P = 0.015). (F) IL-10 protein levels were detected with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; PP2, P = 0.003; dasatinib, P = 0.002). (G,H) Cells were transfected with scrambled or Src-specific siRNA and then incubated with or without LPS for 12 h. Whole-cell lysates were subjected to western blotting analysis. Combined results are compared using one-way ANOVA test ( n = 4; siSrc-1, P = 0.003; siSrc-2, P = 0.004). IL-10 levels in the supernatant were determined with ELISA. Combined results are compared using one-way ANOVA test (n = 3; siSrc-1, P = 0.011; siSrc-2, P = 0.011). (I) Peritoneal macrophages isolated from WT or AhR-KO mice were stimulated with or without LPS for 6 h. Whole-cell lysates were subjected to western blot analysis. Western blot images are representative of three independent experiments. Data in all bar graphs are mean ± SEM of three independent experiments. Differences were analyzed with one-way ANOVA. * P

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Transfection, Incubation, Isolation, Mouse Assay

Loss of AhR in macrophages reduced IL-10 expression after LPS stimulation. Peritoneal macrophages and BMDMs isolated from WT or AhR-KO mice were stimulated with or without LPS at the indicated time points. (A,B) Whole-cell lysates were subjected to western blotting analysis with anti-AhR antibody. (C,D) IL-10 mRNA levels were detected with qRT-PCR at 4 h after LPS stimulation. The experiment was repeated three times; combined results are compared using one-way ANOVA test (PMs, P
Figure Legend Snippet: Loss of AhR in macrophages reduced IL-10 expression after LPS stimulation. Peritoneal macrophages and BMDMs isolated from WT or AhR-KO mice were stimulated with or without LPS at the indicated time points. (A,B) Whole-cell lysates were subjected to western blotting analysis with anti-AhR antibody. (C,D) IL-10 mRNA levels were detected with qRT-PCR at 4 h after LPS stimulation. The experiment was repeated three times; combined results are compared using one-way ANOVA test (PMs, P

Techniques Used: Expressing, Isolation, Mouse Assay, Western Blot, Quantitative RT-PCR

Maximal IL-10 production was associated with STAT3-activation in LPS-induced AhR-overexpressing macrophages. RAW/NC and RAW/AhR cells were untreated or treated with LPS. (A–C) Cells were stimulated with LPS for 1 h and cell lysates were used for western blotting analysis with anti-phosphotyrosine STAT3, phosphoserine STAT3, STAT3, and AhR antibodies. (B,C) Densitometric analysis of relative abundance of phosphotyrosine-STAT3 and phosphoserine-STAT3 normalized to total STAT3. The experiment was repeated three times; combined results are compared using one-way ANOVA test ( P = 0.020). (D) Cells were pre-treated with IL-10-blocking antibody (1 μg/ml) for 12 h and then stimulated with LPS for 1 h, followed by western blotting of whole-cell extracts. (E,F) Cells were transfected with scrambled or STAT3-specific siRNA and then incubated with or without LPS for 12 h. Whole-cell lysates were subjected to western blotting analysis. Combined results are compared using one-way ANOVA test ( n = 3; siSTAT3-1, P = 0.015; siSTAT3-2, P = 0.039). IL-10 levels in the supernatant were determined with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; siSTAT3-1, P = 0.004; siSTAT3-2, P = 0.009). (G–I) Cells were pre-treated with two different STAT3 inhibitors (cryptotanshinone and BP-1-102) for 1 h and then stimulated with or without LPS for the indicated times. (G) Whole-cell extracts were immunoblotted with anti-phosphotyrosine STAT3 and STAT3 antibodies. (H) IL-10 mRNA levels were detected with qRT-PCR. Combined results are compared using one-way ANOVA test ( n = 3; cryptotanshinone, P = 0.017; BP-1-102, P = 0.010). (I) IL-10 protein levels were detected with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; cryptotanshinone, P = 0.004; BP-1-102, P = 0.002). Western blot images are representative of three independent experiments. Data in all bar graphs are mean ± SEM of three independent experiments. Differences were analyzed with one-way ANOVA. * P
Figure Legend Snippet: Maximal IL-10 production was associated with STAT3-activation in LPS-induced AhR-overexpressing macrophages. RAW/NC and RAW/AhR cells were untreated or treated with LPS. (A–C) Cells were stimulated with LPS for 1 h and cell lysates were used for western blotting analysis with anti-phosphotyrosine STAT3, phosphoserine STAT3, STAT3, and AhR antibodies. (B,C) Densitometric analysis of relative abundance of phosphotyrosine-STAT3 and phosphoserine-STAT3 normalized to total STAT3. The experiment was repeated three times; combined results are compared using one-way ANOVA test ( P = 0.020). (D) Cells were pre-treated with IL-10-blocking antibody (1 μg/ml) for 12 h and then stimulated with LPS for 1 h, followed by western blotting of whole-cell extracts. (E,F) Cells were transfected with scrambled or STAT3-specific siRNA and then incubated with or without LPS for 12 h. Whole-cell lysates were subjected to western blotting analysis. Combined results are compared using one-way ANOVA test ( n = 3; siSTAT3-1, P = 0.015; siSTAT3-2, P = 0.039). IL-10 levels in the supernatant were determined with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; siSTAT3-1, P = 0.004; siSTAT3-2, P = 0.009). (G–I) Cells were pre-treated with two different STAT3 inhibitors (cryptotanshinone and BP-1-102) for 1 h and then stimulated with or without LPS for the indicated times. (G) Whole-cell extracts were immunoblotted with anti-phosphotyrosine STAT3 and STAT3 antibodies. (H) IL-10 mRNA levels were detected with qRT-PCR. Combined results are compared using one-way ANOVA test ( n = 3; cryptotanshinone, P = 0.017; BP-1-102, P = 0.010). (I) IL-10 protein levels were detected with ELISA. Combined results are compared using one-way ANOVA test ( n = 3; cryptotanshinone, P = 0.004; BP-1-102, P = 0.002). Western blot images are representative of three independent experiments. Data in all bar graphs are mean ± SEM of three independent experiments. Differences were analyzed with one-way ANOVA. * P

Techniques Used: Activation Assay, Western Blot, Blocking Assay, Transfection, Incubation, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

AhR was increased in LPS-stimulated macrophages via the NF-κB pathway. (A) Peritoneal macrophages, BMDMs, and spleen macrophages isolated from C57BL/6J mice were treated with or without LPS (10 μg/ml) for 8 h. Then, the cells were lysed and subjected to western blotting analysis of AhR protein expression. (B–E) Peritoneal macrophages were treated with or without LPS (10 μg/ml) for the indicated times. (B) AhR mRNA levels were detected with qRT-PCR. The experiment was repeated three times; combined results are compared using one-way ANOVA test (2 h: control, P
Figure Legend Snippet: AhR was increased in LPS-stimulated macrophages via the NF-κB pathway. (A) Peritoneal macrophages, BMDMs, and spleen macrophages isolated from C57BL/6J mice were treated with or without LPS (10 μg/ml) for 8 h. Then, the cells were lysed and subjected to western blotting analysis of AhR protein expression. (B–E) Peritoneal macrophages were treated with or without LPS (10 μg/ml) for the indicated times. (B) AhR mRNA levels were detected with qRT-PCR. The experiment was repeated three times; combined results are compared using one-way ANOVA test (2 h: control, P

Techniques Used: Isolation, Mouse Assay, Western Blot, Expressing, Quantitative RT-PCR

7) Product Images from "Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells"

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0113262

TSA induces early differentiation of ESCs and promotes mesodermal lineage differentiation. ( A ) Bright-field images, alkaline phosphatase staining of ESCs and representative immunofluorescence images of Oct4 staining in control or TSA-treated ESCs (10 and 20 ng/ml) in the presence of LIF. ( B ) Western blotting verification of H3, acetyl-H3, H4, and acetyl-H4 in control or TSA-treated ESCs (10 and 20 ng/ml). GAPDH was used as a loading control. ( C ) The relative expression levels of Oct4, Nanog, and Rex1 mRNA in control or TSA-treated ESCs (10 and 20 ng/ml). ( D, E ) QRT-PCR analysis for marker genes of three germ layers (endoderm, mesoderm and ectoderm) in control or TSA-treated ESCs (10 and 20 ng/ml), under the monolayer differentiation condition without LIF. The cells were treated by TSA after removing LIF for 24h and collected mRNA for QRT-PCR analysis at day 3 of monolayer differentiation. ( F, G ) QRT-PCR analysis for marker genes of the three germ layers in control or TSA-treated ESCs (10 and 20 ng/ml) during EB differentiation. The EBs was treated by TSA from day 2 to 6 of EB differentiation. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P
Figure Legend Snippet: TSA induces early differentiation of ESCs and promotes mesodermal lineage differentiation. ( A ) Bright-field images, alkaline phosphatase staining of ESCs and representative immunofluorescence images of Oct4 staining in control or TSA-treated ESCs (10 and 20 ng/ml) in the presence of LIF. ( B ) Western blotting verification of H3, acetyl-H3, H4, and acetyl-H4 in control or TSA-treated ESCs (10 and 20 ng/ml). GAPDH was used as a loading control. ( C ) The relative expression levels of Oct4, Nanog, and Rex1 mRNA in control or TSA-treated ESCs (10 and 20 ng/ml). ( D, E ) QRT-PCR analysis for marker genes of three germ layers (endoderm, mesoderm and ectoderm) in control or TSA-treated ESCs (10 and 20 ng/ml), under the monolayer differentiation condition without LIF. The cells were treated by TSA after removing LIF for 24h and collected mRNA for QRT-PCR analysis at day 3 of monolayer differentiation. ( F, G ) QRT-PCR analysis for marker genes of the three germ layers in control or TSA-treated ESCs (10 and 20 ng/ml) during EB differentiation. The EBs was treated by TSA from day 2 to 6 of EB differentiation. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P

Techniques Used: Staining, Immunofluorescence, Western Blot, Expressing, Quantitative RT-PCR, Marker, Two Tailed Test

Loss of HDAC1 or 3 enhances mesodermal lineage differentiation. ( A ) Bright-field images and alkaline phosphatase staining of ESCs in shHDAC1 and shHDAC3 ESCs. ( B ) Western blotting verification and QRT-PCR analysis of the knockdown of HDAC1 and HDAC3 in stable E14 cell lines. GAPDH was used as a loading control. ( C ) QRT-PCR analysis of mesoderm genes in shHDAC1 ESCs and control cells at the days 0, 3, 6, and 10 during EB differentiation. ( D ) QRT-PCR analysis of mesoderm genes in shHDAC3 ESCs and control cells during EB differentiation. ( E ) Representative immunofluorescence images for the GATA4 expression level in control, shHDAC1, and shHDAC3 cells after 9 days of EB formation. Green, Gata4; blue, Hoechst 33342 for nuclei staining. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P
Figure Legend Snippet: Loss of HDAC1 or 3 enhances mesodermal lineage differentiation. ( A ) Bright-field images and alkaline phosphatase staining of ESCs in shHDAC1 and shHDAC3 ESCs. ( B ) Western blotting verification and QRT-PCR analysis of the knockdown of HDAC1 and HDAC3 in stable E14 cell lines. GAPDH was used as a loading control. ( C ) QRT-PCR analysis of mesoderm genes in shHDAC1 ESCs and control cells at the days 0, 3, 6, and 10 during EB differentiation. ( D ) QRT-PCR analysis of mesoderm genes in shHDAC3 ESCs and control cells during EB differentiation. ( E ) Representative immunofluorescence images for the GATA4 expression level in control, shHDAC1, and shHDAC3 cells after 9 days of EB formation. Green, Gata4; blue, Hoechst 33342 for nuclei staining. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P

Techniques Used: Staining, Western Blot, Quantitative RT-PCR, Immunofluorescence, Expressing, Two Tailed Test

The histone deacetylase activity of HDACs is required for the regulation of mesoderm gene. ( A ) Western blotting verification of acetyl-H4 and H4 expression levels in control, HDAC1-OE (H1 OE), and TSA-treated H1-OE cells. GAPDH was used as a loading control. ( B, C ) QRT-PCR analysis of the three germ layer genes at day 6 of EB differentiation in control, H1-OE, and TSA-treated H1-OE cells. ( D ) Western blotting verification of acetyl-H4 and H4 expression levels in control, HDAC3-OE (H1 OE), and TSA-treated H3-OE cells. GAPDH was used as a loading control. ( E, F ) QRT-PCR analysis of the three germ layer genes at day 6 of EB differentiation in control, H3-OE, and TSA-treated H3-OE cells. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P
Figure Legend Snippet: The histone deacetylase activity of HDACs is required for the regulation of mesoderm gene. ( A ) Western blotting verification of acetyl-H4 and H4 expression levels in control, HDAC1-OE (H1 OE), and TSA-treated H1-OE cells. GAPDH was used as a loading control. ( B, C ) QRT-PCR analysis of the three germ layer genes at day 6 of EB differentiation in control, H1-OE, and TSA-treated H1-OE cells. ( D ) Western blotting verification of acetyl-H4 and H4 expression levels in control, HDAC3-OE (H1 OE), and TSA-treated H3-OE cells. GAPDH was used as a loading control. ( E, F ) QRT-PCR analysis of the three germ layer genes at day 6 of EB differentiation in control, H3-OE, and TSA-treated H3-OE cells. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P

Techniques Used: Histone Deacetylase Assay, Activity Assay, Western Blot, Expressing, Quantitative RT-PCR, Two Tailed Test

The expression levels of HDAC1 and 3 are decreased during differentiation. ( A ) QRT-PCR for genes characteristic of undifferentiated stem cells (Oct4, Nanog) was performed as indicated on mRNA collected at days 0, 3, 6, and 10 during EB differentiation. ( B ) The relative expression levels of marker genes for three germ layers (endoderm, Gata6; mesoderm, T, Mixl1; primitive ectoderm, Fgf5) at days 0, 3, 6, and 10 during EB differentiation. ( C ) Western blotting verification for genes characteristic of undifferentiated stem cells (Oct4, Nanog) was performed as indicated on protein samples collected at days 0, 3, 6, and 10 during EB differentiation. The expression level of global acetyl-H4 was increasing during EB differentiation. GAPDH and H4 were used as loading controls. ( D ) Western blotting verification for class I HDAC members (HDAC1, 2, 3, and 8) at the indicated days 0, 3, 6, and 10 during EB differentiation. GAPDH was used as a loading control. ( E, F ) QRT-PCR analysis for the expression levels of class I HDAC members (HDAC1, 2, 3, and 8) at the indicated days 0, 3, 6, and 10 during EB differentiation. ( G, H ) Western blotting and QRT-PCR analysis for the expression levels of HDAC members (HDAC1, 2, 3, and 8) at days 0, 2, 3, and 4 during differentiation without LIF.
Figure Legend Snippet: The expression levels of HDAC1 and 3 are decreased during differentiation. ( A ) QRT-PCR for genes characteristic of undifferentiated stem cells (Oct4, Nanog) was performed as indicated on mRNA collected at days 0, 3, 6, and 10 during EB differentiation. ( B ) The relative expression levels of marker genes for three germ layers (endoderm, Gata6; mesoderm, T, Mixl1; primitive ectoderm, Fgf5) at days 0, 3, 6, and 10 during EB differentiation. ( C ) Western blotting verification for genes characteristic of undifferentiated stem cells (Oct4, Nanog) was performed as indicated on protein samples collected at days 0, 3, 6, and 10 during EB differentiation. The expression level of global acetyl-H4 was increasing during EB differentiation. GAPDH and H4 were used as loading controls. ( D ) Western blotting verification for class I HDAC members (HDAC1, 2, 3, and 8) at the indicated days 0, 3, 6, and 10 during EB differentiation. GAPDH was used as a loading control. ( E, F ) QRT-PCR analysis for the expression levels of class I HDAC members (HDAC1, 2, 3, and 8) at the indicated days 0, 3, 6, and 10 during EB differentiation. ( G, H ) Western blotting and QRT-PCR analysis for the expression levels of HDAC members (HDAC1, 2, 3, and 8) at days 0, 2, 3, and 4 during differentiation without LIF.

Techniques Used: Expressing, Quantitative RT-PCR, Marker, Western Blot

Ectopic expression of HDAC1 and 3 inhibits the differentiation into the mesodermal lineage in EBs. ( A ) Bright-field images and alkaline phosphatase staining of ESCs in control, HDAC1-overexpression (HDAC1-OE), and HDAC3-overexpression (HDAC3-OE) ESCs. ( B ) Western blotting verification and QRT-PCR analysis of the overexpression of HDAC1 and HDAC3 in stable E14 cell lines. GAPDH was used as a loading control. ( C ) QRT-PCR analysis for the mRNA levels of mesoderm genes in HDAC1-OE ESCs, HDAC3-OE ESCs and control cells during EB differentiation. ( D ) Western blotting analysis of the Gata4 and α-SMA protein levels in HDAC3-OE ESCs and control cell lines during EB differentiation. ( E ) Representative immunofluorescence images for the GATA4 expression level in control, HDAC1-OE, and HDAC3-OE cells after 9 days of EB formation. Red, Gata4; blue, Hoechst 33342 for nuclei staining. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P
Figure Legend Snippet: Ectopic expression of HDAC1 and 3 inhibits the differentiation into the mesodermal lineage in EBs. ( A ) Bright-field images and alkaline phosphatase staining of ESCs in control, HDAC1-overexpression (HDAC1-OE), and HDAC3-overexpression (HDAC3-OE) ESCs. ( B ) Western blotting verification and QRT-PCR analysis of the overexpression of HDAC1 and HDAC3 in stable E14 cell lines. GAPDH was used as a loading control. ( C ) QRT-PCR analysis for the mRNA levels of mesoderm genes in HDAC1-OE ESCs, HDAC3-OE ESCs and control cells during EB differentiation. ( D ) Western blotting analysis of the Gata4 and α-SMA protein levels in HDAC3-OE ESCs and control cell lines during EB differentiation. ( E ) Representative immunofluorescence images for the GATA4 expression level in control, HDAC1-OE, and HDAC3-OE cells after 9 days of EB formation. Red, Gata4; blue, Hoechst 33342 for nuclei staining. Data are expressed as means ± SD. Statistical significance was assessed by two-tailed Student's t test. ***, P

Techniques Used: Expressing, Staining, Over Expression, Western Blot, Quantitative RT-PCR, Immunofluorescence, Two Tailed Test

8) Product Images from "Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers"

Article Title: Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers

Journal: PLoS ONE

doi: 10.1371/journal.pone.0044951

CDO1 mRNA levels in different types of cancer. A , Expression of CDO1 in cell lines was examined by RT-PCR or qRT-PCR analyses. m, mock treatment. a, 5-Aza-dC treatment (5 µM for three days). β-actin was used as a loading control. Methylation status of CDO1 promoter in each cell line was examined and indicated as M for methylation, U for unmethylation, and M/U for co-existence of methylated and unmethylated alleles. CDO1 was completely methylated in all cancer cell lines since only cytosine peaks were observed in CpGs sequenced (100% methylation) while it was not methylated in HEK293 since only thymidine peaks were observed (0% methylation). CDO1 was partially methylated in MCF-12A since both methylated and unmethylated alleles were observed in 10 CpGs of the CDO1 promoters examined. When a cytosine peak were compared with a thymidine peak in each CpG of the 10 CpGs, cytosine peaks were dominant (methylated), but since these “methylated CpGs” were found in less than 50% of total CpGs (10/34), it was considered as “methylation-negative” according to the criteria described in Materials and Methods . B . qRT-PCR was performed in cDNAs derived from patients with colon, breast, esophagus, bladder and stomach cancer (T) and patients without cancer (NN) (upper). Relative expression (Fold) was calculated by comparing the ratios of mRNA expression of CDO1 to an internal control gene, β-actin. The CDO1 expression level was determined in 10 lung cancer patients and 10 patients without cancer (lower). 2?-()*100, the expression of CDO1 relative to β-actin calculated based on the threshold cycle (C t ) as 2 −ΔCt (ΔCt = C t, CDO1 - C t,β-actin ). Experiments were done in duplicate, and values indicate means ± SD. *, P
Figure Legend Snippet: CDO1 mRNA levels in different types of cancer. A , Expression of CDO1 in cell lines was examined by RT-PCR or qRT-PCR analyses. m, mock treatment. a, 5-Aza-dC treatment (5 µM for three days). β-actin was used as a loading control. Methylation status of CDO1 promoter in each cell line was examined and indicated as M for methylation, U for unmethylation, and M/U for co-existence of methylated and unmethylated alleles. CDO1 was completely methylated in all cancer cell lines since only cytosine peaks were observed in CpGs sequenced (100% methylation) while it was not methylated in HEK293 since only thymidine peaks were observed (0% methylation). CDO1 was partially methylated in MCF-12A since both methylated and unmethylated alleles were observed in 10 CpGs of the CDO1 promoters examined. When a cytosine peak were compared with a thymidine peak in each CpG of the 10 CpGs, cytosine peaks were dominant (methylated), but since these “methylated CpGs” were found in less than 50% of total CpGs (10/34), it was considered as “methylation-negative” according to the criteria described in Materials and Methods . B . qRT-PCR was performed in cDNAs derived from patients with colon, breast, esophagus, bladder and stomach cancer (T) and patients without cancer (NN) (upper). Relative expression (Fold) was calculated by comparing the ratios of mRNA expression of CDO1 to an internal control gene, β-actin. The CDO1 expression level was determined in 10 lung cancer patients and 10 patients without cancer (lower). 2?-()*100, the expression of CDO1 relative to β-actin calculated based on the threshold cycle (C t ) as 2 −ΔCt (ΔCt = C t, CDO1 - C t,β-actin ). Experiments were done in duplicate, and values indicate means ± SD. *, P

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Methylation, Derivative Assay

9) Product Images from "DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy"

Article Title: DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy

Journal: Cancer Medicine

doi: 10.1002/cam4.1603

DSCAM ‐ AS 1 regulates cell proliferation and colony formation by inducing the G1/S transition. A, DSCAM ‐ AS 1 was highly expressed in 21 paired breast tumors and para‐carcinoma fresh frozen tissues by qRT ‐ PCR . Error bars represent the SD of 3 experimental replicates. B, DSCAM ‐ AS 1 was highly expressed in luminal and Her‐2 overexpression subtypes of breast cancer among 40 fresh frozen breast cancer tissues by qRT ‐ PCR . Error bars represent the SD of 3 experimental replicates. C, Interference efficiency of si RNA s by qRT ‐ PCR targeting DSCAM ‐ AS 1 in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. D, CCK 8 proliferation assay following knockdown of DSCAM ‐ AS 1 by si RNA s showed reduced cell proliferation in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. E, Knockdown of DSCAM ‐ AS 1 by si RNA s reduced the cell clonality in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. F, Knockdown of DSCAM ‐ AS 1 by si RNA s induced G 1 /S cell cycle arrest in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates
Figure Legend Snippet: DSCAM ‐ AS 1 regulates cell proliferation and colony formation by inducing the G1/S transition. A, DSCAM ‐ AS 1 was highly expressed in 21 paired breast tumors and para‐carcinoma fresh frozen tissues by qRT ‐ PCR . Error bars represent the SD of 3 experimental replicates. B, DSCAM ‐ AS 1 was highly expressed in luminal and Her‐2 overexpression subtypes of breast cancer among 40 fresh frozen breast cancer tissues by qRT ‐ PCR . Error bars represent the SD of 3 experimental replicates. C, Interference efficiency of si RNA s by qRT ‐ PCR targeting DSCAM ‐ AS 1 in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. D, CCK 8 proliferation assay following knockdown of DSCAM ‐ AS 1 by si RNA s showed reduced cell proliferation in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. E, Knockdown of DSCAM ‐ AS 1 by si RNA s reduced the cell clonality in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates. F, Knockdown of DSCAM ‐ AS 1 by si RNA s induced G 1 /S cell cycle arrest in MCF ‐7 and T‐47D cell lines. Error bars represent the SD of 3 biological replicates

Techniques Used: Quantitative RT-PCR, Over Expression, CCK-8 Assay, Proliferation Assay

RNA ‐seq analysis revealed that DSCAM ‐ AS 1 is related to important cancer‐related biological processes. A, qRT ‐ PCR was used to validate the expression levels of genes related to tumor proliferation. Error bars represent the SD of 3 biological replicates. B, Gene set enrichment analysis ( GSEA ) of Gene Ontology ( GO ) revealed that the most significantly enriched gene sets were related to DNA replication, the G1/S phase transition, sister chromatid cohesion, chromosome segregation, protein localization to the chromosome and DNA recombination. C, Kyoto Encyclopedia of Genes and Genomes ( KEGG ) pathway analysis revealed that DSCAM ‐ AS 1 is highly correlated with DNA replication, cell cycle, pyrimidine metabolism, mismatch repair, and other cancer‐related pathways
Figure Legend Snippet: RNA ‐seq analysis revealed that DSCAM ‐ AS 1 is related to important cancer‐related biological processes. A, qRT ‐ PCR was used to validate the expression levels of genes related to tumor proliferation. Error bars represent the SD of 3 biological replicates. B, Gene set enrichment analysis ( GSEA ) of Gene Ontology ( GO ) revealed that the most significantly enriched gene sets were related to DNA replication, the G1/S phase transition, sister chromatid cohesion, chromosome segregation, protein localization to the chromosome and DNA recombination. C, Kyoto Encyclopedia of Genes and Genomes ( KEGG ) pathway analysis revealed that DSCAM ‐ AS 1 is highly correlated with DNA replication, cell cycle, pyrimidine metabolism, mismatch repair, and other cancer‐related pathways

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing, Sublimation

10) Product Images from "Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep"

Article Title: Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep

Journal: Bioscience Reports

doi: 10.1042/BSR20171350

The pattern of CTSB and CTSD expression in the ovaries ( A ) The relative expression level of CTSB and CTSD as determined by qRT-PCR, and the RNA-seq data of CTSB/CTSD relative expression, normalized by log 10 (FPKM + 1). Comparisons were made using independent-sample t test, with SPSS 24.0. *: P
Figure Legend Snippet: The pattern of CTSB and CTSD expression in the ovaries ( A ) The relative expression level of CTSB and CTSD as determined by qRT-PCR, and the RNA-seq data of CTSB/CTSD relative expression, normalized by log 10 (FPKM + 1). Comparisons were made using independent-sample t test, with SPSS 24.0. *: P

Techniques Used: Expressing, Quantitative RT-PCR, RNA Sequencing Assay

Validation of RNA-seq results using qRT-PCR and RNA-seq, respectively ( A , B ) The relative expression of DE-mRNA and DE-lncRNA was determined by q-PCR. Comparisons by independent-sample t test, using SPSS 24.0. *: P
Figure Legend Snippet: Validation of RNA-seq results using qRT-PCR and RNA-seq, respectively ( A , B ) The relative expression of DE-mRNA and DE-lncRNA was determined by q-PCR. Comparisons by independent-sample t test, using SPSS 24.0. *: P

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing, Polymerase Chain Reaction

11) Product Images from "Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish"

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish

Journal: Disease Models & Mechanisms

doi: 10.1242/dmm.014951

Zebrafish bach1b is a co-ortholog of mammalian Bach1 , and heme regulates exocrine peptidase precursor genes. (A) Zebrafish Bach1b contains four CP motifs, three of which are also found in human and mouse. (B) Phylogenetic analysis of Bach1 proteins shows that zebrafish contain two bach1 genes, bach1a and bach1b , which are co-orthologs of mammalian Bach1 . The tree was constructed using the neighbor-joining method with MEGA5 ( Tamura et al., 2011 ). The numbers indicate the percentage bootstrap support. Dr , Danio rerio; Tr , Takifugu rubripes; Tn , Tetraodon nigroviridis; Ol , Oryzias latipes; Ga , Gasterosteus aculeatus; On , Oreochromis niloticus; Xt , Xenopus tropicalis; Ci , Ciona intestinalis; Cs , Ciona savignyi; Rn , Rattus norvegicus; Mm , Mus musculus; Hs , Homo sapiens. Ciona intestinalis and Ciona savignyi Bach proteins were used as an outgroup. The Ensembl gene IDs of these genes are listed in supplementary material Table S2 . (C) Downregulation of six peptidase precursor genes in zebrafish yquem/urod (−/−) and their rescue upon treatment with hemin. The concentration of hemin used was 100 μM. The expression levels of six peptidase precursor genes in larvae at 84 hpf were determined by using qRT-PCR. Student’s t -tests were conducted. * P
Figure Legend Snippet: Zebrafish bach1b is a co-ortholog of mammalian Bach1 , and heme regulates exocrine peptidase precursor genes. (A) Zebrafish Bach1b contains four CP motifs, three of which are also found in human and mouse. (B) Phylogenetic analysis of Bach1 proteins shows that zebrafish contain two bach1 genes, bach1a and bach1b , which are co-orthologs of mammalian Bach1 . The tree was constructed using the neighbor-joining method with MEGA5 ( Tamura et al., 2011 ). The numbers indicate the percentage bootstrap support. Dr , Danio rerio; Tr , Takifugu rubripes; Tn , Tetraodon nigroviridis; Ol , Oryzias latipes; Ga , Gasterosteus aculeatus; On , Oreochromis niloticus; Xt , Xenopus tropicalis; Ci , Ciona intestinalis; Cs , Ciona savignyi; Rn , Rattus norvegicus; Mm , Mus musculus; Hs , Homo sapiens. Ciona intestinalis and Ciona savignyi Bach proteins were used as an outgroup. The Ensembl gene IDs of these genes are listed in supplementary material Table S2 . (C) Downregulation of six peptidase precursor genes in zebrafish yquem/urod (−/−) and their rescue upon treatment with hemin. The concentration of hemin used was 100 μM. The expression levels of six peptidase precursor genes in larvae at 84 hpf were determined by using qRT-PCR. Student’s t -tests were conducted. * P

Techniques Used: Construct, Concentration Assay, Expressing, Quantitative RT-PCR

ChIP assays. Capped mRNAs encoding mafK -FLAG, nrf2a -FLAG or bach1b -HA were microinjected into one-cell stage embryos, antibodies against FLAG or HA were used to pull down complexes of the protein with the DNA, and the DNAs were eluted. Specific primers and the eluted DNAs were used in PCR analyses to amplify the DNA fragments that contained cpa5 MARE sites, which were subsequently quantified by using qRT-PCR. (A) Electrophoresis analysis of the ChIP results showed that MafK bound to MARE-containing regulatory fragments of six zymogens. (B) Electrophoresis analysis of the cpa5 ChIP assay. Approximately 2.6-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in wild-type control larvae; whereas approximately 2.8-fold more Bach1b than Nrf2a protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in heme-deficient yquem/urod (−/−) larvae. Moreover, treatment of the heme-deficient yquem/urod (−/−) larvae with hemin reversed the situation so that approximately 1.2-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in hemin-treated yquem/urod (−/−) larvae. (C) qRT-PCR analysis of the cpa5 ChIP assay, the results of which were consistent with the gel electrophoresis analysis in B.
Figure Legend Snippet: ChIP assays. Capped mRNAs encoding mafK -FLAG, nrf2a -FLAG or bach1b -HA were microinjected into one-cell stage embryos, antibodies against FLAG or HA were used to pull down complexes of the protein with the DNA, and the DNAs were eluted. Specific primers and the eluted DNAs were used in PCR analyses to amplify the DNA fragments that contained cpa5 MARE sites, which were subsequently quantified by using qRT-PCR. (A) Electrophoresis analysis of the ChIP results showed that MafK bound to MARE-containing regulatory fragments of six zymogens. (B) Electrophoresis analysis of the cpa5 ChIP assay. Approximately 2.6-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in wild-type control larvae; whereas approximately 2.8-fold more Bach1b than Nrf2a protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in heme-deficient yquem/urod (−/−) larvae. Moreover, treatment of the heme-deficient yquem/urod (−/−) larvae with hemin reversed the situation so that approximately 1.2-fold more Nrf2a than Bach1b protein (quantified with ImageJ) was associated with cpa5 promoters that harbored MARE sites in hemin-treated yquem/urod (−/−) larvae. (C) qRT-PCR analysis of the cpa5 ChIP assay, the results of which were consistent with the gel electrophoresis analysis in B.

Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Quantitative RT-PCR, Electrophoresis, Nucleic Acid Electrophoresis

The regulatory functions of BACH1 on exocrine zymogens are conserved, developmental delay of the exocrine pancreas in the HEP fish and a model for heme-mediated regulation of the exocrine peptidase precursor gene. (A) Overexpression of human BACH1 in zebrafish resulted in downregulation of the six peptidase precursor genes investigated. (B) Downregulation of exdpf ( Jiang et al., 2008 ), an exocrine pancreas marker, in zebrafish yquem/urod (−/−), as determined by qRT-PCR analysis, the results of which are consistent with those achieved by using in situ hybridization (shown in supplementary material Fig. S7A,B ). The primers used for the qRT-PCR analysis are listed in supplementary material Table S1 . Student’s t -tests were conducted. ** P
Figure Legend Snippet: The regulatory functions of BACH1 on exocrine zymogens are conserved, developmental delay of the exocrine pancreas in the HEP fish and a model for heme-mediated regulation of the exocrine peptidase precursor gene. (A) Overexpression of human BACH1 in zebrafish resulted in downregulation of the six peptidase precursor genes investigated. (B) Downregulation of exdpf ( Jiang et al., 2008 ), an exocrine pancreas marker, in zebrafish yquem/urod (−/−), as determined by qRT-PCR analysis, the results of which are consistent with those achieved by using in situ hybridization (shown in supplementary material Fig. S7A,B ). The primers used for the qRT-PCR analysis are listed in supplementary material Table S1 . Student’s t -tests were conducted. ** P

Techniques Used: Fluorescence In Situ Hybridization, Over Expression, Marker, Quantitative RT-PCR, In Situ Hybridization

Knockdown experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b knockdown results in the upregulation of the six peptidase precursor genes that we examined, whereas nrf2a knockdown resulted in their downregulation. Knockdown experiments were performed by microinjecting MOs that targeted bach1b or nrf2a into one-cell stage embryos. For bach1b knockdown experiments, an ATG MO and SPL MO were used. Reverse transcription PCR showed that the SPL MO effectively altered bach1b intron 2 splicing ( supplementary material Fig. S1A,B ). The ATG MO also effectively knocked down bach1b ( supplementary material Fig. S1C ). The results using the SPL MO are shown here. For nrf2a knockdown experiments, we used an ATG MO, of which the efficacy of knockdown has been confirmed previously ( Kobayashi et al., 2002 ; Kobayashi et al., 2009 ; Wang and Gallagher, 2013 ). The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by using qRT-PCR. (B) Representative images of in situ hybridization staining show that the upregulation of cpa5 resulted from bach1b knockdown and that its downregulation resulted from nrf2a knockdown, both results occurred specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 4C were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b knockdown overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, and the optic density values lower than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a knockdown group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, the optic density values higher than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ were marked as ‘medium’. The statistical significance of difference between means was determined by using one-way ANOVA and Tukey’s multiple comparison test ( n =9) with SPSS10.0.1. * P
Figure Legend Snippet: Knockdown experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b knockdown results in the upregulation of the six peptidase precursor genes that we examined, whereas nrf2a knockdown resulted in their downregulation. Knockdown experiments were performed by microinjecting MOs that targeted bach1b or nrf2a into one-cell stage embryos. For bach1b knockdown experiments, an ATG MO and SPL MO were used. Reverse transcription PCR showed that the SPL MO effectively altered bach1b intron 2 splicing ( supplementary material Fig. S1A,B ). The ATG MO also effectively knocked down bach1b ( supplementary material Fig. S1C ). The results using the SPL MO are shown here. For nrf2a knockdown experiments, we used an ATG MO, of which the efficacy of knockdown has been confirmed previously ( Kobayashi et al., 2002 ; Kobayashi et al., 2009 ; Wang and Gallagher, 2013 ). The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by using qRT-PCR. (B) Representative images of in situ hybridization staining show that the upregulation of cpa5 resulted from bach1b knockdown and that its downregulation resulted from nrf2a knockdown, both results occurred specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 4C were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b knockdown overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, and the optic density values lower than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a knockdown group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, the optic density values higher than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ were marked as ‘medium’. The statistical significance of difference between means was determined by using one-way ANOVA and Tukey’s multiple comparison test ( n =9) with SPSS10.0.1. * P

Techniques Used: Expressing, Quantitative RT-PCR, Polymerase Chain Reaction, In Situ Hybridization, Staining, Over Expression

Overexpression experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b overexpression resulted in the downregulation of six peptidase precursor genes – cpa5 , ctr1l , ctrb1 , ela2l , try and tryl – whereas nrf2a overexpression resulted in their upregulation. Overexpression experiments were performed by microinjecting bach1b or nrf2a capped mRNAs into one-cell stage embryos. The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by qRT-PCR analysis. (B) Representative images of in situ hybridization staining show that downregulation of cpa5 resulted from bach1b overexpression and that its upregulation resulted from nrf2a overexpression, both specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 3B were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b overexpression group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, and the optic density values higher than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, the optic density values lower than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ marked as ‘medium’. The statistical significance of difference between means was determined by one-way ANOVA and Tukey’s multiple comparison test ( n =9) by using SPSS10.0.1. * P
Figure Legend Snippet: Overexpression experiments with bach1b and nrf2a reveal their antagonism in the regulation of zymogen expression. (A) qRT-PCR analysis showed that bach1b overexpression resulted in the downregulation of six peptidase precursor genes – cpa5 , ctr1l , ctrb1 , ela2l , try and tryl – whereas nrf2a overexpression resulted in their upregulation. Overexpression experiments were performed by microinjecting bach1b or nrf2a capped mRNAs into one-cell stage embryos. The expression levels of the six peptidase precursor genes in the microinjected and control larvae at 84 hpf were determined by qRT-PCR analysis. (B) Representative images of in situ hybridization staining show that downregulation of cpa5 resulted from bach1b overexpression and that its upregulation resulted from nrf2a overexpression, both specifically in the exocrine pancreas. Dorsal view, anterior to the left. (C) Mean optic densities of in situ hybridization staining of a group of larvae (10–12 each) corresponding to Fig. 3B were quantified by using ImageJ. (D) cpa5 morphant phenotypes. For individual larvae (84 hpf) of the bach1b overexpression group, the optic density values lower than the mean optic density value of its own group were marked as ‘strong’, and the optic density values higher than the mean optic density of the control group were marked as ‘weak’. For individual larvae of the nrf2a overexpression group, the optic density values higher than the mean optic density value of its own group were marked as ‘strong’, the optic density values lower than the mean optic density of the control group were marked as ‘weak’, and the values of optic density between ‘weak’ and ‘strong’ marked as ‘medium’. The statistical significance of difference between means was determined by one-way ANOVA and Tukey’s multiple comparison test ( n =9) by using SPSS10.0.1. * P

Techniques Used: Over Expression, Expressing, Quantitative RT-PCR, In Situ Hybridization, Staining

12) Product Images from "Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression"

Article Title: Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression

Journal: Radiation Oncology (London, England)

doi: 10.1186/s13014-017-0802-3

Expression of TUG1 and HMGB1 in bladder cancer tissues. a and b The expression of TUG1 and HMGB1 mRNA was measured by qRT-PCR analysis in bladder cancer tissues ( n = 39) or adjacent non-cancer tissues ( n = 39). c The protein level of HMGB1 was detected by western blot in bladder cancer tissues ( n = 39) or adjacent non-cancer tissues ( n = 39). d Correlation analysis of TUG1 and HMGB1 expression in bladder cancer tissues. *P
Figure Legend Snippet: Expression of TUG1 and HMGB1 in bladder cancer tissues. a and b The expression of TUG1 and HMGB1 mRNA was measured by qRT-PCR analysis in bladder cancer tissues ( n = 39) or adjacent non-cancer tissues ( n = 39). c The protein level of HMGB1 was detected by western blot in bladder cancer tissues ( n = 39) or adjacent non-cancer tissues ( n = 39). d Correlation analysis of TUG1 and HMGB1 expression in bladder cancer tissues. *P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

Radiation promotes the TUG1 and HMGB1 expression in bladder cancer cell lines. a qRT-PCR analysis was conducted to detect the TUG1 expression in bladder cancer cell lines SW780, HT1376, BIU87 and T24 and normal bladder epithelial cell line HCV-29. b The protein level of HMGB1 was determined by western blot in SW780 and BIU87 cells. c TUG1 expression was detected in SW780 and BIU87 cells every 3 h after 0 or 2 Gy of ionizing radiation treatment. d TUG1 expression was measured in SW780 and BIU87 cells after different doses (0, 2, 4, 6 Gy) of ionizing radiation treatment for 24 h. e The HMGB1 protein level was upregulated after SW780 and BIU87 cells treated with 2 Gy of ionizing radiation for 24 h. * P
Figure Legend Snippet: Radiation promotes the TUG1 and HMGB1 expression in bladder cancer cell lines. a qRT-PCR analysis was conducted to detect the TUG1 expression in bladder cancer cell lines SW780, HT1376, BIU87 and T24 and normal bladder epithelial cell line HCV-29. b The protein level of HMGB1 was determined by western blot in SW780 and BIU87 cells. c TUG1 expression was detected in SW780 and BIU87 cells every 3 h after 0 or 2 Gy of ionizing radiation treatment. d TUG1 expression was measured in SW780 and BIU87 cells after different doses (0, 2, 4, 6 Gy) of ionizing radiation treatment for 24 h. e The HMGB1 protein level was upregulated after SW780 and BIU87 cells treated with 2 Gy of ionizing radiation for 24 h. * P

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

TUG1 downregulation inhibits the HMGB1 expression in bladder cancer cell lines. a The expression of HMGB1 mRNA was detected by qRT-PCR analysis at 24 h after SW780 and BIU87 cells were transfected with si-NC or si-TUG1. b and c The protein level of HMGB1 was examined at 24 h after SW780 and BIU87 cells were transfected with si-NC or si-TUG1. *P
Figure Legend Snippet: TUG1 downregulation inhibits the HMGB1 expression in bladder cancer cell lines. a The expression of HMGB1 mRNA was detected by qRT-PCR analysis at 24 h after SW780 and BIU87 cells were transfected with si-NC or si-TUG1. b and c The protein level of HMGB1 was examined at 24 h after SW780 and BIU87 cells were transfected with si-NC or si-TUG1. *P

Techniques Used: Expressing, Quantitative RT-PCR, Transfection

TUG1 silencing enhances radiosensitivity of bladder cancer cell lines. a qRT-PCR analysis of the relative TUG1 expression in SW780 and BIU87 cells transfected withTUG1-specific si-RNAs or control si-RNA. SW780 and BIU87 cells were transfected with si-NC or si-TUG1 and cultured for 24 h followed by ionizing radiation. b The cell viability of transfected SW780 and BIU87 cells at 0, 24, 48, 72 and 96 h afterionizing radiation. c and d Cell apoptosis was determined in transfected SW780 and BIU87 cells at 24 h after 2 Gy radiotherapy. e Transfected SW780 and BIU87 cells were subjected to 0, 2, 4, 6 and 8 Gy of irradiation. After 2 weeks, the colony survival fractions were measured. * P
Figure Legend Snippet: TUG1 silencing enhances radiosensitivity of bladder cancer cell lines. a qRT-PCR analysis of the relative TUG1 expression in SW780 and BIU87 cells transfected withTUG1-specific si-RNAs or control si-RNA. SW780 and BIU87 cells were transfected with si-NC or si-TUG1 and cultured for 24 h followed by ionizing radiation. b The cell viability of transfected SW780 and BIU87 cells at 0, 24, 48, 72 and 96 h afterionizing radiation. c and d Cell apoptosis was determined in transfected SW780 and BIU87 cells at 24 h after 2 Gy radiotherapy. e Transfected SW780 and BIU87 cells were subjected to 0, 2, 4, 6 and 8 Gy of irradiation. After 2 weeks, the colony survival fractions were measured. * P

Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Cell Culture, Irradiation

13) Product Images from "Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma"

Article Title: Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma

Journal: Journal of Experimental & Clinical Cancer Research : CR

doi: 10.1186/s13046-019-1436-0

a-b The protein expression levels of indicate treated Capan-1 ( a ) and Aspc-1 ( b ) cells were measured by WB analysis. c The mRNA expression levels of indicate treated Capan-1and Aspc-1 cells were measured by qRT-PCR analysis. d The protein expression levels of indicate treated Capan-1 and Aspc-1 cells were measured by ELISA analysis. e-g Animal experiments, the luciferase intensities were measured each week ( e and f ) after intrapancreatic injection with NC or circ-ASH2L overexpressing Capan-1 cells, pancreatic tumor in situ (the black arrows point to) and liver metastasis foci (the yellow arrows point to) were showed by autopsy and H E staining ( g )
Figure Legend Snippet: a-b The protein expression levels of indicate treated Capan-1 ( a ) and Aspc-1 ( b ) cells were measured by WB analysis. c The mRNA expression levels of indicate treated Capan-1and Aspc-1 cells were measured by qRT-PCR analysis. d The protein expression levels of indicate treated Capan-1 and Aspc-1 cells were measured by ELISA analysis. e-g Animal experiments, the luciferase intensities were measured each week ( e and f ) after intrapancreatic injection with NC or circ-ASH2L overexpressing Capan-1 cells, pancreatic tumor in situ (the black arrows point to) and liver metastasis foci (the yellow arrows point to) were showed by autopsy and H E staining ( g )

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Luciferase, Injection, In Situ, Staining

a Relative circ-ASH2L expressions of Hs 766 T and Hs 766 T-L2 were measured by qRT-PCR. b Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. c Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. d qRT-PCR analysis of circ-ASH2L or β-actin after treatment of RNase R in Capan-1 and Aspc-1 cells. e qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Capan-1 cells. f qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Aspc-1 cells. g Relative expressions of circ-ASH2L in indicate treated Capan-1 and Aspc-1 cells was measured by qRT-PCR. h The PCR products of Capan-1 cells were confirmed by Sanger sequencing to show the back-splice junction. i Schematic outlining the details of circ-ASH2L and its primer-designing details
Figure Legend Snippet: a Relative circ-ASH2L expressions of Hs 766 T and Hs 766 T-L2 were measured by qRT-PCR. b Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. c Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. d qRT-PCR analysis of circ-ASH2L or β-actin after treatment of RNase R in Capan-1 and Aspc-1 cells. e qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Capan-1 cells. f qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Aspc-1 cells. g Relative expressions of circ-ASH2L in indicate treated Capan-1 and Aspc-1 cells was measured by qRT-PCR. h The PCR products of Capan-1 cells were confirmed by Sanger sequencing to show the back-splice junction. i Schematic outlining the details of circ-ASH2L and its primer-designing details

Techniques Used: Quantitative RT-PCR, Polymerase Chain Reaction, Sequencing

a-b The in-situ expressions of circ-ASH2L ( a ) and 18S ( b , as a control) in Capan-1 cells. Scale bars = 12.5 μm. c The expressions of indicated miRNAs in indicate treated HEK-293 cells were measured by qRT-PCR. d The prediction for miR-34a binding sites on circ-ASH2L transcript. e Schematic outlining the wild type and mut circ-ASH2L luciferase plasmid. ( f ) Luciferase activity in HEK-293 cells co-transfected with indicated concentration of miR-34a or circ-ASH2L luciferase reporter transcript. Data are showed as the ratio of firefly activity to Renilla luciferase activity. g RNA immunoprecipitation (RIP) experiments were performed using the anti-Ago2 or lgG antibody to immunoprecipitates, the expressions of circ-ASH2L or β-actin were measured by qRT-PCR. h The schematic diagram of RNA pull-down assay in this study. i circ-ASH2L was pulled down and enriched with miR-34a probe and then detected by qRT-PCR
Figure Legend Snippet: a-b The in-situ expressions of circ-ASH2L ( a ) and 18S ( b , as a control) in Capan-1 cells. Scale bars = 12.5 μm. c The expressions of indicated miRNAs in indicate treated HEK-293 cells were measured by qRT-PCR. d The prediction for miR-34a binding sites on circ-ASH2L transcript. e Schematic outlining the wild type and mut circ-ASH2L luciferase plasmid. ( f ) Luciferase activity in HEK-293 cells co-transfected with indicated concentration of miR-34a or circ-ASH2L luciferase reporter transcript. Data are showed as the ratio of firefly activity to Renilla luciferase activity. g RNA immunoprecipitation (RIP) experiments were performed using the anti-Ago2 or lgG antibody to immunoprecipitates, the expressions of circ-ASH2L or β-actin were measured by qRT-PCR. h The schematic diagram of RNA pull-down assay in this study. i circ-ASH2L was pulled down and enriched with miR-34a probe and then detected by qRT-PCR

Techniques Used: In Situ, Quantitative RT-PCR, Binding Assay, Luciferase, Plasmid Preparation, Activity Assay, Transfection, Concentration Assay, Immunoprecipitation, Pull Down Assay

14) Product Images from "Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes"

Article Title: Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes

Journal: Stem Cell Reports

doi: 10.1016/j.stemcr.2015.10.005

Telencephalic D-V Patterning (A) Expression of D-V markers in the telencephalon. MGE, medial ganglionic eminence; LGE, lateral ganglionic eminence; POA, preoptic area. (B) qRT-PCR analysis of neurospheres for telencephalic D-V marker expression (n = 3−4 independent experiments; mean ± SEM; ∗ p
Figure Legend Snippet: Telencephalic D-V Patterning (A) Expression of D-V markers in the telencephalon. MGE, medial ganglionic eminence; LGE, lateral ganglionic eminence; POA, preoptic area. (B) qRT-PCR analysis of neurospheres for telencephalic D-V marker expression (n = 3−4 independent experiments; mean ± SEM; ∗ p

Techniques Used: Expressing, Quantitative RT-PCR, Marker

Generation of Region-Specific Neuronal Subtypes (A) qRT-PCR analysis of neurosphere-derived neurons for TBR1 , GATA3 , and LBX1 expression (n = 4−5 independent experiments, mean ± SEM). A-P patterning was maintained throughout neuronal differentiation in vitro. (B−D) qRT-PCR analysis of neurosphere-derived neurons for the expression of neuronal subtype markers expressed in the forebrain (B), the mid/hindbrain (C), and the spinal cord (D) (n = 5−7 independent experiments; mean ± SEM; ∗ p
Figure Legend Snippet: Generation of Region-Specific Neuronal Subtypes (A) qRT-PCR analysis of neurosphere-derived neurons for TBR1 , GATA3 , and LBX1 expression (n = 4−5 independent experiments, mean ± SEM). A-P patterning was maintained throughout neuronal differentiation in vitro. (B−D) qRT-PCR analysis of neurosphere-derived neurons for the expression of neuronal subtype markers expressed in the forebrain (B), the mid/hindbrain (C), and the spinal cord (D) (n = 5−7 independent experiments; mean ± SEM; ∗ p

Techniques Used: Quantitative RT-PCR, Derivative Assay, Expressing, In Vitro

A-P Patterning by Modifying Wnt and RA Signaling (A) Expression of A-P markers in the neural tube in vivo. (B) qRT-PCR analysis of neurospheres for A-P marker expression (n = 3 independent experiments, mean ± SEM). Activation of Wnt and RA signaling posteriorized the neurospheres, whereas blockade of Wnt signaling anteriorized the neurospheres. (C) Immunocytochemical analysis of neurospheres for A-P markers. The frequency of neurospheres containing immunopositive cells is shown as the percentage of total neurospheres (n = 3 independent experiments, mean ± SEM). A-P patterning was also confirmed at the protein level. Scale bar, 50 μm). See also Table S1 .
Figure Legend Snippet: A-P Patterning by Modifying Wnt and RA Signaling (A) Expression of A-P markers in the neural tube in vivo. (B) qRT-PCR analysis of neurospheres for A-P marker expression (n = 3 independent experiments, mean ± SEM). Activation of Wnt and RA signaling posteriorized the neurospheres, whereas blockade of Wnt signaling anteriorized the neurospheres. (C) Immunocytochemical analysis of neurospheres for A-P markers. The frequency of neurospheres containing immunopositive cells is shown as the percentage of total neurospheres (n = 3 independent experiments, mean ± SEM). A-P patterning was also confirmed at the protein level. Scale bar, 50 μm). See also Table S1 .

Techniques Used: Expressing, In Vivo, Quantitative RT-PCR, Marker, Activation Assay

D-V Patterning by Treatment with Shh (A) Expression of D-V markers in the neural tube. The dashed line indicates the alar-basal boundary. (B) qRT-PCR analysis of neurospheres for D-V marker expression (n = 3 independent experiments, mean ± SEM). Neurospheres not treated with Shh showed a dorsal identity, whereas Shh treatment ventralized the neurospheres. (C and D) Immunocytochemical analysis of neurospheres for PAX6/NKX2.1 (C) and PAX6/NKX2.2 (D). The frequency of neurospheres containing immunopositive cells is shown as the percentage of total neurospheres (n = 3 independent experiments, mean ± SEM). D-V patterning was also confirmed at the protein level. Scale bars, 50 μm. See also Table S1 .
Figure Legend Snippet: D-V Patterning by Treatment with Shh (A) Expression of D-V markers in the neural tube. The dashed line indicates the alar-basal boundary. (B) qRT-PCR analysis of neurospheres for D-V marker expression (n = 3 independent experiments, mean ± SEM). Neurospheres not treated with Shh showed a dorsal identity, whereas Shh treatment ventralized the neurospheres. (C and D) Immunocytochemical analysis of neurospheres for PAX6/NKX2.1 (C) and PAX6/NKX2.2 (D). The frequency of neurospheres containing immunopositive cells is shown as the percentage of total neurospheres (n = 3 independent experiments, mean ± SEM). D-V patterning was also confirmed at the protein level. Scale bars, 50 μm. See also Table S1 .

Techniques Used: Expressing, Quantitative RT-PCR, Marker

15) Product Images from "Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice"

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice

Journal: Parasites & Vectors

doi: 10.1186/s13071-015-0806-5

Analysis of the levels of selected miRNAs and their target genes using qRT-PCR. a . qRT-PCR analysis of the plasma levels of selected miRNAs and their target genes; b . qRT-PCR analysis of the levels of selected miRNAs and their target genes in the livers of S. japonicum infected mice. Data illustrate representative experiments and show the mean and standard error derived from triplicate biological replicates. Pools of plasma and livers from at least four S. japonicum infected mice and four uninfected controls were used in each biological experiment. Creb1: cAMP responsive element binding protein 1. *means P ≤ 0.05 and **means P ≤ 0.01. (student’s t test analysis).
Figure Legend Snippet: Analysis of the levels of selected miRNAs and their target genes using qRT-PCR. a . qRT-PCR analysis of the plasma levels of selected miRNAs and their target genes; b . qRT-PCR analysis of the levels of selected miRNAs and their target genes in the livers of S. japonicum infected mice. Data illustrate representative experiments and show the mean and standard error derived from triplicate biological replicates. Pools of plasma and livers from at least four S. japonicum infected mice and four uninfected controls were used in each biological experiment. Creb1: cAMP responsive element binding protein 1. *means P ≤ 0.05 and **means P ≤ 0.01. (student’s t test analysis).

Techniques Used: Quantitative RT-PCR, Infection, Mouse Assay, Derivative Assay, Binding Assay

16) Product Images from "Ube2s stabilizes β-Catenin through K11-linked polyubiquitination to promote mesendoderm specification and colorectal cancer development"

Article Title: Ube2s stabilizes β-Catenin through K11-linked polyubiquitination to promote mesendoderm specification and colorectal cancer development

Journal: Cell Death & Disease

doi: 10.1038/s41419-018-0451-y

Ube2s promoted mES cell differentiation into mesoendoderm. a , b Ube2s overexpression stable mES cell line U1 and the vector-transfected control line (HA) were induced to differentiate into mesoendoderm. The resulting cells were analyzed by qRT-PCR ( a ; t -test, ** p
Figure Legend Snippet: Ube2s promoted mES cell differentiation into mesoendoderm. a , b Ube2s overexpression stable mES cell line U1 and the vector-transfected control line (HA) were induced to differentiate into mesoendoderm. The resulting cells were analyzed by qRT-PCR ( a ; t -test, ** p

Techniques Used: Cell Differentiation, Over Expression, Plasmid Preparation, Transfection, Quantitative RT-PCR

17) Product Images from "MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS"

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS

Journal: Technology in Cancer Research & Treatment

doi: 10.1177/1533033818793652

MiR-19b is significantly downregulated in cancer tissues. A, Relative miR-19b expression levels were analyzed by qRT-PCR in 37 pairs of human cancer tissues and adjacent normal tissues. U6 RNA level was used as an internal control. B, The miR-19b expression in 3 different grades of cancer samples. According to the pathological classification, the 37 pairs of human cancer tissues were divided into 3 groups: WHO grade I, grade II, and grade III–IV. Data represent mean (SD) of 3 replicates. **Significant difference at P
Figure Legend Snippet: MiR-19b is significantly downregulated in cancer tissues. A, Relative miR-19b expression levels were analyzed by qRT-PCR in 37 pairs of human cancer tissues and adjacent normal tissues. U6 RNA level was used as an internal control. B, The miR-19b expression in 3 different grades of cancer samples. According to the pathological classification, the 37 pairs of human cancer tissues were divided into 3 groups: WHO grade I, grade II, and grade III–IV. Data represent mean (SD) of 3 replicates. **Significant difference at P

Techniques Used: Expressing, Quantitative RT-PCR

The expression of KRAS was inversely correlated with miR-19b expression in human clinical specimens. A, The expression of KRAS in adjacent normal tissues and human cancer specimens was determined by qRT-PCR analysis, and fold changes were obtained from the ratio of KRAS and GAPDH levels. B, Spearman analysis was conducted between expression of miR-19b and KRAS. Data represent mean (SD) of 3 replicates. **Significant difference at P
Figure Legend Snippet: The expression of KRAS was inversely correlated with miR-19b expression in human clinical specimens. A, The expression of KRAS in adjacent normal tissues and human cancer specimens was determined by qRT-PCR analysis, and fold changes were obtained from the ratio of KRAS and GAPDH levels. B, Spearman analysis was conducted between expression of miR-19b and KRAS. Data represent mean (SD) of 3 replicates. **Significant difference at P

Techniques Used: Expressing, Quantitative RT-PCR

MiR-19b inhibits tumorigenesis in vivo . A, B, Tumor growth assay in nude mice. Representative pictures of xenograft tumors. Bar: 2 mm. Tumor growth curve (A) and average of xenograft tumors (B) between the groups of miR-NC and miR-19b. C, The expression levels of KRAS were analyzed in tumor tissues by qRT-PCR. D, Protein levels of KRAS in xenograft tumors. Data were presented by mean (SD). * P
Figure Legend Snippet: MiR-19b inhibits tumorigenesis in vivo . A, B, Tumor growth assay in nude mice. Representative pictures of xenograft tumors. Bar: 2 mm. Tumor growth curve (A) and average of xenograft tumors (B) between the groups of miR-NC and miR-19b. C, The expression levels of KRAS were analyzed in tumor tissues by qRT-PCR. D, Protein levels of KRAS in xenograft tumors. Data were presented by mean (SD). * P

Techniques Used: In Vivo, Growth Assay, Mouse Assay, Expressing, Quantitative RT-PCR

18) Product Images from "Overexpression of Poplar PtrWRKY89 in Transgenic Arabidopsis Leads to a Reduction of Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling"

Article Title: Overexpression of Poplar PtrWRKY89 in Transgenic Arabidopsis Leads to a Reduction of Disease Resistance by Regulating Defense-Related Genes in Salicylate- and Jasmonate-Dependent Signaling

Journal: PLoS ONE

doi: 10.1371/journal.pone.0149137

Expression patterns of the PtrWRKY89 promoter driven GUS gene in response to salicylic acid (SA), methyl jasmonate (MeJA) with low concentration and their mixed solution, respectively. SA solution (100 μΜ), MeJA solution (100 μΜ) and SA+MeJA mixture (100 μΜ + 100 μΜ) were sprayed onto the surface of two-week-old transgenic Arabidopsis seedling containing the ProPtrWRKY89-GUS construct. The control plants (CK) were treated by H 2 O. After treatments of 24 h, the seedlings were collected from MS medium. (A) The GUS staining of the seedlings. (B) The transcript profiles of PtrWRKY89 were analyzed by quantitative RT-PCR (qRT-PCR). Error bars were obtained from three biological replicates. Arabidopsis UBC (AT5G25760) expression was used as a control and gene-specific primers were used for qRT-PCR analysis were described in S1 Table . Two asterisks indicate a statistically significant difference by Student's t -test (**, P
Figure Legend Snippet: Expression patterns of the PtrWRKY89 promoter driven GUS gene in response to salicylic acid (SA), methyl jasmonate (MeJA) with low concentration and their mixed solution, respectively. SA solution (100 μΜ), MeJA solution (100 μΜ) and SA+MeJA mixture (100 μΜ + 100 μΜ) were sprayed onto the surface of two-week-old transgenic Arabidopsis seedling containing the ProPtrWRKY89-GUS construct. The control plants (CK) were treated by H 2 O. After treatments of 24 h, the seedlings were collected from MS medium. (A) The GUS staining of the seedlings. (B) The transcript profiles of PtrWRKY89 were analyzed by quantitative RT-PCR (qRT-PCR). Error bars were obtained from three biological replicates. Arabidopsis UBC (AT5G25760) expression was used as a control and gene-specific primers were used for qRT-PCR analysis were described in S1 Table . Two asterisks indicate a statistically significant difference by Student's t -test (**, P

Techniques Used: Expressing, Concentration Assay, Transgenic Assay, Construct, Mass Spectrometry, Staining, Quantitative RT-PCR

19) Product Images from "The AGPase Family Proteins in Banana: Genome-Wide Identification, Phylogeny, and Expression Analyses Reveal Their Involvement in the Development, Ripening, and Abiotic/Biotic Stress Responses"

Article Title: The AGPase Family Proteins in Banana: Genome-Wide Identification, Phylogeny, and Expression Analyses Reveal Their Involvement in the Development, Ripening, and Abiotic/Biotic Stress Responses

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms18081581

Relative expression of MaAGPases in two banana varieties, BX and FJ, by qRT-PCR. ( A – C ) Expression of MaAPL-2a , -3 , and MaAPS1 in different organs. ( D – F ) Expression of MaAPL-2a , -3 , and MaAPS1 at different stages of fruit development and ripening. ( G – I ) Expression of MaAPL-2a , -3 , and MaAPS1 in response to cold, salt, and osmotic stresses. ( J – L ) Expression of MaAPL-2a , -3 , and MaAPS1 in response to fungal infection. Data are presented as means ± standard deviations of n = 3 biological replicates.
Figure Legend Snippet: Relative expression of MaAGPases in two banana varieties, BX and FJ, by qRT-PCR. ( A – C ) Expression of MaAPL-2a , -3 , and MaAPS1 in different organs. ( D – F ) Expression of MaAPL-2a , -3 , and MaAPS1 at different stages of fruit development and ripening. ( G – I ) Expression of MaAPL-2a , -3 , and MaAPS1 in response to cold, salt, and osmotic stresses. ( J – L ) Expression of MaAPL-2a , -3 , and MaAPS1 in response to fungal infection. Data are presented as means ± standard deviations of n = 3 biological replicates.

Techniques Used: Expressing, Quantitative RT-PCR, Infection

20) Product Images from "OsPHR3 affects the traits governing nitrogen homeostasis in rice"

Article Title: OsPHR3 affects the traits governing nitrogen homeostasis in rice

Journal: BMC Plant Biology

doi: 10.1186/s12870-018-1462-7

Effects of total N, NO 3 − and expression of NRTs and AMTs are Pi-independent in osphr3 . Seeds of the WT and mutants ( osphr3–1 and 3–2 ) were grown hydroponically in IRRI solution for 2 weeks and then transferred to +P and -P for ( a, b ) 2 weeks and ( c ) 3 d. Shoot and root were harvested for assaying the ( a ) total N and ( b ) NO 3 − concentration. c qRT-PCR was employed for determining the relative expression levels of genes encoding NO 3 − ( OsNRT1.1a , OsNRT2.3a and OsNRT2.4 ) and NH 4 + ( OsAMT1.1 , OsAMT1.2 and OsAMT1.3 ) transporters in the root. Actin was used as an internal control and the values for +P WT and + P mutants were normalized to 1. Values of are means ±SE ( n = 5) and different letters on the histograms indicate that the values differ significantly ( P
Figure Legend Snippet: Effects of total N, NO 3 − and expression of NRTs and AMTs are Pi-independent in osphr3 . Seeds of the WT and mutants ( osphr3–1 and 3–2 ) were grown hydroponically in IRRI solution for 2 weeks and then transferred to +P and -P for ( a, b ) 2 weeks and ( c ) 3 d. Shoot and root were harvested for assaying the ( a ) total N and ( b ) NO 3 − concentration. c qRT-PCR was employed for determining the relative expression levels of genes encoding NO 3 − ( OsNRT1.1a , OsNRT2.3a and OsNRT2.4 ) and NH 4 + ( OsAMT1.1 , OsAMT1.2 and OsAMT1.3 ) transporters in the root. Actin was used as an internal control and the values for +P WT and + P mutants were normalized to 1. Values of are means ±SE ( n = 5) and different letters on the histograms indicate that the values differ significantly ( P

Techniques Used: Expressing, Concentration Assay, Quantitative RT-PCR

Mutation in OsPHR3 affects the expression of NO 3 − and NH 4 + transporter and nitrate reductase genes. Seeds of the WT and mutants ( osphr3–1 and 3–2 ) were grown hydroponically in IRRI solution for 2 weeks, deprived of N for 3 d and then transferred to 2.5 mM N and 0.25 mM N media for 1 d. Roots were harvested and qRT-PCR was employed for determining the relative expression levels of genes encoding NO 3 − ( OsNRT1.1a , OsNRT2.3a and OsNRT2.4 ), NH 4 + ( OsAMT1.1 , OsAMT1.2 and OsAMT1.3 ) transporters and nitrate reductase ( OsNia1 and OsNia2 ). Actin was used as an internal control and + N WT values were normalized to 1. Values are means ±SE ( n = 3) and different letters on the histograms indicate that the values differ significantly ( P
Figure Legend Snippet: Mutation in OsPHR3 affects the expression of NO 3 − and NH 4 + transporter and nitrate reductase genes. Seeds of the WT and mutants ( osphr3–1 and 3–2 ) were grown hydroponically in IRRI solution for 2 weeks, deprived of N for 3 d and then transferred to 2.5 mM N and 0.25 mM N media for 1 d. Roots were harvested and qRT-PCR was employed for determining the relative expression levels of genes encoding NO 3 − ( OsNRT1.1a , OsNRT2.3a and OsNRT2.4 ), NH 4 + ( OsAMT1.1 , OsAMT1.2 and OsAMT1.3 ) transporters and nitrate reductase ( OsNia1 and OsNia2 ). Actin was used as an internal control and + N WT values were normalized to 1. Values are means ±SE ( n = 3) and different letters on the histograms indicate that the values differ significantly ( P

Techniques Used: Mutagenesis, Expressing, Quantitative RT-PCR

Tissue-specific differential relative expression levels of OsPHR3 during growth under different regimes of N variants. Seeds of the wild-type were grown hydroponically in IRRI solution for 2 weeks, starved for N for 3 d and then supplied for 24 h with nutrient solution containing high NH 4 + (H NH 4 + , 5 mM), low NH 4 + (L NH 4 + , 0.25 mM), high NO 3 − (H NO 3 − , 5 mM), low NO 3 − (L NO 3 − , 0.25 mM), 2.5 mM N (1.25 mM NH 4 + and 1.25 mM NO 3 − ,) and 0.25 mM (0.125 mM NH 4 + and 0.125 mM NO 3 − ). Root and shoot were harvested for the qRT-PCR analysis of the relative expression levels of OsPHR3 in ( a ) high and low NH 4 + or NO 3 − and ( b ) 2.5 mM N and 0.25 mM N conditions. Actin ( OsRac1 ; LOC_Os03g50885) was used as an internal control and the values for H NH 4 + , H NO 3 − and + N were normalized to 1. Values are means ±SE ( n = 3) and different letters on the histograms indicate that the values differ significantly ( P
Figure Legend Snippet: Tissue-specific differential relative expression levels of OsPHR3 during growth under different regimes of N variants. Seeds of the wild-type were grown hydroponically in IRRI solution for 2 weeks, starved for N for 3 d and then supplied for 24 h with nutrient solution containing high NH 4 + (H NH 4 + , 5 mM), low NH 4 + (L NH 4 + , 0.25 mM), high NO 3 − (H NO 3 − , 5 mM), low NO 3 − (L NO 3 − , 0.25 mM), 2.5 mM N (1.25 mM NH 4 + and 1.25 mM NO 3 − ,) and 0.25 mM (0.125 mM NH 4 + and 0.125 mM NO 3 − ). Root and shoot were harvested for the qRT-PCR analysis of the relative expression levels of OsPHR3 in ( a ) high and low NH 4 + or NO 3 − and ( b ) 2.5 mM N and 0.25 mM N conditions. Actin ( OsRac1 ; LOC_Os03g50885) was used as an internal control and the values for H NH 4 + , H NO 3 − and + N were normalized to 1. Values are means ±SE ( n = 3) and different letters on the histograms indicate that the values differ significantly ( P

Techniques Used: Expressing, Quantitative RT-PCR

21) Product Images from "Functional inactivation of OsGCNT induces enhanced disease resistance to Xanthomonas oryzae pv. oryzae in rice"

Article Title: Functional inactivation of OsGCNT induces enhanced disease resistance to Xanthomonas oryzae pv. oryzae in rice

Journal: BMC Plant Biology

doi: 10.1186/s12870-018-1489-9

Evaluation of disease resistance and expression of defense signaling-related genes in spl21 and WT. a Reactions to Xoo race PXO99. 1–2: WT before inoculation; 3–4: spl21 before inoculation; 5–7: WT after inoculation; 8–10: spl21 after inoculation; 11–16: complementation lines. b Mean lesion length/leaf length radio after inoculation of plant leaves with PXO99. Data represent the lesion length means ± SD from 5 independent plants at the tillering stage (Student’s t -test: **, P ≤ 0.01). c Relative expression of seven defense signaling-related genes in WT and spl21 at the tillering stages analyzed by qRT-PCR. The expression level of each gene in WT was normalized to 1; data represent the mean ± SD of three biological replicates (Student’s t -test: **, P ≤ 0.01)
Figure Legend Snippet: Evaluation of disease resistance and expression of defense signaling-related genes in spl21 and WT. a Reactions to Xoo race PXO99. 1–2: WT before inoculation; 3–4: spl21 before inoculation; 5–7: WT after inoculation; 8–10: spl21 after inoculation; 11–16: complementation lines. b Mean lesion length/leaf length radio after inoculation of plant leaves with PXO99. Data represent the lesion length means ± SD from 5 independent plants at the tillering stage (Student’s t -test: **, P ≤ 0.01). c Relative expression of seven defense signaling-related genes in WT and spl21 at the tillering stages analyzed by qRT-PCR. The expression level of each gene in WT was normalized to 1; data represent the mean ± SD of three biological replicates (Student’s t -test: **, P ≤ 0.01)

Techniques Used: Expressing, Quantitative RT-PCR

22) Product Images from "Comprehensive Transcriptome Analysis Reveals Competing Endogenous RNA Networks During Avian Leukosis Virus, Subgroup J-Induced Tumorigenesis in Chickens"

Article Title: Comprehensive Transcriptome Analysis Reveals Competing Endogenous RNA Networks During Avian Leukosis Virus, Subgroup J-Induced Tumorigenesis in Chickens

Journal: Frontiers in Physiology

doi: 10.3389/fphys.2018.00996

qRT-PCR confirmation of sequencing results in chickens with or without ALV-J infection. (A) For mRNA. (B) For lncRNA.
Figure Legend Snippet: qRT-PCR confirmation of sequencing results in chickens with or without ALV-J infection. (A) For mRNA. (B) For lncRNA.

Techniques Used: Quantitative RT-PCR, Sequencing, Infection

23) Product Images from "Involvement of G6PD5 in ABA response during seed germination and root growth in Arabidopsis"

Article Title: Involvement of G6PD5 in ABA response during seed germination and root growth in Arabidopsis

Journal: BMC Plant Biology

doi: 10.1186/s12870-019-1647-8

G6PD5 attenuates the expression of several ABA responsive genes. Relative expression levels of ABA-signaling genes ABI3 , ABI4 , ABI5 in plants. Two-week-old seedlings were incubated in liquid MS medium with or without 10 μM ABA for 12 h. The transcript levels were determined by qRT-PCR analysis. The transcript levels were normalized to Actin2 . Results are averages ± SE (n = 3). All experiments were repeated at least three times with similar results
Figure Legend Snippet: G6PD5 attenuates the expression of several ABA responsive genes. Relative expression levels of ABA-signaling genes ABI3 , ABI4 , ABI5 in plants. Two-week-old seedlings were incubated in liquid MS medium with or without 10 μM ABA for 12 h. The transcript levels were determined by qRT-PCR analysis. The transcript levels were normalized to Actin2 . Results are averages ± SE (n = 3). All experiments were repeated at least three times with similar results

Techniques Used: Expressing, Incubation, Mass Spectrometry, Quantitative RT-PCR

24) Product Images from "Histone demethylase PHF8 promotes progression and metastasis of gastric cancer"

Article Title: Histone demethylase PHF8 promotes progression and metastasis of gastric cancer

Journal: American Journal of Cancer Research

doi:

H. pylori induce PHF8 expression in vitro and in vivo. (A, B) qRT-PCR analysis (A) and IHC staining (B) of PHF8 in H. pylori -negative or positive AG samples. P
Figure Legend Snippet: H. pylori induce PHF8 expression in vitro and in vivo. (A, B) qRT-PCR analysis (A) and IHC staining (B) of PHF8 in H. pylori -negative or positive AG samples. P

Techniques Used: Expressing, In Vitro, In Vivo, Quantitative RT-PCR, Immunohistochemistry, Staining

PHF8 promotes GC cells growth and metastasis in vivo . (A) qRT-PCR and Western blot analysis of PHF8 in BGC-823 cells transfected with PHF8 shRNA. (B-D) Xenograft model in nude mice. Primary tumor appearance (B), tumor growth curves (C) and the average
Figure Legend Snippet: PHF8 promotes GC cells growth and metastasis in vivo . (A) qRT-PCR and Western blot analysis of PHF8 in BGC-823 cells transfected with PHF8 shRNA. (B-D) Xenograft model in nude mice. Primary tumor appearance (B), tumor growth curves (C) and the average

Techniques Used: In Vivo, Quantitative RT-PCR, Western Blot, Transfection, shRNA, Mouse Assay

25) Product Images from "Integrative Analyses of Nontargeted Volatile Profiling and Transcriptome Data Provide Molecular Insight into VOC Diversity in Cucumber Plants (Cucumis sativus) 1) 1 [OPEN]"

Article Title: Integrative Analyses of Nontargeted Volatile Profiling and Transcriptome Data Provide Molecular Insight into VOC Diversity in Cucumber Plants (Cucumis sativus) 1) 1 [OPEN]

Journal: Plant Physiology

doi: 10.1104/pp.16.01051

qRT-PCR analysis of the transcript levels of five TPS genes and four IDS genes in seven representative cucumber tissues. Transcript levels are expressed relative to the expression of the gene encoding the ubiquitin extension protein (GenBank accession
Figure Legend Snippet: qRT-PCR analysis of the transcript levels of five TPS genes and four IDS genes in seven representative cucumber tissues. Transcript levels are expressed relative to the expression of the gene encoding the ubiquitin extension protein (GenBank accession

Techniques Used: Quantitative RT-PCR, Expressing

26) Product Images from "Identification of Known and Novel microRNAs and Their Targets in Peach (Prunus persica) Fruit by High-Throughput Sequencing"

Article Title: Identification of Known and Novel microRNAs and Their Targets in Peach (Prunus persica) Fruit by High-Throughput Sequencing

Journal: PLoS ONE

doi: 10.1371/journal.pone.0159253

Relative expression levels of some known miRNAs in peach. The relative expression levels of known miRNAs in different tissues at five developmental stages were investigated by qRT-PCR analysis and calculated using the 2 -ΔΔCT method. The x-axes show the leaf, fruit, and phloem samples obtained 35, 55, 75, 90, and 105 days after full bloom (DAFB). The vertical bars represent the ±SE of each mean value (n = 9).
Figure Legend Snippet: Relative expression levels of some known miRNAs in peach. The relative expression levels of known miRNAs in different tissues at five developmental stages were investigated by qRT-PCR analysis and calculated using the 2 -ΔΔCT method. The x-axes show the leaf, fruit, and phloem samples obtained 35, 55, 75, 90, and 105 days after full bloom (DAFB). The vertical bars represent the ±SE of each mean value (n = 9).

Techniques Used: Expressing, Quantitative RT-PCR

Relative expression levels of some novel miRNAs in peach fruit. The relative expression levels of novel miRNAs in fruit tissue at five developmental stages were investigated by qRT-PCR and calculated using the 2 -ΔΔCT method. The x-axes show the fruit samples obtained 35, 55, 75, 90, and 105 days after full bloom. The vertical bars represent the ±SE of each mean value (n = 9).
Figure Legend Snippet: Relative expression levels of some novel miRNAs in peach fruit. The relative expression levels of novel miRNAs in fruit tissue at five developmental stages were investigated by qRT-PCR and calculated using the 2 -ΔΔCT method. The x-axes show the fruit samples obtained 35, 55, 75, 90, and 105 days after full bloom. The vertical bars represent the ±SE of each mean value (n = 9).

Techniques Used: Expressing, Quantitative RT-PCR

27) Product Images from "Oxygen promotes biofilm formation of Shewanellaputrefaciens CN32 through a diguanylate cyclase and an adhesin"

Article Title: Oxygen promotes biofilm formation of Shewanellaputrefaciens CN32 through a diguanylate cyclase and an adhesin

Journal: Scientific Reports

doi: 10.1038/srep01945

DosD regulates the transcription and secretion of bpfA . (A) The transcription levels of bpfA and aggA in Δ dosD relative to WT. The quantity of cDNA was normalized to the abundance of 16S cDNA in the qRT-PCR analysis. (B) The level of BpfA in Δ dosD bpfA + ::gfp and bpfA + ::gfp . WT was set as a control. (C) Localization and abundance of BpfA inΔ aggA bpfA + ::gfp and bpfA + ::gfp . M indicates the sample of membrane fractions and C indicates the sample of cytoplasm fraction.
Figure Legend Snippet: DosD regulates the transcription and secretion of bpfA . (A) The transcription levels of bpfA and aggA in Δ dosD relative to WT. The quantity of cDNA was normalized to the abundance of 16S cDNA in the qRT-PCR analysis. (B) The level of BpfA in Δ dosD bpfA + ::gfp and bpfA + ::gfp . WT was set as a control. (C) Localization and abundance of BpfA inΔ aggA bpfA + ::gfp and bpfA + ::gfp . M indicates the sample of membrane fractions and C indicates the sample of cytoplasm fraction.

Techniques Used: Quantitative RT-PCR

28) Product Images from "MAD2 Combined with Mitotic Spindle Apparatus (MSA) and Anticentromere Antibody (ACA) for Diagnosis of Small Cell Lung Cancer (SCLC)"

Article Title: MAD2 Combined with Mitotic Spindle Apparatus (MSA) and Anticentromere Antibody (ACA) for Diagnosis of Small Cell Lung Cancer (SCLC)

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.909772

Agarose electrophoresis of MAD2 expression. MAD2 expression was assessed by agarose electrophoresis. GAPDH was used for internal reference and the length was 146 bp. The length of MAD2 was 163 bp. SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer; PN, pulmonary nodule ( A ). MAD2 expression in SCLC, NSCLC, and PN groups. The quantity of MAD2 expression was assessed by qRt-PCR. * SCLC vs. PN, ** SCLC vs. NSCLC; *** NSCLC vs. PN, P
Figure Legend Snippet: Agarose electrophoresis of MAD2 expression. MAD2 expression was assessed by agarose electrophoresis. GAPDH was used for internal reference and the length was 146 bp. The length of MAD2 was 163 bp. SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer; PN, pulmonary nodule ( A ). MAD2 expression in SCLC, NSCLC, and PN groups. The quantity of MAD2 expression was assessed by qRt-PCR. * SCLC vs. PN, ** SCLC vs. NSCLC; *** NSCLC vs. PN, P

Techniques Used: Electrophoresis, Expressing, Quantitative RT-PCR

29) Product Images from "Candidate Genes for Yellow Leaf Color in Common Wheat (Triticum aestivum L.) and Major Related Metabolic Pathways according to Transcriptome Profiling"

Article Title: Candidate Genes for Yellow Leaf Color in Common Wheat (Triticum aestivum L.) and Major Related Metabolic Pathways according to Transcriptome Profiling

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19061594

qRT-PCR validation of the RNA-Seq results for the candidate DEGs related to yellow leaf color formation in the Y type. Log 2 (FC) represents the fold change in Y relative to that in G.
Figure Legend Snippet: qRT-PCR validation of the RNA-Seq results for the candidate DEGs related to yellow leaf color formation in the Y type. Log 2 (FC) represents the fold change in Y relative to that in G.

Techniques Used: Quantitative RT-PCR, RNA Sequencing Assay

30) Product Images from "Characterization of Transcription Factor Gene OsDRAP1 Conferring Drought Tolerance in Rice"

Article Title: Characterization of Transcription Factor Gene OsDRAP1 Conferring Drought Tolerance in Rice

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2018.00094

Expression model of OsDRAP1 in different tissues of rice, in which (A) the transcript levels were determined by qRT-PCR and semi RT-PCR, OsDRAP1 transcript levels in young panicles (1), matured leaves (2), leaf sheaths (3), nodes (4), internodes (5), stem bases (6), matured roots (7), young leaves (8), young roots (9) and callus (10) with Actin1 used as the reference gene. The OsDRAP1 expression in different tissues of the OsDRAP1-Pro::GUS transgenic rice plants by GUS staining analysis, in the shell (B) , leaf blade (C) , root (D) , root cross section (E) and sheath cross section (F) with red arrows indicating the vascular bundles (the scale bars are in 100 μm).
Figure Legend Snippet: Expression model of OsDRAP1 in different tissues of rice, in which (A) the transcript levels were determined by qRT-PCR and semi RT-PCR, OsDRAP1 transcript levels in young panicles (1), matured leaves (2), leaf sheaths (3), nodes (4), internodes (5), stem bases (6), matured roots (7), young leaves (8), young roots (9) and callus (10) with Actin1 used as the reference gene. The OsDRAP1 expression in different tissues of the OsDRAP1-Pro::GUS transgenic rice plants by GUS staining analysis, in the shell (B) , leaf blade (C) , root (D) , root cross section (E) and sheath cross section (F) with red arrows indicating the vascular bundles (the scale bars are in 100 μm).

Techniques Used: Expressing, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay, Staining

31) Product Images from "Function and Interaction of the Coupled Genes Responsible for Pik-h Encoded Rice Blast Resistance"

Article Title: Function and Interaction of the Coupled Genes Responsible for Pik-h Encoded Rice Blast Resistance

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098067

Transcription profiles of the coupled genes Pikh-1 and Pikh-2 , as assayed by qRT-PCR. Data represent mean ± standard deviation (n = 3). Similar results were obtained from two independent experiments. Lower case letter (a, b) used to indicate whether the treatment and control means differed at P
Figure Legend Snippet: Transcription profiles of the coupled genes Pikh-1 and Pikh-2 , as assayed by qRT-PCR. Data represent mean ± standard deviation (n = 3). Similar results were obtained from two independent experiments. Lower case letter (a, b) used to indicate whether the treatment and control means differed at P

Techniques Used: Quantitative RT-PCR, Standard Deviation

32) Product Images from "Overexpression of a NF-YC Gene Results in Enhanced Drought and Salt Tolerance in Transgenic Seashore Paspalum"

Article Title: Overexpression of a NF-YC Gene Results in Enhanced Drought and Salt Tolerance in Transgenic Seashore Paspalum

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2018.01355

Analysis of transcript levels of PvLEA3 , PvABI2 , PvP5CS1 , and PvDREB1B in the transgenic plants in comparison with the WT. Detached leaves were placed in water for 4 h as control (A) , or air-dried in a hood for 4 h as dehydration treatment (B) , or placed in 0.4 M NaCl solution for 5 h as salt treatment (C) . PvACTIN1 was used as a reference gene for qRT-PCR. Relative expression of each gene was calculated by defining the normalized transcript level in WT plant under control condition as one. Means of three replicates and standard errors are presented; the same letter above the column indicates no significant difference at P
Figure Legend Snippet: Analysis of transcript levels of PvLEA3 , PvABI2 , PvP5CS1 , and PvDREB1B in the transgenic plants in comparison with the WT. Detached leaves were placed in water for 4 h as control (A) , or air-dried in a hood for 4 h as dehydration treatment (B) , or placed in 0.4 M NaCl solution for 5 h as salt treatment (C) . PvACTIN1 was used as a reference gene for qRT-PCR. Relative expression of each gene was calculated by defining the normalized transcript level in WT plant under control condition as one. Means of three replicates and standard errors are presented; the same letter above the column indicates no significant difference at P

Techniques Used: Transgenic Assay, Hood, Quantitative RT-PCR, Expressing

33) Product Images from "Long noncoding RNA gastric cancer-related lncRNA1 mediates gastric malignancy through miRNA-885-3p and cyclin-dependent kinase 4"

Article Title: Long noncoding RNA gastric cancer-related lncRNA1 mediates gastric malignancy through miRNA-885-3p and cyclin-dependent kinase 4

Journal: Cell Death & Disease

doi: 10.1038/s41419-018-0643-5

miR-885-3p suppresses GC proliferation and metastasis in vitro and in vivo. a Expression levels of miR-885-3p determined by qRT-PCR in BGC-823 cells transfected with AgomiR-885, which were normalized to human U6 ( n = 3). b MTT assay showing the cell multiplication of BGC-823 cells treated with AgomiR-885 24, 48, 72, and 96 h after transfection. Results were shown as absorbance at 490 nm ( n = 3). c EdU incorporation assay indicating the cell proliferation of BGC-823 cells treated with agomiR-885 and representative images were shown (scale bars = 50 μm). d Bar graphs of cell multiplication to c upon EdU incorporation assay and results were shown as the ratio of EdU-positive cells to Hoechst-positive cells ( n = 5). e Transwell assay assessing the mobility of BGC-823 cells with miR-885-3p enhancement by AgomiR-885 and representative images were shown (scale bars = 100 μm). ( f ) Bar graphs of cell mobility to e upon transwell assay and results were shown as the number of migrated or invaded cells per field ( n = 5). g Up: morphology of mice tumors dissected at day 29 after injection, n = 6 in each group. Down: tumor growth curves from day 9 to 29 after subcutaneous injection, with tumor volume calculated as 1/2 × length × width 2 cm 3 . h Tumor weight at day 29, n = 6 each group. i Expression levels of miR-885-3p in mice tumor tissues detected by qRT-PCR, normalized to human U6, n = 6 each group. j Left: photographs showing typical morphology of mice lungs dissected 29 days after tail vein injection (scale bars = 500 μm, n = 6 each group). Right: visualization of the dissected mice lungs with H E staining and representative images were shown (scale bars = 100 μm). k Bar graphs showing the number of lung metastatic nodules per view, n = 6. Data are expressed as mean ± SD, * p
Figure Legend Snippet: miR-885-3p suppresses GC proliferation and metastasis in vitro and in vivo. a Expression levels of miR-885-3p determined by qRT-PCR in BGC-823 cells transfected with AgomiR-885, which were normalized to human U6 ( n = 3). b MTT assay showing the cell multiplication of BGC-823 cells treated with AgomiR-885 24, 48, 72, and 96 h after transfection. Results were shown as absorbance at 490 nm ( n = 3). c EdU incorporation assay indicating the cell proliferation of BGC-823 cells treated with agomiR-885 and representative images were shown (scale bars = 50 μm). d Bar graphs of cell multiplication to c upon EdU incorporation assay and results were shown as the ratio of EdU-positive cells to Hoechst-positive cells ( n = 5). e Transwell assay assessing the mobility of BGC-823 cells with miR-885-3p enhancement by AgomiR-885 and representative images were shown (scale bars = 100 μm). ( f ) Bar graphs of cell mobility to e upon transwell assay and results were shown as the number of migrated or invaded cells per field ( n = 5). g Up: morphology of mice tumors dissected at day 29 after injection, n = 6 in each group. Down: tumor growth curves from day 9 to 29 after subcutaneous injection, with tumor volume calculated as 1/2 × length × width 2 cm 3 . h Tumor weight at day 29, n = 6 each group. i Expression levels of miR-885-3p in mice tumor tissues detected by qRT-PCR, normalized to human U6, n = 6 each group. j Left: photographs showing typical morphology of mice lungs dissected 29 days after tail vein injection (scale bars = 500 μm, n = 6 each group). Right: visualization of the dissected mice lungs with H E staining and representative images were shown (scale bars = 100 μm). k Bar graphs showing the number of lung metastatic nodules per view, n = 6. Data are expressed as mean ± SD, * p

Techniques Used: In Vitro, In Vivo, Expressing, Quantitative RT-PCR, Transfection, MTT Assay, Transwell Assay, Mouse Assay, Injection, Staining

miR-885-3p directly targets CDK4. a Up: putative miR-885-3p-binding sites in the 3′-untranslated region (3′UTR) of human CDK4; down: wild type and three mutants of CDK4 3′UTR, with the mutant sites labeled in lowercase letters and underlines. b Relative luciferase activities of CDK4 3′UTR reporter in HEK-293T cells ( n = 3). c Expression levels of CDK4 detected by qRT-PCR (up) and western blotting (down) in BGC-823 cells treated with AgomiR-885, normalized to human GAPDH (up) or with β-actin as a control (down) ( n = 3). d Expression levels of CDK4 detected by qRT-PCR (up) and western blotting (down) in MGC-803 cells treated with AntagomiR-885, normalized to human GAPDH (up) or with β-actin as a control (down) ( n = 3). e Expression levels of CDK4 analyzed by western blotting in mice tumor tissues, with β-actin as controls. f Expression levels of CDK4 examined by immunohistochemical assay and representative images were shown, with ki-67 as a control (scale bars = 50 μm). Data are expressed as mean ± SD, * p
Figure Legend Snippet: miR-885-3p directly targets CDK4. a Up: putative miR-885-3p-binding sites in the 3′-untranslated region (3′UTR) of human CDK4; down: wild type and three mutants of CDK4 3′UTR, with the mutant sites labeled in lowercase letters and underlines. b Relative luciferase activities of CDK4 3′UTR reporter in HEK-293T cells ( n = 3). c Expression levels of CDK4 detected by qRT-PCR (up) and western blotting (down) in BGC-823 cells treated with AgomiR-885, normalized to human GAPDH (up) or with β-actin as a control (down) ( n = 3). d Expression levels of CDK4 detected by qRT-PCR (up) and western blotting (down) in MGC-803 cells treated with AntagomiR-885, normalized to human GAPDH (up) or with β-actin as a control (down) ( n = 3). e Expression levels of CDK4 analyzed by western blotting in mice tumor tissues, with β-actin as controls. f Expression levels of CDK4 examined by immunohistochemical assay and representative images were shown, with ki-67 as a control (scale bars = 50 μm). Data are expressed as mean ± SD, * p

Techniques Used: Binding Assay, Mutagenesis, Labeling, Luciferase, Expressing, Quantitative RT-PCR, Western Blot, Mouse Assay, Immunohistochemistry

Effects of GCRL1 on gastric cancer cell proliferation, migration, and invasion in vitro. a - f Loss-of-function assay with BGC-823. a Silencing effects of si-GCRL1s examined by qRT-PCR, which were normalized to human GAPDH ( n = 3). b MTT assay showing the cell multiplication of BGC-823 cells treated with si-GCRL1s 24, 48, 72, and 96 h after transfection. Results were shown as absorbance at 490 nm ( n = 3). c EdU incorporation assay indicating the cell proliferation of BGC-823 cells treated with si-GCRL1s and representative images were shown (scale bars = 50 μm). d Bar graphs of cell multiplication to c upon EdU incorporation assay and results were shown as the ratio of EdU-positive cells to Hoechst-positive cells ( n = 5). e Transwell assay assessing the mobility of BGC-823 cells after GCRL1 knockdown and representative images were shown. (scale bars = 100 μm). f Bar graphs of cell mobility to e upon transwell assay and results were shown as the number of migrated or invaded cells per field ( n = 5). Data are expressed as mean ± SD, * p
Figure Legend Snippet: Effects of GCRL1 on gastric cancer cell proliferation, migration, and invasion in vitro. a - f Loss-of-function assay with BGC-823. a Silencing effects of si-GCRL1s examined by qRT-PCR, which were normalized to human GAPDH ( n = 3). b MTT assay showing the cell multiplication of BGC-823 cells treated with si-GCRL1s 24, 48, 72, and 96 h after transfection. Results were shown as absorbance at 490 nm ( n = 3). c EdU incorporation assay indicating the cell proliferation of BGC-823 cells treated with si-GCRL1s and representative images were shown (scale bars = 50 μm). d Bar graphs of cell multiplication to c upon EdU incorporation assay and results were shown as the ratio of EdU-positive cells to Hoechst-positive cells ( n = 5). e Transwell assay assessing the mobility of BGC-823 cells after GCRL1 knockdown and representative images were shown. (scale bars = 100 μm). f Bar graphs of cell mobility to e upon transwell assay and results were shown as the number of migrated or invaded cells per field ( n = 5). Data are expressed as mean ± SD, * p

Techniques Used: Migration, In Vitro, Functional Assay, Quantitative RT-PCR, MTT Assay, Transfection, Transwell Assay

GCRL1 directly regulates the expression of miR-885-3p. a Expression levels of miR-885-3p in GC tissues, n = 26. b Expression levels of miR-885-3p in gastric cancer cell lines (SGC-7901, MGC-803, BGC-823, and AGS) and normal gastric epithelium cell line GES-1 ( n = 3). c Expression levels of miR-885-3p in BGC-823 cells transfected with si-GCRL1s ( n = 3). d Expression levels of miR-885-3p in MGC-803 cells with GCRL1 overexpression ( n = 3). e Expression levels of miR-885-3p in mice tumor tissues, n = 6 in each group. f Prediction of the binding sites between GCRL1 and miR-885-3p by RNAhybrid. g Dual luciferase reporter assay assessing the direct binding between GCRL1 and miR-885-3p in HEK-293T cells ( n = 3). h Detection of GCRL1 by qRT-PCR in BGC-823 cells transfected with Bio-885, Bio-885 mut, or Bio-nc by RNA pull-down assay and results were normalized to human GAPDH ( n = 3). Data are expressed as mean ± SD, * p
Figure Legend Snippet: GCRL1 directly regulates the expression of miR-885-3p. a Expression levels of miR-885-3p in GC tissues, n = 26. b Expression levels of miR-885-3p in gastric cancer cell lines (SGC-7901, MGC-803, BGC-823, and AGS) and normal gastric epithelium cell line GES-1 ( n = 3). c Expression levels of miR-885-3p in BGC-823 cells transfected with si-GCRL1s ( n = 3). d Expression levels of miR-885-3p in MGC-803 cells with GCRL1 overexpression ( n = 3). e Expression levels of miR-885-3p in mice tumor tissues, n = 6 in each group. f Prediction of the binding sites between GCRL1 and miR-885-3p by RNAhybrid. g Dual luciferase reporter assay assessing the direct binding between GCRL1 and miR-885-3p in HEK-293T cells ( n = 3). h Detection of GCRL1 by qRT-PCR in BGC-823 cells transfected with Bio-885, Bio-885 mut, or Bio-nc by RNA pull-down assay and results were normalized to human GAPDH ( n = 3). Data are expressed as mean ± SD, * p

Techniques Used: Expressing, Transfection, Over Expression, Mouse Assay, Binding Assay, Luciferase, Reporter Assay, Quantitative RT-PCR, Pull Down Assay

Inhibition of GCRL1 suppresses GC proliferation and metastasis in vivo. a Tumor growth curves from day 9 to 29 after subcutaneous injection, with tumor volume calculated as 1/2 × length × width 2 cm 3 . b Morphology of mice tumors dissected at day 29 after injection, n = 6 each group. c Tumor weight at day 29, n = 6 each group. d Expression levels of GCRL1 in mice tumor tissues detected by qRT-PCR, normalized to human GAPDH, n = 6 each group. e Left: photographs showing typical morphology of mice lungs dissected 29 days after tail vein injection (scale bars = 500 μm, n = 6 each group). Right: visualization of the dissected mice lungs with H E staining and representative images were shown (scale bars = 100 μm). ( f ) Bar graphs showing the number of lung metastatic nodules per view, n = 6. Data are expressed as mean ± SD, * p
Figure Legend Snippet: Inhibition of GCRL1 suppresses GC proliferation and metastasis in vivo. a Tumor growth curves from day 9 to 29 after subcutaneous injection, with tumor volume calculated as 1/2 × length × width 2 cm 3 . b Morphology of mice tumors dissected at day 29 after injection, n = 6 each group. c Tumor weight at day 29, n = 6 each group. d Expression levels of GCRL1 in mice tumor tissues detected by qRT-PCR, normalized to human GAPDH, n = 6 each group. e Left: photographs showing typical morphology of mice lungs dissected 29 days after tail vein injection (scale bars = 500 μm, n = 6 each group). Right: visualization of the dissected mice lungs with H E staining and representative images were shown (scale bars = 100 μm). ( f ) Bar graphs showing the number of lung metastatic nodules per view, n = 6. Data are expressed as mean ± SD, * p

Techniques Used: Inhibition, In Vivo, Injection, Mouse Assay, Expressing, Quantitative RT-PCR, Staining

34) Product Images from "Divergent Expression Patterns in Two Vernicia Species Revealed the Potential Role of the Hub Gene VmAP2/ERF036 in Resistance to Fusarium oxysporum in Vernicia montana"

Article Title: Divergent Expression Patterns in Two Vernicia Species Revealed the Potential Role of the Hub Gene VmAP2/ERF036 in Resistance to Fusarium oxysporum in Vernicia montana

Journal: Genes

doi: 10.3390/genes7120109

Tissue specific expression analyses of 26 Vf / VmAP2 / ERF genes in Vernicia . Root (R), stem (S), leaf (L), kernel (K), stamen (St), petal (P) and bud (B) tissues were used for the expression analysis. The y -axis represents relative expression level. Primary y -axis indicates transcript levels of VmAP2/ERFs ; secondary y -axis indicates transcript levels of VfAP2/ERFs . Expression level was analyzed using qRT-PCR in triplicate.
Figure Legend Snippet: Tissue specific expression analyses of 26 Vf / VmAP2 / ERF genes in Vernicia . Root (R), stem (S), leaf (L), kernel (K), stamen (St), petal (P) and bud (B) tissues were used for the expression analysis. The y -axis represents relative expression level. Primary y -axis indicates transcript levels of VmAP2/ERFs ; secondary y -axis indicates transcript levels of VfAP2/ERFs . Expression level was analyzed using qRT-PCR in triplicate.

Techniques Used: Expressing, Quantitative RT-PCR

Expression patterns validation of 22 selected AP2/ERF genes in root tissue of Vernicia during the four infection stages. The y -axis represents relative expression level. Primary y -axis represents averaged RPKM values from three biological experiments; secondary y -axis represents the expression levels calculated from qRT-PCR analysis. Each sample was analyzed by real-time PCR in triplicate. The numbers in the x -axis represent the four stages of infection, as follows: 0, uninfected stage; 1, early stage of infection; 2, middle stage of infection; 3, late stage of infection.
Figure Legend Snippet: Expression patterns validation of 22 selected AP2/ERF genes in root tissue of Vernicia during the four infection stages. The y -axis represents relative expression level. Primary y -axis represents averaged RPKM values from three biological experiments; secondary y -axis represents the expression levels calculated from qRT-PCR analysis. Each sample was analyzed by real-time PCR in triplicate. The numbers in the x -axis represent the four stages of infection, as follows: 0, uninfected stage; 1, early stage of infection; 2, middle stage of infection; 3, late stage of infection.

Techniques Used: Expressing, Infection, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

( left ) Expression trend in response to F. oxysporum . The numbers in the x -axis represent the four stages of infection, as follows: 0, uninfected stage; 1, early stage of infection; 2, middle stage of infection; 3, late stage of infection. ( right ) Tissue specific expression pattern analysis of VfAP2 / ERF036 / VmAP2 / ERF036 in root (R), stem (S), leaf (L), kernel (K), stamen (St), petal (P) and bud (B) tissues. The y -axis represents relative expression level. Expression level was analyzed using qRT-PCR in triplicate.
Figure Legend Snippet: ( left ) Expression trend in response to F. oxysporum . The numbers in the x -axis represent the four stages of infection, as follows: 0, uninfected stage; 1, early stage of infection; 2, middle stage of infection; 3, late stage of infection. ( right ) Tissue specific expression pattern analysis of VfAP2 / ERF036 / VmAP2 / ERF036 in root (R), stem (S), leaf (L), kernel (K), stamen (St), petal (P) and bud (B) tissues. The y -axis represents relative expression level. Expression level was analyzed using qRT-PCR in triplicate.

Techniques Used: Expressing, Infection, Quantitative RT-PCR

35) Product Images from "Interferon α Induces the Apoptosis of Cervical Cancer HeLa Cells by Activating both the Intrinsic Mitochondrial Pathway and Endoplasmic Reticulum Stress-Induced Pathway"

Article Title: Interferon α Induces the Apoptosis of Cervical Cancer HeLa Cells by Activating both the Intrinsic Mitochondrial Pathway and Endoplasmic Reticulum Stress-Induced Pathway

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms17111832

Knocking down the endogenous caspase 4 expression by caspase 4 small interfering RNA (siCasp 4) reduces IFN-α-mediated HeLa cell apoptosis. ( A ) The inhibitory effect of siCasp 4 on endogenous caspase 4 mRNA expression. HeLa cells were transiently transfected with increasing doses (0, 2, and 4 μg) of siCasp 4 for 48 h. Real-time qRT-PCR was conducted to measure the endogenous levels of caspase 4 mRNAs. Each value is represented as mean± SD from three independent experiments. After statistical analysis, results were considered to be significant if p
Figure Legend Snippet: Knocking down the endogenous caspase 4 expression by caspase 4 small interfering RNA (siCasp 4) reduces IFN-α-mediated HeLa cell apoptosis. ( A ) The inhibitory effect of siCasp 4 on endogenous caspase 4 mRNA expression. HeLa cells were transiently transfected with increasing doses (0, 2, and 4 μg) of siCasp 4 for 48 h. Real-time qRT-PCR was conducted to measure the endogenous levels of caspase 4 mRNAs. Each value is represented as mean± SD from three independent experiments. After statistical analysis, results were considered to be significant if p

Techniques Used: Expressing, Small Interfering RNA, Transfection, Quantitative RT-PCR, IF-P

36) Product Images from "The ABA-induced soybean ERF transcription factor gene GmERF75 plays a role in enhancing osmotic stress tolerance in Arabidopsis and soybean"

Article Title: The ABA-induced soybean ERF transcription factor gene GmERF75 plays a role in enhancing osmotic stress tolerance in Arabidopsis and soybean

Journal: BMC Plant Biology

doi: 10.1186/s12870-019-2066-6

Changes in GmERF75 expression in response to abiotic stress treatments and exogenous hormones. The kinetics of GmERF75 mRNA accumulation were evaluated for hypocotyl and root of 14-day-old seedlings subjected to the abiotic stress treatments drought ( a ), NaCl ( b ), high temperature ( c ), and low temperature ( d ), or treated with the exogenous hormones ethylene (ET, e ), jasmonate (JA, f ), and salicylic acid (SA, g ). The total RNA was extracted 0, 0.5, 1, 2, 5, 12, and 24 h after each treatment and used for qRT-PCR. The data was shown as the means±SD of three biological replicates
Figure Legend Snippet: Changes in GmERF75 expression in response to abiotic stress treatments and exogenous hormones. The kinetics of GmERF75 mRNA accumulation were evaluated for hypocotyl and root of 14-day-old seedlings subjected to the abiotic stress treatments drought ( a ), NaCl ( b ), high temperature ( c ), and low temperature ( d ), or treated with the exogenous hormones ethylene (ET, e ), jasmonate (JA, f ), and salicylic acid (SA, g ). The total RNA was extracted 0, 0.5, 1, 2, 5, 12, and 24 h after each treatment and used for qRT-PCR. The data was shown as the means±SD of three biological replicates

Techniques Used: Expressing, Quantitative RT-PCR

ABA-induced Group VII ERF genes expression. 14-day-old soybean seedlings were treated with ABA and collected the hypocotyl and roots 0, 0.5, 1, 2, 4, 8, 12 h after treatment for RNA extraction and qRT-PCR. Expression levels of the 12 Group VII ERFs in response to ABA treatment were revealed by qRT-PCR. The data was shown as the means±SD of three biological replicates
Figure Legend Snippet: ABA-induced Group VII ERF genes expression. 14-day-old soybean seedlings were treated with ABA and collected the hypocotyl and roots 0, 0.5, 1, 2, 4, 8, 12 h after treatment for RNA extraction and qRT-PCR. Expression levels of the 12 Group VII ERFs in response to ABA treatment were revealed by qRT-PCR. The data was shown as the means±SD of three biological replicates

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

37) Product Images from "MicroRNA-146a-5p attenuates irradiation-induced and LPS-induced hepatic stellate cell activation and hepatocyte apoptosis through inhibition of TLR4 pathway"

Article Title: MicroRNA-146a-5p attenuates irradiation-induced and LPS-induced hepatic stellate cell activation and hepatocyte apoptosis through inhibition of TLR4 pathway

Journal: Cell Death & Disease

doi: 10.1038/s41419-017-0038-z

miR-146a-5p attenuates RILD in mice. a qRT-PCR analysis showed the expression levels of miR-146a-5p in the liver tissue and primary HSCs of mice in each group. Data are presented as the mean ± standard deviation (SD) ( n = 3 mice). * P
Figure Legend Snippet: miR-146a-5p attenuates RILD in mice. a qRT-PCR analysis showed the expression levels of miR-146a-5p in the liver tissue and primary HSCs of mice in each group. Data are presented as the mean ± standard deviation (SD) ( n = 3 mice). * P

Techniques Used: Mouse Assay, Quantitative RT-PCR, Expressing, Standard Deviation

miR-146a-5p negatively regulates TLR4 signaling in primary HSCs. a qRT-PCR analysis showed the expression levels of pro-inflammatory cytokines, TLR4, IRAK1, TRAF6, and α-SMA in primary HSCs of mice in each group. Data are presented as the mean ± SD ( n = 3 mice). * P
Figure Legend Snippet: miR-146a-5p negatively regulates TLR4 signaling in primary HSCs. a qRT-PCR analysis showed the expression levels of pro-inflammatory cytokines, TLR4, IRAK1, TRAF6, and α-SMA in primary HSCs of mice in each group. Data are presented as the mean ± SD ( n = 3 mice). * P

Techniques Used: Quantitative RT-PCR, Expressing, Mouse Assay

Irradiation and LPS stimulation induces TLR4 and miR-146a-5p expression in LX2 cells. a and b qRT-PCR analysis showed the expression of TLR4 in LX2 cells at 24 h a or 48 h b after irradiation and LPS stimulation under various conditions, as indicated. c – f LX2 cells were treated with 8 Gy X-ray irradiation and 50 ng/ml LPS for 24 or 48 h and then qRT-PCR was performed to detect the expression levels of IRAK1 c , TRAF6 d , Bcl-2 e and α-SMA f. g miR-146a-5p expression was examined by qRT-PCR at 24 h after irradiation and LPS stimulation under various conditions, as indicated. h miR-146a-5p expression was assessed by qRT-PCR after treatment with 8 Gy X ray irradiation and 50 ng/ml LPS for the indicated time periods. All data are presented as the mean ± S.E.M. of three independent experiments. * P
Figure Legend Snippet: Irradiation and LPS stimulation induces TLR4 and miR-146a-5p expression in LX2 cells. a and b qRT-PCR analysis showed the expression of TLR4 in LX2 cells at 24 h a or 48 h b after irradiation and LPS stimulation under various conditions, as indicated. c – f LX2 cells were treated with 8 Gy X-ray irradiation and 50 ng/ml LPS for 24 or 48 h and then qRT-PCR was performed to detect the expression levels of IRAK1 c , TRAF6 d , Bcl-2 e and α-SMA f. g miR-146a-5p expression was examined by qRT-PCR at 24 h after irradiation and LPS stimulation under various conditions, as indicated. h miR-146a-5p expression was assessed by qRT-PCR after treatment with 8 Gy X ray irradiation and 50 ng/ml LPS for the indicated time periods. All data are presented as the mean ± S.E.M. of three independent experiments. * P

Techniques Used: Irradiation, Expressing, Quantitative RT-PCR

Knockdown of IRAK1 or TRAF6 suppressed the production of pro-inflammatory cytokines and cell activation in irradiated and LPS-stimulated LX2 cells. LX2 cells were treated with siRNA against IRAK1 or TRAF6 together with miR-146a-5p inhibitors and then subjected to 8 Gy X-ray irradiation and 50 ng/ml LPS treatment. a and b CCK8 assay showed the proliferation of LX2 cells transfected with si-IRAK1 a or si-TRAF6 b . c and d Apoptosis analysis of LX2 cells transfected with si-IRAK1 c or si-TRAF6 ( d ). e and f Secretion levels of IL-1β, IL-6, and TNF-α in LX2 cells transfected with si-IRAK1 e or si-TRAF6 f . g and h qRT-PCR analysis showed the expression of IRAK1, TRAF6, Bcl-2, or α-SMA in LX2 cells transfected with si-IRAK1 g or si-TRAF6 h . i Representative western blots showed the expression of IRAK1 and TRAF6, phosphorylation of NF-κB p65, and the expression of apoptosis-related proteins in LX2 cells. j Representative western blots showed the phosphorylation levels of JNK and Smad2 and the expression of α-SMA in LX2 cells. k and l Immunofluorescence staining showed NF-κB p65 nuclear translation (indicated by arrows) in LX2 cells transfected with si-IRAK1 k or si-TRAF6 l . Scale bar: 100 μm. All data are presented as the mean ± S.E.M. of three independent experiments. * P
Figure Legend Snippet: Knockdown of IRAK1 or TRAF6 suppressed the production of pro-inflammatory cytokines and cell activation in irradiated and LPS-stimulated LX2 cells. LX2 cells were treated with siRNA against IRAK1 or TRAF6 together with miR-146a-5p inhibitors and then subjected to 8 Gy X-ray irradiation and 50 ng/ml LPS treatment. a and b CCK8 assay showed the proliferation of LX2 cells transfected with si-IRAK1 a or si-TRAF6 b . c and d Apoptosis analysis of LX2 cells transfected with si-IRAK1 c or si-TRAF6 ( d ). e and f Secretion levels of IL-1β, IL-6, and TNF-α in LX2 cells transfected with si-IRAK1 e or si-TRAF6 f . g and h qRT-PCR analysis showed the expression of IRAK1, TRAF6, Bcl-2, or α-SMA in LX2 cells transfected with si-IRAK1 g or si-TRAF6 h . i Representative western blots showed the expression of IRAK1 and TRAF6, phosphorylation of NF-κB p65, and the expression of apoptosis-related proteins in LX2 cells. j Representative western blots showed the phosphorylation levels of JNK and Smad2 and the expression of α-SMA in LX2 cells. k and l Immunofluorescence staining showed NF-κB p65 nuclear translation (indicated by arrows) in LX2 cells transfected with si-IRAK1 k or si-TRAF6 l . Scale bar: 100 μm. All data are presented as the mean ± S.E.M. of three independent experiments. * P

Techniques Used: Activation Assay, Irradiation, CCK-8 Assay, Transfection, Quantitative RT-PCR, Expressing, Western Blot, Immunofluorescence, Staining

Overexpression of miR-146a-5p inhibited the activation of TLR4 signaling in LX2 cells after irradiation and LPS stimulation. LX2 cells were transfected with miR-146a-5p mimics or inhibitors and then subjected to 8 Gy X-ray irradiation with or without 50 ng/ml LPS treatment. a qRT-PCR analysis showed the expression levels of TLR4, its downstream genes, and α-SMA in LX2 cells. Data are presented as the mean ± S.E.M. of three independent experiments. * P
Figure Legend Snippet: Overexpression of miR-146a-5p inhibited the activation of TLR4 signaling in LX2 cells after irradiation and LPS stimulation. LX2 cells were transfected with miR-146a-5p mimics or inhibitors and then subjected to 8 Gy X-ray irradiation with or without 50 ng/ml LPS treatment. a qRT-PCR analysis showed the expression levels of TLR4, its downstream genes, and α-SMA in LX2 cells. Data are presented as the mean ± S.E.M. of three independent experiments. * P

Techniques Used: Over Expression, Activation Assay, Irradiation, Transfection, Quantitative RT-PCR, Expressing

38) Product Images from "A wheat caffeic acid 3-O-methyltransferase TaCOMT-3D positively contributes to both resistance to sharp eyespot disease and stem mechanical strength"

Article Title: A wheat caffeic acid 3-O-methyltransferase TaCOMT-3D positively contributes to both resistance to sharp eyespot disease and stem mechanical strength

Journal: Scientific Reports

doi: 10.1038/s41598-018-24884-0

Transcription of TaCOMT-3D in wheat ( Triticum aestivum ). ( A ) Expression patterns of TaCOMT-3D in five wheat cultivars with different degrees of resistance to Rhizoctonia cerealis . The expression level of TaCOMT-3D in the Wenmai 6 plants inoculated with R . cerealis for 21 days was set to 1. DI indicates disease index of sharp eyespot. (B) qRT-PCR analysis of R . cerealis Actin ( RcActin ) gene in CI12633 plants inoculated with R. cerealis at the indicated time. (C) qRT-PCR analysis of TaCOMT-3D induction by R . cerealis inoculation in CI12633 plants. The expression level of TaCOMT-3D at 0 day post inoculation (dpi) with R . cerealis is set to 1. (D) Transcription of TaCOMT-3D in roots, stems, leaves, sheaths, and spikes of Yangmai 16 and CI12633 plants. The transcriptional level of TaCOMT-3D in leaves was set to 1. Statistically significant differences are derived from the results of three independent replications ( t -test: **P
Figure Legend Snippet: Transcription of TaCOMT-3D in wheat ( Triticum aestivum ). ( A ) Expression patterns of TaCOMT-3D in five wheat cultivars with different degrees of resistance to Rhizoctonia cerealis . The expression level of TaCOMT-3D in the Wenmai 6 plants inoculated with R . cerealis for 21 days was set to 1. DI indicates disease index of sharp eyespot. (B) qRT-PCR analysis of R . cerealis Actin ( RcActin ) gene in CI12633 plants inoculated with R. cerealis at the indicated time. (C) qRT-PCR analysis of TaCOMT-3D induction by R . cerealis inoculation in CI12633 plants. The expression level of TaCOMT-3D at 0 day post inoculation (dpi) with R . cerealis is set to 1. (D) Transcription of TaCOMT-3D in roots, stems, leaves, sheaths, and spikes of Yangmai 16 and CI12633 plants. The transcriptional level of TaCOMT-3D in leaves was set to 1. Statistically significant differences are derived from the results of three independent replications ( t -test: **P

Techniques Used: Expressing, Quantitative RT-PCR, Derivative Assay

Silencing of TaCOMT-3D by barley stripe mosaic virus (BSMV)-induced gene silencing impairs CI12633 resistance to Rhizoctonia cerealis . ( A ) Scheme of genomic RNAs of BSMV construct and the construct of the recombinant virus expressing the wheat ( Triticum aestivum ) gene TaCOMT-3D , BSMV:TaCOMT-3D. The orientation of the TaCOMT-3D insert is indicated by dark boxes. ( B ) Mild chlorotic mosaic symptoms were observed on leaves at 10 days post inoculated (dpi) with BSMV: GFP or BSMV:TaCOMT-3D. ( C ) RT-PCR analysis of the transcription levels of BSMV coat protein encoding gene CP in the wheat plants infected by BSMV: GFP or BSMV:TaCOMT-3D at 10 dpi with R . cerealis . ( D ) qRT-PCR analysis of the transcription levels of wheat TaCOMT-3D gene in the wheat plants infected by BSMV: GFP or BSMV:TaCOMT-3D at after infection with R . cerealis . The relative transcript level of TaCOMT-3D in BSMV:TaCOMT-3D-infected ( TaCOMT-3D -silencing) wheat CI12633 plants is relative to that in BSMV: GFP-infected (control) plants (set to 1). Significant differences were analyzed based on three replications ( t -test: **P
Figure Legend Snippet: Silencing of TaCOMT-3D by barley stripe mosaic virus (BSMV)-induced gene silencing impairs CI12633 resistance to Rhizoctonia cerealis . ( A ) Scheme of genomic RNAs of BSMV construct and the construct of the recombinant virus expressing the wheat ( Triticum aestivum ) gene TaCOMT-3D , BSMV:TaCOMT-3D. The orientation of the TaCOMT-3D insert is indicated by dark boxes. ( B ) Mild chlorotic mosaic symptoms were observed on leaves at 10 days post inoculated (dpi) with BSMV: GFP or BSMV:TaCOMT-3D. ( C ) RT-PCR analysis of the transcription levels of BSMV coat protein encoding gene CP in the wheat plants infected by BSMV: GFP or BSMV:TaCOMT-3D at 10 dpi with R . cerealis . ( D ) qRT-PCR analysis of the transcription levels of wheat TaCOMT-3D gene in the wheat plants infected by BSMV: GFP or BSMV:TaCOMT-3D at after infection with R . cerealis . The relative transcript level of TaCOMT-3D in BSMV:TaCOMT-3D-infected ( TaCOMT-3D -silencing) wheat CI12633 plants is relative to that in BSMV: GFP-infected (control) plants (set to 1). Significant differences were analyzed based on three replications ( t -test: **P

Techniques Used: Construct, Recombinant, Expressing, Reverse Transcription Polymerase Chain Reaction, Infection, Quantitative RT-PCR

39) Product Images from "PARP inhibitor increases chemosensitivity by upregulating miR-664b-5p in BRCA1-mutated triple-negative breast cancer"

Article Title: PARP inhibitor increases chemosensitivity by upregulating miR-664b-5p in BRCA1-mutated triple-negative breast cancer

Journal: Scientific Reports

doi: 10.1038/srep42319

miR-664b-5p overexpression suppresses cell growth, migration and invasion. ( A ) The efficiency of miR-664b-5p overexpression and inhibition in BRCA1-mutated TNBC cell lines was measured with qRT-PCR. ( B ) The influence of miR-664b-5p on the cell growth of BRCA1-mutated TNBC cells was measured with an MTT assay. ( C ) The representative images of cell apoptosis analysed by flow cytometry using Annexin V and PI staining. The apoptotic rate in MDA-MB-436 and HCC1937 cells transfected with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( D ) Representative images of the cell cycle analysis by flow cytometry using Annexin V and PI staining. The cell-cycle phase distribution of MDA-MB-436 and HCC1937 cells transfected with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( E ) Wound-healing assays in MDA-MB-436 and HCC1937 cells were performed after transduction with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( F ) Representative results of the Transwell assays showing the effect of miR-664b-5p expression on the invasion ability in MDA-MB-436 and HCC1937 cells. *p
Figure Legend Snippet: miR-664b-5p overexpression suppresses cell growth, migration and invasion. ( A ) The efficiency of miR-664b-5p overexpression and inhibition in BRCA1-mutated TNBC cell lines was measured with qRT-PCR. ( B ) The influence of miR-664b-5p on the cell growth of BRCA1-mutated TNBC cells was measured with an MTT assay. ( C ) The representative images of cell apoptosis analysed by flow cytometry using Annexin V and PI staining. The apoptotic rate in MDA-MB-436 and HCC1937 cells transfected with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( D ) Representative images of the cell cycle analysis by flow cytometry using Annexin V and PI staining. The cell-cycle phase distribution of MDA-MB-436 and HCC1937 cells transfected with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( E ) Wound-healing assays in MDA-MB-436 and HCC1937 cells were performed after transduction with miR-NC, miR-664b-5p, or anti-miR-664b-5p. ( F ) Representative results of the Transwell assays showing the effect of miR-664b-5p expression on the invasion ability in MDA-MB-436 and HCC1937 cells. *p

Techniques Used: Over Expression, Migration, Inhibition, Quantitative RT-PCR, MTT Assay, Flow Cytometry, Cytometry, Staining, Multiple Displacement Amplification, Transfection, Cell Cycle Assay, Transduction, Expressing

CCNE2 is a direct downstream target of miR-664b-5p. ( A ) The nucleotide sequences of miR-664b-5p and the complementary sequence in CCNE2 mRNA revealed a potential binding site. ( B ) Western blot analysis of cyclin E2 protein in miR-664b-5p overexpressing cells. GAPDH expression was used as the loading control. ( C ) qRT-PCR detection of CCNE2 mRNA expression in MDA-MB-436 and HCC1937 cells transfected with miR-664b-5p or miR-NC. ( D ) Relative luciferase activity was analysed after wild-type or mutant 3′-UTR reporter plasmids were cotransfected with miR-664b-5p or miR-NC in HCC1937 cells. ( E ) Fluorescence microscopy analysis of the expression of cyclin E2 by immunofluorescence. The green signal represents the staining of the cyclin E2 protein, and the blue signal represents the nuclear DNA staining by DAPI. *p
Figure Legend Snippet: CCNE2 is a direct downstream target of miR-664b-5p. ( A ) The nucleotide sequences of miR-664b-5p and the complementary sequence in CCNE2 mRNA revealed a potential binding site. ( B ) Western blot analysis of cyclin E2 protein in miR-664b-5p overexpressing cells. GAPDH expression was used as the loading control. ( C ) qRT-PCR detection of CCNE2 mRNA expression in MDA-MB-436 and HCC1937 cells transfected with miR-664b-5p or miR-NC. ( D ) Relative luciferase activity was analysed after wild-type or mutant 3′-UTR reporter plasmids were cotransfected with miR-664b-5p or miR-NC in HCC1937 cells. ( E ) Fluorescence microscopy analysis of the expression of cyclin E2 by immunofluorescence. The green signal represents the staining of the cyclin E2 protein, and the blue signal represents the nuclear DNA staining by DAPI. *p

Techniques Used: Sequencing, Binding Assay, Western Blot, Expressing, Quantitative RT-PCR, Multiple Displacement Amplification, Transfection, Luciferase, Activity Assay, Mutagenesis, Fluorescence, Microscopy, Immunofluorescence, Staining

Effect of miR-664b-5p on tumour growth in vivo . ( A ) The gross morphology of tumours and the final xenograft tumour weights measured on day 42 after injection of tumour cells. ( B ) Effect of miR-664b-5p on tumour growth in vivo . Growth curves of HCC1937 subcutaneous xenograft tumours treated with miR-664b-5p or miR-NC. Tumour volumes were calculated as (long axis × short axis 2 )/2; n = 8 per group. ( C ) qRT-PCR detection of CCNE2 mRNA expression in two groups of tumour xenografts. ( D ) Representative images of the expression of cyclin E2, Ki67 and active caspase-3 in two groups of tumour xenografts determined by IHC. ( E , F ) Representative images of cyclin E2 high-expression (IHC) and miR-664b-5p low-expression (FISH) (E) or cyclin E2 low-expression and miR-664b-5p high-expression ( F ) in TNBC patient specimens. *p
Figure Legend Snippet: Effect of miR-664b-5p on tumour growth in vivo . ( A ) The gross morphology of tumours and the final xenograft tumour weights measured on day 42 after injection of tumour cells. ( B ) Effect of miR-664b-5p on tumour growth in vivo . Growth curves of HCC1937 subcutaneous xenograft tumours treated with miR-664b-5p or miR-NC. Tumour volumes were calculated as (long axis × short axis 2 )/2; n = 8 per group. ( C ) qRT-PCR detection of CCNE2 mRNA expression in two groups of tumour xenografts. ( D ) Representative images of the expression of cyclin E2, Ki67 and active caspase-3 in two groups of tumour xenografts determined by IHC. ( E , F ) Representative images of cyclin E2 high-expression (IHC) and miR-664b-5p low-expression (FISH) (E) or cyclin E2 low-expression and miR-664b-5p high-expression ( F ) in TNBC patient specimens. *p

Techniques Used: In Vivo, Injection, Quantitative RT-PCR, Expressing, Immunohistochemistry, Fluorescence In Situ Hybridization

40) Product Images from "Hepatitis B virus X protein (HBx)-induced abnormalities of nucleic acid metabolism revealed by 1H-NMR-based metabonomics"

Article Title: Hepatitis B virus X protein (HBx)-induced abnormalities of nucleic acid metabolism revealed by 1H-NMR-based metabonomics

Journal: Scientific Reports

doi: 10.1038/srep24430

HBx affected gene expression profiles of cells. ( a ) Shows the expression profiles of mRNA (left) and DNA damage-related genes (right). Green or red on the heat map indicated a decrease or an increase in the mRNA level and color intensities correspond to relative signal levels on a logarithmic scale. ( b ) qRT-PCR validation of representative mRNA. Data were normalized to GAPDH and represent the mean of three experimental replicates. *indicates a significant difference between cells infected Ad-N and Ad-HBx by Student’s t test ( p
Figure Legend Snippet: HBx affected gene expression profiles of cells. ( a ) Shows the expression profiles of mRNA (left) and DNA damage-related genes (right). Green or red on the heat map indicated a decrease or an increase in the mRNA level and color intensities correspond to relative signal levels on a logarithmic scale. ( b ) qRT-PCR validation of representative mRNA. Data were normalized to GAPDH and represent the mean of three experimental replicates. *indicates a significant difference between cells infected Ad-N and Ad-HBx by Student’s t test ( p

Techniques Used: Expressing, Quantitative RT-PCR, Infection

41) Product Images from "Ubiquitin Ligase ATL31 Functions in Leaf Senescence in Response to the Balance Between Atmospheric CO2 and Nitrogen Availability in Arabidopsis"

Article Title: Ubiquitin Ligase ATL31 Functions in Leaf Senescence in Response to the Balance Between Atmospheric CO2 and Nitrogen Availability in Arabidopsis

Journal: Plant and Cell Physiology

doi: 10.1093/pcp/pcu002

Relative expression levels of C/N- and senescence-related genes. Expression levels in WT plants grown in each CO 2 /N medium were analyzed by qRT–PCR. Total RNA was purified from WT plants grown for 2.5 weeks after transfer to each CO 2 /N condition; namely, 280 or 780 p.p.m. CO 2 (LCO 2 or HCO 2 ) and 0.3 or 3 mM nitrogen (LN or HN). Relative expression levels were compared with WT plants grown under control CO 2 /N (LCO 2 /HN) condition. Means ± SD of three independent experiments with two technical replicates are shown. An asterisk indicates significant differences compared with the WT grown under the control CO 2 /N condition as determined by Dunnet analysis ( P
Figure Legend Snippet: Relative expression levels of C/N- and senescence-related genes. Expression levels in WT plants grown in each CO 2 /N medium were analyzed by qRT–PCR. Total RNA was purified from WT plants grown for 2.5 weeks after transfer to each CO 2 /N condition; namely, 280 or 780 p.p.m. CO 2 (LCO 2 or HCO 2 ) and 0.3 or 3 mM nitrogen (LN or HN). Relative expression levels were compared with WT plants grown under control CO 2 /N (LCO 2 /HN) condition. Means ± SD of three independent experiments with two technical replicates are shown. An asterisk indicates significant differences compared with the WT grown under the control CO 2 /N condition as determined by Dunnet analysis ( P

Techniques Used: Expressing, Quantitative RT-PCR, Purification

Relative expression levels of C/N- and senescence-related genes. Expression levels of C/N- and senescence-related genes in WT plants grown in each C/N medium were analyzed by qRT–PCR. Total RNA was purified from WT plants 24 h after transfer to C/N medium containing 100 or 200 mM glucose (LC or HC) and 0.3 or 30 mM nitrogen (LN or HN) from control medium (LC/HN). Relative expression levels were compared with those of WT plants grown in control C/N medium. Means ± SD of three independent experiments are shown. An asterisk indicates significant differences compared with the WT in the control C/N condition as determined by Dunnet analysis ( P
Figure Legend Snippet: Relative expression levels of C/N- and senescence-related genes. Expression levels of C/N- and senescence-related genes in WT plants grown in each C/N medium were analyzed by qRT–PCR. Total RNA was purified from WT plants 24 h after transfer to C/N medium containing 100 or 200 mM glucose (LC or HC) and 0.3 or 30 mM nitrogen (LN or HN) from control medium (LC/HN). Relative expression levels were compared with those of WT plants grown in control C/N medium. Means ± SD of three independent experiments are shown. An asterisk indicates significant differences compared with the WT in the control C/N condition as determined by Dunnet analysis ( P

Techniques Used: Expressing, Quantitative RT-PCR, Purification

Physiological function of ATL31 in leaf senescence. (A) The expression pattern of ATL31 is shown as researched using the publicly accessible microarray database. Age-dependent expression (eFP browser; http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi ) (upper panel) and co-expression with WRKY53 (Genevestigator; https://www.genevestigator.com/gv/index.jsp ) (lower panel) were analyzed for the ATL31 gene. (B) Expression levels of the ATL31 gene in WT plants grown under each CO 2 /N condition were analyzed by qRT–PCR. Relative expression levels were compared with the control CO 2 /N condition (LCO 2 /HN). Means ± SD of three independent experiments with two technical replicates are shown. An asterisk indicates significant differences compared with the WT grown under the control CO 2 /N condition as determined by Dunnet analysis ( P
Figure Legend Snippet: Physiological function of ATL31 in leaf senescence. (A) The expression pattern of ATL31 is shown as researched using the publicly accessible microarray database. Age-dependent expression (eFP browser; http://bbc.botany.utoronto.ca/efp/cgi-bin/efpWeb.cgi ) (upper panel) and co-expression with WRKY53 (Genevestigator; https://www.genevestigator.com/gv/index.jsp ) (lower panel) were analyzed for the ATL31 gene. (B) Expression levels of the ATL31 gene in WT plants grown under each CO 2 /N condition were analyzed by qRT–PCR. Relative expression levels were compared with the control CO 2 /N condition (LCO 2 /HN). Means ± SD of three independent experiments with two technical replicates are shown. An asterisk indicates significant differences compared with the WT grown under the control CO 2 /N condition as determined by Dunnet analysis ( P

Techniques Used: Expressing, Microarray, Quantitative RT-PCR

42) Product Images from "Expression profiling of Chrysanthemum crassum under salinity stress and the initiation of morphological changes"

Article Title: Expression profiling of Chrysanthemum crassum under salinity stress and the initiation of morphological changes

Journal: PLoS ONE

doi: 10.1371/journal.pone.0175972

qRT-PCR analyses of unigene responses to salinity stress. The transcript abundance and expression patterns of selected genes were measured by qRT-PCR and RNA-seq at 12 h and 24 h and were compared with those at 0 h (Fig 5A). The transcript abundances of the selected genes were measured by qRT-PCR at 1 h, 6 h, 12 h, 24 h and 48 h and compared with those at 0 h (Fig 5B). RNA-seq values are the log2 values of the RPKMs of two libraries; the qRT-PCR values were determined via qPCR using the –ΔΔCT values.
Figure Legend Snippet: qRT-PCR analyses of unigene responses to salinity stress. The transcript abundance and expression patterns of selected genes were measured by qRT-PCR and RNA-seq at 12 h and 24 h and were compared with those at 0 h (Fig 5A). The transcript abundances of the selected genes were measured by qRT-PCR at 1 h, 6 h, 12 h, 24 h and 48 h and compared with those at 0 h (Fig 5B). RNA-seq values are the log2 values of the RPKMs of two libraries; the qRT-PCR values were determined via qPCR using the –ΔΔCT values.

Techniques Used: Quantitative RT-PCR, Expressing, RNA Sequencing Assay, Real-time Polymerase Chain Reaction

43) Product Images from "Overexpression of FoxM1 predicts poor prognosis of intrahepatic cholangiocarcinoma"

Article Title: Overexpression of FoxM1 predicts poor prognosis of intrahepatic cholangiocarcinoma

Journal: Aging (Albany NY)

doi: 10.18632/aging.101706

Selection and establishment of stably transfected ICC cell lines with FoxM1. ( A ) The protein and mRNA expression of FoxM1 in ICC cell lines (HCCC-9810, RBE, and SSP-25). Western blotting and qRT-PCR analysis showed successful overexpression ( B ) and knockdown ( C ) of FoxM1 in ICC cells (HCCC-9810 and SSP-25, respectively). *** P
Figure Legend Snippet: Selection and establishment of stably transfected ICC cell lines with FoxM1. ( A ) The protein and mRNA expression of FoxM1 in ICC cell lines (HCCC-9810, RBE, and SSP-25). Western blotting and qRT-PCR analysis showed successful overexpression ( B ) and knockdown ( C ) of FoxM1 in ICC cells (HCCC-9810 and SSP-25, respectively). *** P

Techniques Used: Selection, Stable Transfection, Transfection, Immunocytochemistry, Expressing, Western Blot, Quantitative RT-PCR, Over Expression

44) Product Images from "Overexpression of a New Zinc Finger Protein Transcription Factor OsCTZFP8 Improves Cold Tolerance in Rice"

Article Title: Overexpression of a New Zinc Finger Protein Transcription Factor OsCTZFP8 Improves Cold Tolerance in Rice

Journal: International Journal of Genomics

doi: 10.1155/2018/5480617

Expression patterns of OsCTZFP8 transcript in response to abiotic stresses. qRT-PCR was performed with 2-week-old NT plants exposed to cold (4°C), ABA (5 μ M), and NaCl (250 mM) treatments at different time points. The expression of eEF1α was used as an internal control. Data present the means ± SE of two biological replicates.
Figure Legend Snippet: Expression patterns of OsCTZFP8 transcript in response to abiotic stresses. qRT-PCR was performed with 2-week-old NT plants exposed to cold (4°C), ABA (5 μ M), and NaCl (250 mM) treatments at different time points. The expression of eEF1α was used as an internal control. Data present the means ± SE of two biological replicates.

Techniques Used: Expressing, Quantitative RT-PCR

Spatial expression pattern of OsCTZFP8 . qRT-PCR was performed with total RNA isolated from different organs of wild-type rice under normal conditions. The expression of eEF1α was used as an internal control. Data present the means ± SE of two biological replicates.
Figure Legend Snippet: Spatial expression pattern of OsCTZFP8 . qRT-PCR was performed with total RNA isolated from different organs of wild-type rice under normal conditions. The expression of eEF1α was used as an internal control. Data present the means ± SE of two biological replicates.

Techniques Used: Expressing, Quantitative RT-PCR, Isolation

45) Product Images from "Genome Wide Transcriptome Analysis Reveals Complex Regulatory Mechanisms Underlying Phosphate Homeostasis in Soybean Nodules"

Article Title: Genome Wide Transcriptome Analysis Reveals Complex Regulatory Mechanisms Underlying Phosphate Homeostasis in Soybean Nodules

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19102924

qRT-PCR analysis of ten Pi responsive genes in soybean nodules under Pi sufficient (HP) and deficient (LP) conditions. Data in the figure are mean of four replicates with standard error. Asterisks indicate significant difference between HP and LP treatments in the Student’s t -test (*: p
Figure Legend Snippet: qRT-PCR analysis of ten Pi responsive genes in soybean nodules under Pi sufficient (HP) and deficient (LP) conditions. Data in the figure are mean of four replicates with standard error. Asterisks indicate significant difference between HP and LP treatments in the Student’s t -test (*: p

Techniques Used: Quantitative RT-PCR

46) Product Images from "Transcriptome reveals the gene expression patterns of sulforaphane metabolism in broccoli florets"

Article Title: Transcriptome reveals the gene expression patterns of sulforaphane metabolism in broccoli florets

Journal: PLoS ONE

doi: 10.1371/journal.pone.0213902

RNA sequencing and qRT-PCR results of the expression genes related with sulforaphane metabolism.
Figure Legend Snippet: RNA sequencing and qRT-PCR results of the expression genes related with sulforaphane metabolism.

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing

47) Product Images from "Transcriptome profiling reveals regulatory mechanisms underlying corolla senescence in petunia"

Article Title: Transcriptome profiling reveals regulatory mechanisms underlying corolla senescence in petunia

Journal: Horticulture Research

doi: 10.1038/s41438-018-0018-1

Validation of RNA-seq data by qRT-PCR. Eighteen genes were selected and their time-course expression profiles were evaluated at specific time points. cDNA analysis was performed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) amplification with specific primers designed by PRIMER 3 (Table S1 ). Transcript levels were normalized to 26S rRNA. Data represent three independent replicates (SD, n = 5). The correlation coefficient between RNA-seq and qRT-PCR was listed on the left corner of each gene expression figure
Figure Legend Snippet: Validation of RNA-seq data by qRT-PCR. Eighteen genes were selected and their time-course expression profiles were evaluated at specific time points. cDNA analysis was performed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) amplification with specific primers designed by PRIMER 3 (Table S1 ). Transcript levels were normalized to 26S rRNA. Data represent three independent replicates (SD, n = 5). The correlation coefficient between RNA-seq and qRT-PCR was listed on the left corner of each gene expression figure

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification

48) Product Images from "Zinc Finger-Homeodomain Transcriptional Factors (ZHDs) in Upland Cotton (Gossypium hirsutum): Genome-Wide Identification and Expression Analysis in Fiber Development"

Article Title: Zinc Finger-Homeodomain Transcriptional Factors (ZHDs) in Upland Cotton (Gossypium hirsutum): Genome-Wide Identification and Expression Analysis in Fiber Development

Journal: Frontiers in Genetics

doi: 10.3389/fgene.2018.00357

Expression patterns of GhZHD genes at different fiber developmental stages of brown cotton obtained by performing qRT-PCR. The relative expression levels were calculated using the 2 -ΔΔCt method.
Figure Legend Snippet: Expression patterns of GhZHD genes at different fiber developmental stages of brown cotton obtained by performing qRT-PCR. The relative expression levels were calculated using the 2 -ΔΔCt method.

Techniques Used: Expressing, Quantitative RT-PCR

49) Product Images from "A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis *A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis * ♦"

Article Title: A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis *A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis * ♦

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M112.440453

rs71428439 polymorphism affects the maturation of miR-149. A, hairpin loop structure of the A- and G-allelic miR-149 precursor is different. The polymorphism site is indicated by the dots . The A→G polymorphism located in the stem region outside of the mature miR-149 sequence causes a change to the stem structure of the precursor. B and C, G allele shows a low level of mature miR-149 compared with the A allele in HEK293 cells. HEK293 cells were transfected with the plasmids of empty pcDNA3.0, pc3.0-miR-149-A, pc3.0-miR-149-G, or pc3.0-miR-423 along with pc3.0-cel-miR-39, respectively. 24 h after transfection, miR-149 and cel-miR-39 levels were analyzed by qRT-PCR ( B ). For Northern blot, the miR-149 precursor and mature miR-149 were indicated ( C ). A representative result of three independent experiments is shown. UD , undetectable. D, G allele impairs miR-149 maturation in cardiomyocytes ( CMC ). Cardiomyocytes were infected with adenoviral miR-149-A or miR-149-G, respectively. 24 h after infection, miR-149 levels were analyzed by qRT-PCR. The qRT-PCR results were normalized to that of U6. E, levels of miR-149 in human peripheral blood mononuclear cells. The qRT-PCR results were normalized to that of U6 levels. Data are shown as means ± S.E. ( n = 29–35).
Figure Legend Snippet: rs71428439 polymorphism affects the maturation of miR-149. A, hairpin loop structure of the A- and G-allelic miR-149 precursor is different. The polymorphism site is indicated by the dots . The A→G polymorphism located in the stem region outside of the mature miR-149 sequence causes a change to the stem structure of the precursor. B and C, G allele shows a low level of mature miR-149 compared with the A allele in HEK293 cells. HEK293 cells were transfected with the plasmids of empty pcDNA3.0, pc3.0-miR-149-A, pc3.0-miR-149-G, or pc3.0-miR-423 along with pc3.0-cel-miR-39, respectively. 24 h after transfection, miR-149 and cel-miR-39 levels were analyzed by qRT-PCR ( B ). For Northern blot, the miR-149 precursor and mature miR-149 were indicated ( C ). A representative result of three independent experiments is shown. UD , undetectable. D, G allele impairs miR-149 maturation in cardiomyocytes ( CMC ). Cardiomyocytes were infected with adenoviral miR-149-A or miR-149-G, respectively. 24 h after infection, miR-149 levels were analyzed by qRT-PCR. The qRT-PCR results were normalized to that of U6. E, levels of miR-149 in human peripheral blood mononuclear cells. The qRT-PCR results were normalized to that of U6 levels. Data are shown as means ± S.E. ( n = 29–35).

Techniques Used: Sequencing, Transfection, Quantitative RT-PCR, Northern Blot, Infection

rs71428439 polymorphism effects on myocardial infarction. A, analysis of miR-149 and Puma levels under myocardial infarction. Adult male C57 mice (8–10 weeks old) were injected with adenoviral β-gal, miR-149-A, or miR-149 and subjected to permanent left anterior descending coronary artery ligation. miR-149 levels were analyzed by qRT-PCR. Puma was analyzed by immunoblot. B, A and G alleles of rs71428439 polymorphism exert differential effect on cardiac function. Mice were treated as in A . Cardiac functions were evaluated by echocardiography. n = 8 per group. C, A and G alleles of rs71428439 polymorphism exert differential effect on myocardial infarction sizes. Mice were treated as in A . MI areas were calculated as the ratio of MI area to left ventricular ( LV ) area. n = 6–8 mice per group. *, p
Figure Legend Snippet: rs71428439 polymorphism effects on myocardial infarction. A, analysis of miR-149 and Puma levels under myocardial infarction. Adult male C57 mice (8–10 weeks old) were injected with adenoviral β-gal, miR-149-A, or miR-149 and subjected to permanent left anterior descending coronary artery ligation. miR-149 levels were analyzed by qRT-PCR. Puma was analyzed by immunoblot. B, A and G alleles of rs71428439 polymorphism exert differential effect on cardiac function. Mice were treated as in A . Cardiac functions were evaluated by echocardiography. n = 8 per group. C, A and G alleles of rs71428439 polymorphism exert differential effect on myocardial infarction sizes. Mice were treated as in A . MI areas were calculated as the ratio of MI area to left ventricular ( LV ) area. n = 6–8 mice per group. *, p

Techniques Used: Mouse Assay, Injection, Ligation, Quantitative RT-PCR

50) Product Images from "Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia"

Article Title: Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia

Journal: BMC Plant Biology

doi: 10.1186/s12870-018-1235-3

Expression patterns of CiWRKYs under drought treatment. Samples were collected from the shoots of one-month-old C. intermedia seedlings at 0.5, 1, 3, 6, 12, 24 or 48 h following drought treatment, and untreated plants were employed as the control. The expression levels of 28 CiWRKYs with full-length sequences were examined via qRT-PCR. Expression values were estimated using the 2 -ΔΔCT method, and CiEF1α was used as reference gene. The error bars represent the means of three technical replicates ± SD
Figure Legend Snippet: Expression patterns of CiWRKYs under drought treatment. Samples were collected from the shoots of one-month-old C. intermedia seedlings at 0.5, 1, 3, 6, 12, 24 or 48 h following drought treatment, and untreated plants were employed as the control. The expression levels of 28 CiWRKYs with full-length sequences were examined via qRT-PCR. Expression values were estimated using the 2 -ΔΔCT method, and CiEF1α was used as reference gene. The error bars represent the means of three technical replicates ± SD

Techniques Used: Expressing, Quantitative RT-PCR

Expression profiles of CiWRKY genes in different tissues. Samples were collected from the roots (R), stems (S) and leaves (L) of C. intermedia . The transcripts of 28 CiWRKYs with full-length sequences were examined via qRT-PCR. The relative expression values were calculated using the 2 -ΔCT method, and CiEF1α was employed as the endogenous control. The 2 -ΔCT -based expression values were used to produce the heatmap
Figure Legend Snippet: Expression profiles of CiWRKY genes in different tissues. Samples were collected from the roots (R), stems (S) and leaves (L) of C. intermedia . The transcripts of 28 CiWRKYs with full-length sequences were examined via qRT-PCR. The relative expression values were calculated using the 2 -ΔCT method, and CiEF1α was employed as the endogenous control. The 2 -ΔCT -based expression values were used to produce the heatmap

Techniques Used: Expressing, Quantitative RT-PCR

51) Product Images from "Rostrocaudal Areal Patterning of Human PSC-Derived Cortical Neurons by FGF8 Signaling"

Article Title: Rostrocaudal Areal Patterning of Human PSC-Derived Cortical Neurons by FGF8 Signaling

Journal: eNeuro

doi: 10.1523/ENEURO.0368-17.2018

Effect of FGF8 on R-C marker expression. A , qRT-PCR analysis of ESC-derived neurospheres for R-C marker expression ( n = 3; mean ± SEM; *** p
Figure Legend Snippet: Effect of FGF8 on R-C marker expression. A , qRT-PCR analysis of ESC-derived neurospheres for R-C marker expression ( n = 3; mean ± SEM; *** p

Techniques Used: Marker, Expressing, Quantitative RT-PCR, Derivative Assay

52) Product Images from "Interference of ribosomal frameshifting by antisense peptide nucleic acids suppresses SARS coronavirus replication"

Article Title: Interference of ribosomal frameshifting by antisense peptide nucleic acids suppresses SARS coronavirus replication

Journal: Antiviral research

doi: 10.1016/j.antiviral.2011.04.009

A SARS-CoV replicon expressing a luciferase reporter. (A) The Feo gene fused or non-fused to TRS9 was inserted into pBAC-SARS-CoV-REP (REP) to construct pSARS-CoV-REP-Feo (Feo) or pSARS-CoV-REP-ΔTRSFeo (ΔTRS), respectively. The pSARS-CoV-REP-Feo-MluIrev (MluIrev), which is defective in synthesis of functional replicase proteins, was used as a negative control plasmid. TRSs are indicated by a black box and leader sequences by a box with deviant crease lines. Black arrows indicate primers used for detection of N gene-specific sg-mRNAs and gray arrows for detection of sg-mRNAs containing the Feo gene. (B and C) BHK-21 cells were co-transfected with replicon plasmids and pRL-TK used for normalization of transfection efficiency, by electroporation. At 30 h post-transfection, cells were harvested and analyzed for sg-mRNA level, luciferase activity, and intracellular SARS-CoV nucleocapsid N protein level. (B) The N gene-specific sg-mRNA level was quantified by real-time qRT-PCR using a TaqMan probe. Subgenomic RNA copy numbers per μg total RNA are shown. ND, not detected. (C) Firefiy luciferase activity from the replicon plasmid was normalized to Renilla luciferase activity from the pRL-TK plasmid. Normalized luciferase activity of cells transfected with pSARS-CoV-REP was defined as 100. Endogenous sg-mRNAs containing Feo gene was amplified by RT-PCR and resulting PCR products were resolved by agarose gel electrophoresis (low panel). (D) BHK-21 or HEK293 cells were left untransfected (Mock) or transfected with the plasmid indicated above the blots. N protein and α-tubulin were detected by Western blot analysis. (E) Kinetics of SARS-CoV replicon replication in transiently transfected cells. BHK-21 cells were transfected with pSARS-REP-Feo (●) or pSARS-REP-ΔTRSFeo (▲) by electroporation. Cells were harvested at each given time point and store at −80 °C until analysis. Luciferase activity was measured with the same amount of cell lysate. Data from one representative experiment from two independent experiments with similar results are shown.
Figure Legend Snippet: A SARS-CoV replicon expressing a luciferase reporter. (A) The Feo gene fused or non-fused to TRS9 was inserted into pBAC-SARS-CoV-REP (REP) to construct pSARS-CoV-REP-Feo (Feo) or pSARS-CoV-REP-ΔTRSFeo (ΔTRS), respectively. The pSARS-CoV-REP-Feo-MluIrev (MluIrev), which is defective in synthesis of functional replicase proteins, was used as a negative control plasmid. TRSs are indicated by a black box and leader sequences by a box with deviant crease lines. Black arrows indicate primers used for detection of N gene-specific sg-mRNAs and gray arrows for detection of sg-mRNAs containing the Feo gene. (B and C) BHK-21 cells were co-transfected with replicon plasmids and pRL-TK used for normalization of transfection efficiency, by electroporation. At 30 h post-transfection, cells were harvested and analyzed for sg-mRNA level, luciferase activity, and intracellular SARS-CoV nucleocapsid N protein level. (B) The N gene-specific sg-mRNA level was quantified by real-time qRT-PCR using a TaqMan probe. Subgenomic RNA copy numbers per μg total RNA are shown. ND, not detected. (C) Firefiy luciferase activity from the replicon plasmid was normalized to Renilla luciferase activity from the pRL-TK plasmid. Normalized luciferase activity of cells transfected with pSARS-CoV-REP was defined as 100. Endogenous sg-mRNAs containing Feo gene was amplified by RT-PCR and resulting PCR products were resolved by agarose gel electrophoresis (low panel). (D) BHK-21 or HEK293 cells were left untransfected (Mock) or transfected with the plasmid indicated above the blots. N protein and α-tubulin were detected by Western blot analysis. (E) Kinetics of SARS-CoV replicon replication in transiently transfected cells. BHK-21 cells were transfected with pSARS-REP-Feo (●) or pSARS-REP-ΔTRSFeo (▲) by electroporation. Cells were harvested at each given time point and store at −80 °C until analysis. Luciferase activity was measured with the same amount of cell lysate. Data from one representative experiment from two independent experiments with similar results are shown.

Techniques Used: Expressing, Luciferase, Construct, Functional Assay, Negative Control, Plasmid Preparation, Transfection, Electroporation, Activity Assay, Quantitative RT-PCR, Amplification, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Western Blot

Suppression of SARS-CoV replication by Tat-peptide-conjugated FS PNA in SARS-CoV replicon-replicating cells. (A) HEK293 cells, co-transfected with pSARS-REP-Feo and pRL-TK, were treated with each indicated PNA (10 μM) in serum-free DMEM for 3 h at 6 h post-transfection. Tat-conjugated J3U2 PNA (Tat-J3U2) targeting the 3′-UTR of JEV genome was used as a negative control. IFN-β (250 IU/ml) and IFN-β inducer poly(I:C) (0.8 μg/ml) were used as positive controls. Poly(I:C) was transfected into the cells using lipofectamin RNAiMAX agent. After 30 h incubation in complete medium, cells were harvested and luciferase activity was measured. (B) The IC 50 value for the inhibition of SARS-CoV replication by Tat-FS PNA was determined at various PNA concentrations. (C) HEK293 cells were co-transfected with IFNb-pGL3 luciferase reporter plasmid and pRL-TK used for normalization of transfection efficiency, prior to mock-treatment or treatment with 10 μM of Tat-FS or Tat-FSm2 PNA. Poly(I:C) or HCV 3′-UTR at a final concentration of 2 μg/ml or expression of an active form of IRF3, IRF3(5D) was used as a positive control for stimulation of IFN-β promoter activity. The normalized firefly luciferase activity of the mock-treated cells is considered one unit and the increase in luciferase activity is shown as fold induction. (D) HEK293 cells treated with PNAs orindicated RNAs as in (C) were analyzed for IFN-β and ISG56 mRNA abundance by real-time qRT-PCR. Fold increase in mRNA abundance is shown. (E) The real-time PCR products representing the abundance of the indicated mRNAs were visualized by agarose gel electrophoresis and ethidium bromide staining. Detection of GAPDH mRNA served as control. Results are from a representative experiment of n = 3 that gave similar results. (A–D) Data represent means ± SD of triplicate measurements from three independent experiments.
Figure Legend Snippet: Suppression of SARS-CoV replication by Tat-peptide-conjugated FS PNA in SARS-CoV replicon-replicating cells. (A) HEK293 cells, co-transfected with pSARS-REP-Feo and pRL-TK, were treated with each indicated PNA (10 μM) in serum-free DMEM for 3 h at 6 h post-transfection. Tat-conjugated J3U2 PNA (Tat-J3U2) targeting the 3′-UTR of JEV genome was used as a negative control. IFN-β (250 IU/ml) and IFN-β inducer poly(I:C) (0.8 μg/ml) were used as positive controls. Poly(I:C) was transfected into the cells using lipofectamin RNAiMAX agent. After 30 h incubation in complete medium, cells were harvested and luciferase activity was measured. (B) The IC 50 value for the inhibition of SARS-CoV replication by Tat-FS PNA was determined at various PNA concentrations. (C) HEK293 cells were co-transfected with IFNb-pGL3 luciferase reporter plasmid and pRL-TK used for normalization of transfection efficiency, prior to mock-treatment or treatment with 10 μM of Tat-FS or Tat-FSm2 PNA. Poly(I:C) or HCV 3′-UTR at a final concentration of 2 μg/ml or expression of an active form of IRF3, IRF3(5D) was used as a positive control for stimulation of IFN-β promoter activity. The normalized firefly luciferase activity of the mock-treated cells is considered one unit and the increase in luciferase activity is shown as fold induction. (D) HEK293 cells treated with PNAs orindicated RNAs as in (C) were analyzed for IFN-β and ISG56 mRNA abundance by real-time qRT-PCR. Fold increase in mRNA abundance is shown. (E) The real-time PCR products representing the abundance of the indicated mRNAs were visualized by agarose gel electrophoresis and ethidium bromide staining. Detection of GAPDH mRNA served as control. Results are from a representative experiment of n = 3 that gave similar results. (A–D) Data represent means ± SD of triplicate measurements from three independent experiments.

Techniques Used: Transfection, Negative Control, Incubation, Luciferase, Activity Assay, Inhibition, Plasmid Preparation, Concentration Assay, Expressing, Positive Control, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

53) Product Images from "Prognostic value of molecular events from negative surgical margin of non-small-cell lung cancer"

Article Title: Prognostic value of molecular events from negative surgical margin of non-small-cell lung cancer

Journal: Oncotarget

doi: 10.18632/oncotarget.10949

EMT of human immortalized bronchial epithelial cells induced by TGF-β1 M-BE cells were treated with human recombinant TGF-β1 at a final concentration of 5 ng/ml for 6 days, with cells cultured without TGF-β1 as control. A. A phenotypic change in M-BE from epithelial to spindle-shaped morphology was observed after TGF-β1 treatment, which was photographed at 100× magnification using white light microscopy (left panel, scale bar = 100 μm). Immunofluorescence staining showed the expression status of three EMT markers (left to right panels: E-cadherin, N-cadherin, Vimentin) in M-BE cells induced by TGF-β1. FITC (green) was used for respective target proteins; 4,6-diamidino-2-phenylindole (DAPI) was used to visualize nuclei. All of the fluorescence images were captured at 400× magnification using fluorescence microscopy (scale bar = 25 μm). B. qRT-PCR analysis for mRNA levels of three EMT markers in TGF-β1 treated cells. Y-axis indicates the relative expression level (Fold Change, FC) of genes. Means and standard deviations (SD, error bars) are shown. Unpaired Student's t-test (two sided) was performed for significance estimate. **M-BE cells treated with TGF-β1vs control, P
Figure Legend Snippet: EMT of human immortalized bronchial epithelial cells induced by TGF-β1 M-BE cells were treated with human recombinant TGF-β1 at a final concentration of 5 ng/ml for 6 days, with cells cultured without TGF-β1 as control. A. A phenotypic change in M-BE from epithelial to spindle-shaped morphology was observed after TGF-β1 treatment, which was photographed at 100× magnification using white light microscopy (left panel, scale bar = 100 μm). Immunofluorescence staining showed the expression status of three EMT markers (left to right panels: E-cadherin, N-cadherin, Vimentin) in M-BE cells induced by TGF-β1. FITC (green) was used for respective target proteins; 4,6-diamidino-2-phenylindole (DAPI) was used to visualize nuclei. All of the fluorescence images were captured at 400× magnification using fluorescence microscopy (scale bar = 25 μm). B. qRT-PCR analysis for mRNA levels of three EMT markers in TGF-β1 treated cells. Y-axis indicates the relative expression level (Fold Change, FC) of genes. Means and standard deviations (SD, error bars) are shown. Unpaired Student's t-test (two sided) was performed for significance estimate. **M-BE cells treated with TGF-β1vs control, P

Techniques Used: Recombinant, Concentration Assay, Cell Culture, Light Microscopy, Immunofluorescence, Staining, Expressing, Fluorescence, Microscopy, Quantitative RT-PCR

54) Product Images from "Comparative physiological responses and transcriptome analysis reveal the roles of melatonin and serotonin in regulating growth and metabolism in Arabidopsis"

Article Title: Comparative physiological responses and transcriptome analysis reveal the roles of melatonin and serotonin in regulating growth and metabolism in Arabidopsis

Journal: BMC Plant Biology

doi: 10.1186/s12870-018-1548-2

a-g LBD16 and XTR6 are involved in melatonin- or serotonin-mediated LR development. a , b Five-day-old proLBD16:GUS ( a ) and proXTR6:GUS ( b ) seedlings were transferred to 1/4 MS medium containing 10 or 50 μM melatonin or serotonin for 4 days. c , d qRT-PCR analysis of LBD16 ( c ) and XTR6 ( d ) gene expression in the roots of Col-0 seedlings treated with 10 or 50 μM melatonin or serotonin for 2 days. The expression levels of the indicated genes in untreated roots were set to 1. e-h Effects of melatonin and serotonin on auxin accumulation in roots. e YFP fluorescence in the PR tips of 5-day-old DII-VENUS seedlings exposed to 1 μM IAA or 10 or 50 μM melatonin or serotonin for 4 days and ( f ) quantification of DII-VENUS fluorescence intensity in plants treated as in ( e ). g YFP fluorescence in the LR tips of 5-day-old DII-VENUS seedlings exposed to 1 μM IAA or 10 or 50 μM melatonin or serotonin for 4 days and ( h ) quantification of the DII-VENUS fluorescence intensity in plants treated as in ( g ). The fluorescence intensity in untreated roots was set to 1. MT, melatonin; ST, serotonin. Error bars represent the SE. Different letters indicate significantly different values ( P
Figure Legend Snippet: a-g LBD16 and XTR6 are involved in melatonin- or serotonin-mediated LR development. a , b Five-day-old proLBD16:GUS ( a ) and proXTR6:GUS ( b ) seedlings were transferred to 1/4 MS medium containing 10 or 50 μM melatonin or serotonin for 4 days. c , d qRT-PCR analysis of LBD16 ( c ) and XTR6 ( d ) gene expression in the roots of Col-0 seedlings treated with 10 or 50 μM melatonin or serotonin for 2 days. The expression levels of the indicated genes in untreated roots were set to 1. e-h Effects of melatonin and serotonin on auxin accumulation in roots. e YFP fluorescence in the PR tips of 5-day-old DII-VENUS seedlings exposed to 1 μM IAA or 10 or 50 μM melatonin or serotonin for 4 days and ( f ) quantification of DII-VENUS fluorescence intensity in plants treated as in ( e ). g YFP fluorescence in the LR tips of 5-day-old DII-VENUS seedlings exposed to 1 μM IAA or 10 or 50 μM melatonin or serotonin for 4 days and ( h ) quantification of the DII-VENUS fluorescence intensity in plants treated as in ( g ). The fluorescence intensity in untreated roots was set to 1. MT, melatonin; ST, serotonin. Error bars represent the SE. Different letters indicate significantly different values ( P

Techniques Used: Mass Spectrometry, Quantitative RT-PCR, Expressing, Fluorescence

55) Product Images from "Possible connection between imidacloprid-induced changes in rice gene transcription profiles and susceptibility to the brown plant hopper Nilaparvatalugens St?l (Hemiptera: Delphacidae)"

Article Title: Possible connection between imidacloprid-induced changes in rice gene transcription profiles and susceptibility to the brown plant hopper Nilaparvatalugens St?l (Hemiptera: Delphacidae)

Journal: Pesticide Biochemistry and Physiology

doi: 10.1016/j.pestbp.2012.01.003

Confirmation of the microarray results by qRT-PCR. Analysis by qRT-PCR of 10 genes selected from the IMI-responsive genes was performed with RNA extracted from control rice sheaths or 60 ppm IMI treated rice sheaths. The fold change of related genes after 60 ppm IMI treatment is presented on the left. The correlation between microarray signal ratios and qRT-PCR is presented on the right..
Figure Legend Snippet: Confirmation of the microarray results by qRT-PCR. Analysis by qRT-PCR of 10 genes selected from the IMI-responsive genes was performed with RNA extracted from control rice sheaths or 60 ppm IMI treated rice sheaths. The fold change of related genes after 60 ppm IMI treatment is presented on the left. The correlation between microarray signal ratios and qRT-PCR is presented on the right..

Techniques Used: Microarray, Quantitative RT-PCR

56) Product Images from "MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae"

Article Title: MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae

Journal: Autophagy

doi: 10.1080/15548627.2018.1458171

MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.
Figure Legend Snippet: MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.

Techniques Used: Expressing, Bimolecular Fluorescence Complementation Assay, Staining, Epifluorescence Microscopy, Isolation, Histone Deacetylase Assay, Activity Assay, Quantitative RT-PCR, In Vitro, Incubation, Real-time Polymerase Chain Reaction

MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.
Figure Legend Snippet: MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.

Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, RNA Extraction

MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P
Figure Legend Snippet: MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P

Techniques Used: Staining, Epifluorescence Microscopy, Quantitative RT-PCR, Expressing, Inhibition

57) Product Images from "Functional inactivation of OsGCNT induces enhanced disease resistance to Xanthomonas oryzae pv. oryzae in rice"

Article Title: Functional inactivation of OsGCNT induces enhanced disease resistance to Xanthomonas oryzae pv. oryzae in rice

Journal: BMC Plant Biology

doi: 10.1186/s12870-018-1489-9

Evaluation of disease resistance and expression of defense signaling-related genes in spl21 and WT. a Reactions to Xoo race PXO99. 1–2: WT before inoculation; 3–4: spl21 before inoculation; 5–7: WT after inoculation; 8–10: spl21 after inoculation; 11–16: complementation lines. b Mean lesion length/leaf length radio after inoculation of plant leaves with PXO99. Data represent the lesion length means ± SD from 5 independent plants at the tillering stage (Student’s t -test: **, P ≤ 0.01). c Relative expression of seven defense signaling-related genes in WT and spl21 at the tillering stages analyzed by qRT-PCR. The expression level of each gene in WT was normalized to 1; data represent the mean ± SD of three biological replicates (Student’s t -test: **, P ≤ 0.01)
Figure Legend Snippet: Evaluation of disease resistance and expression of defense signaling-related genes in spl21 and WT. a Reactions to Xoo race PXO99. 1–2: WT before inoculation; 3–4: spl21 before inoculation; 5–7: WT after inoculation; 8–10: spl21 after inoculation; 11–16: complementation lines. b Mean lesion length/leaf length radio after inoculation of plant leaves with PXO99. Data represent the lesion length means ± SD from 5 independent plants at the tillering stage (Student’s t -test: **, P ≤ 0.01). c Relative expression of seven defense signaling-related genes in WT and spl21 at the tillering stages analyzed by qRT-PCR. The expression level of each gene in WT was normalized to 1; data represent the mean ± SD of three biological replicates (Student’s t -test: **, P ≤ 0.01)

Techniques Used: Expressing, Quantitative RT-PCR

58) Product Images from "Biosynthetic Pathway and Genes of Chitin/Chitosan-Like Bioflocculant in the Genus Citrobacter"

Article Title: Biosynthetic Pathway and Genes of Chitin/Chitosan-Like Bioflocculant in the Genus Citrobacter

Journal: Polymers

doi: 10.3390/polym10030237

Changes in substrate concentration, growth, and relative flocculation activity (flocculation titer, Ft) during the batch cultivation of C. freundii IFO 13545 in: AM ( a ); and GM ( b ). Arrows indicate the sampling points of the cultures for qRT-PCR analysis (early-, mid-, and late-log phases in Figure 9 ).
Figure Legend Snippet: Changes in substrate concentration, growth, and relative flocculation activity (flocculation titer, Ft) during the batch cultivation of C. freundii IFO 13545 in: AM ( a ); and GM ( b ). Arrows indicate the sampling points of the cultures for qRT-PCR analysis (early-, mid-, and late-log phases in Figure 9 ).

Techniques Used: Concentration Assay, Flocculation, Activity Assay, Sampling, Quantitative RT-PCR

Relative gene expressions in the cells of C. freundii IFO 13545 grown in AM (on acetate) ( a ) or GM (on glucose) ( b ) compared to that of the 16S rRNA gene. The cells were grown in AM or GM and harvested at O.D. 600 = 0.52, 1.15, and 2.00 (early-, mid- or late-log phase, respectively). RNA samples were extracted from the cells and qRT-PCR was conducted using specific paired primers for each gene ( Table 1 ). The average ± the standard deviation of the values obtained in three repeated experiments is shown. The relative amounts of RNA from the 16S rRNA gene in AM were 3.27 × 10 −2 (early), 2.63 × 10 −2 (mid), and 3.88 × 10 −2 (late), whereas the amounts in GM were 3.39 × 10 −2 (early), 2.11 × 10 −2 (mid), and 3.35 × 10 −2 (late).
Figure Legend Snippet: Relative gene expressions in the cells of C. freundii IFO 13545 grown in AM (on acetate) ( a ) or GM (on glucose) ( b ) compared to that of the 16S rRNA gene. The cells were grown in AM or GM and harvested at O.D. 600 = 0.52, 1.15, and 2.00 (early-, mid- or late-log phase, respectively). RNA samples were extracted from the cells and qRT-PCR was conducted using specific paired primers for each gene ( Table 1 ). The average ± the standard deviation of the values obtained in three repeated experiments is shown. The relative amounts of RNA from the 16S rRNA gene in AM were 3.27 × 10 −2 (early), 2.63 × 10 −2 (mid), and 3.88 × 10 −2 (late), whereas the amounts in GM were 3.39 × 10 −2 (early), 2.11 × 10 −2 (mid), and 3.35 × 10 −2 (late).

Techniques Used: Quantitative RT-PCR, Standard Deviation

Proposed bioflocculant (BF) synthetic pathway and the genes of Citrobacter freundii IFO 13545 involved in the pathway. Blue arrows and gene names indicate the proposed BF synthetic pathway and the genes encoding the enzymes involved in this pathway. The genes underlined in red were used in a qRT-PCR study to determine the level of gene expression in glucose medium (GM) and in acetate medium (AM). Abbreviations: BF, bioflocculant; GO, glyoxylate; P, phosphate; P 2 , diphosphate; DHAP, dihyroxyacetone-P; PEP, phosphoenolpyruvate; GlcN, glucosamine; GlcNAc, N -acetylglucosamine.
Figure Legend Snippet: Proposed bioflocculant (BF) synthetic pathway and the genes of Citrobacter freundii IFO 13545 involved in the pathway. Blue arrows and gene names indicate the proposed BF synthetic pathway and the genes encoding the enzymes involved in this pathway. The genes underlined in red were used in a qRT-PCR study to determine the level of gene expression in glucose medium (GM) and in acetate medium (AM). Abbreviations: BF, bioflocculant; GO, glyoxylate; P, phosphate; P 2 , diphosphate; DHAP, dihyroxyacetone-P; PEP, phosphoenolpyruvate; GlcN, glucosamine; GlcNAc, N -acetylglucosamine.

Techniques Used: Quantitative RT-PCR, Expressing

59) Product Images from "Zinc Finger-Homeodomain Transcriptional Factors (ZHDs) in Upland Cotton (Gossypium hirsutum): Genome-Wide Identification and Expression Analysis in Fiber Development"

Article Title: Zinc Finger-Homeodomain Transcriptional Factors (ZHDs) in Upland Cotton (Gossypium hirsutum): Genome-Wide Identification and Expression Analysis in Fiber Development

Journal: Frontiers in Genetics

doi: 10.3389/fgene.2018.00357

Expression patterns of GhZHD genes at different fiber developmental stages of brown cotton obtained by performing qRT-PCR. The relative expression levels were calculated using the 2 -ΔΔCt method.
Figure Legend Snippet: Expression patterns of GhZHD genes at different fiber developmental stages of brown cotton obtained by performing qRT-PCR. The relative expression levels were calculated using the 2 -ΔΔCt method.

Techniques Used: Expressing, Quantitative RT-PCR

60) Product Images from "A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies"

Article Title: A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1005679

Newly identified causative genes via whole-exome sequencing analysis. ( A ) Family pedigrees of Pt276. ( B and C ) Complementation assay in Pt276 fibroblasts and normal control (fHDF). Mitochondrial fractions were isolated from fibroblasts with established stable expression of MRPS23 using a lentiviral expression system. Assembly levels and 12s rRNA stability were compared between control and MRPS23 expressing fibroblasts by BN-PAGE /Western blotting ( B ) and qRT-PCR ( C ). fHDF: normal fetal human dermal fibroblast, RFP: mito-TurboRFP-V5 , MRPS23: MRPS23-V5 . Significance was calculated in comparison with controls using Student's t-test (*; p
Figure Legend Snippet: Newly identified causative genes via whole-exome sequencing analysis. ( A ) Family pedigrees of Pt276. ( B and C ) Complementation assay in Pt276 fibroblasts and normal control (fHDF). Mitochondrial fractions were isolated from fibroblasts with established stable expression of MRPS23 using a lentiviral expression system. Assembly levels and 12s rRNA stability were compared between control and MRPS23 expressing fibroblasts by BN-PAGE /Western blotting ( B ) and qRT-PCR ( C ). fHDF: normal fetal human dermal fibroblast, RFP: mito-TurboRFP-V5 , MRPS23: MRPS23-V5 . Significance was calculated in comparison with controls using Student's t-test (*; p

Techniques Used: Sequencing, Isolation, Expressing, Polyacrylamide Gel Electrophoresis, Western Blot, Quantitative RT-PCR

61) Product Images from "Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing"

Article Title: Characterization of Conserved and Novel microRNAs in Lilium lancifolium Thunb. by High-Throughput Sequencing

Journal: Scientific Reports

doi: 10.1038/s41598-018-21193-4

Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P
Figure Legend Snippet: Validation of miRNAs and targets using qRT-PCR. The X axis represents different tissues. The Y axis represents the relative expression level of miRNAs or targets.The amount of expression of miRNAs and targets was normalized to the level of 5.8S rRNA and 18S rRNA, respectively. Different letters indicate significant differences at P

Techniques Used: Quantitative RT-PCR, Expressing

62) Product Images from "Novel insights into molecular mechanisms of Pseudourostyla cristata encystment using comparative transcriptomics"

Article Title: Novel insights into molecular mechanisms of Pseudourostyla cristata encystment using comparative transcriptomics

Journal: Scientific Reports

doi: 10.1038/s41598-019-55608-7

Verification of the transcriptomic data by qRT-PCR. Left panel shows the qRT-PCR data and right panel represents transcriptomic data. yy indicats trophonts of P. cristata , and bn indicats dormant cysts of P. cristata . Error bars represent standard deviation of three repeats. Significant differences compared to the control group are indicated with * p
Figure Legend Snippet: Verification of the transcriptomic data by qRT-PCR. Left panel shows the qRT-PCR data and right panel represents transcriptomic data. yy indicats trophonts of P. cristata , and bn indicats dormant cysts of P. cristata . Error bars represent standard deviation of three repeats. Significant differences compared to the control group are indicated with * p

Techniques Used: Quantitative RT-PCR, Standard Deviation

63) Product Images from "Genome-Wide Analysis Reveals Extensive Changes in LncRNAs during Skeletal Muscle Development in Hu Sheep"

Article Title: Genome-Wide Analysis Reveals Extensive Changes in LncRNAs during Skeletal Muscle Development in Hu Sheep

Journal: Genes

doi: 10.3390/genes8080191

The verification of the expression level of the differentially expressed lncRNAs and the co-expressed target genes at fetus, lamb and adult stages measured by qRT-PCR. ( A ) The relative expression of TCONS_00606329 and target gene ELN. ( B ) The relative expression of TCONS_00758916 and TCONS_00685981 and the target genes PFKM and ASB8. ( C ) The relative expression of TCONS_00297401 and the target gene USP2. ( D ) The relative expression of TCONS_00377352, TCONS_00381991 and TCONS_00381994 and their target gene RTL1. The qRT-PCR data were represented as the mean ± SEM of three biological and technical replicates. Columns with different letters are significantly different at p
Figure Legend Snippet: The verification of the expression level of the differentially expressed lncRNAs and the co-expressed target genes at fetus, lamb and adult stages measured by qRT-PCR. ( A ) The relative expression of TCONS_00606329 and target gene ELN. ( B ) The relative expression of TCONS_00758916 and TCONS_00685981 and the target genes PFKM and ASB8. ( C ) The relative expression of TCONS_00297401 and the target gene USP2. ( D ) The relative expression of TCONS_00377352, TCONS_00381991 and TCONS_00381994 and their target gene RTL1. The qRT-PCR data were represented as the mean ± SEM of three biological and technical replicates. Columns with different letters are significantly different at p

Techniques Used: Expressing, Quantitative RT-PCR

The verification of expression level of differentially expressed transcripts at fetus, lamb and adult stages measured by qRT-PCR and RNA-Seq, respectively. ( A ) The relative expression level of differentially expressed lncRNAs in different stages determined by qRT-PCR. ( B ) The relative expression level of DEGs, including GOT2 (glutamic-oxaloacetic transaminase 2), MKNK1 (MAP kinase interacting serine/threonine kinase 1), PPP1R16B (protein phosphatase 1 regulatory subunit 16B), SMOX (spermine oxidase), MYOG (myogenin) and MYH7 (myosin heavy chain 7) in different stages determined by qRT-PCR. ( C ) The relative expression level of the differentially expressed lncRNAs in different stages determined by RNA-Seq, respectively. ( D ) The relative expression level of DEGs in different stages determined by RNA-Seq, respectively. The expression of delta-like1 homologue gene (DLK1, which is enriched in fetal muscle) and ras related dexamethasone induced 1 (RASD1, which is enriched in lamb muscle at 12 weeks of age [ 28 ]) were also showed. The relative expression level of the differentially expressed lncRNAs and DEGs in muscle was determined by qRT-PCR and normalized to the expression of hypoxanthine phosphoribosyltransferase 1 (HPRT1). The qRT-PCR data were represented as the mean ± SEM of three biological and technical replicates. Columns with different letters are significantly different at p
Figure Legend Snippet: The verification of expression level of differentially expressed transcripts at fetus, lamb and adult stages measured by qRT-PCR and RNA-Seq, respectively. ( A ) The relative expression level of differentially expressed lncRNAs in different stages determined by qRT-PCR. ( B ) The relative expression level of DEGs, including GOT2 (glutamic-oxaloacetic transaminase 2), MKNK1 (MAP kinase interacting serine/threonine kinase 1), PPP1R16B (protein phosphatase 1 regulatory subunit 16B), SMOX (spermine oxidase), MYOG (myogenin) and MYH7 (myosin heavy chain 7) in different stages determined by qRT-PCR. ( C ) The relative expression level of the differentially expressed lncRNAs in different stages determined by RNA-Seq, respectively. ( D ) The relative expression level of DEGs in different stages determined by RNA-Seq, respectively. The expression of delta-like1 homologue gene (DLK1, which is enriched in fetal muscle) and ras related dexamethasone induced 1 (RASD1, which is enriched in lamb muscle at 12 weeks of age [ 28 ]) were also showed. The relative expression level of the differentially expressed lncRNAs and DEGs in muscle was determined by qRT-PCR and normalized to the expression of hypoxanthine phosphoribosyltransferase 1 (HPRT1). The qRT-PCR data were represented as the mean ± SEM of three biological and technical replicates. Columns with different letters are significantly different at p

Techniques Used: Expressing, Quantitative RT-PCR, RNA Sequencing Assay

64) Product Images from "Genome-wide identification of lncRNAs associated with chlorantraniliprole resistance in diamondback moth Plutella xylostella (L.)"

Article Title: Genome-wide identification of lncRNAs associated with chlorantraniliprole resistance in diamondback moth Plutella xylostella (L.)

Journal: BMC Genomics

doi: 10.1186/s12864-017-3748-9

qRT-PCR validation of significantly differentially expressed lncRNAs among CHS, CHR and ZZ. Different lowercase letters represent significant differences by t -test ( P
Figure Legend Snippet: qRT-PCR validation of significantly differentially expressed lncRNAs among CHS, CHR and ZZ. Different lowercase letters represent significant differences by t -test ( P

Techniques Used: Quantitative RT-PCR

Pearson correlation between the RNA-seq and qRT-PCR data. All expression data were normalized in log 2 ratio
Figure Legend Snippet: Pearson correlation between the RNA-seq and qRT-PCR data. All expression data were normalized in log 2 ratio

Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR, Expressing

65) Product Images from "Mir-509-5p joins the Mdm2/p53 feedback loop and regulates cancer cell growth"

Article Title: Mir-509-5p joins the Mdm2/p53 feedback loop and regulates cancer cell growth

Journal: Cell Death & Disease

doi: 10.1038/cddis.2014.327

miR-509-5p directly targets Mdm2 and inhibits its expression. ( a ) A schematic of the bioinformatics predicted seed region in the 3′-UTR of Mdm2 is shown above; the mutated 3′-UTR used in this study is also shown. ( b ) Expression of miR-509-5p, Mdm2 and p53 in the 14 pairs of matched cervical tumor specimens and in the 12 pairs of matched HCC tissues. ( c ) qRT-PCR showed the suppression of Mdm2 expression by miR-509-5p. The HeLa cells were transfected with the empty vector or miR-509-5p for 24 h before harvesting. ( d ) Western blot analysis was used to detect Mdm2 protein expression when HeLa cells were transfected with pcDNA3/pri-miR-509 or ASO-miR-509-5p. ( e ) The effect of miR-509-5p or ASO-miR-509-5p on the EGFP activity of EGFP-Mdm2-3′-UTR and EGFP-Mdm2-3′-UTR-mut, in which the putative miR-509-5p-binding site was mutated. For the EGFP reporter assays, HeLa cells were transfected with a miR-509-5p expression vector or ASO-miR-509-5p oligo and then harvested for lysis 48 h after transfection. The MTT assay ( f ) and colony formation assay ( g ) were performed to assess the HeLa and QGY-7703 cell growth alterations in the rescue experiment to further confirm that miR-509-5p acts as a tumor suppressor. ( h and i ) MTT and colony formation assays were performed to detect the effect of miR-509-5p in Mdm2-siRNA-transfected cells (* P
Figure Legend Snippet: miR-509-5p directly targets Mdm2 and inhibits its expression. ( a ) A schematic of the bioinformatics predicted seed region in the 3′-UTR of Mdm2 is shown above; the mutated 3′-UTR used in this study is also shown. ( b ) Expression of miR-509-5p, Mdm2 and p53 in the 14 pairs of matched cervical tumor specimens and in the 12 pairs of matched HCC tissues. ( c ) qRT-PCR showed the suppression of Mdm2 expression by miR-509-5p. The HeLa cells were transfected with the empty vector or miR-509-5p for 24 h before harvesting. ( d ) Western blot analysis was used to detect Mdm2 protein expression when HeLa cells were transfected with pcDNA3/pri-miR-509 or ASO-miR-509-5p. ( e ) The effect of miR-509-5p or ASO-miR-509-5p on the EGFP activity of EGFP-Mdm2-3′-UTR and EGFP-Mdm2-3′-UTR-mut, in which the putative miR-509-5p-binding site was mutated. For the EGFP reporter assays, HeLa cells were transfected with a miR-509-5p expression vector or ASO-miR-509-5p oligo and then harvested for lysis 48 h after transfection. The MTT assay ( f ) and colony formation assay ( g ) were performed to assess the HeLa and QGY-7703 cell growth alterations in the rescue experiment to further confirm that miR-509-5p acts as a tumor suppressor. ( h and i ) MTT and colony formation assays were performed to detect the effect of miR-509-5p in Mdm2-siRNA-transfected cells (* P

Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot, Allele-specific Oligonucleotide, Activity Assay, Binding Assay, Lysis, MTT Assay, Colony Assay

Role of miR-509-5p in the regulation of cell cycle and apoptosis. ( a ) Overexpression of miR-509-5p enhanced p53 ubiquitination, and inhibition of miR-509-5p by ASO-miR-509-5p attenuated endogenous p53 ubiquitination in HeLa cells (top panel). The bottom panel shows the effect of miR-509-5p or ASO-miR-509-5p on p53 expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( b ) The mRNA level of Mdm2 and p53 in the presence of ASO-miR-509-5p with or without treatment of doxo. ( c ) The HeLa cells were treated with miR-509-5p or ASO-miR-509-5p for 48 h and were then lysed. Western blot analysis was used to detect p21 and bak expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( d ) qRT-PCR was used to detect the mRNA levels of p21 and bak in HeLa cells. ( e and f ) Cell cycle progression and apoptosis were analyzed using FACS and TUNEL assay in HeLa cells. ( g and h ) Rescue experiment to detect miR-509-5p effect in Mdm2-transfected HeLa cells (* P
Figure Legend Snippet: Role of miR-509-5p in the regulation of cell cycle and apoptosis. ( a ) Overexpression of miR-509-5p enhanced p53 ubiquitination, and inhibition of miR-509-5p by ASO-miR-509-5p attenuated endogenous p53 ubiquitination in HeLa cells (top panel). The bottom panel shows the effect of miR-509-5p or ASO-miR-509-5p on p53 expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( b ) The mRNA level of Mdm2 and p53 in the presence of ASO-miR-509-5p with or without treatment of doxo. ( c ) The HeLa cells were treated with miR-509-5p or ASO-miR-509-5p for 48 h and were then lysed. Western blot analysis was used to detect p21 and bak expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( d ) qRT-PCR was used to detect the mRNA levels of p21 and bak in HeLa cells. ( e and f ) Cell cycle progression and apoptosis were analyzed using FACS and TUNEL assay in HeLa cells. ( g and h ) Rescue experiment to detect miR-509-5p effect in Mdm2-transfected HeLa cells (* P

Techniques Used: Over Expression, Inhibition, Allele-specific Oligonucleotide, Expressing, Transfection, Western Blot, Quantitative RT-PCR, FACS, TUNEL Assay

p53 induces the miR-509-5p promoter activity. ( a ) A schematic description of the putative miR-509-5p promoter with two potential p53 response elements, p53RE1 and p53RE2, is shown compared with the p53RE consensus, where R=A or G; W=A or T and Y=C or T. C and G in red are the conserved nucleotides. ( b ) pMir-509p-Luc-1 luciferase assays in HeLa cells with overexpression or knockdown of p53. ( c ) pMir-509p-Luc-1 luciferase assays in HeLa cells treated with 1 μ g/ml doxo. ( d ) Deletion analysis identifies p53RE2-mediated p53-induced miR-509-5p promoter luciferase activity. pMir-509p-Luc-2: p53RE1 was deleted; pMir-509p-Luc-3: the upstream sequence of pRE2 was deleted; pMir-509p-Luc-4: pRE2 sequence was deleted. ( e ) ChIP assay shows that p53 directly interacts with p53RE2. GAPDH sequence that can bind to Pol II antibody serves as a positive control. Normal mouse IgG was used as the negative control. ( f ) miR-509-5p primary transcript was detected by qRT-PCR (* P
Figure Legend Snippet: p53 induces the miR-509-5p promoter activity. ( a ) A schematic description of the putative miR-509-5p promoter with two potential p53 response elements, p53RE1 and p53RE2, is shown compared with the p53RE consensus, where R=A or G; W=A or T and Y=C or T. C and G in red are the conserved nucleotides. ( b ) pMir-509p-Luc-1 luciferase assays in HeLa cells with overexpression or knockdown of p53. ( c ) pMir-509p-Luc-1 luciferase assays in HeLa cells treated with 1 μ g/ml doxo. ( d ) Deletion analysis identifies p53RE2-mediated p53-induced miR-509-5p promoter luciferase activity. pMir-509p-Luc-2: p53RE1 was deleted; pMir-509p-Luc-3: the upstream sequence of pRE2 was deleted; pMir-509p-Luc-4: pRE2 sequence was deleted. ( e ) ChIP assay shows that p53 directly interacts with p53RE2. GAPDH sequence that can bind to Pol II antibody serves as a positive control. Normal mouse IgG was used as the negative control. ( f ) miR-509-5p primary transcript was detected by qRT-PCR (* P

Techniques Used: Activity Assay, Luciferase, Over Expression, Sequencing, Chromatin Immunoprecipitation, Positive Control, Negative Control, Quantitative RT-PCR

miR-509-5p serves as a tumor suppressor. ( a ) qRT-PCR was performed to examine the alterations of miR-509-5p expression after transfection with pri-miR-509 and ASO-miR-509-5p in HeLa cells. U6 snRNA was used as an internal control. ( b and c ) The effects of overexpression or knockdown of miR-509-5p on cell viability were detected using an MTT assay, and the long-term effects on proliferative capacity were examined after transfection using a colony formation assay in HeLa, QGY-7703 and HepG2 cells. ( d and e ) Transwell migration assays were performed with HeLa and QGY-7703 cells transfected with pri-miR-509, ASO-miR-509-5p and the corresponding control vectors. Transwell assays without Matrigel demonstrated that miR-509 significantly decreased the migration of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted. ( f and g ) Transwell assays with Matrigel demonstrated that miR-509 overexpression significantly promoted the invasion of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted (* P
Figure Legend Snippet: miR-509-5p serves as a tumor suppressor. ( a ) qRT-PCR was performed to examine the alterations of miR-509-5p expression after transfection with pri-miR-509 and ASO-miR-509-5p in HeLa cells. U6 snRNA was used as an internal control. ( b and c ) The effects of overexpression or knockdown of miR-509-5p on cell viability were detected using an MTT assay, and the long-term effects on proliferative capacity were examined after transfection using a colony formation assay in HeLa, QGY-7703 and HepG2 cells. ( d and e ) Transwell migration assays were performed with HeLa and QGY-7703 cells transfected with pri-miR-509, ASO-miR-509-5p and the corresponding control vectors. Transwell assays without Matrigel demonstrated that miR-509 significantly decreased the migration of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted. ( f and g ) Transwell assays with Matrigel demonstrated that miR-509 overexpression significantly promoted the invasion of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted (* P

Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Allele-specific Oligonucleotide, Over Expression, MTT Assay, Colony Assay, Migration, Plasmid Preparation

The miR-509-5p expression is modulated through the p53 pathway. ( a ) HeLa cells were transfected with pcDNA3/p53, and microarray was used to detect the differentially expressed miRNAs. The upregulated and downregulated miRNAs are shown. ( b ) p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h (left panel). Under this condition, miR-509-5p was induced in the four cell lines (right panel). ( c ) Cells were grown in medium containing 10% or no FBS for 24 h. p53 was induced in the four cells grown under serum starvation conditions (left panel), and miR-509-5p was induced in the four cell lines (right panel). ( d ) The qRT-PCR analysis showed that the level of p53 mRNA increased or decreased (left panel) following transfection with pcDNA3/p53 or pSilencer2.1/p53-shRNA, respectively, and miR-509-5p expression was also subsequently induced or reduced in these four cell lines (right panel). ( e ) Western blot analysis showed that p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h. Accordingly, increased p21 protein expression level was also detected. GAPDH was used as an internal control. ( f ) Western blot analysis was performed to examine p53 and p21 protein expression level in the four cell lines (HeLa, Caski, QGY-7703 and HepG2 cells) grown in medium containing 10% or no FBS for 24 h. GAPDH was used as an internal control. ( g ) The gain or loss of p53 protein expression level was measured in cells (HeLa, Caski, QGY-7703 and HepG2 cells) transfected with pcDNA3/p53 or pSilencer2.1/p53-shRNA as well as control plasmid by western blot analysis. The protein expression of p21 was also detected. GAPDH was used as an internal control. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/p53, pSilencer2.1 and pSilencer2.1/p53-shRNA, respectively (* P
Figure Legend Snippet: The miR-509-5p expression is modulated through the p53 pathway. ( a ) HeLa cells were transfected with pcDNA3/p53, and microarray was used to detect the differentially expressed miRNAs. The upregulated and downregulated miRNAs are shown. ( b ) p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h (left panel). Under this condition, miR-509-5p was induced in the four cell lines (right panel). ( c ) Cells were grown in medium containing 10% or no FBS for 24 h. p53 was induced in the four cells grown under serum starvation conditions (left panel), and miR-509-5p was induced in the four cell lines (right panel). ( d ) The qRT-PCR analysis showed that the level of p53 mRNA increased or decreased (left panel) following transfection with pcDNA3/p53 or pSilencer2.1/p53-shRNA, respectively, and miR-509-5p expression was also subsequently induced or reduced in these four cell lines (right panel). ( e ) Western blot analysis showed that p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h. Accordingly, increased p21 protein expression level was also detected. GAPDH was used as an internal control. ( f ) Western blot analysis was performed to examine p53 and p21 protein expression level in the four cell lines (HeLa, Caski, QGY-7703 and HepG2 cells) grown in medium containing 10% or no FBS for 24 h. GAPDH was used as an internal control. ( g ) The gain or loss of p53 protein expression level was measured in cells (HeLa, Caski, QGY-7703 and HepG2 cells) transfected with pcDNA3/p53 or pSilencer2.1/p53-shRNA as well as control plasmid by western blot analysis. The protein expression of p21 was also detected. GAPDH was used as an internal control. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/p53, pSilencer2.1 and pSilencer2.1/p53-shRNA, respectively (* P

Techniques Used: Expressing, Transfection, Microarray, Quantitative RT-PCR, shRNA, Western Blot, Plasmid Preparation

66) Product Images from "Roles of Long Non-Coding RNA CCAT2 in Cervical Cancer Cell Growth and Apoptosis"

Article Title: Roles of Long Non-Coding RNA CCAT2 in Cervical Cancer Cell Growth and Apoptosis

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.897754

Relative expression of CCAT2 in 3 cervical cancer cell lines was carried out by qRT-PCR ( A ). Knockdown effects of siRNA CCAT2 in HeLa cell line ( B ). CCK8 assay to test the function of lncRNA CCAT2. Downregulation of CCAT2 inhibited HeLa cells growth ( C ). Statistical analyses were performed with the independent samples t test. All data are shown as the mean ±SD.
Figure Legend Snippet: Relative expression of CCAT2 in 3 cervical cancer cell lines was carried out by qRT-PCR ( A ). Knockdown effects of siRNA CCAT2 in HeLa cell line ( B ). CCK8 assay to test the function of lncRNA CCAT2. Downregulation of CCAT2 inhibited HeLa cells growth ( C ). Statistical analyses were performed with the independent samples t test. All data are shown as the mean ±SD.

Techniques Used: Expressing, Quantitative RT-PCR, CCK-8 Assay

67) Product Images from "Characterization of Transcription Factor Gene OsDRAP1 Conferring Drought Tolerance in Rice"

Article Title: Characterization of Transcription Factor Gene OsDRAP1 Conferring Drought Tolerance in Rice

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2018.00094

Expression model of OsDRAP1 in different tissues of rice, in which (A) the transcript levels were determined by qRT-PCR and semi RT-PCR, OsDRAP1 transcript levels in young panicles (1), matured leaves (2), leaf sheaths (3), nodes (4), internodes (5), stem bases (6), matured roots (7), young leaves (8), young roots (9) and callus (10) with Actin1 used as the reference gene. The OsDRAP1 expression in different tissues of the OsDRAP1-Pro::GUS transgenic rice plants by GUS staining analysis, in the shell (B) , leaf blade (C) , root (D) , root cross section (E) and sheath cross section (F) with red arrows indicating the vascular bundles (the scale bars are in 100 μm).
Figure Legend Snippet: Expression model of OsDRAP1 in different tissues of rice, in which (A) the transcript levels were determined by qRT-PCR and semi RT-PCR, OsDRAP1 transcript levels in young panicles (1), matured leaves (2), leaf sheaths (3), nodes (4), internodes (5), stem bases (6), matured roots (7), young leaves (8), young roots (9) and callus (10) with Actin1 used as the reference gene. The OsDRAP1 expression in different tissues of the OsDRAP1-Pro::GUS transgenic rice plants by GUS staining analysis, in the shell (B) , leaf blade (C) , root (D) , root cross section (E) and sheath cross section (F) with red arrows indicating the vascular bundles (the scale bars are in 100 μm).

Techniques Used: Expressing, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay, Staining

68) Product Images from "Comprehensive Transcriptome Analysis Reveals Competing Endogenous RNA Networks During Avian Leukosis Virus, Subgroup J-Induced Tumorigenesis in Chickens"

Article Title: Comprehensive Transcriptome Analysis Reveals Competing Endogenous RNA Networks During Avian Leukosis Virus, Subgroup J-Induced Tumorigenesis in Chickens

Journal: Frontiers in Physiology

doi: 10.3389/fphys.2018.00996

qRT-PCR confirmation of sequencing results in chickens with or without ALV-J infection. (A) For mRNA. (B) For lncRNA.
Figure Legend Snippet: qRT-PCR confirmation of sequencing results in chickens with or without ALV-J infection. (A) For mRNA. (B) For lncRNA.

Techniques Used: Quantitative RT-PCR, Sequencing, Infection

69) Product Images from "Construction and analysis of a lncRNA (PWRN2)-mediated ceRNA network reveal its potential roles in oocyte nuclear maturation of patients with PCOS"

Article Title: Construction and analysis of a lncRNA (PWRN2)-mediated ceRNA network reveal its potential roles in oocyte nuclear maturation of patients with PCOS

Journal: Reproductive Biology and Endocrinology : RB & E

doi: 10.1186/s12958-018-0392-4

Expression profiles of lncRNAs and mRNAs in KGN/shPWRN2 cell lines. a Relative expression of PWRN2 mRNA was examined in KGN cells infected with different lentiviral shRNAs (LV- PWRN2 -homo-502, LV- PWRN2 -homo-1574, LV- PWRN2 -homo-1261, or LV negative control) using qRT-PCR analysis with GAPDH as an endogenous reference. The KGN cells treated with different lentiviral shRNAs are shown on the x-axis, and the relative change of PWRN2 / GAPDH is shown on the y-axis. Each set of qRT-PCR reactions was repeated at least three times. The results are presented as mean ± SEM. ** indicates P
Figure Legend Snippet: Expression profiles of lncRNAs and mRNAs in KGN/shPWRN2 cell lines. a Relative expression of PWRN2 mRNA was examined in KGN cells infected with different lentiviral shRNAs (LV- PWRN2 -homo-502, LV- PWRN2 -homo-1574, LV- PWRN2 -homo-1261, or LV negative control) using qRT-PCR analysis with GAPDH as an endogenous reference. The KGN cells treated with different lentiviral shRNAs are shown on the x-axis, and the relative change of PWRN2 / GAPDH is shown on the y-axis. Each set of qRT-PCR reactions was repeated at least three times. The results are presented as mean ± SEM. ** indicates P

Techniques Used: Expressing, Infection, Negative Control, Quantitative RT-PCR

Transcripts levels of the candidate genes of PWRN2 -miR-92b-3p- TMEM120B ceRNA network according to oocyte nuclear maturity in patients with PCOS ( n = 30). The transcript levels of miR-92b-3p ( a ), PWRN2 ( b ) and TMEM120B ( c ) were detected by qRT-PCR. d Relationship between the expression levels of PWRN2 and TMEM120B . The signal intensity for the genes is shown on the y-axis in arbitrary units determined by qRT-PCR analysis. GAPDH was used as internal control for PWRN2 and TMEM120B , while U6 was used as internal control for miR-92b-3p. * indicates a significant difference in gene expression between CC categories (** P
Figure Legend Snippet: Transcripts levels of the candidate genes of PWRN2 -miR-92b-3p- TMEM120B ceRNA network according to oocyte nuclear maturity in patients with PCOS ( n = 30). The transcript levels of miR-92b-3p ( a ), PWRN2 ( b ) and TMEM120B ( c ) were detected by qRT-PCR. d Relationship between the expression levels of PWRN2 and TMEM120B . The signal intensity for the genes is shown on the y-axis in arbitrary units determined by qRT-PCR analysis. GAPDH was used as internal control for PWRN2 and TMEM120B , while U6 was used as internal control for miR-92b-3p. * indicates a significant difference in gene expression between CC categories (** P

Techniques Used: Quantitative RT-PCR, Expressing

Transcript levels of PWRN2 according to oocyte nuclear maturity in PCOS ( n = 30) and normal patients ( n = 30). Expression levels of PWRN2 in cumulus cells of different oocyte nuclear maturity stages (MI/GV stage and MII stage) of patients with PCOS ( a ) and normal patients ( b ). The signal intensity for PWRN2 is shown on the y-axis in arbitrary units determined by qRT-PCR analysis with GAPDH as an endogenous reference. * indicates a significant difference in gene expression between CC categories (** P
Figure Legend Snippet: Transcript levels of PWRN2 according to oocyte nuclear maturity in PCOS ( n = 30) and normal patients ( n = 30). Expression levels of PWRN2 in cumulus cells of different oocyte nuclear maturity stages (MI/GV stage and MII stage) of patients with PCOS ( a ) and normal patients ( b ). The signal intensity for PWRN2 is shown on the y-axis in arbitrary units determined by qRT-PCR analysis with GAPDH as an endogenous reference. * indicates a significant difference in gene expression between CC categories (** P

Techniques Used: Expressing, Quantitative RT-PCR

70) Product Images from "CircZNF609 promotes breast cancer cell growth, migration, and invasion by elevating p70S6K1 via sponging miR-145-5p"

Article Title: CircZNF609 promotes breast cancer cell growth, migration, and invasion by elevating p70S6K1 via sponging miR-145-5p

Journal: Cancer Management and Research

doi: 10.2147/CMAR.S174778

Knockdown of circZNF609 inhibits breast cancer cell proliferation, migration, and invasion in vitro. Notes: (A) qRT-PCR analysis of the interfering efficacies of three circZNF609-targeting siRNAs on circZNF609 and ZNF609 in MCF7 and MDA-MB-231 cell lines. (B) CCK-8 assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. (C) EdU assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. Scale bar=20 µm. (D) Transwell migration and Matrigel invasion assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. Scale bar=20 µm. Data were represented as mean ± SD of at least three independent experiments. * P
Figure Legend Snippet: Knockdown of circZNF609 inhibits breast cancer cell proliferation, migration, and invasion in vitro. Notes: (A) qRT-PCR analysis of the interfering efficacies of three circZNF609-targeting siRNAs on circZNF609 and ZNF609 in MCF7 and MDA-MB-231 cell lines. (B) CCK-8 assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. (C) EdU assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. Scale bar=20 µm. (D) Transwell migration and Matrigel invasion assay of MCF7 and MDA-MB-231 cells transfected with si-circZNF609#1 or NC. Scale bar=20 µm. Data were represented as mean ± SD of at least three independent experiments. * P

Techniques Used: Migration, In Vitro, Quantitative RT-PCR, Multiple Displacement Amplification, CCK-8 Assay, Transfection, EdU Assay, Invasion Assay

CircZNF609 serves as a sponge of miR-145-5p in breast cell lines. Notes: (A) The putative targeting site of circZNF609 and miR-145-5p was predicted by CircInteractome. (B) Luciferase activity analysis in MCF7 and MDA-MB-231 cells cotransfected with miR-145-5p mimics and pmirGLO-circZNF609-WT or pmirGLO-circZNF609-Mut vector. (C) RNA pull-down assay in MCF7 and MDA-MB-231 cells, the expression levels of miR-145-5p pulled down by circZNF609 or oligo probe were detected by qRT-PCR. (D) qRT-PCR analysis of miR-145-5p in MCF7 and MDA-MB-231 cells with circZNF609 knockdown or overexpression. (E) qRT-PCR analysis of circZNF609 in MCF7 and MDA-MB-231 cells with miR-145-5p knockdown or overexpression. (F) qRT-PCR analysis of miR-145-5p in BC tissues (n=143) and adjacent normal tissues (n=38). (G) Pearson’s correlation analysis of circZNF609 and miR-145-5p in BC tissues (n=143) ( r =-0.597, P
Figure Legend Snippet: CircZNF609 serves as a sponge of miR-145-5p in breast cell lines. Notes: (A) The putative targeting site of circZNF609 and miR-145-5p was predicted by CircInteractome. (B) Luciferase activity analysis in MCF7 and MDA-MB-231 cells cotransfected with miR-145-5p mimics and pmirGLO-circZNF609-WT or pmirGLO-circZNF609-Mut vector. (C) RNA pull-down assay in MCF7 and MDA-MB-231 cells, the expression levels of miR-145-5p pulled down by circZNF609 or oligo probe were detected by qRT-PCR. (D) qRT-PCR analysis of miR-145-5p in MCF7 and MDA-MB-231 cells with circZNF609 knockdown or overexpression. (E) qRT-PCR analysis of circZNF609 in MCF7 and MDA-MB-231 cells with miR-145-5p knockdown or overexpression. (F) qRT-PCR analysis of miR-145-5p in BC tissues (n=143) and adjacent normal tissues (n=38). (G) Pearson’s correlation analysis of circZNF609 and miR-145-5p in BC tissues (n=143) ( r =-0.597, P

Techniques Used: Luciferase, Activity Assay, Multiple Displacement Amplification, Plasmid Preparation, Pull Down Assay, Expressing, Quantitative RT-PCR, Over Expression

71) Product Images from "Exosomes from human umbilical cord blood accelerate cutaneous wound healing through miR-21-3p-mediated promotion of angiogenesis and fibroblast function"

Article Title: Exosomes from human umbilical cord blood accelerate cutaneous wound healing through miR-21-3p-mediated promotion of angiogenesis and fibroblast function

Journal: Theranostics

doi: 10.7150/thno.21234

Inhibition of PTEN and SPRY1 induces UCB-Exos-like pro-angiogenic effects on endothelial cells. (A) The inhibitory efficiency of the siRNAs targeting PTEN and SPRY1 was verified by qRT-PCR. n = 3 per group. (B) The migration of HMECs in different treatment groups was tested by the scratch wound assay. (C) Quantitative analysis of the migration rates in (B). n = 3 per group. (D-E) Representative images and quantification of HMECs tube formation in different treatment groups. n = 3 per group. (F) CCK-8 analysis of HMECs proliferation in different treatment groups. n = 4 per group. * P
Figure Legend Snippet: Inhibition of PTEN and SPRY1 induces UCB-Exos-like pro-angiogenic effects on endothelial cells. (A) The inhibitory efficiency of the siRNAs targeting PTEN and SPRY1 was verified by qRT-PCR. n = 3 per group. (B) The migration of HMECs in different treatment groups was tested by the scratch wound assay. (C) Quantitative analysis of the migration rates in (B). n = 3 per group. (D-E) Representative images and quantification of HMECs tube formation in different treatment groups. n = 3 per group. (F) CCK-8 analysis of HMECs proliferation in different treatment groups. n = 4 per group. * P

Techniques Used: Inhibition, Quantitative RT-PCR, Migration, Scratch Wound Assay Assay, CCK-8 Assay

MiR-21-3p mediates the pro-angiogenic effects of UCB-Exos on endothelial cells. UCB-Exos induced a significant increase in the motility of HMECs, but the pro-migratory effect was decreased by the miR-21-3p inhibitor, as analyzed by the scratch wound assay (A-B) (Scale bar: 250 μm) and the transwell assay (C-D) (Scale bar: 100 μm). n = 3 per group. (E) The proliferation of HMECs receiving different treatments was assessed by CCK-8 analysis. n = 4 per group. (F) UCB-Exos increased the tube formation ability of HMECs, but this effect was decreased by miR-21-3p inhibition. Scale bar: 100 μm. (G) Quantitative analysis of the total branching points and total tube length in (F). n = 3 per group. (H) Detection of the expression of PTEN and SPRY1 by qRT-PCR analysis. n = 3 per group. (I) Detection of the phosphorylation levels of Akt and Erk1/2 by western blotting. n = 4 per group. * P
Figure Legend Snippet: MiR-21-3p mediates the pro-angiogenic effects of UCB-Exos on endothelial cells. UCB-Exos induced a significant increase in the motility of HMECs, but the pro-migratory effect was decreased by the miR-21-3p inhibitor, as analyzed by the scratch wound assay (A-B) (Scale bar: 250 μm) and the transwell assay (C-D) (Scale bar: 100 μm). n = 3 per group. (E) The proliferation of HMECs receiving different treatments was assessed by CCK-8 analysis. n = 4 per group. (F) UCB-Exos increased the tube formation ability of HMECs, but this effect was decreased by miR-21-3p inhibition. Scale bar: 100 μm. (G) Quantitative analysis of the total branching points and total tube length in (F). n = 3 per group. (H) Detection of the expression of PTEN and SPRY1 by qRT-PCR analysis. n = 3 per group. (I) Detection of the phosphorylation levels of Akt and Erk1/2 by western blotting. n = 4 per group. * P

Techniques Used: Scratch Wound Assay Assay, Transwell Assay, CCK-8 Assay, Inhibition, Expressing, Quantitative RT-PCR, Western Blot

UCB-Exos deliver miR-21-3p into fibroblasts and endothelial cells. (A) Detection of the expression of the indicated miRNAs by qRT-PCR analysis. n = 3. (B) Fluorescence microscopy analysis of PKH67-labeled UCB-Exos internalization by HSFs and HMECs. The green-labeled exosomes were visible in the perinuclear region of recipient cells. Scale bar: 50 μm. (C-D) HSFs and HMECs incubated with UCB-Exos for 3 h showed higher expression levels of miR-21-3p than controls did. n = 3 per group. Incubation with UCB-Exos for 24 h reduced the expression of PTEN and SPRY1 in HSFs (E) and HMECs (F) . n = 3 per group. UCB-Exos were used at a concentration of 100 μg/mL. * P
Figure Legend Snippet: UCB-Exos deliver miR-21-3p into fibroblasts and endothelial cells. (A) Detection of the expression of the indicated miRNAs by qRT-PCR analysis. n = 3. (B) Fluorescence microscopy analysis of PKH67-labeled UCB-Exos internalization by HSFs and HMECs. The green-labeled exosomes were visible in the perinuclear region of recipient cells. Scale bar: 50 μm. (C-D) HSFs and HMECs incubated with UCB-Exos for 3 h showed higher expression levels of miR-21-3p than controls did. n = 3 per group. Incubation with UCB-Exos for 24 h reduced the expression of PTEN and SPRY1 in HSFs (E) and HMECs (F) . n = 3 per group. UCB-Exos were used at a concentration of 100 μg/mL. * P

Techniques Used: Expressing, Quantitative RT-PCR, Fluorescence, Microscopy, Labeling, Incubation, Concentration Assay

Inhibition of PTEN and SPRY1 induces UCB-Exos-like positive effects on fibroblast function. (A) The inhibitory efficiency of the siRNAs targeting PTEN and SPRY1 was verified by qRT-PCR. n = 3 per group. (B) The migration of HSFs in different treatment groups was tested by the scratch wound assay. (C) Quantitative analysis of the migration rates in (B). n = 3 per group. (D) CCK-8 analysis of HSFs proliferation in different treatment groups. n = 4 per group. * P
Figure Legend Snippet: Inhibition of PTEN and SPRY1 induces UCB-Exos-like positive effects on fibroblast function. (A) The inhibitory efficiency of the siRNAs targeting PTEN and SPRY1 was verified by qRT-PCR. n = 3 per group. (B) The migration of HSFs in different treatment groups was tested by the scratch wound assay. (C) Quantitative analysis of the migration rates in (B). n = 3 per group. (D) CCK-8 analysis of HSFs proliferation in different treatment groups. n = 4 per group. * P

Techniques Used: Inhibition, Quantitative RT-PCR, Migration, Scratch Wound Assay Assay, CCK-8 Assay

72) Product Images from "Systematic Analysis of Alkaline/Neutral Invertase Genes Reveals the Involvement of Smi-miR399 in Regulation of SmNINV3 and SmNINV4 in Salvia miltiorrhiza"

Article Title: Systematic Analysis of Alkaline/Neutral Invertase Genes Reveals the Involvement of Smi-miR399 in Regulation of SmNINV3 and SmNINV4 in Salvia miltiorrhiza

Journal: Plants

doi: 10.3390/plants8110490

Expression of SmNINVs in S. miltiorrhiza . ( a ) Number of reads per kilobase per million mapped reads (RPKM) of SmNINVs in RNA-seq data from roots (Rt), stems (St), leaves (Le), and flowers (Fl). ( b ) Number of reads (RPKM) of SmNINVs in RNA-seq data from root periderm (Rpe), root phloem (Rph) and root xylem (Rxy). ( c ) Relative expression of SmNINVs in roots (Rt), stems (St), leaves (Le) and flowers (Fl) of S. miltiorrhiza . Expression level in leaves was arbitrarily set to 1 and the levels in other organs were given relative to this. One-way ANOVA was calculated for qRT-PCR data using IBM SPSS 20 software. P
Figure Legend Snippet: Expression of SmNINVs in S. miltiorrhiza . ( a ) Number of reads per kilobase per million mapped reads (RPKM) of SmNINVs in RNA-seq data from roots (Rt), stems (St), leaves (Le), and flowers (Fl). ( b ) Number of reads (RPKM) of SmNINVs in RNA-seq data from root periderm (Rpe), root phloem (Rph) and root xylem (Rxy). ( c ) Relative expression of SmNINVs in roots (Rt), stems (St), leaves (Le) and flowers (Fl) of S. miltiorrhiza . Expression level in leaves was arbitrarily set to 1 and the levels in other organs were given relative to this. One-way ANOVA was calculated for qRT-PCR data using IBM SPSS 20 software. P

Techniques Used: Expressing, RNA Sequencing Assay, Quantitative RT-PCR, Software

73) Product Images from "Sulfiredoxin-1 protects against simulated ischaemia/reperfusion injury in cardiomyocyte by inhibiting PI3K/AKT-regulated mitochondrial apoptotic pathways"

Article Title: Sulfiredoxin-1 protects against simulated ischaemia/reperfusion injury in cardiomyocyte by inhibiting PI3K/AKT-regulated mitochondrial apoptotic pathways

Journal: Bioscience Reports

doi: 10.1042/BSR20160076

Effect of Srx-1 overexpression on SI/R-induced cell injury H9c2 cells were transfected with the 2 nmol/l of recombinant Ad-Srx-1 or Ad-GFP prior to subject to SI/R. ( A ) About 96% of cardiomyocytes were infected after 48 h adenoviral infection. ( B and C ) The effect on Srx-1 mRNA and protein levels were evaluated by qRT-PCR and western blotting. ( D ) About 0.5 mg/ml MTT solution was added to assess the effect on cell viability. ( E ) LDH concentration was determined using a colorimetric assay kit. ( F ) Cells were subsequently treated with Annexin V/PI staining. Typical representative of cell apoptosis under various treatments by flow cytometry assay. Graph showing cell apoptotic rate in H9c2 cells. * P
Figure Legend Snippet: Effect of Srx-1 overexpression on SI/R-induced cell injury H9c2 cells were transfected with the 2 nmol/l of recombinant Ad-Srx-1 or Ad-GFP prior to subject to SI/R. ( A ) About 96% of cardiomyocytes were infected after 48 h adenoviral infection. ( B and C ) The effect on Srx-1 mRNA and protein levels were evaluated by qRT-PCR and western blotting. ( D ) About 0.5 mg/ml MTT solution was added to assess the effect on cell viability. ( E ) LDH concentration was determined using a colorimetric assay kit. ( F ) Cells were subsequently treated with Annexin V/PI staining. Typical representative of cell apoptosis under various treatments by flow cytometry assay. Graph showing cell apoptotic rate in H9c2 cells. * P

Techniques Used: Over Expression, Transfection, Recombinant, Infection, Quantitative RT-PCR, Western Blot, MTT Assay, Concentration Assay, Colorimetric Assay, Staining, Flow Cytometry, Cytometry

Down-regulation of Srx-1 in H9c2 cardiomyocytes under SI/R treatment The H9c2 cells were exposed to hypoxia for 10 h and then reoxygenated for 3 h. ( A ) The mRNA levels were detected by qRT-PCR. ( B ) The protein expression of Srx-1 was determined by western blotting. * P
Figure Legend Snippet: Down-regulation of Srx-1 in H9c2 cardiomyocytes under SI/R treatment The H9c2 cells were exposed to hypoxia for 10 h and then reoxygenated for 3 h. ( A ) The mRNA levels were detected by qRT-PCR. ( B ) The protein expression of Srx-1 was determined by western blotting. * P

Techniques Used: Quantitative RT-PCR, Expressing, Western Blot

74) Product Images from "Identification and biochemical characterization of Laodelphax striatellus neutral ceramidase"

Article Title: Identification and biochemical characterization of Laodelphax striatellus neutral ceramidase

Journal: Insect molecular biology

doi: 10.1111/imb.12028

Insecticide stimulated the LsnCer expression (A) 4-instar nymphs were treated with fipronil, imidacloprid and chlorpyrifos with LD50. Nymphs treated with acetone were used as control. The relative mRNA level of LsnCer was analyzed by qRT-PCR at indicated time points. Transcript abundance was calculated based on the difference in threshold cycle (Ct) values between LsnCer and actin transcripts based on the normalized relative quantification 2 −ΔΔCt method. The mRNA level of acetone treated nymphs was set as 1 at each time point, the relative mRNA level of each insecticide treated insects was calculated by comparing with mRNA level of acetone treated ones. (B) The nCDase activity of imidacloprid treated 4-instar nymphs analyzed at indicated time points. Ceramidase activity was assayed at pH 8. The nCDase activity in acetone-treated nymphs was set as 100% at each time point. Ceramidase activity of imidacloprid treated nymphs was expressed as % of the activity of the acetone-treated insects. Data represent the mean value ± SE of three independent experiments performed in duplicate.
Figure Legend Snippet: Insecticide stimulated the LsnCer expression (A) 4-instar nymphs were treated with fipronil, imidacloprid and chlorpyrifos with LD50. Nymphs treated with acetone were used as control. The relative mRNA level of LsnCer was analyzed by qRT-PCR at indicated time points. Transcript abundance was calculated based on the difference in threshold cycle (Ct) values between LsnCer and actin transcripts based on the normalized relative quantification 2 −ΔΔCt method. The mRNA level of acetone treated nymphs was set as 1 at each time point, the relative mRNA level of each insecticide treated insects was calculated by comparing with mRNA level of acetone treated ones. (B) The nCDase activity of imidacloprid treated 4-instar nymphs analyzed at indicated time points. Ceramidase activity was assayed at pH 8. The nCDase activity in acetone-treated nymphs was set as 100% at each time point. Ceramidase activity of imidacloprid treated nymphs was expressed as % of the activity of the acetone-treated insects. Data represent the mean value ± SE of three independent experiments performed in duplicate.

Techniques Used: Expressing, Quantitative RT-PCR, Activity Assay

75) Product Images from "Genome-Wide Identification and Analysis of Polygalacturonase Genes in Solanum lycopersicum"

Article Title: Genome-Wide Identification and Analysis of Polygalacturonase Genes in Solanum lycopersicum

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms19082290

Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.
Figure Legend Snippet: Detailed expression profile analysis of the four SlPG genes based on qRT-PCR analysis in different fruit developmental stages of S. lycopersicum . R: roots, ST: stems, L: leaves, F: flowers, MG: mature green fruit, B: breaker fruit, RR: red ripening fruit.

Techniques Used: Expressing, Quantitative RT-PCR

Related Articles

SYBR Green Assay:

Article Title: Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers
Article Snippet: For the qRT-PCR analysis, five matched normal and tumor cDNA (A ∼ E) were purchased from Clontech Laboratories, Inc. (Mountain View, CA). cDNA panels of human normal (NN) and cancer tissue (T) derived from colon, breast, esophagus, bladder and stomach were purchased from BioChain Institute, Inc. (Hayward, CA). .. One µl of each cDNA was used for qRT-PCR using QuantiFast SYBR Green PCR Kit (Promega, Valencia, CA) as described .

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan). .. The reactions were run on an ABI Prism 7500 sequence detector (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Applied Biosystems).

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS
Article Snippet: According to the manufacturer’s instructions, qRT-PCR analysis for miR-19b was carried out using the RT reagent kit (Takara, China). .. Furthermore, 500 ng total RNA was reversely transcribed into complementary DNA, and qRT-PCR was performed using SYBR Green Master Mix (Takara, China) on a 7900HT Applied Biosystem.

Article Title: Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep
Article Snippet: Validation of gene expression of by qRT-PCR For the qRT-PCR analysis, 1 μg total RNA was reverse transcribed using RT reagent kits with gDNA Eraser (Takara, China) according to the manufacturer’s protocol. .. Real-time PCR was performed on an ABI 7300 (Applied Biosystems, Foster City, CA, U.S.A.) with Fast Start Universal SYBR Green Master (ROX) (Roche, Mannheim, Germany).

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells
Article Snippet: .. QRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Takara). .. For QRT-PCR, a template equivalent to 20 ng of total RNA was subjected to 40 cycles of quantitative PCR, and the expression levels of the genes of interest were normalized to that of the gapdh gene.

RNA Extraction:

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish
Article Snippet: .. RNA extraction and qRT-PCR Total RNA was extracted using the TRIzol® Reagent, according to the manufacturer’s instructions (Invitrogen). cDNA was synthesized by using reverse transcription with the M-MLV reverse transcription kit (Invitrogen), which was then used as the template for qRT-PCR analysis. qRT-PCR reactions were performed with the ABI StepOnePlus™ system, using SYBR® Premix Ex Taq™ (TaKaRa) and the following thermal profile: 95°C for 3 minutes; 95°C for 10 seconds; 58°C for 30 seconds for 40 cycles. ..

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells
Article Snippet: Paragraph title: RNA Extraction and Quantitative RT-PCR (QRT-PCR) ... QRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Takara).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers
Article Snippet: Paragraph title: 5-Aza-dC Treatment, RT-PCR and the Quantitative Real-time RT-PCR ... For the qRT-PCR analysis, five matched normal and tumor cDNA (A ∼ E) were purchased from Clontech Laboratories, Inc. (Mountain View, CA). cDNA panels of human normal (NN) and cancer tissue (T) derived from colon, breast, esophagus, bladder and stomach were purchased from BioChain Institute, Inc. (Hayward, CA).

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS
Article Snippet: Paragraph title: Quantitative Reverse Transcription Polymerase Chain Reaction ... According to the manufacturer’s instructions, qRT-PCR analysis for miR-19b was carried out using the RT reagent kit (Takara, China).

Article Title: Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck
Article Snippet: .. The qRT-PCR analysis of the target genes of novel-mir-8 and novel-mir-14 The SYBR PrimeScript RT-PCR Kit (TaKaRa, Dalian, China) and a reference gene (β-actin ) were used for detecting the expression of MAP2K1 (a of the target of novel-mir-8) and PPARα (a of the target of novel-mir-14). .. The qRT-PCR reactions were carried out with an iCycler IQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, USA).

Synthesized:

Article Title: Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression
Article Snippet: Quantitative real-time PCR (qRT-PCR) TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA from bladder cancer tissues and cell lines. cDNAs were synthesized by reverse transcription using M-MLV reverse transcriptase (Invitrogen). .. Oligo (dT18) RT primer was used for the reverse transcription of HMGB1 mRNA and lncRNA TUG1. qRT-PCR analysis was performed using SYBR Premix Ex Taq II (TaKaRa, Dalian, China) with an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). β-actin was used as endogenous controls.

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish
Article Snippet: .. RNA extraction and qRT-PCR Total RNA was extracted using the TRIzol® Reagent, according to the manufacturer’s instructions (Invitrogen). cDNA was synthesized by using reverse transcription with the M-MLV reverse transcription kit (Invitrogen), which was then used as the template for qRT-PCR analysis. qRT-PCR reactions were performed with the ABI StepOnePlus™ system, using SYBR® Premix Ex Taq™ (TaKaRa) and the following thermal profile: 95°C for 3 minutes; 95°C for 10 seconds; 58°C for 30 seconds for 40 cycles. ..

Article Title: Aryl Hydrocarbon Receptor Promotes IL-10 Expression in Inflammatory Macrophages Through Src-STAT3 Signaling Pathway
Article Snippet: .. Complementary DNA was synthesized from 1 μg of total RNA by reverse transcription, and the mRNAs of interest were quantitated by qRT-PCR analysis using SYBR Premix (TaKaRa) on a BioRad CFX96. β-actin was chosen as the reference gene (Table ). .. HEK 293T cells were co-transfected with 1 μg of pGL3-Basic-IL10-promoter-luc and 0.1 μg of pRL-TK plasmid (Fitgene Biotech) for 48 h using Lipofectamine 2000 transfection reagent (Invitrogen).

Isolation:

Article Title: DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy
Article Snippet: For FFPE samples, a RecoverAll™ Total Nucleic Acid Isolation Kit (Life Technologies, AM1975) was used to extract total RNA according to the manufacturer's protocol. .. 1 μg total RNA per sample was reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, RR047A) according to the manufacturer's instructions. qRT‐PCR analysis was performed using the SYBR® Premix Ex Taq™ Kit (Takara, RR420A) and fast real‐time fluorescent quantitative PCR system (Life Technologies; ABI 7900HT).

Article Title: Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes
Article Snippet: qRT-PCR Total RNA was isolated with the RNeasy mini kit (QIAGEN) with DNase I treatment, and cDNA was prepared by using a ReverTraAce qPCR RT kit (Toyobo). .. The qRT-PCR analysis was performed with SYBR premix Ex TaqII (Takara Bio) on a ViiA 7 real-time PCR system (Applied Biosystems).

Article Title: Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma
Article Snippet: .. RNA isolation and qRT-PCR analysis Additionally, the miRNA mRQ 3′ primer was provided in the Mir-X miRNA qRT-PCR SYBR Kit (Clontech, Japan). .. Flow cytometric analysis The procedures of cell cycle analysis were referred to the manufacturer’s instructions of Cell Cycle Detection Kit (KGA512, KeyGEN BioTECH, China).

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: .. Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions. .. All PCR reactions were performed in a 20 μL reaction mixture under the conditions: 95°C for 30 s, 35 cycles at 95°C for 5 s, 60°C for 30 s, and 72°C for 8 s. The GAPDH gene was used as internal reference.

Mouse Assay:

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: .. Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions. .. All PCR reactions were performed in a 20 μL reaction mixture under the conditions: 95°C for 30 s, 35 cycles at 95°C for 5 s, 60°C for 30 s, and 72°C for 8 s. The GAPDH gene was used as internal reference.

Quantitative RT-PCR:

Article Title: Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers
Article Snippet: .. For the qRT-PCR analysis, five matched normal and tumor cDNA (A ∼ E) were purchased from Clontech Laboratories, Inc. (Mountain View, CA). cDNA panels of human normal (NN) and cancer tissue (T) derived from colon, breast, esophagus, bladder and stomach were purchased from BioChain Institute, Inc. (Hayward, CA). .. One µl of each cDNA was used for qRT-PCR using QuantiFast SYBR Green PCR Kit (Promega, Valencia, CA) as described .

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: .. The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan). .. The reactions were run on an ABI Prism 7500 sequence detector (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Applied Biosystems).

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS
Article Snippet: .. According to the manufacturer’s instructions, qRT-PCR analysis for miR-19b was carried out using the RT reagent kit (Takara, China). .. Furthermore, 500 ng total RNA was reversely transcribed into complementary DNA, and qRT-PCR was performed using SYBR Green Master Mix (Takara, China) on a 7900HT Applied Biosystem.

Article Title: Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression
Article Snippet: .. Oligo (dT18) RT primer was used for the reverse transcription of HMGB1 mRNA and lncRNA TUG1. qRT-PCR analysis was performed using SYBR Premix Ex Taq II (TaKaRa, Dalian, China) with an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). β-actin was used as endogenous controls. ..

Article Title: DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy
Article Snippet: .. 1 μg total RNA per sample was reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, RR047A) according to the manufacturer's instructions. qRT‐PCR analysis was performed using the SYBR® Premix Ex Taq™ Kit (Takara, RR420A) and fast real‐time fluorescent quantitative PCR system (Life Technologies; ABI 7900HT). .. For fresh frozen tumor tissues or cells samples, primers for qRT‐PCR were as follows: DSCAM‐AS1‐F, 5′‐GTGACACAGCAAGACTCCCT‐3′ and DSCAM‐AS1‐R, 5′‐GATCCGTCGTCCATCTCTGT‐3′; and GAPDH‐F, 5′‐ TGACCCCTTCATTGACCTCA ‐3′ and GAPDH‐R, 5′‐ GGACTCCACGACGTACTCAG ‐3′.

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish
Article Snippet: .. RNA extraction and qRT-PCR Total RNA was extracted using the TRIzol® Reagent, according to the manufacturer’s instructions (Invitrogen). cDNA was synthesized by using reverse transcription with the M-MLV reverse transcription kit (Invitrogen), which was then used as the template for qRT-PCR analysis. qRT-PCR reactions were performed with the ABI StepOnePlus™ system, using SYBR® Premix Ex Taq™ (TaKaRa) and the following thermal profile: 95°C for 3 minutes; 95°C for 10 seconds; 58°C for 30 seconds for 40 cycles. ..

Article Title: Tomato Sl3-MMP, a member of the Matrix metalloproteinase family, is required for disease resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000
Article Snippet: .. qRT-PCR analysis of gene expression Total RNA was extracted by Trizol regent (TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. RNA was treated with RNase-free DNase and then reverse-transcribed into cDNA using the PrimeScript RT regent kit (TaKaRa, Dalian, China).

Article Title: Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes
Article Snippet: .. The qRT-PCR analysis was performed with SYBR premix Ex TaqII (Takara Bio) on a ViiA 7 real-time PCR system (Applied Biosystems). ..

Article Title: Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep
Article Snippet: .. Validation of gene expression of by qRT-PCR For the qRT-PCR analysis, 1 μg total RNA was reverse transcribed using RT reagent kits with gDNA Eraser (Takara, China) according to the manufacturer’s protocol. .. Real-time PCR was performed on an ABI 7300 (Applied Biosystems, Foster City, CA, U.S.A.) with Fast Start Universal SYBR Green Master (ROX) (Roche, Mannheim, Germany).

Article Title: Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma
Article Snippet: .. RNA isolation and qRT-PCR analysis Additionally, the miRNA mRQ 3′ primer was provided in the Mir-X miRNA qRT-PCR SYBR Kit (Clontech, Japan). .. Flow cytometric analysis The procedures of cell cycle analysis were referred to the manufacturer’s instructions of Cell Cycle Detection Kit (KGA512, KeyGEN BioTECH, China).

Article Title: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis
Article Snippet: .. The poly(A)-tailed total RNA was reverse-transcribed by PrimeScript® RTase by using a universal adapter primer (containing oligo-dT). qRT-PCR analysis was carried out by using SYBR® Premix Ex TaqTM II (Perfect Real Time) (TaKaRa, Japan) on a Bio-Rad CFX96 machine. ..

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: .. Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions. .. All PCR reactions were performed in a 20 μL reaction mixture under the conditions: 95°C for 30 s, 35 cycles at 95°C for 5 s, 60°C for 30 s, and 72°C for 8 s. The GAPDH gene was used as internal reference.

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells
Article Snippet: .. QRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Takara). .. For QRT-PCR, a template equivalent to 20 ng of total RNA was subjected to 40 cycles of quantitative PCR, and the expression levels of the genes of interest were normalized to that of the gapdh gene.

Article Title: Aryl Hydrocarbon Receptor Promotes IL-10 Expression in Inflammatory Macrophages Through Src-STAT3 Signaling Pathway
Article Snippet: .. Complementary DNA was synthesized from 1 μg of total RNA by reverse transcription, and the mRNAs of interest were quantitated by qRT-PCR analysis using SYBR Premix (TaKaRa) on a BioRad CFX96. β-actin was chosen as the reference gene (Table ). .. HEK 293T cells were co-transfected with 1 μg of pGL3-Basic-IL10-promoter-luc and 0.1 μg of pRL-TK plasmid (Fitgene Biotech) for 48 h using Lipofectamine 2000 transfection reagent (Invitrogen).

Purification:

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS
Article Snippet: Purified RNA was extracted and stored at −80°C. .. According to the manufacturer’s instructions, qRT-PCR analysis for miR-19b was carried out using the RT reagent kit (Takara, China).

Real-time Polymerase Chain Reaction:

Article Title: Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression
Article Snippet: .. Oligo (dT18) RT primer was used for the reverse transcription of HMGB1 mRNA and lncRNA TUG1. qRT-PCR analysis was performed using SYBR Premix Ex Taq II (TaKaRa, Dalian, China) with an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). β-actin was used as endogenous controls. ..

Article Title: DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy
Article Snippet: .. 1 μg total RNA per sample was reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, RR047A) according to the manufacturer's instructions. qRT‐PCR analysis was performed using the SYBR® Premix Ex Taq™ Kit (Takara, RR420A) and fast real‐time fluorescent quantitative PCR system (Life Technologies; ABI 7900HT). .. For fresh frozen tumor tissues or cells samples, primers for qRT‐PCR were as follows: DSCAM‐AS1‐F, 5′‐GTGACACAGCAAGACTCCCT‐3′ and DSCAM‐AS1‐R, 5′‐GATCCGTCGTCCATCTCTGT‐3′; and GAPDH‐F, 5′‐ TGACCCCTTCATTGACCTCA ‐3′ and GAPDH‐R, 5′‐ GGACTCCACGACGTACTCAG ‐3′.

Article Title: Tomato Sl3-MMP, a member of the Matrix metalloproteinase family, is required for disease resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000
Article Snippet: qRT-PCR analysis of gene expression Total RNA was extracted by Trizol regent (TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. The obtained cDNAs were used for gene expression analysis with real time quantitative PCR.

Article Title: Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes
Article Snippet: .. The qRT-PCR analysis was performed with SYBR premix Ex TaqII (Takara Bio) on a ViiA 7 real-time PCR system (Applied Biosystems). ..

Article Title: Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep
Article Snippet: Validation of gene expression of by qRT-PCR For the qRT-PCR analysis, 1 μg total RNA was reverse transcribed using RT reagent kits with gDNA Eraser (Takara, China) according to the manufacturer’s protocol. .. Real-time PCR was performed on an ABI 7300 (Applied Biosystems, Foster City, CA, U.S.A.) with Fast Start Universal SYBR Green Master (ROX) (Roche, Mannheim, Germany).

Article Title: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis
Article Snippet: Paragraph title: Quantitative real-time PCR ... The poly(A)-tailed total RNA was reverse-transcribed by PrimeScript® RTase by using a universal adapter primer (containing oligo-dT). qRT-PCR analysis was carried out by using SYBR® Premix Ex TaqTM II (Perfect Real Time) (TaKaRa, Japan) on a Bio-Rad CFX96 machine.

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells
Article Snippet: .. QRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Takara). .. For QRT-PCR, a template equivalent to 20 ng of total RNA was subjected to 40 cycles of quantitative PCR, and the expression levels of the genes of interest were normalized to that of the gapdh gene.

Article Title: Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck
Article Snippet: The qRT-PCR analysis of the target genes of novel-mir-8 and novel-mir-14 The SYBR PrimeScript RT-PCR Kit (TaKaRa, Dalian, China) and a reference gene (β-actin ) were used for detecting the expression of MAP2K1 (a of the target of novel-mir-8) and PPARα (a of the target of novel-mir-14). .. The qRT-PCR reactions were carried out with an iCycler IQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, USA).

Polymerase Chain Reaction:

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan). .. The reactions were run on an ABI Prism 7500 sequence detector (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Applied Biosystems).

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions. .. All PCR reactions were performed in a 20 μL reaction mixture under the conditions: 95°C for 30 s, 35 cycles at 95°C for 5 s, 60°C for 30 s, and 72°C for 8 s. The GAPDH gene was used as internal reference.

Article Title: Aryl Hydrocarbon Receptor Promotes IL-10 Expression in Inflammatory Macrophages Through Src-STAT3 Signaling Pathway
Article Snippet: Paragraph title: Quantitative reverse transcription PCR analysis ... Complementary DNA was synthesized from 1 μg of total RNA by reverse transcription, and the mRNAs of interest were quantitated by qRT-PCR analysis using SYBR Premix (TaKaRa) on a BioRad CFX96. β-actin was chosen as the reference gene (Table ).

Transgenic Assay:

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: The expression patterns and levels of secondary cell wall-related genes in 120-day-old PdRanBP -OE and PdRanBP -DR transgenic plants were also assessed (Additional files and ). .. The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan).

Formalin-fixed Paraffin-Embedded:

Article Title: DSCAM‐ AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy, et al. DSCAM‐AS1 regulates the G1/S cell cycle transition and is an independent prognostic factor of poor survival in luminal breast cancer patients treated with endocrine therapy
Article Snippet: For FFPE samples, a RecoverAll™ Total Nucleic Acid Isolation Kit (Life Technologies, AM1975) was used to extract total RNA according to the manufacturer's protocol. .. 1 μg total RNA per sample was reverse transcribed into cDNA using a PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara, RR047A) according to the manufacturer's instructions. qRT‐PCR analysis was performed using the SYBR® Premix Ex Taq™ Kit (Takara, RR420A) and fast real‐time fluorescent quantitative PCR system (Life Technologies; ABI 7900HT).

Infection:

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: Analysis of the expression of selected miRNAs and their target genes To investigate the link between altered levels of miRNAs and the expression of putative targets, qRT-PCR was performed to determine the expression of the genes encoding Caspase-3 for miR-706 [ ], cAMP responsive element binding protein 1 (Creb1) for miR-134 [ ], and Bcl2/adenovirus E1B interacting protein 3 (Bnip3) for miR-210 [ ] in S. japonicum infected mice. .. Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions.

Expressing:

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: Paragraph title: Analysis of the expression of PdRanBP and secondary wall-associated transcription factors/genes by qRT-PCR ... The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan).

Article Title: MicroRNA-19b Promotes Nasopharyngeal Carcinoma More Sensitive to Cisplatin by Suppressing KRAS
Article Snippet: According to the manufacturer’s instructions, qRT-PCR analysis for miR-19b was carried out using the RT reagent kit (Takara, China). .. The miR-19b expression was determined relative to internal U6, and relative fold changes were calculated by 2−▵▵Ct .

Article Title: Heme acts through the Bach1b/Nrf2a-MafK pathway to regulate exocrine peptidase precursor genes in porphyric zebrafish
Article Snippet: RNA extraction and qRT-PCR Total RNA was extracted using the TRIzol® Reagent, according to the manufacturer’s instructions (Invitrogen). cDNA was synthesized by using reverse transcription with the M-MLV reverse transcription kit (Invitrogen), which was then used as the template for qRT-PCR analysis. qRT-PCR reactions were performed with the ABI StepOnePlus™ system, using SYBR® Premix Ex Taq™ (TaKaRa) and the following thermal profile: 95°C for 3 minutes; 95°C for 10 seconds; 58°C for 30 seconds for 40 cycles. .. Relative mRNA expression levels were quantified using the comparative C t (ΔC t ) method and expressed as 2−(ΔΔC t) .

Article Title: Tomato Sl3-MMP, a member of the Matrix metalloproteinase family, is required for disease resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000
Article Snippet: .. qRT-PCR analysis of gene expression Total RNA was extracted by Trizol regent (TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. RNA was treated with RNase-free DNase and then reverse-transcribed into cDNA using the PrimeScript RT regent kit (TaKaRa, Dalian, China).

Article Title: Controlling the Regional Identity of hPSC-Derived Neurons to Uncover Neuronal Subtype Specificity of Neurological Disease Phenotypes
Article Snippet: The qRT-PCR analysis was performed with SYBR premix Ex TaqII (Takara Bio) on a ViiA 7 real-time PCR system (Applied Biosystems). .. Relative expression levels are presented as geometric means ± geometric SEM.

Article Title: Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep
Article Snippet: .. Validation of gene expression of by qRT-PCR For the qRT-PCR analysis, 1 μg total RNA was reverse transcribed using RT reagent kits with gDNA Eraser (Takara, China) according to the manufacturer’s protocol. .. Real-time PCR was performed on an ABI 7300 (Applied Biosystems, Foster City, CA, U.S.A.) with Fast Start Universal SYBR Green Master (ROX) (Roche, Mannheim, Germany).

Article Title: Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis
Article Snippet: The poly(A)-tailed total RNA was reverse-transcribed by PrimeScript® RTase by using a universal adapter primer (containing oligo-dT). qRT-PCR analysis was carried out by using SYBR® Premix Ex TaqTM II (Perfect Real Time) (TaKaRa, Japan) on a Bio-Rad CFX96 machine. .. Relative expression levels of miRNAs were quantified by using the 2-ΔΔCt method [ ].

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: Paragraph title: Analysis of the expression of selected miRNAs and their target genes ... Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions.

Article Title: Histone Deacetylase 1 and 3 Regulate the Mesodermal Lineage Commitment of Mouse Embryonic Stem Cells
Article Snippet: QRT-PCR analysis was performed using the SYBR Green qPCR Master Mix (Takara). .. For QRT-PCR, a template equivalent to 20 ng of total RNA was subjected to 40 cycles of quantitative PCR, and the expression levels of the genes of interest were normalized to that of the gapdh gene.

Article Title: Identification and Profiling of MicroRNAs in the Embryonic Breast Muscle of Pekin Duck
Article Snippet: .. The qRT-PCR analysis of the target genes of novel-mir-8 and novel-mir-14 The SYBR PrimeScript RT-PCR Kit (TaKaRa, Dalian, China) and a reference gene (β-actin ) were used for detecting the expression of MAP2K1 (a of the target of novel-mir-8) and PPARα (a of the target of novel-mir-14). .. The qRT-PCR reactions were carried out with an iCycler IQ5 Multicolor Real-Time PCR Detection System (Bio-Rad, USA).

Sequencing:

Article Title: Small GTP-binding protein PdRanBP regulates vascular tissue development in poplar
Article Snippet: The qRT-PCR analysis was performed using the α-tubulin (TUA1 ) and Ubiquitin (UBQ1 ) gene as internal controls [ ], according to the instructions of the SYBR® Premix Ex TaqTM Kit (Takara, Tokyo, Japan). .. The reactions were run on an ABI Prism 7500 sequence detector (Applied Biosystems, Foster City, CA, USA) using SYBR Green PCR Master Mix (Applied Biosystems).

Binding Assay:

Article Title: Altered levels of circulating miRNAs are associated Schistosoma japonicum infection in mice
Article Snippet: Analysis of the expression of selected miRNAs and their target genes To investigate the link between altered levels of miRNAs and the expression of putative targets, qRT-PCR was performed to determine the expression of the genes encoding Caspase-3 for miR-706 [ ], cAMP responsive element binding protein 1 (Creb1) for miR-134 [ ], and Bcl2/adenovirus E1B interacting protein 3 (Bnip3) for miR-210 [ ] in S. japonicum infected mice. .. Total RNAs were isolated from the plasma of mice at 25 dpi and transcribed into cDNA using a PrimeScript RT reagent Kit (Takara) and qRT-PCR analysis was performed using the SYBR Premix ExTaq kit (TaKaRa), each according to the manufacturer’s instructions.

Derivative Assay:

Article Title: Cysteine Dioxygenase 1 Is a Tumor Suppressor Gene Silenced by Promoter Methylation in Multiple Human Cancers
Article Snippet: .. For the qRT-PCR analysis, five matched normal and tumor cDNA (A ∼ E) were purchased from Clontech Laboratories, Inc. (Mountain View, CA). cDNA panels of human normal (NN) and cancer tissue (T) derived from colon, breast, esophagus, bladder and stomach were purchased from BioChain Institute, Inc. (Hayward, CA). .. One µl of each cDNA was used for qRT-PCR using QuantiFast SYBR Green PCR Kit (Promega, Valencia, CA) as described .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa quantitative real time pcr qrt pcr analysis total rna
    Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and <t>qRT-PCR.</t> Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.
    Quantitative Real Time Pcr Qrt Pcr Analysis Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr analysis total rna/product/TaKaRa
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr analysis total rna - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    78
    TaKaRa quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr
    <t>qRT-PCR</t> analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.
    Quantitative Reverse Transcription Qrt Pcr Analysis Quantitative Reverse Transcription Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr/product/TaKaRa
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    82
    TaKaRa qrt pcr analysis quantitative reverse transcription polymerase chain reaction qrt pcr
    <t>qRT-PCR</t> validation of selected genes in linalool and borneol chemotypes of C. camphora . a The gray bars represent the relative expression determined with RT-qPCR (left y-axis) and the black bars represent the level of expression (FPKM) of the transcripts (right y-axis). The relative expression levels were estimated from the threshold of PCR cycle with the delta-delta CT method. The error bars indicate the standard errors from two biological and three technical replicates. b Scatter plots show simple linear regression and the R-squared (R 2 ) between RNA sequencing data and qRT-PCR validation data expressed in terms of log 2 FC. The fold change (FC) was calculated as the ratio between the linalool-type and borneol-type of C. camphora
    Qrt Pcr Analysis Quantitative Reverse Transcription Polymerase Chain Reaction Qrt Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis quantitative reverse transcription polymerase chain reaction qrt pcr/product/TaKaRa
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis quantitative reverse transcription polymerase chain reaction qrt pcr - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    Image Search Results


    Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and qRT-PCR. Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.

    Journal: PLoS ONE

    Article Title: Quantitative Proteomic Analysis of Wheat Seeds during Artificial Ageing and Priming Using the Isobaric Tandem Mass Tag Labeling

    doi: 10.1371/journal.pone.0162851

    Figure Lengend Snippet: Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and qRT-PCR. Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.

    Article Snippet: RNA isolation and quantitative real-time PCR (qRT-PCR) analysis Total RNA from wheat embryos of WH98, WH50, WH20, and WH01 were extracted by using RNAiso Plus reagent (Takara, Tokyo, Japan), and genomic DNA was removed by treating with DNase I (Takara) following the manufacturer’s protocol.

    Techniques: Expressing, Quantitative RT-PCR

    LncRNA DBH-AS1 is inactivated by p53 A. The potential p53-binding site upstream of DBH-AS1 predicted by JASPAR database. B. Western blot analysis showed the reduced levels of p53 protein in HepG2 cells and LO2 cells transfected with siRNAs. C. Reduced p53 mRNA expression by siRNAs in HepG2 cells and LO2 cells was shown by qRT-PCR. D. Expression of DBH-AS1 transcripts was quantified by qRT-PCR. Data shown are the mean ± SD of three independent experiments. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 is inactivated by p53 A. The potential p53-binding site upstream of DBH-AS1 predicted by JASPAR database. B. Western blot analysis showed the reduced levels of p53 protein in HepG2 cells and LO2 cells transfected with siRNAs. C. Reduced p53 mRNA expression by siRNAs in HepG2 cells and LO2 cells was shown by qRT-PCR. D. Expression of DBH-AS1 transcripts was quantified by qRT-PCR. Data shown are the mean ± SD of three independent experiments. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Binding Assay, Western Blot, Transfection, Expressing, Quantitative RT-PCR

    LncRNA DBH-AS1 induces cell-cycle progression in HCC cells A. HepG2 and SMMC-7721 cells with elevated DBH-AS1 expression were seeded on 96-well plates, and cell proliferation was examined by EdU immunofluorescence staining. Effect of DBH-AS1 knockdown on Hep3B and SK-Hep1 cell proliferation was also measured by EdU immunofluorescence staining. The graph on the right shows the percentage of EdU-positive nuclei. B. Cell-cycle analysis of HepG2 and SMMC-7721 cells overexpressing DBH-AS1 and Hep3B and SK-Hep1 cells with stably silenced DBH-AS1 expression. C. Proportion of cells in various phases of the cell cycle. D. - E. The relative expression levels of cell cycle associated genes, including CDK6, CCND1, CCNE1, P16, P21 and P27, were detected in HepG2 cells overexpressing DBH-AS1 and Hep3B cells with stably down-regulated DBH-AS1 expression by qRT-PCR D. and western blot with quantitative analysis E. . The results show the means ± SD from at least 3 separate experiments. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 induces cell-cycle progression in HCC cells A. HepG2 and SMMC-7721 cells with elevated DBH-AS1 expression were seeded on 96-well plates, and cell proliferation was examined by EdU immunofluorescence staining. Effect of DBH-AS1 knockdown on Hep3B and SK-Hep1 cell proliferation was also measured by EdU immunofluorescence staining. The graph on the right shows the percentage of EdU-positive nuclei. B. Cell-cycle analysis of HepG2 and SMMC-7721 cells overexpressing DBH-AS1 and Hep3B and SK-Hep1 cells with stably silenced DBH-AS1 expression. C. Proportion of cells in various phases of the cell cycle. D. - E. The relative expression levels of cell cycle associated genes, including CDK6, CCND1, CCNE1, P16, P21 and P27, were detected in HepG2 cells overexpressing DBH-AS1 and Hep3B cells with stably down-regulated DBH-AS1 expression by qRT-PCR D. and western blot with quantitative analysis E. . The results show the means ± SD from at least 3 separate experiments. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Expressing, Immunofluorescence, Staining, Cell Cycle Assay, Stable Transfection, Quantitative RT-PCR, Western Blot

    HBx induces the expression of lncRNA DBH-AS1 A. Ectopic re-expression of HBx was detected in Lv-HBx-transfected HepG2 and LO2 cells by qRT-PCR and western blot. β-actin was used as a loading control. B. The relative expression of lncRNA DBH-AS1 in HepG2 and LO2 cells re-expressing HBx compared with controls by qRT-PCR. Data are shown as the mean±SD based on at least three independent experiments. C. Comparison of levels of DBH-AS1 in HCC patients with and without HBV infection (independent t test). D. The correlation between DBH-AS1 transcript level and HBx mRNA level in 31 HCC tissues. The ΔCt values were subjected to Pearson correlation analysis. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: HBx induces the expression of lncRNA DBH-AS1 A. Ectopic re-expression of HBx was detected in Lv-HBx-transfected HepG2 and LO2 cells by qRT-PCR and western blot. β-actin was used as a loading control. B. The relative expression of lncRNA DBH-AS1 in HepG2 and LO2 cells re-expressing HBx compared with controls by qRT-PCR. Data are shown as the mean±SD based on at least three independent experiments. C. Comparison of levels of DBH-AS1 in HCC patients with and without HBV infection (independent t test). D. The correlation between DBH-AS1 transcript level and HBx mRNA level in 31 HCC tissues. The ΔCt values were subjected to Pearson correlation analysis. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Expressing, Transfection, Quantitative RT-PCR, Western Blot, Infection

    LncRNA DBH-AS1 promotes HCC cell proliferation in vitro A. HepG2 and SMMC-7721 cells were infected with lentivirus carrying the DBH-AS1 gene, and HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 were screened by qRT-PCR. B. Short hairpin RNA against DBH-AS1 stably decreased the expression of DBH-AS1 in sh-DBH-AS1 Hep3B and SK-Hep1 cells compared with sh-control cells by qRT-PCR. C. After overexpression of DBH-AS1 in HepG2 and SMMC-7721 cells, the cell viability was assessed by CCK-8 assays daily for 3 days. D. Cell viability was assessed by CCK-8 assays daily for 3 days in Hep3B and SK-Hep1 cells with silenced DBH-AS1 expression. E. Colony formation assays were performed on HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 for 2 weeks. F. In vitro proliferative ability of Hep3B and SK-Hep1 cells was significantly decreased in DBH-AS1-suppressed cells compared to sh-control cells by colony formation assays. Data are presented as mean ± SD for at least three independent experiments, * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 promotes HCC cell proliferation in vitro A. HepG2 and SMMC-7721 cells were infected with lentivirus carrying the DBH-AS1 gene, and HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 were screened by qRT-PCR. B. Short hairpin RNA against DBH-AS1 stably decreased the expression of DBH-AS1 in sh-DBH-AS1 Hep3B and SK-Hep1 cells compared with sh-control cells by qRT-PCR. C. After overexpression of DBH-AS1 in HepG2 and SMMC-7721 cells, the cell viability was assessed by CCK-8 assays daily for 3 days. D. Cell viability was assessed by CCK-8 assays daily for 3 days in Hep3B and SK-Hep1 cells with silenced DBH-AS1 expression. E. Colony formation assays were performed on HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 for 2 weeks. F. In vitro proliferative ability of Hep3B and SK-Hep1 cells was significantly decreased in DBH-AS1-suppressed cells compared to sh-control cells by colony formation assays. Data are presented as mean ± SD for at least three independent experiments, * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: In Vitro, Infection, Stable Transfection, Quantitative RT-PCR, shRNA, Expressing, Over Expression, CCK-8 Assay

    qRT-PCR analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.

    Journal: Scientific Reports

    Article Title: Overexpression of the Eggplant (Solanum melongena) NAC Family Transcription Factor SmNAC Suppresses Resistance to Bacterial Wilt

    doi: 10.1038/srep31568

    Figure Lengend Snippet: qRT-PCR analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.

    Article Snippet: Quantitative reverse-transcription (qRT-PCR) analysis Quantitative reverse-transcription PCR (qPCR) was performed using gene-specific primers ( ) and a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols.

    Techniques: Quantitative RT-PCR, Expressing, Transgenic Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    qRT-PCR validation of selected genes in linalool and borneol chemotypes of C. camphora . a The gray bars represent the relative expression determined with RT-qPCR (left y-axis) and the black bars represent the level of expression (FPKM) of the transcripts (right y-axis). The relative expression levels were estimated from the threshold of PCR cycle with the delta-delta CT method. The error bars indicate the standard errors from two biological and three technical replicates. b Scatter plots show simple linear regression and the R-squared (R 2 ) between RNA sequencing data and qRT-PCR validation data expressed in terms of log 2 FC. The fold change (FC) was calculated as the ratio between the linalool-type and borneol-type of C. camphora

    Journal: BMC Genomics

    Article Title: Transcriptome analysis and identification of genes related to terpenoid biosynthesis in Cinnamomum camphora

    doi: 10.1186/s12864-018-4941-1

    Figure Lengend Snippet: qRT-PCR validation of selected genes in linalool and borneol chemotypes of C. camphora . a The gray bars represent the relative expression determined with RT-qPCR (left y-axis) and the black bars represent the level of expression (FPKM) of the transcripts (right y-axis). The relative expression levels were estimated from the threshold of PCR cycle with the delta-delta CT method. The error bars indicate the standard errors from two biological and three technical replicates. b Scatter plots show simple linear regression and the R-squared (R 2 ) between RNA sequencing data and qRT-PCR validation data expressed in terms of log 2 FC. The fold change (FC) was calculated as the ratio between the linalool-type and borneol-type of C. camphora

    Article Snippet: Validation of DEGs by qRT-PCR analysis Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was employed using the SYBR Green PCR Master Mix (Takara, Dalian, China) and the ABI ViiA 7 Real-time PCR platform.

    Techniques: Quantitative RT-PCR, Expressing, Polymerase Chain Reaction, RNA Sequencing Assay

    qRT-PCR validation of selected genes in five chemotypes of C. camphora . Five chemotypes include camphor-, cineole-, nerolidol-, borneol- and linalool-types. Relative expression levels were estimated from the threshold of the PCR cycle by the Delta CT method. The values indicate the means of two biological replications

    Journal: BMC Genomics

    Article Title: Transcriptome analysis and identification of genes related to terpenoid biosynthesis in Cinnamomum camphora

    doi: 10.1186/s12864-018-4941-1

    Figure Lengend Snippet: qRT-PCR validation of selected genes in five chemotypes of C. camphora . Five chemotypes include camphor-, cineole-, nerolidol-, borneol- and linalool-types. Relative expression levels were estimated from the threshold of the PCR cycle by the Delta CT method. The values indicate the means of two biological replications

    Article Snippet: Validation of DEGs by qRT-PCR analysis Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was employed using the SYBR Green PCR Master Mix (Takara, Dalian, China) and the ABI ViiA 7 Real-time PCR platform.

    Techniques: Quantitative RT-PCR, Expressing, Polymerase Chain Reaction