Structured Review

TaKaRa qrt pcr analysis
Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and <t>qRT-PCR</t> analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale
Qrt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qrt pcr analysis/product/TaKaRa
Average 99 stars, based on 455 article reviews
Price from $9.99 to $1999.99
qrt pcr analysis - by Bioz Stars, 2020-10
99/100 stars

Images

1) Product Images from "Genome-wide identification and expression analysis of the NAC transcription factor family in tomato (Solanum lycopersicum) during aluminum stress"

Article Title: Genome-wide identification and expression analysis of the NAC transcription factor family in tomato (Solanum lycopersicum) during aluminum stress

Journal: BMC Genomics

doi: 10.1186/s12864-020-6689-7

Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and qRT-PCR analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale
Figure Legend Snippet: Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and qRT-PCR analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale

Techniques Used: Expressing, RNA Sequencing Assay, Quantitative RT-PCR

2) Product Images from "Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma"

Article Title: Circ-ASH2L promotes tumor progression by sponging miR-34a to regulate Notch1 in pancreatic ductal adenocarcinoma

Journal: Journal of Experimental & Clinical Cancer Research : CR

doi: 10.1186/s13046-019-1436-0

a-b The protein expression levels of indicate treated Capan-1 ( a ) and Aspc-1 ( b ) cells were measured by WB analysis. c The mRNA expression levels of indicate treated Capan-1and Aspc-1 cells were measured by qRT-PCR analysis. d The protein expression levels of indicate treated Capan-1 and Aspc-1 cells were measured by ELISA analysis. e-g Animal experiments, the luciferase intensities were measured each week ( e and f ) after intrapancreatic injection with NC or circ-ASH2L overexpressing Capan-1 cells, pancreatic tumor in situ (the black arrows point to) and liver metastasis foci (the yellow arrows point to) were showed by autopsy and H E staining ( g )
Figure Legend Snippet: a-b The protein expression levels of indicate treated Capan-1 ( a ) and Aspc-1 ( b ) cells were measured by WB analysis. c The mRNA expression levels of indicate treated Capan-1and Aspc-1 cells were measured by qRT-PCR analysis. d The protein expression levels of indicate treated Capan-1 and Aspc-1 cells were measured by ELISA analysis. e-g Animal experiments, the luciferase intensities were measured each week ( e and f ) after intrapancreatic injection with NC or circ-ASH2L overexpressing Capan-1 cells, pancreatic tumor in situ (the black arrows point to) and liver metastasis foci (the yellow arrows point to) were showed by autopsy and H E staining ( g )

Techniques Used: Expressing, Western Blot, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Luciferase, Injection, In Situ, Staining

a Relative circ-ASH2L expressions of Hs 766 T and Hs 766 T-L2 were measured by qRT-PCR. b Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. c Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. d qRT-PCR analysis of circ-ASH2L or β-actin after treatment of RNase R in Capan-1 and Aspc-1 cells. e qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Capan-1 cells. f qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Aspc-1 cells. g Relative expressions of circ-ASH2L in indicate treated Capan-1 and Aspc-1 cells was measured by qRT-PCR. h The PCR products of Capan-1 cells were confirmed by Sanger sequencing to show the back-splice junction. i Schematic outlining the details of circ-ASH2L and its primer-designing details
Figure Legend Snippet: a Relative circ-ASH2L expressions of Hs 766 T and Hs 766 T-L2 were measured by qRT-PCR. b Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. c Relative circ-ASH2L expressions of HPDE (the normal pancreatic cell line) and the indicated PDAC cells were measured by qRT-PCR. d qRT-PCR analysis of circ-ASH2L or β-actin after treatment of RNase R in Capan-1 and Aspc-1 cells. e qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Capan-1 cells. f qRT-PCR analysis of circ-ASH2L and β-actin after treatment of Actinomycin D at the indicated time points in Aspc-1 cells. g Relative expressions of circ-ASH2L in indicate treated Capan-1 and Aspc-1 cells was measured by qRT-PCR. h The PCR products of Capan-1 cells were confirmed by Sanger sequencing to show the back-splice junction. i Schematic outlining the details of circ-ASH2L and its primer-designing details

Techniques Used: Quantitative RT-PCR, Polymerase Chain Reaction, Sequencing

a-b The in-situ expressions of circ-ASH2L ( a ) and 18S ( b , as a control) in Capan-1 cells. Scale bars = 12.5 μm. c The expressions of indicated miRNAs in indicate treated HEK-293 cells were measured by qRT-PCR. d The prediction for miR-34a binding sites on circ-ASH2L transcript. e Schematic outlining the wild type and mut circ-ASH2L luciferase plasmid. ( f ) Luciferase activity in HEK-293 cells co-transfected with indicated concentration of miR-34a or circ-ASH2L luciferase reporter transcript. Data are showed as the ratio of firefly activity to Renilla luciferase activity. g RNA immunoprecipitation (RIP) experiments were performed using the anti-Ago2 or lgG antibody to immunoprecipitates, the expressions of circ-ASH2L or β-actin were measured by qRT-PCR. h The schematic diagram of RNA pull-down assay in this study. i circ-ASH2L was pulled down and enriched with miR-34a probe and then detected by qRT-PCR
Figure Legend Snippet: a-b The in-situ expressions of circ-ASH2L ( a ) and 18S ( b , as a control) in Capan-1 cells. Scale bars = 12.5 μm. c The expressions of indicated miRNAs in indicate treated HEK-293 cells were measured by qRT-PCR. d The prediction for miR-34a binding sites on circ-ASH2L transcript. e Schematic outlining the wild type and mut circ-ASH2L luciferase plasmid. ( f ) Luciferase activity in HEK-293 cells co-transfected with indicated concentration of miR-34a or circ-ASH2L luciferase reporter transcript. Data are showed as the ratio of firefly activity to Renilla luciferase activity. g RNA immunoprecipitation (RIP) experiments were performed using the anti-Ago2 or lgG antibody to immunoprecipitates, the expressions of circ-ASH2L or β-actin were measured by qRT-PCR. h The schematic diagram of RNA pull-down assay in this study. i circ-ASH2L was pulled down and enriched with miR-34a probe and then detected by qRT-PCR

Techniques Used: In Situ, Quantitative RT-PCR, Binding Assay, Luciferase, Plasmid Preparation, Activity Assay, Transfection, Concentration Assay, Immunoprecipitation, Pull Down Assay

3) Product Images from "Phosphoribosyl Pyrophosphate Amidotransferase Promotes the Progression of Thyroid Cancer via Regulating Pyruvate Kinase M2"

Article Title: Phosphoribosyl Pyrophosphate Amidotransferase Promotes the Progression of Thyroid Cancer via Regulating Pyruvate Kinase M2

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S253137

PPAT was highly expressed in TC tissues and cells. ( A ) We used IHC to detect the expression of PPAT protein in tissue samples from 50 TC patients and 50 normal thyroid tissues. ( B ) qRT-PCR was used to detect the expression of PPAT mRNA in TC tissues and normal thyroid tissues. ( C ) qRT-PCR was used to detect PPAT mRNA expression in normal thyroid follicular epithelial cells and TC cells. ( D ) Western blot was used to detect PPAT protein expression in normal thyroid follicular epithelial cells and TC cells. ( E ) The relationship between the expression of PPAT and the prognosis of TC patients was analyzed by GEPIA database. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P
Figure Legend Snippet: PPAT was highly expressed in TC tissues and cells. ( A ) We used IHC to detect the expression of PPAT protein in tissue samples from 50 TC patients and 50 normal thyroid tissues. ( B ) qRT-PCR was used to detect the expression of PPAT mRNA in TC tissues and normal thyroid tissues. ( C ) qRT-PCR was used to detect PPAT mRNA expression in normal thyroid follicular epithelial cells and TC cells. ( D ) Western blot was used to detect PPAT protein expression in normal thyroid follicular epithelial cells and TC cells. ( E ) The relationship between the expression of PPAT and the prognosis of TC patients was analyzed by GEPIA database. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P

Techniques Used: Immunohistochemistry, Expressing, Quantitative RT-PCR, Western Blot

PKM2 expression was up-regulated in TC tissues and cells. ( A ) GEPIA database was used to analyze the expression of PKM2 in TC tissues. ( B ) Immunohistochemistry was used to detect the expression of PKM2 protein in tissue samples from TC patients and normal thyroid tissues. ( C ) qRT-PCR was used to detect the expression of PKM2 mRNA in TC tissues and normal thyroid tissues. ( D ) qRT-PCR was used to detect PKM2 mRNA expression in normal thyroid follicular epithelial cells and TC cells. ( E ) Western blot was used to detect PKM2 protein expression in normal thyroid follicular epithelial cells and TC cells. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P
Figure Legend Snippet: PKM2 expression was up-regulated in TC tissues and cells. ( A ) GEPIA database was used to analyze the expression of PKM2 in TC tissues. ( B ) Immunohistochemistry was used to detect the expression of PKM2 protein in tissue samples from TC patients and normal thyroid tissues. ( C ) qRT-PCR was used to detect the expression of PKM2 mRNA in TC tissues and normal thyroid tissues. ( D ) qRT-PCR was used to detect PKM2 mRNA expression in normal thyroid follicular epithelial cells and TC cells. ( E ) Western blot was used to detect PKM2 protein expression in normal thyroid follicular epithelial cells and TC cells. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P

Techniques Used: Expressing, Immunohistochemistry, Quantitative RT-PCR, Western Blot

PPAT activated ERK and STAT3 signaling pathway by up-regulating PKM2 expression. ( A and B ) Western blot was used to detect the expression of PKM2 protein in BHP5-16 and KTC-1 cells after overexpression or knockdown of PPAT. ( C ) qRT-PCR was used to detect the expression of PKM2 mRNA in BHP5-16 and KTC-1 cells after overexpression or knockdown of PPAT. ( D ) qRT-PCR was used to detect the correlation between PPAT mRNA and PKM2 mRNA expression in TC tissue. ( E ) Western blot was used to detect the p-ERK, ERK, p-STAT3, and STAT3 after PPAT and PKM2 were modulated in TC cells. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P
Figure Legend Snippet: PPAT activated ERK and STAT3 signaling pathway by up-regulating PKM2 expression. ( A and B ) Western blot was used to detect the expression of PKM2 protein in BHP5-16 and KTC-1 cells after overexpression or knockdown of PPAT. ( C ) qRT-PCR was used to detect the expression of PKM2 mRNA in BHP5-16 and KTC-1 cells after overexpression or knockdown of PPAT. ( D ) qRT-PCR was used to detect the correlation between PPAT mRNA and PKM2 mRNA expression in TC tissue. ( E ) Western blot was used to detect the p-ERK, ERK, p-STAT3, and STAT3 after PPAT and PKM2 were modulated in TC cells. The experimental results were analyzed by Student’s t -test, and the difference was statistically significant with P

Techniques Used: Expressing, Western Blot, Over Expression, Quantitative RT-PCR

4) Product Images from "Oxygen promotes biofilm formation of Shewanellaputrefaciens CN32 through a diguanylate cyclase and an adhesin"

Article Title: Oxygen promotes biofilm formation of Shewanellaputrefaciens CN32 through a diguanylate cyclase and an adhesin

Journal: Scientific Reports

doi: 10.1038/srep01945

DosD regulates the transcription and secretion of bpfA . (A) The transcription levels of bpfA and aggA in Δ dosD relative to WT. The quantity of cDNA was normalized to the abundance of 16S cDNA in the qRT-PCR analysis. (B) The level of BpfA in Δ dosD bpfA + ::gfp and bpfA + ::gfp . WT was set as a control. (C) Localization and abundance of BpfA inΔ aggA bpfA + ::gfp and bpfA + ::gfp . M indicates the sample of membrane fractions and C indicates the sample of cytoplasm fraction.
Figure Legend Snippet: DosD regulates the transcription and secretion of bpfA . (A) The transcription levels of bpfA and aggA in Δ dosD relative to WT. The quantity of cDNA was normalized to the abundance of 16S cDNA in the qRT-PCR analysis. (B) The level of BpfA in Δ dosD bpfA + ::gfp and bpfA + ::gfp . WT was set as a control. (C) Localization and abundance of BpfA inΔ aggA bpfA + ::gfp and bpfA + ::gfp . M indicates the sample of membrane fractions and C indicates the sample of cytoplasm fraction.

Techniques Used: Quantitative RT-PCR

5) Product Images from "MAD2 Combined with Mitotic Spindle Apparatus (MSA) and Anticentromere Antibody (ACA) for Diagnosis of Small Cell Lung Cancer (SCLC)"

Article Title: MAD2 Combined with Mitotic Spindle Apparatus (MSA) and Anticentromere Antibody (ACA) for Diagnosis of Small Cell Lung Cancer (SCLC)

Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

doi: 10.12659/MSM.909772

Agarose electrophoresis of MAD2 expression. MAD2 expression was assessed by agarose electrophoresis. GAPDH was used for internal reference and the length was 146 bp. The length of MAD2 was 163 bp. SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer; PN, pulmonary nodule ( A ). MAD2 expression in SCLC, NSCLC, and PN groups. The quantity of MAD2 expression was assessed by qRt-PCR. * SCLC vs. PN, ** SCLC vs. NSCLC; *** NSCLC vs. PN, P
Figure Legend Snippet: Agarose electrophoresis of MAD2 expression. MAD2 expression was assessed by agarose electrophoresis. GAPDH was used for internal reference and the length was 146 bp. The length of MAD2 was 163 bp. SCLC, small cell lung cancer; NSCLC, non-small cell lung cancer; PN, pulmonary nodule ( A ). MAD2 expression in SCLC, NSCLC, and PN groups. The quantity of MAD2 expression was assessed by qRt-PCR. * SCLC vs. PN, ** SCLC vs. NSCLC; *** NSCLC vs. PN, P

Techniques Used: Electrophoresis, Expressing, Quantitative RT-PCR

6) Product Images from "Function and Interaction of the Coupled Genes Responsible for Pik-h Encoded Rice Blast Resistance"

Article Title: Function and Interaction of the Coupled Genes Responsible for Pik-h Encoded Rice Blast Resistance

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098067

Transcription profiles of the coupled genes Pikh-1 and Pikh-2 , as assayed by qRT-PCR. Data represent mean ± standard deviation (n = 3). Similar results were obtained from two independent experiments. Lower case letter (a, b) used to indicate whether the treatment and control means differed at P
Figure Legend Snippet: Transcription profiles of the coupled genes Pikh-1 and Pikh-2 , as assayed by qRT-PCR. Data represent mean ± standard deviation (n = 3). Similar results were obtained from two independent experiments. Lower case letter (a, b) used to indicate whether the treatment and control means differed at P

Techniques Used: Quantitative RT-PCR, Standard Deviation

7) Product Images from "miR-99a-5p Regulates the Proliferation and Differentiation of Skeletal Muscle Satellite Cells by Targeting MTMR3 in Chicken"

Article Title: miR-99a-5p Regulates the Proliferation and Differentiation of Skeletal Muscle Satellite Cells by Targeting MTMR3 in Chicken

Journal: Genes

doi: 10.3390/genes11040369

Knockdown MTMR3 facilitates chicken SMSCs proliferation. ( A ) The knockdown efficiency of MTMR3 gene in SMSCs by three small interfering RNAs (siRNAs) were detected by qRT-PCR. ( B , C ) The protein expression level of MTMR3 after interference by MTMR3-siRNA1 was detected by Western blotting. ( D ) The mRNA levels of cell proliferation-related genes were detected by qRT-PCR in SMSCs after MTMR3 knockdown. ( E ) CCK-8 assays for SMSCs after MTMR3 knockdown. ( F ) The statistical results of cell cycle analysis for SMSCs after MTMR3 knockdown. ( G ) EdU staining after the transfection of MTMR3-siRNA1 in SMSCs. ( H ) Proliferation rates of chicken SMSCs following MTMR3 knockdown. Results are shown as mean ± SEM and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p
Figure Legend Snippet: Knockdown MTMR3 facilitates chicken SMSCs proliferation. ( A ) The knockdown efficiency of MTMR3 gene in SMSCs by three small interfering RNAs (siRNAs) were detected by qRT-PCR. ( B , C ) The protein expression level of MTMR3 after interference by MTMR3-siRNA1 was detected by Western blotting. ( D ) The mRNA levels of cell proliferation-related genes were detected by qRT-PCR in SMSCs after MTMR3 knockdown. ( E ) CCK-8 assays for SMSCs after MTMR3 knockdown. ( F ) The statistical results of cell cycle analysis for SMSCs after MTMR3 knockdown. ( G ) EdU staining after the transfection of MTMR3-siRNA1 in SMSCs. ( H ) Proliferation rates of chicken SMSCs following MTMR3 knockdown. Results are shown as mean ± SEM and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p

Techniques Used: Quantitative RT-PCR, Expressing, Western Blot, CCK-8 Assay, Cell Cycle Assay, Staining, Transfection

Knockdown MTMR3 represses chicken SMSCs differentiation. ( A ) The mRNA levels of muscle cell differentiation marker genes were detected by qRT-PCR in SMSCs after MTMR3 knockdown. ( B ) Western blotting results of MyoG in SMSCs after transfection with MTMR3 siRNA1. ( C ) The relative protein level of MyoG in SMSCs after inhibition of MTMR3. ( D ) MyHC immunofluorescence staining after the transfection of MTMR3 siRNA1 in SMSCs. ( E ) Relative myotube area of chicken SMSCs following MTMR3 knockdown. Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p
Figure Legend Snippet: Knockdown MTMR3 represses chicken SMSCs differentiation. ( A ) The mRNA levels of muscle cell differentiation marker genes were detected by qRT-PCR in SMSCs after MTMR3 knockdown. ( B ) Western blotting results of MyoG in SMSCs after transfection with MTMR3 siRNA1. ( C ) The relative protein level of MyoG in SMSCs after inhibition of MTMR3. ( D ) MyHC immunofluorescence staining after the transfection of MTMR3 siRNA1 in SMSCs. ( E ) Relative myotube area of chicken SMSCs following MTMR3 knockdown. Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p

Techniques Used: Cell Differentiation, Marker, Quantitative RT-PCR, Western Blot, Transfection, Inhibition, Immunofluorescence, Staining, Expressing

Target gene scanning revealed that miR-99a-5p directly target the myotubularin-related protein 3 (MTMR3) gene. ( A ) Venn analysis of miR-99a-5p target gene prediction results from TargetScan and miRDB websites. ( B ) Seventeen target genes of miR-99a-5p (the intersection of Venn analysis results) are listed. ( C , D ) Thirteen target genes of miR-99a-5p were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p in the proliferation stage. ( E , F ) Thirteen target genes of miR-99a-5p were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p in the differentiation stage. ( G ) The protein level of MTMR3 were detected by Western blotting in undifferentiated SMSCs after overexpression and inhibition of miR-99a-5p. ( H ) The protein level of MTMR3 was detected by Western blotting in differentiated SMSCs after overexpression and inhibition of miR-99a-5p. ( I ) The conserved miR-99a-5p binding site in the MTMR3 mRNA 3′ untranslated region (UTR). The seed sequence and mutant sequence in miR-34b-5p are highlighted in red and blue, respectively. ( J ) The dual-luciferase reporter assay was performed in DF-1 cells that co-transfected with wild-type or mutant MTMR3 3′ UTR with miR-99a-5p mimic or mimic NC. Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p
Figure Legend Snippet: Target gene scanning revealed that miR-99a-5p directly target the myotubularin-related protein 3 (MTMR3) gene. ( A ) Venn analysis of miR-99a-5p target gene prediction results from TargetScan and miRDB websites. ( B ) Seventeen target genes of miR-99a-5p (the intersection of Venn analysis results) are listed. ( C , D ) Thirteen target genes of miR-99a-5p were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p in the proliferation stage. ( E , F ) Thirteen target genes of miR-99a-5p were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p in the differentiation stage. ( G ) The protein level of MTMR3 were detected by Western blotting in undifferentiated SMSCs after overexpression and inhibition of miR-99a-5p. ( H ) The protein level of MTMR3 was detected by Western blotting in differentiated SMSCs after overexpression and inhibition of miR-99a-5p. ( I ) The conserved miR-99a-5p binding site in the MTMR3 mRNA 3′ untranslated region (UTR). The seed sequence and mutant sequence in miR-34b-5p are highlighted in red and blue, respectively. ( J ) The dual-luciferase reporter assay was performed in DF-1 cells that co-transfected with wild-type or mutant MTMR3 3′ UTR with miR-99a-5p mimic or mimic NC. Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test were used to compare expression levels among different groups. * p

Techniques Used: Quantitative RT-PCR, Over Expression, Inhibition, Western Blot, Binding Assay, Sequencing, Mutagenesis, Luciferase, Reporter Assay, Transfection, Expressing

miR-99a-5p promotes the proliferation of chicken skeletal muscle satellite cells (SMSCs). ( A , D ) The mRNA levels of cell proliferation-related genes were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p. ( B , E ) Cell counting kit 8 (CCK-8) assays for SMSCs after overexpression and inhibition of miR-99a-5p. ( C , F ) The statistical results of cell cycle analysis for SMSCs after overexpression and inhibition of miR-99a-5p. ( G , H ) EdU staining after the transfection of miR-99a-5p mimic and inhibitor in SMSCs (upper panels). Proliferation rates of chicken SMSCs following miR-99a-5p overexpression and inhibition (lower panels). Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test was used to compare expression levels among different groups. * p
Figure Legend Snippet: miR-99a-5p promotes the proliferation of chicken skeletal muscle satellite cells (SMSCs). ( A , D ) The mRNA levels of cell proliferation-related genes were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p. ( B , E ) Cell counting kit 8 (CCK-8) assays for SMSCs after overexpression and inhibition of miR-99a-5p. ( C , F ) The statistical results of cell cycle analysis for SMSCs after overexpression and inhibition of miR-99a-5p. ( G , H ) EdU staining after the transfection of miR-99a-5p mimic and inhibitor in SMSCs (upper panels). Proliferation rates of chicken SMSCs following miR-99a-5p overexpression and inhibition (lower panels). Results are shown as mean ± SEM, and the data are representative of at least three independent assays. Student’s t -test was used to compare expression levels among different groups. * p

Techniques Used: Quantitative RT-PCR, Over Expression, Inhibition, Cell Counting, CCK-8 Assay, Cell Cycle Assay, Staining, Transfection, Expressing

miR-99a-5p inhibits the differentiation of chicken SMSCs. ( A , C ) The mRNA levels of muscle cell differentiation marker genes were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p. ( B , D ) Western blotting results of myogenin (MyoG) in SMSCs after transfection with miR-99a-5p mimic and inhibitor (upper panels). The relative protein level of MyoG in SMSCs after overexpression and inhibition of miR-99a-5p. ( E , F ) Anti-Myosin heavy chain (MyHC) immunofluorescence staining after the transfection of miR-99a-5p mimic and inhibitor in SMSCs (upper panels). Relative myotube area of chicken SMSCs following miR-99a-5p overexpression and inhibition (lower panels). Results are shown as mean ± SEM and the data are representative of at least three independent assays. Student’s t -test was used to compare expression levels among different groups. * p
Figure Legend Snippet: miR-99a-5p inhibits the differentiation of chicken SMSCs. ( A , C ) The mRNA levels of muscle cell differentiation marker genes were detected by qRT-PCR in SMSCs after overexpression and inhibition of miR-99a-5p. ( B , D ) Western blotting results of myogenin (MyoG) in SMSCs after transfection with miR-99a-5p mimic and inhibitor (upper panels). The relative protein level of MyoG in SMSCs after overexpression and inhibition of miR-99a-5p. ( E , F ) Anti-Myosin heavy chain (MyHC) immunofluorescence staining after the transfection of miR-99a-5p mimic and inhibitor in SMSCs (upper panels). Relative myotube area of chicken SMSCs following miR-99a-5p overexpression and inhibition (lower panels). Results are shown as mean ± SEM and the data are representative of at least three independent assays. Student’s t -test was used to compare expression levels among different groups. * p

Techniques Used: Cell Differentiation, Marker, Quantitative RT-PCR, Over Expression, Inhibition, Western Blot, Transfection, Immunofluorescence, Staining, Expressing

8) Product Images from "Transcription Factor GmWRKY142 Confers Cadmium Resistance by Up-Regulating the Cadmium Tolerance 1-Like Genes"

Article Title: Transcription Factor GmWRKY142 Confers Cadmium Resistance by Up-Regulating the Cadmium Tolerance 1-Like Genes

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2020.00724

Overexpression of GmWRKY142 caused global transcriptional reprogramming in transgenic Arabidopsis thaliana. (A) Scatterplots of gene expression patterns in the transgenic line compared with the WT. Red represents up-regulated genes, while blue represents down-regulated ones. (B) Validation of the expression of eight selected Cd tolerance related genes by qRT-PCR. (C) KEGG pathways enriched among differentially expressed genes (DEGs). (D) GO analysis of DEGs. Three independent biological replicates were tested in qRT-PCR assay. Significant differences according to the one-way analysis of variance are denoted as follows: * p
Figure Legend Snippet: Overexpression of GmWRKY142 caused global transcriptional reprogramming in transgenic Arabidopsis thaliana. (A) Scatterplots of gene expression patterns in the transgenic line compared with the WT. Red represents up-regulated genes, while blue represents down-regulated ones. (B) Validation of the expression of eight selected Cd tolerance related genes by qRT-PCR. (C) KEGG pathways enriched among differentially expressed genes (DEGs). (D) GO analysis of DEGs. Three independent biological replicates were tested in qRT-PCR assay. Significant differences according to the one-way analysis of variance are denoted as follows: * p

Techniques Used: Over Expression, Transgenic Assay, Expressing, Quantitative RT-PCR

GmWRKY142 was bound to and activated the promoters of the GmCDT1-like genes. (A) Multiple alignments of the conserved CDT domains. Identical amino acids are shown with a black background. (B) Phylogenetic relationships between GmCDT1s and related proteins. Accession numbers are: AtCDT1 , NM_202281 ; BsCDT1 , ABL85053 ; EcCDT1 , AB426477; HvCDT1 , AK251605; HvCDT2 , AK249080; MsCDT1 , AB426478; OsCDT1 , AK121052; OsCDT2 , AK061597; OsCDT3 , AK062450; OsCDT4 , AK059641; OsCDT5 , AK099514; PsCDT1 , EF081525; PtCDT1 , CU225257; ZmCDT1 , AY103859 . (C) GmCDT1-1 and GmCDT1-2 were induced by Cd. The Huaxia 7 roots cultured in 0 or 25 μM of CdCl2 for 6 h were sampled and qRT-PCR assay was performed. (D) Schematic diagrams of ATCDT1, GmCDT1-1, and GmCDT1-2 promoters and partial sequences containing W-box used in yeast one-hybrid assays. (E) Culture of yeast cells co-transformed with the prey and bait, as well as the positive control (pGADT7-Rec-p53+p53-AbAi) on selective medium with or without 150 ng mL –1 Aureobasidin A (AbA). (F) Schematic diagrams of the effector and reporter constructs used for transient luciferase (LUC) assays. Full-length CDS of GmWRKY142 was inserted into pGreen II 62-SK to produce an effector, while the original or mutated W-box elements were inserted into pGreen II 0800-LUC to generate reporters. MCS, multiple cloning site. P35S and T35S, the promoter and terminator of CaMV 35S, respectively. REN (Renilla luciferase) was used as an internal control for activity normalization. (G) Transient expression assay of the promoter activity, shown as LUC/REN ratio, using tobacco leaves co-transformed with the effector and the reporters. LUC/REN ratio of the control co-transformed with the reporters and the empty effector vector (pGreen II 62-SK) was set as 1. Values are expressed as the means ± SD ( n = 3). The experiment was performed with at least three independent biological replicates. Significant differences according to the one-way analysis of variance are denoted as follows: * p
Figure Legend Snippet: GmWRKY142 was bound to and activated the promoters of the GmCDT1-like genes. (A) Multiple alignments of the conserved CDT domains. Identical amino acids are shown with a black background. (B) Phylogenetic relationships between GmCDT1s and related proteins. Accession numbers are: AtCDT1 , NM_202281 ; BsCDT1 , ABL85053 ; EcCDT1 , AB426477; HvCDT1 , AK251605; HvCDT2 , AK249080; MsCDT1 , AB426478; OsCDT1 , AK121052; OsCDT2 , AK061597; OsCDT3 , AK062450; OsCDT4 , AK059641; OsCDT5 , AK099514; PsCDT1 , EF081525; PtCDT1 , CU225257; ZmCDT1 , AY103859 . (C) GmCDT1-1 and GmCDT1-2 were induced by Cd. The Huaxia 7 roots cultured in 0 or 25 μM of CdCl2 for 6 h were sampled and qRT-PCR assay was performed. (D) Schematic diagrams of ATCDT1, GmCDT1-1, and GmCDT1-2 promoters and partial sequences containing W-box used in yeast one-hybrid assays. (E) Culture of yeast cells co-transformed with the prey and bait, as well as the positive control (pGADT7-Rec-p53+p53-AbAi) on selective medium with or without 150 ng mL –1 Aureobasidin A (AbA). (F) Schematic diagrams of the effector and reporter constructs used for transient luciferase (LUC) assays. Full-length CDS of GmWRKY142 was inserted into pGreen II 62-SK to produce an effector, while the original or mutated W-box elements were inserted into pGreen II 0800-LUC to generate reporters. MCS, multiple cloning site. P35S and T35S, the promoter and terminator of CaMV 35S, respectively. REN (Renilla luciferase) was used as an internal control for activity normalization. (G) Transient expression assay of the promoter activity, shown as LUC/REN ratio, using tobacco leaves co-transformed with the effector and the reporters. LUC/REN ratio of the control co-transformed with the reporters and the empty effector vector (pGreen II 62-SK) was set as 1. Values are expressed as the means ± SD ( n = 3). The experiment was performed with at least three independent biological replicates. Significant differences according to the one-way analysis of variance are denoted as follows: * p

Techniques Used: Cell Culture, Quantitative RT-PCR, Transformation Assay, Positive Control, Construct, Luciferase, Clone Assay, Activity Assay, Expressing, Plasmid Preparation

Analysis of expression patterns of GmWRKY142. (A) qRT-PCR analysis of the GmWRKY142 transcript in different tissues of the soybean variety Huaxia 7. mRNAs were isolated from roots, stems, leaves, apex, flowers, pods, and seeds. (B) Dose-dependent GmWRKY142 expression in roots. Roots were exposed to different Cd concentrations (0, 5, 10, 15, 25, and 50 μM) for 6 h. (C) For the time-course experiment, seedlings were exposed to 25 μM CdCl 2 for 0, 1, 2, 4, 6, 8, 12, or 24 h. Samples were separately harvested for qRT-PCR analysis. Values are expressed as the means ± SD ( n = 3). The experiment was performed with at least three independent biological replicates. Significant differences according to the one-way analysis of variance are denoted as follows: * p
Figure Legend Snippet: Analysis of expression patterns of GmWRKY142. (A) qRT-PCR analysis of the GmWRKY142 transcript in different tissues of the soybean variety Huaxia 7. mRNAs were isolated from roots, stems, leaves, apex, flowers, pods, and seeds. (B) Dose-dependent GmWRKY142 expression in roots. Roots were exposed to different Cd concentrations (0, 5, 10, 15, 25, and 50 μM) for 6 h. (C) For the time-course experiment, seedlings were exposed to 25 μM CdCl 2 for 0, 1, 2, 4, 6, 8, 12, or 24 h. Samples were separately harvested for qRT-PCR analysis. Values are expressed as the means ± SD ( n = 3). The experiment was performed with at least three independent biological replicates. Significant differences according to the one-way analysis of variance are denoted as follows: * p

Techniques Used: Expressing, Quantitative RT-PCR, Isolation

9) Product Images from "From Maternal Grazing to Barn Feeding During Pre-weaning Period: Altered Gastrointestinal Microbiota Contributes to Change the Development and Function of the Rumen and Intestine of Yak Calves"

Article Title: From Maternal Grazing to Barn Feeding During Pre-weaning Period: Altered Gastrointestinal Microbiota Contributes to Change the Development and Function of the Rumen and Intestine of Yak Calves

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2020.00485

Differentially expressed mRNAs in the rumen epithelium of yak calves from two different feeding strategies (maternal grazing and barn feeding) groups. (A) The volcano plot shows the significantly differentially expressed genes (barn feeding group vs maternal grazing group). (B) The heatmap of significantly differentially expressed genes. (C) Pathway classification based on the differentially expressed genes between the barn feeding group and maternal grazing group. (D) Significantly enriched pathways based on differentially expressed genes between the barn feeding group and maternal grazing group. (E) Sequencing of five selected DEGs verified by qRT-PCR.
Figure Legend Snippet: Differentially expressed mRNAs in the rumen epithelium of yak calves from two different feeding strategies (maternal grazing and barn feeding) groups. (A) The volcano plot shows the significantly differentially expressed genes (barn feeding group vs maternal grazing group). (B) The heatmap of significantly differentially expressed genes. (C) Pathway classification based on the differentially expressed genes between the barn feeding group and maternal grazing group. (D) Significantly enriched pathways based on differentially expressed genes between the barn feeding group and maternal grazing group. (E) Sequencing of five selected DEGs verified by qRT-PCR.

Techniques Used: Sequencing, Quantitative RT-PCR

10) Product Images from "Citron Rho-interacting serine/threonine kinase knockdown suppresses prostate cancer cell proliferation and metastasis by blocking Hippo-YAP pathway"

Article Title: Citron Rho-interacting serine/threonine kinase knockdown suppresses prostate cancer cell proliferation and metastasis by blocking Hippo-YAP pathway

Journal: Journal of Southern Medical University

doi: 10.12122/j.issn.1673-4254.2019.03.01

CIT expression was significantly lowered in PC- 3 cells at 48 after siRNA transfection. A : The mRNA level of CIT detected by qRT-PCR. Data are presented as Mean ± SD from 3 independent experiments. *** P
Figure Legend Snippet: CIT expression was significantly lowered in PC- 3 cells at 48 after siRNA transfection. A : The mRNA level of CIT detected by qRT-PCR. Data are presented as Mean ± SD from 3 independent experiments. *** P

Techniques Used: Expressing, Transfection, Quantitative RT-PCR

11) Product Images from "The ABA-induced soybean ERF transcription factor gene GmERF75 plays a role in enhancing osmotic stress tolerance in Arabidopsis and soybean"

Article Title: The ABA-induced soybean ERF transcription factor gene GmERF75 plays a role in enhancing osmotic stress tolerance in Arabidopsis and soybean

Journal: BMC Plant Biology

doi: 10.1186/s12870-019-2066-6

Changes in GmERF75 expression in response to abiotic stress treatments and exogenous hormones. The kinetics of GmERF75 mRNA accumulation were evaluated for hypocotyl and root of 14-day-old seedlings subjected to the abiotic stress treatments drought ( a ), NaCl ( b ), high temperature ( c ), and low temperature ( d ), or treated with the exogenous hormones ethylene (ET, e ), jasmonate (JA, f ), and salicylic acid (SA, g ). The total RNA was extracted 0, 0.5, 1, 2, 5, 12, and 24 h after each treatment and used for qRT-PCR. The data was shown as the means±SD of three biological replicates
Figure Legend Snippet: Changes in GmERF75 expression in response to abiotic stress treatments and exogenous hormones. The kinetics of GmERF75 mRNA accumulation were evaluated for hypocotyl and root of 14-day-old seedlings subjected to the abiotic stress treatments drought ( a ), NaCl ( b ), high temperature ( c ), and low temperature ( d ), or treated with the exogenous hormones ethylene (ET, e ), jasmonate (JA, f ), and salicylic acid (SA, g ). The total RNA was extracted 0, 0.5, 1, 2, 5, 12, and 24 h after each treatment and used for qRT-PCR. The data was shown as the means±SD of three biological replicates

Techniques Used: Expressing, Quantitative RT-PCR

ABA-induced Group VII ERF genes expression. 14-day-old soybean seedlings were treated with ABA and collected the hypocotyl and roots 0, 0.5, 1, 2, 4, 8, 12 h after treatment for RNA extraction and qRT-PCR. Expression levels of the 12 Group VII ERFs in response to ABA treatment were revealed by qRT-PCR. The data was shown as the means±SD of three biological replicates
Figure Legend Snippet: ABA-induced Group VII ERF genes expression. 14-day-old soybean seedlings were treated with ABA and collected the hypocotyl and roots 0, 0.5, 1, 2, 4, 8, 12 h after treatment for RNA extraction and qRT-PCR. Expression levels of the 12 Group VII ERFs in response to ABA treatment were revealed by qRT-PCR. The data was shown as the means±SD of three biological replicates

Techniques Used: Expressing, RNA Extraction, Quantitative RT-PCR

12) Product Images from "FASN-Mediated Lipid Metabolism Regulates Goose Granulosa Cells Apoptosis and Steroidogenesis"

Article Title: FASN-Mediated Lipid Metabolism Regulates Goose Granulosa Cells Apoptosis and Steroidogenesis

Journal: Frontiers in Physiology

doi: 10.3389/fphys.2020.00600

Efficiency of FASN overexpression or interference. (A) The expression levels of FASN of phGCs and hGCs were detected by qRT-PCR 48 h after treatment with FASN overexpression, respectively. (B) The expression levels of FASN of phGCs and hGCs were detected by qRT-PCR 48 h after treatment with FASN interference, respectively. OE, overexpression; SI, RNA interference; phGCs, pre-hierarchical GCs; hGCs, hierarchical GCs. The expression of FASN was normalized by β -actin , and the control was set as one. Results were presented as the mean ± SEM of three independent experiments (** P
Figure Legend Snippet: Efficiency of FASN overexpression or interference. (A) The expression levels of FASN of phGCs and hGCs were detected by qRT-PCR 48 h after treatment with FASN overexpression, respectively. (B) The expression levels of FASN of phGCs and hGCs were detected by qRT-PCR 48 h after treatment with FASN interference, respectively. OE, overexpression; SI, RNA interference; phGCs, pre-hierarchical GCs; hGCs, hierarchical GCs. The expression of FASN was normalized by β -actin , and the control was set as one. Results were presented as the mean ± SEM of three independent experiments (** P

Techniques Used: Over Expression, Expressing, Quantitative RT-PCR

13) Product Images from "Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis"

Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis

Journal: Journal of Cellular and Molecular Medicine

doi: 10.1111/jcmm.15080

SETD8 repressed STRA8 expression by directly binding to the proximal STRA8 promoter. STRA8 increased the transcriptional activity of SETD8 promoter in a dose‐dependent manner. A, Transcriptional activity analysis of STRA8 promoter by DLR assay. pGL3 was a negative control group. pGL4 was a positive control group. B, Effects of SETD8 protein (pCMV‐HA‐SETD8, μg) with different doses on transcriptional activity of STRA8 promoter. C, Validation of SETD8 protein expression by Western blot. D, Transcriptional activity analysis of SETD8 promoter. E, Effects of STRA8 protein (pCMV‐MYC‐STRA8) with different doses on transcriptional activity of SETD8 promoter. F, Validation of STRA8 protein expression by Western blot. G, Schematic representation of primers structure of STRA8 promoter for ChIP assay. H, ChIP assay using anti‐HA antibody and control IgG. qRT‐PCR with specific primers was used to calculate the IP efficiency. The data were presented as mean ± standard deviation, * represented a significant statistical difference versus the control group, P
Figure Legend Snippet: SETD8 repressed STRA8 expression by directly binding to the proximal STRA8 promoter. STRA8 increased the transcriptional activity of SETD8 promoter in a dose‐dependent manner. A, Transcriptional activity analysis of STRA8 promoter by DLR assay. pGL3 was a negative control group. pGL4 was a positive control group. B, Effects of SETD8 protein (pCMV‐HA‐SETD8, μg) with different doses on transcriptional activity of STRA8 promoter. C, Validation of SETD8 protein expression by Western blot. D, Transcriptional activity analysis of SETD8 promoter. E, Effects of STRA8 protein (pCMV‐MYC‐STRA8) with different doses on transcriptional activity of SETD8 promoter. F, Validation of STRA8 protein expression by Western blot. G, Schematic representation of primers structure of STRA8 promoter for ChIP assay. H, ChIP assay using anti‐HA antibody and control IgG. qRT‐PCR with specific primers was used to calculate the IP efficiency. The data were presented as mean ± standard deviation, * represented a significant statistical difference versus the control group, P

Techniques Used: Expressing, Binding Assay, Activity Assay, Negative Control, Positive Control, Western Blot, Chromatin Immunoprecipitation, Quantitative RT-PCR, Standard Deviation

14) Product Images from "Gill Transcriptome Sequencing and De Novo Annotation of Acanthogobius ommaturus in Response to Salinity Stress"

Article Title: Gill Transcriptome Sequencing and De Novo Annotation of Acanthogobius ommaturus in Response to Salinity Stress

Journal: Genes

doi: 10.3390/genes11060631

Relative change of the transcriptomes data and qRT-PCR data of 8 DEGs. Log 2 fold changes are expressed as the ratio of gene expression after normalization to β-actin. The data are means ± SD from three independent replicates, and “*” indicates statistical significance between experimental group and control group ( p
Figure Legend Snippet: Relative change of the transcriptomes data and qRT-PCR data of 8 DEGs. Log 2 fold changes are expressed as the ratio of gene expression after normalization to β-actin. The data are means ± SD from three independent replicates, and “*” indicates statistical significance between experimental group and control group ( p

Techniques Used: Quantitative RT-PCR, Expressing

15) Product Images from "Transcriptome and metabolite analysis reveal the drought tolerance of foxtail millet significantly correlated with phenylpropanoids-related pathways during germination process under PEG stress"

Article Title: Transcriptome and metabolite analysis reveal the drought tolerance of foxtail millet significantly correlated with phenylpropanoids-related pathways during germination process under PEG stress

Journal: BMC Plant Biology

doi: 10.1186/s12870-020-02483-4

Expression analysis of drought responsive genes at different germination period under PEG stress by qRT-PCR. 2 h-H2O-0 h, 2 h-H2O-1 h, 2 h-H2O-3 h, 2 h-H2O-12 h and 2 h-H2O-48 h indicated respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 2 h under normal conditions. 8 h-H2O-0 h, 8 h-H2O-1 h, 8 h-H2O-3 h, 8 h-H2O-12 h and 8 h-H2O-48 h represented respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 8 h under normal conditions. 14 h-H2O-0 h, 14 h-H2O-1 h, 14 h-H2O-3 h, 14 h-H2O-12 h and 14 h-H2O-48 h indicated respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 14 h under normal conditions
Figure Legend Snippet: Expression analysis of drought responsive genes at different germination period under PEG stress by qRT-PCR. 2 h-H2O-0 h, 2 h-H2O-1 h, 2 h-H2O-3 h, 2 h-H2O-12 h and 2 h-H2O-48 h indicated respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 2 h under normal conditions. 8 h-H2O-0 h, 8 h-H2O-1 h, 8 h-H2O-3 h, 8 h-H2O-12 h and 8 h-H2O-48 h represented respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 8 h under normal conditions. 14 h-H2O-0 h, 14 h-H2O-1 h, 14 h-H2O-3 h, 14 h-H2O-12 h and 14 h-H2O-48 h indicated respectively the foxtail millet seeds treated by PEG stress for 0 h, 1 h, 3 h, 12 h, 48 h, after germinated for 14 h under normal conditions

Techniques Used: Expressing, Quantitative RT-PCR

Validation of differential expression of drought responsive genes by qRT-PCR. The relative mRNA levels were normalized with the inner control gene (β-actin) and expressed relative to the corresponding value of 14CK1(control), which were given an arbitrary value of 1. 14CK1 indicated the foxtail millet transferred into another water pertri-dishes for 1 h after germinated for 14 h under normal conditions. 14CK3 represented the foxtail millet transferred into another water pertri-dishes for 3 h after germinated for 14 h under normal conditions. 14P1 indicated the foxtail millet treated by PEG stress for 1 h after germinated for 14 h under normal conditions. 14P3 represented the foxtail millet treated by PEG stress for 3 h after germinated for 14 h under normal conditions. The SD of different samples were calculated using one-way ANOVA followed by Tukey HSD multiple comparison
Figure Legend Snippet: Validation of differential expression of drought responsive genes by qRT-PCR. The relative mRNA levels were normalized with the inner control gene (β-actin) and expressed relative to the corresponding value of 14CK1(control), which were given an arbitrary value of 1. 14CK1 indicated the foxtail millet transferred into another water pertri-dishes for 1 h after germinated for 14 h under normal conditions. 14CK3 represented the foxtail millet transferred into another water pertri-dishes for 3 h after germinated for 14 h under normal conditions. 14P1 indicated the foxtail millet treated by PEG stress for 1 h after germinated for 14 h under normal conditions. 14P3 represented the foxtail millet treated by PEG stress for 3 h after germinated for 14 h under normal conditions. The SD of different samples were calculated using one-way ANOVA followed by Tukey HSD multiple comparison

Techniques Used: Expressing, Quantitative RT-PCR

16) Product Images from "A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis *A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis * ♦"

Article Title: A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis *A Pre-microRNA-149 (miR-149) Genetic Variation Affects miR-149 Maturation and Its Ability to Regulate the Puma Protein in Apoptosis * ♦

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M112.440453

rs71428439 polymorphism affects the maturation of miR-149. A, hairpin loop structure of the A- and G-allelic miR-149 precursor is different. The polymorphism site is indicated by the dots . The A→G polymorphism located in the stem region outside of the mature miR-149 sequence causes a change to the stem structure of the precursor. B and C, G allele shows a low level of mature miR-149 compared with the A allele in HEK293 cells. HEK293 cells were transfected with the plasmids of empty pcDNA3.0, pc3.0-miR-149-A, pc3.0-miR-149-G, or pc3.0-miR-423 along with pc3.0-cel-miR-39, respectively. 24 h after transfection, miR-149 and cel-miR-39 levels were analyzed by qRT-PCR ( B ). For Northern blot, the miR-149 precursor and mature miR-149 were indicated ( C ). A representative result of three independent experiments is shown. UD , undetectable. D, G allele impairs miR-149 maturation in cardiomyocytes ( CMC ). Cardiomyocytes were infected with adenoviral miR-149-A or miR-149-G, respectively. 24 h after infection, miR-149 levels were analyzed by qRT-PCR. The qRT-PCR results were normalized to that of U6. E, levels of miR-149 in human peripheral blood mononuclear cells. The qRT-PCR results were normalized to that of U6 levels. Data are shown as means ± S.E. ( n = 29–35).
Figure Legend Snippet: rs71428439 polymorphism affects the maturation of miR-149. A, hairpin loop structure of the A- and G-allelic miR-149 precursor is different. The polymorphism site is indicated by the dots . The A→G polymorphism located in the stem region outside of the mature miR-149 sequence causes a change to the stem structure of the precursor. B and C, G allele shows a low level of mature miR-149 compared with the A allele in HEK293 cells. HEK293 cells were transfected with the plasmids of empty pcDNA3.0, pc3.0-miR-149-A, pc3.0-miR-149-G, or pc3.0-miR-423 along with pc3.0-cel-miR-39, respectively. 24 h after transfection, miR-149 and cel-miR-39 levels were analyzed by qRT-PCR ( B ). For Northern blot, the miR-149 precursor and mature miR-149 were indicated ( C ). A representative result of three independent experiments is shown. UD , undetectable. D, G allele impairs miR-149 maturation in cardiomyocytes ( CMC ). Cardiomyocytes were infected with adenoviral miR-149-A or miR-149-G, respectively. 24 h after infection, miR-149 levels were analyzed by qRT-PCR. The qRT-PCR results were normalized to that of U6. E, levels of miR-149 in human peripheral blood mononuclear cells. The qRT-PCR results were normalized to that of U6 levels. Data are shown as means ± S.E. ( n = 29–35).

Techniques Used: Sequencing, Transfection, Quantitative RT-PCR, Northern Blot, Infection

rs71428439 polymorphism effects on myocardial infarction. A, analysis of miR-149 and Puma levels under myocardial infarction. Adult male C57 mice (8–10 weeks old) were injected with adenoviral β-gal, miR-149-A, or miR-149 and subjected to permanent left anterior descending coronary artery ligation. miR-149 levels were analyzed by qRT-PCR. Puma was analyzed by immunoblot. B, A and G alleles of rs71428439 polymorphism exert differential effect on cardiac function. Mice were treated as in A . Cardiac functions were evaluated by echocardiography. n = 8 per group. C, A and G alleles of rs71428439 polymorphism exert differential effect on myocardial infarction sizes. Mice were treated as in A . MI areas were calculated as the ratio of MI area to left ventricular ( LV ) area. n = 6–8 mice per group. *, p
Figure Legend Snippet: rs71428439 polymorphism effects on myocardial infarction. A, analysis of miR-149 and Puma levels under myocardial infarction. Adult male C57 mice (8–10 weeks old) were injected with adenoviral β-gal, miR-149-A, or miR-149 and subjected to permanent left anterior descending coronary artery ligation. miR-149 levels were analyzed by qRT-PCR. Puma was analyzed by immunoblot. B, A and G alleles of rs71428439 polymorphism exert differential effect on cardiac function. Mice were treated as in A . Cardiac functions were evaluated by echocardiography. n = 8 per group. C, A and G alleles of rs71428439 polymorphism exert differential effect on myocardial infarction sizes. Mice were treated as in A . MI areas were calculated as the ratio of MI area to left ventricular ( LV ) area. n = 6–8 mice per group. *, p

Techniques Used: Mouse Assay, Injection, Ligation, Quantitative RT-PCR

17) Product Images from "Interference of ribosomal frameshifting by antisense peptide nucleic acids suppresses SARS coronavirus replication"

Article Title: Interference of ribosomal frameshifting by antisense peptide nucleic acids suppresses SARS coronavirus replication

Journal: Antiviral research

doi: 10.1016/j.antiviral.2011.04.009

A SARS-CoV replicon expressing a luciferase reporter. (A) The Feo gene fused or non-fused to TRS9 was inserted into pBAC-SARS-CoV-REP (REP) to construct pSARS-CoV-REP-Feo (Feo) or pSARS-CoV-REP-ΔTRSFeo (ΔTRS), respectively. The pSARS-CoV-REP-Feo-MluIrev (MluIrev), which is defective in synthesis of functional replicase proteins, was used as a negative control plasmid. TRSs are indicated by a black box and leader sequences by a box with deviant crease lines. Black arrows indicate primers used for detection of N gene-specific sg-mRNAs and gray arrows for detection of sg-mRNAs containing the Feo gene. (B and C) BHK-21 cells were co-transfected with replicon plasmids and pRL-TK used for normalization of transfection efficiency, by electroporation. At 30 h post-transfection, cells were harvested and analyzed for sg-mRNA level, luciferase activity, and intracellular SARS-CoV nucleocapsid N protein level. (B) The N gene-specific sg-mRNA level was quantified by real-time qRT-PCR using a TaqMan probe. Subgenomic RNA copy numbers per μg total RNA are shown. ND, not detected. (C) Firefiy luciferase activity from the replicon plasmid was normalized to Renilla luciferase activity from the pRL-TK plasmid. Normalized luciferase activity of cells transfected with pSARS-CoV-REP was defined as 100. Endogenous sg-mRNAs containing Feo gene was amplified by RT-PCR and resulting PCR products were resolved by agarose gel electrophoresis (low panel). (D) BHK-21 or HEK293 cells were left untransfected (Mock) or transfected with the plasmid indicated above the blots. N protein and α-tubulin were detected by Western blot analysis. (E) Kinetics of SARS-CoV replicon replication in transiently transfected cells. BHK-21 cells were transfected with pSARS-REP-Feo (●) or pSARS-REP-ΔTRSFeo (▲) by electroporation. Cells were harvested at each given time point and store at −80 °C until analysis. Luciferase activity was measured with the same amount of cell lysate. Data from one representative experiment from two independent experiments with similar results are shown.
Figure Legend Snippet: A SARS-CoV replicon expressing a luciferase reporter. (A) The Feo gene fused or non-fused to TRS9 was inserted into pBAC-SARS-CoV-REP (REP) to construct pSARS-CoV-REP-Feo (Feo) or pSARS-CoV-REP-ΔTRSFeo (ΔTRS), respectively. The pSARS-CoV-REP-Feo-MluIrev (MluIrev), which is defective in synthesis of functional replicase proteins, was used as a negative control plasmid. TRSs are indicated by a black box and leader sequences by a box with deviant crease lines. Black arrows indicate primers used for detection of N gene-specific sg-mRNAs and gray arrows for detection of sg-mRNAs containing the Feo gene. (B and C) BHK-21 cells were co-transfected with replicon plasmids and pRL-TK used for normalization of transfection efficiency, by electroporation. At 30 h post-transfection, cells were harvested and analyzed for sg-mRNA level, luciferase activity, and intracellular SARS-CoV nucleocapsid N protein level. (B) The N gene-specific sg-mRNA level was quantified by real-time qRT-PCR using a TaqMan probe. Subgenomic RNA copy numbers per μg total RNA are shown. ND, not detected. (C) Firefiy luciferase activity from the replicon plasmid was normalized to Renilla luciferase activity from the pRL-TK plasmid. Normalized luciferase activity of cells transfected with pSARS-CoV-REP was defined as 100. Endogenous sg-mRNAs containing Feo gene was amplified by RT-PCR and resulting PCR products were resolved by agarose gel electrophoresis (low panel). (D) BHK-21 or HEK293 cells were left untransfected (Mock) or transfected with the plasmid indicated above the blots. N protein and α-tubulin were detected by Western blot analysis. (E) Kinetics of SARS-CoV replicon replication in transiently transfected cells. BHK-21 cells were transfected with pSARS-REP-Feo (●) or pSARS-REP-ΔTRSFeo (▲) by electroporation. Cells were harvested at each given time point and store at −80 °C until analysis. Luciferase activity was measured with the same amount of cell lysate. Data from one representative experiment from two independent experiments with similar results are shown.

Techniques Used: Expressing, Luciferase, Construct, Functional Assay, Negative Control, Plasmid Preparation, Transfection, Electroporation, Activity Assay, Quantitative RT-PCR, Amplification, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Western Blot

Suppression of SARS-CoV replication by Tat-peptide-conjugated FS PNA in SARS-CoV replicon-replicating cells. (A) HEK293 cells, co-transfected with pSARS-REP-Feo and pRL-TK, were treated with each indicated PNA (10 μM) in serum-free DMEM for 3 h at 6 h post-transfection. Tat-conjugated J3U2 PNA (Tat-J3U2) targeting the 3′-UTR of JEV genome was used as a negative control. IFN-β (250 IU/ml) and IFN-β inducer poly(I:C) (0.8 μg/ml) were used as positive controls. Poly(I:C) was transfected into the cells using lipofectamin RNAiMAX agent. After 30 h incubation in complete medium, cells were harvested and luciferase activity was measured. (B) The IC 50 value for the inhibition of SARS-CoV replication by Tat-FS PNA was determined at various PNA concentrations. (C) HEK293 cells were co-transfected with IFNb-pGL3 luciferase reporter plasmid and pRL-TK used for normalization of transfection efficiency, prior to mock-treatment or treatment with 10 μM of Tat-FS or Tat-FSm2 PNA. Poly(I:C) or HCV 3′-UTR at a final concentration of 2 μg/ml or expression of an active form of IRF3, IRF3(5D) was used as a positive control for stimulation of IFN-β promoter activity. The normalized firefly luciferase activity of the mock-treated cells is considered one unit and the increase in luciferase activity is shown as fold induction. (D) HEK293 cells treated with PNAs orindicated RNAs as in (C) were analyzed for IFN-β and ISG56 mRNA abundance by real-time qRT-PCR. Fold increase in mRNA abundance is shown. (E) The real-time PCR products representing the abundance of the indicated mRNAs were visualized by agarose gel electrophoresis and ethidium bromide staining. Detection of GAPDH mRNA served as control. Results are from a representative experiment of n = 3 that gave similar results. (A–D) Data represent means ± SD of triplicate measurements from three independent experiments.
Figure Legend Snippet: Suppression of SARS-CoV replication by Tat-peptide-conjugated FS PNA in SARS-CoV replicon-replicating cells. (A) HEK293 cells, co-transfected with pSARS-REP-Feo and pRL-TK, were treated with each indicated PNA (10 μM) in serum-free DMEM for 3 h at 6 h post-transfection. Tat-conjugated J3U2 PNA (Tat-J3U2) targeting the 3′-UTR of JEV genome was used as a negative control. IFN-β (250 IU/ml) and IFN-β inducer poly(I:C) (0.8 μg/ml) were used as positive controls. Poly(I:C) was transfected into the cells using lipofectamin RNAiMAX agent. After 30 h incubation in complete medium, cells were harvested and luciferase activity was measured. (B) The IC 50 value for the inhibition of SARS-CoV replication by Tat-FS PNA was determined at various PNA concentrations. (C) HEK293 cells were co-transfected with IFNb-pGL3 luciferase reporter plasmid and pRL-TK used for normalization of transfection efficiency, prior to mock-treatment or treatment with 10 μM of Tat-FS or Tat-FSm2 PNA. Poly(I:C) or HCV 3′-UTR at a final concentration of 2 μg/ml or expression of an active form of IRF3, IRF3(5D) was used as a positive control for stimulation of IFN-β promoter activity. The normalized firefly luciferase activity of the mock-treated cells is considered one unit and the increase in luciferase activity is shown as fold induction. (D) HEK293 cells treated with PNAs orindicated RNAs as in (C) were analyzed for IFN-β and ISG56 mRNA abundance by real-time qRT-PCR. Fold increase in mRNA abundance is shown. (E) The real-time PCR products representing the abundance of the indicated mRNAs were visualized by agarose gel electrophoresis and ethidium bromide staining. Detection of GAPDH mRNA served as control. Results are from a representative experiment of n = 3 that gave similar results. (A–D) Data represent means ± SD of triplicate measurements from three independent experiments.

Techniques Used: Transfection, Negative Control, Incubation, Luciferase, Activity Assay, Inhibition, Plasmid Preparation, Concentration Assay, Expressing, Positive Control, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Staining

18) Product Images from "Circular RNA Profiling Reveals Exosomal circ_0006156 as a Novel Biomarker in Papillary Thyroid Cancer"

Article Title: Circular RNA Profiling Reveals Exosomal circ_0006156 as a Novel Biomarker in Papillary Thyroid Cancer

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2019.12.025

circFNDC3B Knockdown Inhibits the Growth of PTC Cells In Vivo (A) circFNDC3B knockdown inhibits tumor growth in vivo . The tumor volume curve of nude mice was analyzed. (B) The tumor weights of nude mice were measured. (C) qRT-PCR analysis was performed to detect circFNDC3B expressions. (D) IHC analysis was performed to examine the expression levels of proliferation marker Ki-67 in tumors of nude mice. ** p
Figure Legend Snippet: circFNDC3B Knockdown Inhibits the Growth of PTC Cells In Vivo (A) circFNDC3B knockdown inhibits tumor growth in vivo . The tumor volume curve of nude mice was analyzed. (B) The tumor weights of nude mice were measured. (C) qRT-PCR analysis was performed to detect circFNDC3B expressions. (D) IHC analysis was performed to examine the expression levels of proliferation marker Ki-67 in tumors of nude mice. ** p

Techniques Used: In Vivo, Mouse Assay, Quantitative RT-PCR, Immunohistochemistry, Expressing, Marker

Inhibition of circFNDC3B in the TPC-1 Cell Line and Overexpression of circFNDC3B in the K1 Cell Line (A) The qRT-PCR assay indicated the relative abundance of circFNDC3B in TPC-1 cells treated with si-circFNDC3B. (B) The qRT-PCR assay indicated the relative abundance of circFNDC3B in K1 cells infected with circFNDC3B overexpression plasmid. (C) The qRT-PCR assay indicated the relative abundance of FNDC3B in TPC-1 cells treated with si-circFNDC3B. (D) The qRT-PCR assay indicated the relative abundance of FNDC3B in K1 cells infected with circFNDC3B overexpression plasmid. Data indicate the mean ± SD, n = 3. **p
Figure Legend Snippet: Inhibition of circFNDC3B in the TPC-1 Cell Line and Overexpression of circFNDC3B in the K1 Cell Line (A) The qRT-PCR assay indicated the relative abundance of circFNDC3B in TPC-1 cells treated with si-circFNDC3B. (B) The qRT-PCR assay indicated the relative abundance of circFNDC3B in K1 cells infected with circFNDC3B overexpression plasmid. (C) The qRT-PCR assay indicated the relative abundance of FNDC3B in TPC-1 cells treated with si-circFNDC3B. (D) The qRT-PCR assay indicated the relative abundance of FNDC3B in K1 cells infected with circFNDC3B overexpression plasmid. Data indicate the mean ± SD, n = 3. **p

Techniques Used: Inhibition, Over Expression, Quantitative RT-PCR, Infection, Plasmid Preparation

circFNDC3B Is Secreted by Exosomes into Serum of PTC Patients (A) circFNDC3B was secreted into exosomes derived from serum of PTC patients. A representative image of exosome (indicated by red arrows) derived from serum of PTC patients detected from an electron microscope. (B) Western blot showing the expression of TSG101 and HSP70, which are the markers of exosome from purified serum exosome. (C) qRT-PCR for the abundance of circFNDC3B in serum exosomes. The levels of circFNDC3B in serum exosomes from PTC patients were significantly higher than that in normal individuals. (D) The expression levels of circFNDC3B were negatively correlated with that of miR-1178 in the exosomes extracted from serum of PTC patients. All tests were at least performed three times. Data were expressed as mean ± SD. **p
Figure Legend Snippet: circFNDC3B Is Secreted by Exosomes into Serum of PTC Patients (A) circFNDC3B was secreted into exosomes derived from serum of PTC patients. A representative image of exosome (indicated by red arrows) derived from serum of PTC patients detected from an electron microscope. (B) Western blot showing the expression of TSG101 and HSP70, which are the markers of exosome from purified serum exosome. (C) qRT-PCR for the abundance of circFNDC3B in serum exosomes. The levels of circFNDC3B in serum exosomes from PTC patients were significantly higher than that in normal individuals. (D) The expression levels of circFNDC3B were negatively correlated with that of miR-1178 in the exosomes extracted from serum of PTC patients. All tests were at least performed three times. Data were expressed as mean ± SD. **p

Techniques Used: Derivative Assay, Microscopy, Western Blot, Expressing, Purification, Quantitative RT-PCR

Confirmation of Subcellular Localization of circFNDC3B (A) qRT-PCR for the abundance of circFNDC3B and FNDC3B in TPC-1 cells treated with actinomycin D at the indicated time point. The error bars represent SD (n = 3). (B) qRT-PCR for the expression of circFNDC3B and FNDC3B mRNA in TPC-1 cells treated with or without RNase R. The results indicated that circFNDC3B was resistant to RNase R digestion. (C) Levels of circFNDC3B in the nuclear and cytoplasmic fractions of TPC-1 cells. The results showed that circFNDC3B was predominantly localized in the cytoplasm. (D) The CCK8 assay showed that circFNDC3B knockdown significantly repressed cell proliferation of TPC-1 cells. (E) The CCK8 assay showing overexpression of circFNDC3B promoted the proliferation of K1 cells. (F) Colony-formation assay showed that the knockdown of circFNDC3B significantly restrained the proliferation of TPC-1 cells. (G) Colony-formation assay showed that the ectopic expression of circFNDC3B significantly promoted the proliferation of K1 cells. (H) The flow cytometry analysis showed that circFNDC3B knockdown led to an arrest in the G1 phase of TPC-1 cells. (I) The flow cytometry analysis showed that overexpression of circFNDC3B decreased the G0/G1-phase percentage of K1 cells. Data are listed as mean ± SD of at least three independent experiments. **p
Figure Legend Snippet: Confirmation of Subcellular Localization of circFNDC3B (A) qRT-PCR for the abundance of circFNDC3B and FNDC3B in TPC-1 cells treated with actinomycin D at the indicated time point. The error bars represent SD (n = 3). (B) qRT-PCR for the expression of circFNDC3B and FNDC3B mRNA in TPC-1 cells treated with or without RNase R. The results indicated that circFNDC3B was resistant to RNase R digestion. (C) Levels of circFNDC3B in the nuclear and cytoplasmic fractions of TPC-1 cells. The results showed that circFNDC3B was predominantly localized in the cytoplasm. (D) The CCK8 assay showed that circFNDC3B knockdown significantly repressed cell proliferation of TPC-1 cells. (E) The CCK8 assay showing overexpression of circFNDC3B promoted the proliferation of K1 cells. (F) Colony-formation assay showed that the knockdown of circFNDC3B significantly restrained the proliferation of TPC-1 cells. (G) Colony-formation assay showed that the ectopic expression of circFNDC3B significantly promoted the proliferation of K1 cells. (H) The flow cytometry analysis showed that circFNDC3B knockdown led to an arrest in the G1 phase of TPC-1 cells. (I) The flow cytometry analysis showed that overexpression of circFNDC3B decreased the G0/G1-phase percentage of K1 cells. Data are listed as mean ± SD of at least three independent experiments. **p

Techniques Used: Quantitative RT-PCR, Expressing, CCK-8 Assay, Over Expression, Colony Assay, Flow Cytometry

circFNDC3B Acts as a Molecular Sponge for miR-1178-3p in PTC Cells (A) miR-1178 shares complementary binding sequences with circFNDC3B. (B) The dual-luciferase reporter showed a significant reduction of luciferase activity of the wild-type, and luciferase activity is restored by the mutant sequence. (C) The RIP experiment showed that miR-1178 and circFNDC3B simultaneously existed in the production precipitated by anti-AGO2. (D) Bioinformatics analysis revealed the predicted binding sites between TLR4 and miR-1178. (E) A subsequent luciferase reporter assay revealed decreased luciferase intensity after cotransfection of miR-1178 mimics and wild type luciferase reporter, while the mutated luciferase reporter exerted no such effect; (F) The results of qRT-PCR showed that TLR4 expression in PTC specimens was significantly upregulated compare with that in the adjacent normal tissues; (G) circFNDC3B knockdown could suppress TLR4 mRNA expression, while a miR-1178 inhibitor attenuated the effect of inhibition of circFNDC3B. (H) circFNDC3B knockdown could suppress TLR4 protein expression, while a miR-1179 inhibitor attenuated the effect of inhibition of circFNDC3B. Data are listed as mean ± SD of at least three independent experiments. ∗∗p
Figure Legend Snippet: circFNDC3B Acts as a Molecular Sponge for miR-1178-3p in PTC Cells (A) miR-1178 shares complementary binding sequences with circFNDC3B. (B) The dual-luciferase reporter showed a significant reduction of luciferase activity of the wild-type, and luciferase activity is restored by the mutant sequence. (C) The RIP experiment showed that miR-1178 and circFNDC3B simultaneously existed in the production precipitated by anti-AGO2. (D) Bioinformatics analysis revealed the predicted binding sites between TLR4 and miR-1178. (E) A subsequent luciferase reporter assay revealed decreased luciferase intensity after cotransfection of miR-1178 mimics and wild type luciferase reporter, while the mutated luciferase reporter exerted no such effect; (F) The results of qRT-PCR showed that TLR4 expression in PTC specimens was significantly upregulated compare with that in the adjacent normal tissues; (G) circFNDC3B knockdown could suppress TLR4 mRNA expression, while a miR-1178 inhibitor attenuated the effect of inhibition of circFNDC3B. (H) circFNDC3B knockdown could suppress TLR4 protein expression, while a miR-1179 inhibitor attenuated the effect of inhibition of circFNDC3B. Data are listed as mean ± SD of at least three independent experiments. ∗∗p

Techniques Used: Binding Assay, Luciferase, Activity Assay, Mutagenesis, Sequencing, Reporter Assay, Cotransfection, Quantitative RT-PCR, Expressing, Inhibition

19) Product Images from "Characterization of two novel ADP ribosylation factors from giant freshwater prawn Macrobrachium rosenbergii and their responses to WSSV challenge"

Article Title: Characterization of two novel ADP ribosylation factors from giant freshwater prawn Macrobrachium rosenbergii and their responses to WSSV challenge

Journal: Developmental and Comparative Immunology

doi: 10.1016/j.dci.2014.10.006

Analysis of MrArf1 and MrArf2 expression in gills (A, B) and hepatopancreas (C, D) from the giant freshwater prawns M. rosenbergii challenged with WSSV using qRT-PCR methods.
Figure Legend Snippet: Analysis of MrArf1 and MrArf2 expression in gills (A, B) and hepatopancreas (C, D) from the giant freshwater prawns M. rosenbergii challenged with WSSV using qRT-PCR methods.

Techniques Used: Expressing, Quantitative RT-PCR

MrArf1 and MrArf2 knockdown decreases WSSV in giant freshwater prawn. The giant freshwater prawn was subjected to RNA interference with dsGFP as the control. (A, B) Effect of MrArf1 and MrArf2 RNAi on the target gene levels in the gills analyzed via qRT-PCR. (C) The giant freshwater prawn was infected with WSSV after MrArf1 and MrArf2 knockdown, and the amount of WSSV was detected via qRT-PCR using vp28 as a marker. Bars represent the mean of three individual measurements ± SEM. Differences between groups were analyzed using one-way ANOVA followed by a Tukey's multiple comparison test. Different letters indicate significant difference ( P
Figure Legend Snippet: MrArf1 and MrArf2 knockdown decreases WSSV in giant freshwater prawn. The giant freshwater prawn was subjected to RNA interference with dsGFP as the control. (A, B) Effect of MrArf1 and MrArf2 RNAi on the target gene levels in the gills analyzed via qRT-PCR. (C) The giant freshwater prawn was infected with WSSV after MrArf1 and MrArf2 knockdown, and the amount of WSSV was detected via qRT-PCR using vp28 as a marker. Bars represent the mean of three individual measurements ± SEM. Differences between groups were analyzed using one-way ANOVA followed by a Tukey's multiple comparison test. Different letters indicate significant difference ( P

Techniques Used: Quantitative RT-PCR, Infection, Marker

20) Product Images from "Circular RNA circTNPO3 Regulates Paclitaxel Resistance of Ovarian Cancer Cells by miR-1299/NEK2 Signaling Pathway"

Article Title: Circular RNA circTNPO3 Regulates Paclitaxel Resistance of Ovarian Cancer Cells by miR-1299/NEK2 Signaling Pathway

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2020.06.002

Confirmation of Subcellular Localization of circTNPO3 (A) qRT-PCR for the abundance of circTNPO3 and TNPO3 in SKOV3/PTX cells treated with Actinomycin D at the indicated time point. (B) qRT-PCR for the abundance of circTNPO3 and TNPO3 in HeyA-8/PTX cells treated with Actinomycin D at the indicated time point. (C) qRT-PCR for the expression of circTNPO3 and TNPO3 mRNA in SKOV3/PTX cells treated with or without RNase R. (D) qRT-PCR for the expression of circTNPO3 and TNPO3 mRNA in HeyA-8/PTX cells treated with or without RNase R. (E) Levels of circTNPO3 in the nuclear and cytoplasmic fractions of SKOV3/PTX cells. (F) Levels of circTNPO3 in the nuclear and cytoplasmic fractions of HeyA-8/PTX. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗p
Figure Legend Snippet: Confirmation of Subcellular Localization of circTNPO3 (A) qRT-PCR for the abundance of circTNPO3 and TNPO3 in SKOV3/PTX cells treated with Actinomycin D at the indicated time point. (B) qRT-PCR for the abundance of circTNPO3 and TNPO3 in HeyA-8/PTX cells treated with Actinomycin D at the indicated time point. (C) qRT-PCR for the expression of circTNPO3 and TNPO3 mRNA in SKOV3/PTX cells treated with or without RNase R. (D) qRT-PCR for the expression of circTNPO3 and TNPO3 mRNA in HeyA-8/PTX cells treated with or without RNase R. (E) Levels of circTNPO3 in the nuclear and cytoplasmic fractions of SKOV3/PTX cells. (F) Levels of circTNPO3 in the nuclear and cytoplasmic fractions of HeyA-8/PTX. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗p

Techniques Used: Quantitative RT-PCR, Expressing

circRNA Profiling in Human PTX-Resistant OC Tissues and circTNPO3 Characterization (A) Among the 723 differentially expressed circRNAs, 118 circRNAs were verified as novel circRNAs; 605 circRNAs were identified beforehand and listed in the circRNA database. (B) The 723 identified circRNAs were divided into five different categories on the basis of the way they were produced. (C) The heatmap showed the top 10 dysregulated circRNAs between PTX-resistant OC tissues and PTX-sensitive OC tissues. (D) Expression levels of top 10 dysregulated circRNAs were measured by qRT-PCR. (E) Inhibition of hsa_circ_0001741 reversed PTX resistance in both SKOV3/PTX and HeyA-8/PTX cell lines. (F) The level of circTNPO3 was significantly increased in PTX-resistant OC tissues compared to PTX-sensitive OC tissues. (G) Evaluation the diagnostic performance of circTNPO3 for OC diagnosis. (H) Kaplan-Meier curve revealed that high expression of circTNPO3 was relative to a poor overall survival in OC patients. (I) circTNPO3 expression was distinctively higher in PTX-resistant OC cells SKOV3/PTX and HeyA-8/PTX cells. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗∗p
Figure Legend Snippet: circRNA Profiling in Human PTX-Resistant OC Tissues and circTNPO3 Characterization (A) Among the 723 differentially expressed circRNAs, 118 circRNAs were verified as novel circRNAs; 605 circRNAs were identified beforehand and listed in the circRNA database. (B) The 723 identified circRNAs were divided into five different categories on the basis of the way they were produced. (C) The heatmap showed the top 10 dysregulated circRNAs between PTX-resistant OC tissues and PTX-sensitive OC tissues. (D) Expression levels of top 10 dysregulated circRNAs were measured by qRT-PCR. (E) Inhibition of hsa_circ_0001741 reversed PTX resistance in both SKOV3/PTX and HeyA-8/PTX cell lines. (F) The level of circTNPO3 was significantly increased in PTX-resistant OC tissues compared to PTX-sensitive OC tissues. (G) Evaluation the diagnostic performance of circTNPO3 for OC diagnosis. (H) Kaplan-Meier curve revealed that high expression of circTNPO3 was relative to a poor overall survival in OC patients. (I) circTNPO3 expression was distinctively higher in PTX-resistant OC cells SKOV3/PTX and HeyA-8/PTX cells. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗∗p

Techniques Used: Produced, Expressing, Quantitative RT-PCR, Inhibition, Diagnostic Assay

circTNPO3 Knockdown Inhibited PTX Resistance by Upregulating miR-1299 in PTX-Resistant OC Cells (A) qRT-PCR analysis showed that miR-1299 expression was obviously upregulated in si-circTNPO3-transfected SKOV3/PTX and HeyA-8/PTX cells. (B) Relative expression of miR-1299 in a panel of ovarian cancer cell lines. (C) Relative expression of miR-1299 in PTX-resistant ovarian cancer and PTX-sensitive ovarian cancer. (D) circTNPO3 knockdown-induced decrease of cell growth was partially restored by miR-1299 inhibition. (E) Silence of miR-1299 effectively attenuated the promoting effect of circTNPO3 knockdown on PTX-induced apoptosis. (F) Silence of miR-1299 effectively attenuated the promoting effect of circTNPO3 knockdown on PTX-induced apoptosis. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗p
Figure Legend Snippet: circTNPO3 Knockdown Inhibited PTX Resistance by Upregulating miR-1299 in PTX-Resistant OC Cells (A) qRT-PCR analysis showed that miR-1299 expression was obviously upregulated in si-circTNPO3-transfected SKOV3/PTX and HeyA-8/PTX cells. (B) Relative expression of miR-1299 in a panel of ovarian cancer cell lines. (C) Relative expression of miR-1299 in PTX-resistant ovarian cancer and PTX-sensitive ovarian cancer. (D) circTNPO3 knockdown-induced decrease of cell growth was partially restored by miR-1299 inhibition. (E) Silence of miR-1299 effectively attenuated the promoting effect of circTNPO3 knockdown on PTX-induced apoptosis. (F) Silence of miR-1299 effectively attenuated the promoting effect of circTNPO3 knockdown on PTX-induced apoptosis. All tests were performed at least three times. Data were expressed as mean ± SD. ∗∗p

Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Inhibition

21) Product Images from "MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae"

Article Title: MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae

Journal: Autophagy

doi: 10.1080/15548627.2018.1458171

MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.
Figure Legend Snippet: MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.

Techniques Used: Expressing, Bimolecular Fluorescence Complementation Assay, Staining, Epifluorescence Microscopy, Isolation, Histone Deacetylase Assay, Activity Assay, Quantitative RT-PCR, In Vitro, Incubation, Real-time Polymerase Chain Reaction

MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.
Figure Legend Snippet: MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.

Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, RNA Extraction

MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P
Figure Legend Snippet: MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P

Techniques Used: Staining, Epifluorescence Microscopy, Quantitative RT-PCR, Expressing, Inhibition

22) Product Images from "Overexpression of a NF-YC Gene Results in Enhanced Drought and Salt Tolerance in Transgenic Seashore Paspalum"

Article Title: Overexpression of a NF-YC Gene Results in Enhanced Drought and Salt Tolerance in Transgenic Seashore Paspalum

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2018.01355

Analysis of transcript levels of PvLEA3 , PvABI2 , PvP5CS1 , and PvDREB1B in the transgenic plants in comparison with the WT. Detached leaves were placed in water for 4 h as control (A) , or air-dried in a hood for 4 h as dehydration treatment (B) , or placed in 0.4 M NaCl solution for 5 h as salt treatment (C) . PvACTIN1 was used as a reference gene for qRT-PCR. Relative expression of each gene was calculated by defining the normalized transcript level in WT plant under control condition as one. Means of three replicates and standard errors are presented; the same letter above the column indicates no significant difference at P
Figure Legend Snippet: Analysis of transcript levels of PvLEA3 , PvABI2 , PvP5CS1 , and PvDREB1B in the transgenic plants in comparison with the WT. Detached leaves were placed in water for 4 h as control (A) , or air-dried in a hood for 4 h as dehydration treatment (B) , or placed in 0.4 M NaCl solution for 5 h as salt treatment (C) . PvACTIN1 was used as a reference gene for qRT-PCR. Relative expression of each gene was calculated by defining the normalized transcript level in WT plant under control condition as one. Means of three replicates and standard errors are presented; the same letter above the column indicates no significant difference at P

Techniques Used: Transgenic Assay, Hood, Quantitative RT-PCR, Expressing

23) Product Images from "MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae"

Article Title: MoSnt2-dependent deacetylation of histone H3 mediates MoTor-dependent autophagy and plant infection by the rice blast fungus Magnaporthe oryzae

Journal: Autophagy

doi: 10.1080/15548627.2018.1458171

MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.
Figure Legend Snippet: MoSnt2 mediates H3 deacetylation and regulates expression of autophagy genes. (A) Visualization of the interaction between proteins as shown in the BiFC assay. Vegetative hyphae were stained with DAPI and then analyzed by epifluorescence microscopy. Scale bar: 10 μm. (B) GST-PHD1 coimmunoprecipitates H3 histones. E. coli -expressed fusion proteins were used for affinity isolation of histones of calf thymus and immunoblot analysis conducted with the antibodies indicated. The star indicates GST-PHD1 and GST-PHD2, while arrowhead indicates GST. (C) Histone deacetylase activity in affinity isolation complexes. (D) Immunoblot analysis of histone proteins in M. oryzae with the indicated primary antibodies. (E) qRT-PCR analysis on the expression levels of autophagy genes. (F) In vitro affinity isolation of autophagy gene DNA by MoSnt2. GST-MoSnt2-F1, GST-MoSnt2-F2 or GST alone were incubated with sheared chromatin, affinity isolated, washed and subjected to qPCR for autophagy genes. Similar results were obtained from 3 independent biological experiments.

Techniques Used: Expressing, Bimolecular Fluorescence Complementation Assay, Staining, Epifluorescence Microscopy, Isolation, Histone Deacetylase Assay, Activity Assay, Quantitative RT-PCR, In Vitro, Incubation, Real-time Polymerase Chain Reaction

MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.
Figure Legend Snippet: MoSNT2 is associated with the MoTor signaling pathway. (A) Vegetative growth of M. oryzae on CM agar medium supplemented with or without 1 μg/ml rapamycin (rapa.). (B) Inhibition rate of rapamycin on the mycelial growth. (C) Expression profiles of MoSNT2 and MoTOR in the wild-type Guy11 strain at different developmental processes. (D) Linear correlation between qRT-PCR-measured expression levels of MoSNT2 and MoTOR . (E) qRT-PCR analysis of MoSNT2 expression levels in the Guy11 strain in response to rapamycin. The Guy11 strain grown in liquid CM for 48 h was transferred into fresh liquid CM in the presence or absence of 1 μg/ml rapamycin for 6 h before total RNA extraction.

Techniques Used: Inhibition, Expressing, Quantitative RT-PCR, RNA Extraction

MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P
Figure Legend Snippet: MoSNT2 regulates cell wall integrity and oxidative stress response. (A) Growth of M. oryzae on CM agar medium containing 200 μg/ml CFW or 200 μg/ml CR for 5 days. (B) CFW staining and epifluorescence microscopy of cell wall chitin of mycelium grown in liquid CM. Scale bar: 20 μm. (C) Increased hyphal melanization as a consequence of MoSNT2 deletion. (D) qRT-PCR analysis on the expression levels of melanin biosynthesis genes in mycelium grown in liquid CM. (E) Mycelial growth on CM agar medium in the presence of different concentrations of H 2 O 2 . (F) Statistical analysis of the inhibition rate under H 2 O 2 -induced oxidative stress on mycelial growth. Asterisks represent significant differences (** P

Techniques Used: Staining, Epifluorescence Microscopy, Quantitative RT-PCR, Expressing, Inhibition

24) Product Images from "Novel insights into molecular mechanisms of Pseudourostyla cristata encystment using comparative transcriptomics"

Article Title: Novel insights into molecular mechanisms of Pseudourostyla cristata encystment using comparative transcriptomics

Journal: Scientific Reports

doi: 10.1038/s41598-019-55608-7

Verification of the transcriptomic data by qRT-PCR. Left panel shows the qRT-PCR data and right panel represents transcriptomic data. yy indicats trophonts of P. cristata , and bn indicats dormant cysts of P. cristata . Error bars represent standard deviation of three repeats. Significant differences compared to the control group are indicated with * p
Figure Legend Snippet: Verification of the transcriptomic data by qRT-PCR. Left panel shows the qRT-PCR data and right panel represents transcriptomic data. yy indicats trophonts of P. cristata , and bn indicats dormant cysts of P. cristata . Error bars represent standard deviation of three repeats. Significant differences compared to the control group are indicated with * p

Techniques Used: Quantitative RT-PCR, Standard Deviation

25) Product Images from "Mir-509-5p joins the Mdm2/p53 feedback loop and regulates cancer cell growth"

Article Title: Mir-509-5p joins the Mdm2/p53 feedback loop and regulates cancer cell growth

Journal: Cell Death & Disease

doi: 10.1038/cddis.2014.327

miR-509-5p directly targets Mdm2 and inhibits its expression. ( a ) A schematic of the bioinformatics predicted seed region in the 3′-UTR of Mdm2 is shown above; the mutated 3′-UTR used in this study is also shown. ( b ) Expression of miR-509-5p, Mdm2 and p53 in the 14 pairs of matched cervical tumor specimens and in the 12 pairs of matched HCC tissues. ( c ) qRT-PCR showed the suppression of Mdm2 expression by miR-509-5p. The HeLa cells were transfected with the empty vector or miR-509-5p for 24 h before harvesting. ( d ) Western blot analysis was used to detect Mdm2 protein expression when HeLa cells were transfected with pcDNA3/pri-miR-509 or ASO-miR-509-5p. ( e ) The effect of miR-509-5p or ASO-miR-509-5p on the EGFP activity of EGFP-Mdm2-3′-UTR and EGFP-Mdm2-3′-UTR-mut, in which the putative miR-509-5p-binding site was mutated. For the EGFP reporter assays, HeLa cells were transfected with a miR-509-5p expression vector or ASO-miR-509-5p oligo and then harvested for lysis 48 h after transfection. The MTT assay ( f ) and colony formation assay ( g ) were performed to assess the HeLa and QGY-7703 cell growth alterations in the rescue experiment to further confirm that miR-509-5p acts as a tumor suppressor. ( h and i ) MTT and colony formation assays were performed to detect the effect of miR-509-5p in Mdm2-siRNA-transfected cells (* P
Figure Legend Snippet: miR-509-5p directly targets Mdm2 and inhibits its expression. ( a ) A schematic of the bioinformatics predicted seed region in the 3′-UTR of Mdm2 is shown above; the mutated 3′-UTR used in this study is also shown. ( b ) Expression of miR-509-5p, Mdm2 and p53 in the 14 pairs of matched cervical tumor specimens and in the 12 pairs of matched HCC tissues. ( c ) qRT-PCR showed the suppression of Mdm2 expression by miR-509-5p. The HeLa cells were transfected with the empty vector or miR-509-5p for 24 h before harvesting. ( d ) Western blot analysis was used to detect Mdm2 protein expression when HeLa cells were transfected with pcDNA3/pri-miR-509 or ASO-miR-509-5p. ( e ) The effect of miR-509-5p or ASO-miR-509-5p on the EGFP activity of EGFP-Mdm2-3′-UTR and EGFP-Mdm2-3′-UTR-mut, in which the putative miR-509-5p-binding site was mutated. For the EGFP reporter assays, HeLa cells were transfected with a miR-509-5p expression vector or ASO-miR-509-5p oligo and then harvested for lysis 48 h after transfection. The MTT assay ( f ) and colony formation assay ( g ) were performed to assess the HeLa and QGY-7703 cell growth alterations in the rescue experiment to further confirm that miR-509-5p acts as a tumor suppressor. ( h and i ) MTT and colony formation assays were performed to detect the effect of miR-509-5p in Mdm2-siRNA-transfected cells (* P

Techniques Used: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Western Blot, Allele-specific Oligonucleotide, Activity Assay, Binding Assay, Lysis, MTT Assay, Colony Assay

Role of miR-509-5p in the regulation of cell cycle and apoptosis. ( a ) Overexpression of miR-509-5p enhanced p53 ubiquitination, and inhibition of miR-509-5p by ASO-miR-509-5p attenuated endogenous p53 ubiquitination in HeLa cells (top panel). The bottom panel shows the effect of miR-509-5p or ASO-miR-509-5p on p53 expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( b ) The mRNA level of Mdm2 and p53 in the presence of ASO-miR-509-5p with or without treatment of doxo. ( c ) The HeLa cells were treated with miR-509-5p or ASO-miR-509-5p for 48 h and were then lysed. Western blot analysis was used to detect p21 and bak expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( d ) qRT-PCR was used to detect the mRNA levels of p21 and bak in HeLa cells. ( e and f ) Cell cycle progression and apoptosis were analyzed using FACS and TUNEL assay in HeLa cells. ( g and h ) Rescue experiment to detect miR-509-5p effect in Mdm2-transfected HeLa cells (* P
Figure Legend Snippet: Role of miR-509-5p in the regulation of cell cycle and apoptosis. ( a ) Overexpression of miR-509-5p enhanced p53 ubiquitination, and inhibition of miR-509-5p by ASO-miR-509-5p attenuated endogenous p53 ubiquitination in HeLa cells (top panel). The bottom panel shows the effect of miR-509-5p or ASO-miR-509-5p on p53 expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( b ) The mRNA level of Mdm2 and p53 in the presence of ASO-miR-509-5p with or without treatment of doxo. ( c ) The HeLa cells were treated with miR-509-5p or ASO-miR-509-5p for 48 h and were then lysed. Western blot analysis was used to detect p21 and bak expression. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/pri-miR-509, ASO-NC and ASO-miR-509, respectively. ( d ) qRT-PCR was used to detect the mRNA levels of p21 and bak in HeLa cells. ( e and f ) Cell cycle progression and apoptosis were analyzed using FACS and TUNEL assay in HeLa cells. ( g and h ) Rescue experiment to detect miR-509-5p effect in Mdm2-transfected HeLa cells (* P

Techniques Used: Over Expression, Inhibition, Allele-specific Oligonucleotide, Expressing, Transfection, Western Blot, Quantitative RT-PCR, FACS, TUNEL Assay

p53 induces the miR-509-5p promoter activity. ( a ) A schematic description of the putative miR-509-5p promoter with two potential p53 response elements, p53RE1 and p53RE2, is shown compared with the p53RE consensus, where R=A or G; W=A or T and Y=C or T. C and G in red are the conserved nucleotides. ( b ) pMir-509p-Luc-1 luciferase assays in HeLa cells with overexpression or knockdown of p53. ( c ) pMir-509p-Luc-1 luciferase assays in HeLa cells treated with 1 μ g/ml doxo. ( d ) Deletion analysis identifies p53RE2-mediated p53-induced miR-509-5p promoter luciferase activity. pMir-509p-Luc-2: p53RE1 was deleted; pMir-509p-Luc-3: the upstream sequence of pRE2 was deleted; pMir-509p-Luc-4: pRE2 sequence was deleted. ( e ) ChIP assay shows that p53 directly interacts with p53RE2. GAPDH sequence that can bind to Pol II antibody serves as a positive control. Normal mouse IgG was used as the negative control. ( f ) miR-509-5p primary transcript was detected by qRT-PCR (* P
Figure Legend Snippet: p53 induces the miR-509-5p promoter activity. ( a ) A schematic description of the putative miR-509-5p promoter with two potential p53 response elements, p53RE1 and p53RE2, is shown compared with the p53RE consensus, where R=A or G; W=A or T and Y=C or T. C and G in red are the conserved nucleotides. ( b ) pMir-509p-Luc-1 luciferase assays in HeLa cells with overexpression or knockdown of p53. ( c ) pMir-509p-Luc-1 luciferase assays in HeLa cells treated with 1 μ g/ml doxo. ( d ) Deletion analysis identifies p53RE2-mediated p53-induced miR-509-5p promoter luciferase activity. pMir-509p-Luc-2: p53RE1 was deleted; pMir-509p-Luc-3: the upstream sequence of pRE2 was deleted; pMir-509p-Luc-4: pRE2 sequence was deleted. ( e ) ChIP assay shows that p53 directly interacts with p53RE2. GAPDH sequence that can bind to Pol II antibody serves as a positive control. Normal mouse IgG was used as the negative control. ( f ) miR-509-5p primary transcript was detected by qRT-PCR (* P

Techniques Used: Activity Assay, Luciferase, Over Expression, Sequencing, Chromatin Immunoprecipitation, Positive Control, Negative Control, Quantitative RT-PCR

miR-509-5p serves as a tumor suppressor. ( a ) qRT-PCR was performed to examine the alterations of miR-509-5p expression after transfection with pri-miR-509 and ASO-miR-509-5p in HeLa cells. U6 snRNA was used as an internal control. ( b and c ) The effects of overexpression or knockdown of miR-509-5p on cell viability were detected using an MTT assay, and the long-term effects on proliferative capacity were examined after transfection using a colony formation assay in HeLa, QGY-7703 and HepG2 cells. ( d and e ) Transwell migration assays were performed with HeLa and QGY-7703 cells transfected with pri-miR-509, ASO-miR-509-5p and the corresponding control vectors. Transwell assays without Matrigel demonstrated that miR-509 significantly decreased the migration of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted. ( f and g ) Transwell assays with Matrigel demonstrated that miR-509 overexpression significantly promoted the invasion of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted (* P
Figure Legend Snippet: miR-509-5p serves as a tumor suppressor. ( a ) qRT-PCR was performed to examine the alterations of miR-509-5p expression after transfection with pri-miR-509 and ASO-miR-509-5p in HeLa cells. U6 snRNA was used as an internal control. ( b and c ) The effects of overexpression or knockdown of miR-509-5p on cell viability were detected using an MTT assay, and the long-term effects on proliferative capacity were examined after transfection using a colony formation assay in HeLa, QGY-7703 and HepG2 cells. ( d and e ) Transwell migration assays were performed with HeLa and QGY-7703 cells transfected with pri-miR-509, ASO-miR-509-5p and the corresponding control vectors. Transwell assays without Matrigel demonstrated that miR-509 significantly decreased the migration of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted. ( f and g ) Transwell assays with Matrigel demonstrated that miR-509 overexpression significantly promoted the invasion of HeLa and QGY-7703 cells when compared with the control vector groups. The results were consistent when miR-509-5p was depleted (* P

Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Allele-specific Oligonucleotide, Over Expression, MTT Assay, Colony Assay, Migration, Plasmid Preparation

The miR-509-5p expression is modulated through the p53 pathway. ( a ) HeLa cells were transfected with pcDNA3/p53, and microarray was used to detect the differentially expressed miRNAs. The upregulated and downregulated miRNAs are shown. ( b ) p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h (left panel). Under this condition, miR-509-5p was induced in the four cell lines (right panel). ( c ) Cells were grown in medium containing 10% or no FBS for 24 h. p53 was induced in the four cells grown under serum starvation conditions (left panel), and miR-509-5p was induced in the four cell lines (right panel). ( d ) The qRT-PCR analysis showed that the level of p53 mRNA increased or decreased (left panel) following transfection with pcDNA3/p53 or pSilencer2.1/p53-shRNA, respectively, and miR-509-5p expression was also subsequently induced or reduced in these four cell lines (right panel). ( e ) Western blot analysis showed that p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h. Accordingly, increased p21 protein expression level was also detected. GAPDH was used as an internal control. ( f ) Western blot analysis was performed to examine p53 and p21 protein expression level in the four cell lines (HeLa, Caski, QGY-7703 and HepG2 cells) grown in medium containing 10% or no FBS for 24 h. GAPDH was used as an internal control. ( g ) The gain or loss of p53 protein expression level was measured in cells (HeLa, Caski, QGY-7703 and HepG2 cells) transfected with pcDNA3/p53 or pSilencer2.1/p53-shRNA as well as control plasmid by western blot analysis. The protein expression of p21 was also detected. GAPDH was used as an internal control. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/p53, pSilencer2.1 and pSilencer2.1/p53-shRNA, respectively (* P
Figure Legend Snippet: The miR-509-5p expression is modulated through the p53 pathway. ( a ) HeLa cells were transfected with pcDNA3/p53, and microarray was used to detect the differentially expressed miRNAs. The upregulated and downregulated miRNAs are shown. ( b ) p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h (left panel). Under this condition, miR-509-5p was induced in the four cell lines (right panel). ( c ) Cells were grown in medium containing 10% or no FBS for 24 h. p53 was induced in the four cells grown under serum starvation conditions (left panel), and miR-509-5p was induced in the four cell lines (right panel). ( d ) The qRT-PCR analysis showed that the level of p53 mRNA increased or decreased (left panel) following transfection with pcDNA3/p53 or pSilencer2.1/p53-shRNA, respectively, and miR-509-5p expression was also subsequently induced or reduced in these four cell lines (right panel). ( e ) Western blot analysis showed that p53 was induced in HeLa, Caski, QGY-7703 and HepG2 cells treated with 0.5 or 1.0 μ g/ml doxo for 16 h. Accordingly, increased p21 protein expression level was also detected. GAPDH was used as an internal control. ( f ) Western blot analysis was performed to examine p53 and p21 protein expression level in the four cell lines (HeLa, Caski, QGY-7703 and HepG2 cells) grown in medium containing 10% or no FBS for 24 h. GAPDH was used as an internal control. ( g ) The gain or loss of p53 protein expression level was measured in cells (HeLa, Caski, QGY-7703 and HepG2 cells) transfected with pcDNA3/p53 or pSilencer2.1/p53-shRNA as well as control plasmid by western blot analysis. The protein expression of p21 was also detected. GAPDH was used as an internal control. a, b, c and d represent the cells transfected with pcDNA3, pcDNA3/p53, pSilencer2.1 and pSilencer2.1/p53-shRNA, respectively (* P

Techniques Used: Expressing, Transfection, Microarray, Quantitative RT-PCR, shRNA, Western Blot, Plasmid Preparation

26) Product Images from "circRASSF2 Acts as ceRNA and Promotes Papillary Thyroid Carcinoma Progression through miR-1178/TLR4 Signaling Pathway"

Article Title: circRASSF2 Acts as ceRNA and Promotes Papillary Thyroid Carcinoma Progression through miR-1178/TLR4 Signaling Pathway

Journal: Molecular Therapy. Nucleic Acids

doi: 10.1016/j.omtn.2019.11.037

circRASSF2 Is Secreted by Exosomes into Serum of PTC Patients (A) circRASSF2 was secreted into exosomes derived from serum of PTC patients. A representative image of exosome (indicated by red arrows) derived from serum of PTC patients detected from electron microscope. (B) WB showing the expression of TSG101 and HSP70, which are the markers of exosome from purified serum exosome. (C) qRT-PCR for the abundance of circRASSF2 in serum exosomes. The levels of circRASSF2 in serum exosomes from PTC patients were significantly higher than that in normal individuals. (D) The expression levels of circRASSF2 were negatively correlated with that of miR-1178 in the exosomes extracted from serum of PTC patients. All tests were performed at least three times. Data were expressed as mean ± SD. **p
Figure Legend Snippet: circRASSF2 Is Secreted by Exosomes into Serum of PTC Patients (A) circRASSF2 was secreted into exosomes derived from serum of PTC patients. A representative image of exosome (indicated by red arrows) derived from serum of PTC patients detected from electron microscope. (B) WB showing the expression of TSG101 and HSP70, which are the markers of exosome from purified serum exosome. (C) qRT-PCR for the abundance of circRASSF2 in serum exosomes. The levels of circRASSF2 in serum exosomes from PTC patients were significantly higher than that in normal individuals. (D) The expression levels of circRASSF2 were negatively correlated with that of miR-1178 in the exosomes extracted from serum of PTC patients. All tests were performed at least three times. Data were expressed as mean ± SD. **p

Techniques Used: Derivative Assay, Microscopy, Western Blot, Expressing, Purification, Quantitative RT-PCR

27) Product Images from "Mitochondrial TXNRD3 confers drug resistance via redox-mediated mechanism and is a potential therapeutic target in vivo"

Article Title: Mitochondrial TXNRD3 confers drug resistance via redox-mediated mechanism and is a potential therapeutic target in vivo

Journal: Redox Biology

doi: 10.1016/j.redox.2020.101652

Identification of TXNRD3 in Sorafenib-resistant cells by metabolic qRT-PCR array. ( A ) Experimental procedures to prepare metabolic qRT-PCR array for comparison of gene expression profiles of sorafenib-sensitive cells (MV4-11) and sorafenib–resistant cells (MV4-11R). Cell viability was measured by MTS assay. ( B ) Characterization of the metabolic qRT-PCR array showing primer specificity (product melting curves, left panel), reproducibility in replicate experiments (middle panel), and detection sensitivity over a range of 50–1000 ng RNA input (right panel). ( C ) Identification of TXNRD3 as a highly expressed gene in sorafenib-resistant cells (MV4-11R), revealed by metabolic qRT-PCR array analysis. ( D ) Expression of TXNRD3 in leukemia samples from high-risk and low-risk AML patients and their association with overall survival based on analysis of GEO dataset (GSE12417). Data represent mean ± SD; ***, p
Figure Legend Snippet: Identification of TXNRD3 in Sorafenib-resistant cells by metabolic qRT-PCR array. ( A ) Experimental procedures to prepare metabolic qRT-PCR array for comparison of gene expression profiles of sorafenib-sensitive cells (MV4-11) and sorafenib–resistant cells (MV4-11R). Cell viability was measured by MTS assay. ( B ) Characterization of the metabolic qRT-PCR array showing primer specificity (product melting curves, left panel), reproducibility in replicate experiments (middle panel), and detection sensitivity over a range of 50–1000 ng RNA input (right panel). ( C ) Identification of TXNRD3 as a highly expressed gene in sorafenib-resistant cells (MV4-11R), revealed by metabolic qRT-PCR array analysis. ( D ) Expression of TXNRD3 in leukemia samples from high-risk and low-risk AML patients and their association with overall survival based on analysis of GEO dataset (GSE12417). Data represent mean ± SD; ***, p

Techniques Used: Quantitative RT-PCR, Expressing, MTS Assay

28) Product Images from "Cardiomyocytes capture stem cell-derived, anti-apoptotic microRNA-214 via clathrin-mediated endocytosis in acute myocardial infarction"

Article Title: Cardiomyocytes capture stem cell-derived, anti-apoptotic microRNA-214 via clathrin-mediated endocytosis in acute myocardial infarction

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA119.007537

ADRC-secreted miR-214 reduces ischemia-induced cardiac apoptosis. A , anti-apoptotic and secreted miRNA expression analysis in isolated cardiomyocytes, BM-MNCs, and ADRCs using qRT-PCR ( n = 4). B , tissue and cell distribution of miR-214 ( n = 4). C , expression analysis of miRNAs in isolated cardiomyocytes treated with the ADRC culture supernatants ( n = 4). Comparisons were performed using one-way ANOVA with Tukey's post hoc testing. D , expression analysis of miR-214 in the heart following coronary artery ligation and ADRC injection ( n = 4). E , efficiency of 48-h miR-214 inhibitor–mediated miR-214 knockdown in ADRCs determined by qRT-PCR ( n = 6). F , miR-214 expression in cardiomyocytes induced by ADRC culture supernatant treatment ( n = 4). G , effect of miR-214 silencing in ADRCs on anti-apoptotic effects in isolated cardiomyocytes ( n = 8). H , effect of an miR-214 mimic in rat neonatal cardiomyocytes ( n = 6). I , infarct area in left ventricles 2 days following coronary artery ligation as assessed by triphenyltetrazolium chloride staining ( n = 6). J , echocardiogram analysis of left ventricular fractional shortening. K , cardiomyocyte apoptosis as assessed by TUNEL assay in the left ventricle ( n = 4). L , gene expression in the heart 2 days after coronary artery ligation ( n = 4). F and p values for one-way ANOVA ( F , G , and I–L ) or two-way ANOVA ( D and H ) are shown above the individual panels. p values are shown for pairwise comparisons using Tukey's multiple-comparison test after ANOVA ( D and F–L ) or unpaired two-tailed t test ( E ). ns , not significant; *, p
Figure Legend Snippet: ADRC-secreted miR-214 reduces ischemia-induced cardiac apoptosis. A , anti-apoptotic and secreted miRNA expression analysis in isolated cardiomyocytes, BM-MNCs, and ADRCs using qRT-PCR ( n = 4). B , tissue and cell distribution of miR-214 ( n = 4). C , expression analysis of miRNAs in isolated cardiomyocytes treated with the ADRC culture supernatants ( n = 4). Comparisons were performed using one-way ANOVA with Tukey's post hoc testing. D , expression analysis of miR-214 in the heart following coronary artery ligation and ADRC injection ( n = 4). E , efficiency of 48-h miR-214 inhibitor–mediated miR-214 knockdown in ADRCs determined by qRT-PCR ( n = 6). F , miR-214 expression in cardiomyocytes induced by ADRC culture supernatant treatment ( n = 4). G , effect of miR-214 silencing in ADRCs on anti-apoptotic effects in isolated cardiomyocytes ( n = 8). H , effect of an miR-214 mimic in rat neonatal cardiomyocytes ( n = 6). I , infarct area in left ventricles 2 days following coronary artery ligation as assessed by triphenyltetrazolium chloride staining ( n = 6). J , echocardiogram analysis of left ventricular fractional shortening. K , cardiomyocyte apoptosis as assessed by TUNEL assay in the left ventricle ( n = 4). L , gene expression in the heart 2 days after coronary artery ligation ( n = 4). F and p values for one-way ANOVA ( F , G , and I–L ) or two-way ANOVA ( D and H ) are shown above the individual panels. p values are shown for pairwise comparisons using Tukey's multiple-comparison test after ANOVA ( D and F–L ) or unpaired two-tailed t test ( E ). ns , not significant; *, p

Techniques Used: Expressing, Isolation, Quantitative RT-PCR, Ligation, Injection, Staining, TUNEL Assay, Two Tailed Test

Hypoxia conditions activate clathrin-mediated endocytosis in cardiomyocytes. A , immunoblotting showing protein expression of MFG-E8, syntenin, and actin in ADRC-conditioned medium (supernatant) ( ADRC-CM ), exosomes isolated from ADRC-CM, and ADRCs. MFG-E8 and syntenin are associated with exosomes. MW , molecular weight. B , three-dimensional reconstruction of confocal microscopy images showing fluorescent dye PKH67-labeled exosomes in the cardiomyocyte cytoplasm ( red , α-actinin; blue , DAPI; green , PKH67). C , hypoxia conditions enhance endocytosis in cardiomyocytes. Right , magnified image of the boxed area in the center panel. D , statistical evaluation of C ( n = 4). E , endocytosis inhibitor–treated cardiomyocyte cell viability as assessed by the trypan blue dye exclusion test ( n = 4). F , effect of chlorpromazine treatment on hypoxia-induced cardiomyocyte endocytosis ( n = 4). G , qRT-PCR analysis of miR-214 expression in isolated cardiomyocytes ( n = 4) upon chlorpromazine treatment in hypoxia conditions. H , effect of dynasore treatment on ADRC-CM–induced decrease of hypoxia-damaged cardiomyocytes. F and p values for one-way ANOVA ( E , G , and H ) or two-way ANOVA ( D and F ) are shown above the individual panels. p values are shown for pairwise comparisons using Tukey's multiple-comparison test after ANOVA ( D–H ). ns , not significant; **, p
Figure Legend Snippet: Hypoxia conditions activate clathrin-mediated endocytosis in cardiomyocytes. A , immunoblotting showing protein expression of MFG-E8, syntenin, and actin in ADRC-conditioned medium (supernatant) ( ADRC-CM ), exosomes isolated from ADRC-CM, and ADRCs. MFG-E8 and syntenin are associated with exosomes. MW , molecular weight. B , three-dimensional reconstruction of confocal microscopy images showing fluorescent dye PKH67-labeled exosomes in the cardiomyocyte cytoplasm ( red , α-actinin; blue , DAPI; green , PKH67). C , hypoxia conditions enhance endocytosis in cardiomyocytes. Right , magnified image of the boxed area in the center panel. D , statistical evaluation of C ( n = 4). E , endocytosis inhibitor–treated cardiomyocyte cell viability as assessed by the trypan blue dye exclusion test ( n = 4). F , effect of chlorpromazine treatment on hypoxia-induced cardiomyocyte endocytosis ( n = 4). G , qRT-PCR analysis of miR-214 expression in isolated cardiomyocytes ( n = 4) upon chlorpromazine treatment in hypoxia conditions. H , effect of dynasore treatment on ADRC-CM–induced decrease of hypoxia-damaged cardiomyocytes. F and p values for one-way ANOVA ( E , G , and H ) or two-way ANOVA ( D and F ) are shown above the individual panels. p values are shown for pairwise comparisons using Tukey's multiple-comparison test after ANOVA ( D–H ). ns , not significant; **, p

Techniques Used: Expressing, Isolation, Molecular Weight, Confocal Microscopy, Labeling, Quantitative RT-PCR

29) Product Images from "Ectopic Expression of AhGLK1b (GOLDEN2-like Transcription Factor) in Arabidopsis Confers Dual Resistance to Fungal and Bacterial Pathogens"

Article Title: Ectopic Expression of AhGLK1b (GOLDEN2-like Transcription Factor) in Arabidopsis Confers Dual Resistance to Fungal and Bacterial Pathogens

Journal: Genes

doi: 10.3390/genes11030343

Microarray or qRT-PCR analysis of AhGLK1b transcription levels responding to different abiotic and biotic stresses. ( a ) Microarray analysis of AhGLK1b expression in response to deficient and sufficient Ca 2+ in a peanut developing embryo. ( b ) qRT-PCR analysis of AhGLK1b in a peanut embryo at different developmental stages under Ca 2+ stresses. ( c ) Microarray analysis of AhGLK1b expression in peanut seedlings in response to low temperature and drought stresses. ( d ) qRT-PCR analysis of relative expressions of AhGLK1b in resistant and susceptible peanut cultivars responding to the R. solanacearum challenge. The samples pods or leaves were collected from more than thirty plants or seedlings, with 10–15 plants or more than 40 pods mixed as one biological repeat. Data represent means of three biological replicates ± SD, asterisks indicate statistical significance in comparison with the control (Student’s t -test, significance levels of ** p
Figure Legend Snippet: Microarray or qRT-PCR analysis of AhGLK1b transcription levels responding to different abiotic and biotic stresses. ( a ) Microarray analysis of AhGLK1b expression in response to deficient and sufficient Ca 2+ in a peanut developing embryo. ( b ) qRT-PCR analysis of AhGLK1b in a peanut embryo at different developmental stages under Ca 2+ stresses. ( c ) Microarray analysis of AhGLK1b expression in peanut seedlings in response to low temperature and drought stresses. ( d ) qRT-PCR analysis of relative expressions of AhGLK1b in resistant and susceptible peanut cultivars responding to the R. solanacearum challenge. The samples pods or leaves were collected from more than thirty plants or seedlings, with 10–15 plants or more than 40 pods mixed as one biological repeat. Data represent means of three biological replicates ± SD, asterisks indicate statistical significance in comparison with the control (Student’s t -test, significance levels of ** p

Techniques Used: Microarray, Quantitative RT-PCR, Expressing

30) Product Images from "Nuclear localization of Newcastle disease virus matrix protein promotes virus replication by affecting viral RNA synthesis and transcription and inhibiting host cell transcription"

Article Title: Nuclear localization of Newcastle disease virus matrix protein promotes virus replication by affecting viral RNA synthesis and transcription and inhibiting host cell transcription

Journal: Veterinary Research

doi: 10.1186/s13567-019-0640-4

Quantitative analysis of genomic RNA, antigenomic RNA, mRNA and protein in a minigenomic assay. Relative fold expression of genomic RNA ( A ), antigenomic RNA ( B ), and mRNA ( C ) in the minigenome system caused by M or M/NLSm were measured by qRT-PCR. Error bars represent standard deviations (mean ± SD) (* P
Figure Legend Snippet: Quantitative analysis of genomic RNA, antigenomic RNA, mRNA and protein in a minigenomic assay. Relative fold expression of genomic RNA ( A ), antigenomic RNA ( B ), and mRNA ( C ) in the minigenome system caused by M or M/NLSm were measured by qRT-PCR. Error bars represent standard deviations (mean ± SD) (* P

Techniques Used: Expressing, Quantitative RT-PCR

Effect of AHR knockdown on the viral RNA synthesis and viral replication. The expression levels of AHR protein in BSR-T7/5 cells infected with rSS1GFP and rSS1GFP-M/NLSm ( A ) or transfected with pCI-M and pCI-M/NLSm ( B ) were examined by Western blotting. The relative levels of the AHR protein were compared with the control GAPDH expression. C Effect of the AHR siRNA or control siRNA on the expression of endogenous AHR in BSR-T7/5 cells. D AHR siRNA- or control siRNA-treated BSR-T7/5 cells were infected with rSS1GFP and rSS1GFP-M/NLSm, and viral RNA synthesis corresponding to the NP and P genes were detected by qRT-PCR. E The growth kinetics of rSS1GFP and rSS1GFP-M/NLSm were compared using multicycle growth curves in AHR siRNA- or control siRNA-treated cells. Error bars represent standard deviations (mean ± SD) (* P
Figure Legend Snippet: Effect of AHR knockdown on the viral RNA synthesis and viral replication. The expression levels of AHR protein in BSR-T7/5 cells infected with rSS1GFP and rSS1GFP-M/NLSm ( A ) or transfected with pCI-M and pCI-M/NLSm ( B ) were examined by Western blotting. The relative levels of the AHR protein were compared with the control GAPDH expression. C Effect of the AHR siRNA or control siRNA on the expression of endogenous AHR in BSR-T7/5 cells. D AHR siRNA- or control siRNA-treated BSR-T7/5 cells were infected with rSS1GFP and rSS1GFP-M/NLSm, and viral RNA synthesis corresponding to the NP and P genes were detected by qRT-PCR. E The growth kinetics of rSS1GFP and rSS1GFP-M/NLSm were compared using multicycle growth curves in AHR siRNA- or control siRNA-treated cells. Error bars represent standard deviations (mean ± SD) (* P

Techniques Used: Expressing, Infection, Transfection, Western Blot, Quantitative RT-PCR

Comparison of the viral RNA synthesis and transcription in DF-1 cells. A The viral RNA synthesis corresponding to the NP and P genes and B viral transcription corresponding to the M and GFP genes in rSS1GFP- and rSS1GFP-M/NLSm-infected cells were detected by qRT-PCR. Error bars represent standard deviations (mean ± SD) (* P
Figure Legend Snippet: Comparison of the viral RNA synthesis and transcription in DF-1 cells. A The viral RNA synthesis corresponding to the NP and P genes and B viral transcription corresponding to the M and GFP genes in rSS1GFP- and rSS1GFP-M/NLSm-infected cells were detected by qRT-PCR. Error bars represent standard deviations (mean ± SD) (* P

Techniques Used: Infection, Quantitative RT-PCR

Effect of PROX1 knockdown on the viral RNA synthesis and viral replication. The expression levels of PROX1 protein in BSR-T7/5 cells infected with rSS1GFP and rSS1GFP-M/NLSm ( A ) or transfected with pCI-M and pCI-M/NLSm ( B ) were examined by Western blotting. The relative levels of the PROX1 protein were compared with the control GAPDH expression. C Effect of the PROX1 siRNA or control siRNA on the expression of endogenous PROX1 in BSR-T7/5 cells. D PROX1 siRNA- or control siRNA-treated BSR-T7/5 cells were infected with rSS1GFP and rSS1GFP-M/NLSm, and viral RNA synthesis corresponding to the NP and P genes were detected by qRT-PCR. E The growth kinetics of rSS1GFP and rSS1GFP-M/NLSm were compared using multicycle growth curves in PROX1 siRNA- or control siRNA-treated cells. Error bars represent standard deviations (mean ± SD) (* P
Figure Legend Snippet: Effect of PROX1 knockdown on the viral RNA synthesis and viral replication. The expression levels of PROX1 protein in BSR-T7/5 cells infected with rSS1GFP and rSS1GFP-M/NLSm ( A ) or transfected with pCI-M and pCI-M/NLSm ( B ) were examined by Western blotting. The relative levels of the PROX1 protein were compared with the control GAPDH expression. C Effect of the PROX1 siRNA or control siRNA on the expression of endogenous PROX1 in BSR-T7/5 cells. D PROX1 siRNA- or control siRNA-treated BSR-T7/5 cells were infected with rSS1GFP and rSS1GFP-M/NLSm, and viral RNA synthesis corresponding to the NP and P genes were detected by qRT-PCR. E The growth kinetics of rSS1GFP and rSS1GFP-M/NLSm were compared using multicycle growth curves in PROX1 siRNA- or control siRNA-treated cells. Error bars represent standard deviations (mean ± SD) (* P

Techniques Used: Expressing, Infection, Transfection, Western Blot, Quantitative RT-PCR

31) Product Images from "Elevated CO2 concentration promotes photosynthesis of grape (Vitis vinifera L. cv. ‘Pinot noir’) plantlet in vitro by regulating RbcS and Rca revealed by proteomic and transcriptomic profiles"

Article Title: Elevated CO2 concentration promotes photosynthesis of grape (Vitis vinifera L. cv. ‘Pinot noir’) plantlet in vitro by regulating RbcS and Rca revealed by proteomic and transcriptomic profiles

Journal: BMC Plant Biology

doi: 10.1186/s12870-019-1644-y

qRT-PCR validation of the relative expression levels of 18 slected genes from Cs, C0 and CK in leaves
Figure Legend Snippet: qRT-PCR validation of the relative expression levels of 18 slected genes from Cs, C0 and CK in leaves

Techniques Used: Quantitative RT-PCR, Expressing

32) Product Images from "Analyses of MicroRNA and mRNA Expression Profiles Reveal the Crucial Interaction Networks and Pathways for Regulation of Chicken Breast Muscle Development"

Article Title: Analyses of MicroRNA and mRNA Expression Profiles Reveal the Crucial Interaction Networks and Pathways for Regulation of Chicken Breast Muscle Development

Journal: Frontiers in Genetics

doi: 10.3389/fgene.2019.00197

Quantitative real-time PCR validation of differentially expressed miRNAs and their corresponding target mRNAs. The red dots indicate three biological repetition of gene in qRT-PCR result. The blue dots indicate three biological repetition of miRNA in qRT-PCR result. (A) The qRT-PCR validation of miR-30a-3p and its target gene FOXO3 ; (B) The qRT-PCR validation of miR-30a-3p and its target gene DYNLL2; (C) The qRT-PCR validation of miR-148a-3p and its target gene DYNLL2.
Figure Legend Snippet: Quantitative real-time PCR validation of differentially expressed miRNAs and their corresponding target mRNAs. The red dots indicate three biological repetition of gene in qRT-PCR result. The blue dots indicate three biological repetition of miRNA in qRT-PCR result. (A) The qRT-PCR validation of miR-30a-3p and its target gene FOXO3 ; (B) The qRT-PCR validation of miR-30a-3p and its target gene DYNLL2; (C) The qRT-PCR validation of miR-148a-3p and its target gene DYNLL2.

Techniques Used: Real-time Polymerase Chain Reaction, Quantitative RT-PCR

Quantitative real-time PCR (qRT-PCR) validation of differentially expressed mRNAs. The red dots indicate the biological repetition in qRT-PCR result. The blue dots indicate the biological repetition from RNA-seq.
Figure Legend Snippet: Quantitative real-time PCR (qRT-PCR) validation of differentially expressed mRNAs. The red dots indicate the biological repetition in qRT-PCR result. The blue dots indicate the biological repetition from RNA-seq.

Techniques Used: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, RNA Sequencing Assay

33) Product Images from "Casparian strip membrane domain proteins in Gossypium arboreum: genome-wide identification and negative regulation of lateral root growth"

Article Title: Casparian strip membrane domain proteins in Gossypium arboreum: genome-wide identification and negative regulation of lateral root growth

Journal: BMC Genomics

doi: 10.1186/s12864-020-6723-9

GaCASP27 silenced plants have an increased number of lateral root phenotypes in G. arboreum . a Phenotypes of gene silencing plants were observed 2 weeks after infiltration. The plants from left to right were blank control (CK), negative control (TRV:00), positive control (TRV: CLA1) and two GaCASP27 -silenced lines. b The expression levels of GaCASP27 in the blank control, negative control and silenced cotton plants were conducted through qRT-PCR All experiments were analyzed with three independent biological replicates. c Two weeks after infiltration, the root length, lateral root number and plant height were determined in GA0149 accession. All experiments were analyzed based on three independent biological replicates. The significant difference analysis was performed using the t-test at P ≤ 0.05
Figure Legend Snippet: GaCASP27 silenced plants have an increased number of lateral root phenotypes in G. arboreum . a Phenotypes of gene silencing plants were observed 2 weeks after infiltration. The plants from left to right were blank control (CK), negative control (TRV:00), positive control (TRV: CLA1) and two GaCASP27 -silenced lines. b The expression levels of GaCASP27 in the blank control, negative control and silenced cotton plants were conducted through qRT-PCR All experiments were analyzed with three independent biological replicates. c Two weeks after infiltration, the root length, lateral root number and plant height were determined in GA0149 accession. All experiments were analyzed based on three independent biological replicates. The significant difference analysis was performed using the t-test at P ≤ 0.05

Techniques Used: Negative Control, Positive Control, Expressing, Quantitative RT-PCR

34) Product Images from "Systematic Analysis of Alkaline/Neutral Invertase Genes Reveals the Involvement of Smi-miR399 in Regulation of SmNINV3 and SmNINV4 in Salvia miltiorrhiza"

Article Title: Systematic Analysis of Alkaline/Neutral Invertase Genes Reveals the Involvement of Smi-miR399 in Regulation of SmNINV3 and SmNINV4 in Salvia miltiorrhiza

Journal: Plants

doi: 10.3390/plants8110490

Expression of SmNINVs in S. miltiorrhiza . ( a ) Number of reads per kilobase per million mapped reads (RPKM) of SmNINVs in RNA-seq data from roots (Rt), stems (St), leaves (Le), and flowers (Fl). ( b ) Number of reads (RPKM) of SmNINVs in RNA-seq data from root periderm (Rpe), root phloem (Rph) and root xylem (Rxy). ( c ) Relative expression of SmNINVs in roots (Rt), stems (St), leaves (Le) and flowers (Fl) of S. miltiorrhiza . Expression level in leaves was arbitrarily set to 1 and the levels in other organs were given relative to this. One-way ANOVA was calculated for qRT-PCR data using IBM SPSS 20 software. P
Figure Legend Snippet: Expression of SmNINVs in S. miltiorrhiza . ( a ) Number of reads per kilobase per million mapped reads (RPKM) of SmNINVs in RNA-seq data from roots (Rt), stems (St), leaves (Le), and flowers (Fl). ( b ) Number of reads (RPKM) of SmNINVs in RNA-seq data from root periderm (Rpe), root phloem (Rph) and root xylem (Rxy). ( c ) Relative expression of SmNINVs in roots (Rt), stems (St), leaves (Le) and flowers (Fl) of S. miltiorrhiza . Expression level in leaves was arbitrarily set to 1 and the levels in other organs were given relative to this. One-way ANOVA was calculated for qRT-PCR data using IBM SPSS 20 software. P

Techniques Used: Expressing, RNA Sequencing Assay, Quantitative RT-PCR, Software

35) Product Images from "Identification and biochemical characterization of Laodelphax striatellus neutral ceramidase"

Article Title: Identification and biochemical characterization of Laodelphax striatellus neutral ceramidase

Journal: Insect molecular biology

doi: 10.1111/imb.12028

Insecticide stimulated the LsnCer expression (A) 4-instar nymphs were treated with fipronil, imidacloprid and chlorpyrifos with LD50. Nymphs treated with acetone were used as control. The relative mRNA level of LsnCer was analyzed by qRT-PCR at indicated time points. Transcript abundance was calculated based on the difference in threshold cycle (Ct) values between LsnCer and actin transcripts based on the normalized relative quantification 2 −ΔΔCt method. The mRNA level of acetone treated nymphs was set as 1 at each time point, the relative mRNA level of each insecticide treated insects was calculated by comparing with mRNA level of acetone treated ones. (B) The nCDase activity of imidacloprid treated 4-instar nymphs analyzed at indicated time points. Ceramidase activity was assayed at pH 8. The nCDase activity in acetone-treated nymphs was set as 100% at each time point. Ceramidase activity of imidacloprid treated nymphs was expressed as % of the activity of the acetone-treated insects. Data represent the mean value ± SE of three independent experiments performed in duplicate.
Figure Legend Snippet: Insecticide stimulated the LsnCer expression (A) 4-instar nymphs were treated with fipronil, imidacloprid and chlorpyrifos with LD50. Nymphs treated with acetone were used as control. The relative mRNA level of LsnCer was analyzed by qRT-PCR at indicated time points. Transcript abundance was calculated based on the difference in threshold cycle (Ct) values between LsnCer and actin transcripts based on the normalized relative quantification 2 −ΔΔCt method. The mRNA level of acetone treated nymphs was set as 1 at each time point, the relative mRNA level of each insecticide treated insects was calculated by comparing with mRNA level of acetone treated ones. (B) The nCDase activity of imidacloprid treated 4-instar nymphs analyzed at indicated time points. Ceramidase activity was assayed at pH 8. The nCDase activity in acetone-treated nymphs was set as 100% at each time point. Ceramidase activity of imidacloprid treated nymphs was expressed as % of the activity of the acetone-treated insects. Data represent the mean value ± SE of three independent experiments performed in duplicate.

Techniques Used: Expressing, Quantitative RT-PCR, Activity Assay

36) Product Images from "The Streptococcus suis transcriptional landscape reveals adaptation mechanisms in pig blood and cerebrospinal fluid"

Article Title: The Streptococcus suis transcriptional landscape reveals adaptation mechanisms in pig blood and cerebrospinal fluid

Journal: RNA

doi: 10.1261/rna.041822.113

Validation of gene and regulatory RNAs expression by qRT-PCR. To verify the data obtained by RNA-seq, qRT-PCR was performed on 13 genes and nine regulatory RNAs. ( A ) Gene expression in blood and CSF. ( B ) Regulatory RNAs expression in blood and CSF.
Figure Legend Snippet: Validation of gene and regulatory RNAs expression by qRT-PCR. To verify the data obtained by RNA-seq, qRT-PCR was performed on 13 genes and nine regulatory RNAs. ( A ) Gene expression in blood and CSF. ( B ) Regulatory RNAs expression in blood and CSF.

Techniques Used: Expressing, Quantitative RT-PCR, RNA Sequencing Assay

37) Product Images from "CD61 promotes the differentiation of canine ADMSCs into PGC-like cells through modulation of TGF-β signaling"

Article Title: CD61 promotes the differentiation of canine ADMSCs into PGC-like cells through modulation of TGF-β signaling

Journal: Scientific Reports

doi: 10.1038/srep43851

Morphology and expression of primordial germ cell (PGC)-related markers in CD61- overexpressed cells and control cells. ( a ) The morphology of CD61-overexpressed cells and control cells. Canine adipose-derived mesenchymal stem cells (cADMSCs) with overexpression of CD61 became short spindle-shaped or triangular. ( b ) Gene expression ( CD61, Nanog, SOX2, Prdm1, Prdm14, CD49f and Ap2γ ) of control and CD61- overexpressed cells was detected by QRT-PCR. **P
Figure Legend Snippet: Morphology and expression of primordial germ cell (PGC)-related markers in CD61- overexpressed cells and control cells. ( a ) The morphology of CD61-overexpressed cells and control cells. Canine adipose-derived mesenchymal stem cells (cADMSCs) with overexpression of CD61 became short spindle-shaped or triangular. ( b ) Gene expression ( CD61, Nanog, SOX2, Prdm1, Prdm14, CD49f and Ap2γ ) of control and CD61- overexpressed cells was detected by QRT-PCR. **P

Techniques Used: Expressing, Pyrolysis Gas Chromatography, Derivative Assay, Over Expression, Quantitative RT-PCR

Expression of PGC-related markers in TGF-β1 treated cells and control cells. ( a ) Morphology of TGF-β1 treated cells and control cells. cADMSCs became flat, short-spindled and triangular or polygon-shaped after TGF-β1 treatment. ( b ) Gene expression ( Prdm1, Prdm14, CD49f, Ap2γ and Nanog ) of CD61-overexpressed cells and control cells analyzed by QRT-PCR. **P
Figure Legend Snippet: Expression of PGC-related markers in TGF-β1 treated cells and control cells. ( a ) Morphology of TGF-β1 treated cells and control cells. cADMSCs became flat, short-spindled and triangular or polygon-shaped after TGF-β1 treatment. ( b ) Gene expression ( Prdm1, Prdm14, CD49f, Ap2γ and Nanog ) of CD61-overexpressed cells and control cells analyzed by QRT-PCR. **P

Techniques Used: Expressing, Pyrolysis Gas Chromatography, Quantitative RT-PCR

Expression of PGC-related markers in LY2109761-treated cells and control cells. ( a ) PGC-related markers CD61, Prdm1, Prdm14, CD49f, Ap2γ and stem cell markers Nanog and Sox2 were examined by QRT-PCR in LY2109761-treated cells and control cells. **P
Figure Legend Snippet: Expression of PGC-related markers in LY2109761-treated cells and control cells. ( a ) PGC-related markers CD61, Prdm1, Prdm14, CD49f, Ap2γ and stem cell markers Nanog and Sox2 were examined by QRT-PCR in LY2109761-treated cells and control cells. **P

Techniques Used: Expressing, Pyrolysis Gas Chromatography, Quantitative RT-PCR

38) Product Images from "Transcriptomic analysis reveals that enterovirus F strain SWUN-AB001 infection activates JNK/SAPK and p38 MAPK signaling pathways in MDBK cells"

Article Title: Transcriptomic analysis reveals that enterovirus F strain SWUN-AB001 infection activates JNK/SAPK and p38 MAPK signaling pathways in MDBK cells

Journal: BMC Veterinary Research

doi: 10.1186/s12917-018-1721-8

Validation of the expression patterns of six differentially expressed genes by qRT-PCR analysis. The log 2 (fold change) values derived from the RNA-seq analysis of eight genes were compared with those obtained by qRT-PCR
Figure Legend Snippet: Validation of the expression patterns of six differentially expressed genes by qRT-PCR analysis. The log 2 (fold change) values derived from the RNA-seq analysis of eight genes were compared with those obtained by qRT-PCR

Techniques Used: Expressing, Quantitative RT-PCR, Derivative Assay, RNA Sequencing Assay

39) Product Images from "Characteristics of Circular RNA Expression Profiles of Porcine Granulosa Cells in Healthy and Atretic Antral Follicles"

Article Title: Characteristics of Circular RNA Expression Profiles of Porcine Granulosa Cells in Healthy and Atretic Antral Follicles

Journal: International Journal of Molecular Sciences

doi: 10.3390/ijms21155217

Validation and characterization of circRNAs. ( A ) Relative circRNA expression measured by qRT-PCR. circRNA expression was calculated as a fold change of AA over HA follicles. circRNA expression in HA was set to 1 for up-regulated genes and −1 for down-regulated genes. ( B ) Representative examples of PCR products purified and sequenced to confirm circRNA junction sites by Sanger sequencing, n = 3. ( C ) qRT-PCR for the abundance of circRNAs ( n = 6) and mRNAs ( n = 6) treated with RNase R. The amount of circRNAs and mRNAs was calculated as fold change of RNase R over controls. The expression values in the controls were set to 1 for up-regulated genes and −1 for down-regulated genes. *, p
Figure Legend Snippet: Validation and characterization of circRNAs. ( A ) Relative circRNA expression measured by qRT-PCR. circRNA expression was calculated as a fold change of AA over HA follicles. circRNA expression in HA was set to 1 for up-regulated genes and −1 for down-regulated genes. ( B ) Representative examples of PCR products purified and sequenced to confirm circRNA junction sites by Sanger sequencing, n = 3. ( C ) qRT-PCR for the abundance of circRNAs ( n = 6) and mRNAs ( n = 6) treated with RNase R. The amount of circRNAs and mRNAs was calculated as fold change of RNase R over controls. The expression values in the controls were set to 1 for up-regulated genes and −1 for down-regulated genes. *, p

Techniques Used: Expressing, Quantitative RT-PCR, Polymerase Chain Reaction, Purification, Sequencing

Characterization and putative role of circ_KIF16B. ( A ) The genomic loci of circ_KIF16B in the KIF16B gene. The expression of circ_KIF16B was validated by qRT-PCR, followed by Sanger sequencing. Arrows represent divergent primers binding to the genome region of circ_KIF16B. ( B ) Cellular characterization of circ_KIF16B. Levels of nuclear control transcript (U1), cytoplasmic control transcript (GAPDH and mRNA), and circ_KIF16B were assessed by qRT-PCR in nuclear ( n = 3) and cytoplasmic fractions ( n = 3) of porcine granulosa cells. Data are presented as a percentage of U1, GAPDH, and circ_KIF16B levels. ( C ) qRT-PCR for the abundance of circ_KIF16B (blue line, n = 3) and KIF16B mRNA (red line, n = 3) in granulosa cells treated with actinomycin D at the indicated time points. ( D ) A putative ceRNA network of circ_KIF16B constructed by Cytoscape 3.8. The red V shape represents circ_KIF16B, the yellow triangle represents targeted miRNAs, and blue round circles denote targeted mRNAs. ( E ) qRT-PCR for the abundance of mRNA content of 10 targeted pro-apoptotic genes in granulosa cells of HA (open circles, n = 6) and AA (filled squares, n = 6) follicles. ( F ) Correlation of expression levels of circ_KIF16B and TP53 . ( G ) circ_KIF16B expression in cumulus cells of HA (black bar, n = 6) and AA follicles (grey bar, n = 6), as measured by qRT-PCR. Gene expression, as fold change of AA over HA follicles, with no change, was indicated as 1. KIF16B , kinesin family member 16B; *, p
Figure Legend Snippet: Characterization and putative role of circ_KIF16B. ( A ) The genomic loci of circ_KIF16B in the KIF16B gene. The expression of circ_KIF16B was validated by qRT-PCR, followed by Sanger sequencing. Arrows represent divergent primers binding to the genome region of circ_KIF16B. ( B ) Cellular characterization of circ_KIF16B. Levels of nuclear control transcript (U1), cytoplasmic control transcript (GAPDH and mRNA), and circ_KIF16B were assessed by qRT-PCR in nuclear ( n = 3) and cytoplasmic fractions ( n = 3) of porcine granulosa cells. Data are presented as a percentage of U1, GAPDH, and circ_KIF16B levels. ( C ) qRT-PCR for the abundance of circ_KIF16B (blue line, n = 3) and KIF16B mRNA (red line, n = 3) in granulosa cells treated with actinomycin D at the indicated time points. ( D ) A putative ceRNA network of circ_KIF16B constructed by Cytoscape 3.8. The red V shape represents circ_KIF16B, the yellow triangle represents targeted miRNAs, and blue round circles denote targeted mRNAs. ( E ) qRT-PCR for the abundance of mRNA content of 10 targeted pro-apoptotic genes in granulosa cells of HA (open circles, n = 6) and AA (filled squares, n = 6) follicles. ( F ) Correlation of expression levels of circ_KIF16B and TP53 . ( G ) circ_KIF16B expression in cumulus cells of HA (black bar, n = 6) and AA follicles (grey bar, n = 6), as measured by qRT-PCR. Gene expression, as fold change of AA over HA follicles, with no change, was indicated as 1. KIF16B , kinesin family member 16B; *, p

Techniques Used: Expressing, Quantitative RT-PCR, Sequencing, Binding Assay, Construct

The characterization and putative role of circ_CBFA2T2. ( A ) The genomic loci of circ_CBFA2T2 in the CBFA2T2 gene. The expression of circ_CBFA2T2 was validated by qRT-PCR, followed by Sanger sequencing. Arrows represent divergent primers binding to the genome region of circ_CBFA2T2. ( B ) Cellular characterization of circ_CBFA2T2. Levels of nuclear control transcript (U1), cytoplasmic control transcript (GAPDH and mRNA), and circ_CBFA2T2 were assessed by qRT-PCR in nuclear ( n = 3) and cytoplasmic ( n = 3) fractions of porcine granulosa cells. Data are presented as a percentage of U1, GAPDH, and circ_CBFA2T2 levels. ( C ) qRT-PCR for the abundance of circ_CBFA2T2 (blue line, n = 3) and CBFA2T2 mRNA (red line, n = 3) in granulosa cells treated with actinomycin D at the indicated time points. ( D ) A putative ceRNA network of circ_CBFA2T2 constructed by Cytoscape 3.8. The green V shape represents circ_CBFA2T2, the yellow triangle represents targeted miRNAs, and blue circles denote targeted mRNAs. ( E ) qRT-PCR for the abundance of mRNA content of eight targeted genes in granulosa cells of HA (open circles, n = 6) and AA (filled squares, n = 6) follicles. ( F ) Association of expression levels of circ_CBFA2T2 and GCLC . ( G ) circ_CBFA2T2 expression in cumulus cells of HA (black bar, n = 6) and AA (grey bar, n = 6) follicles, as measured by qRT-PCR. Gene expression, as fold change of AA over HA follicles, with no change, was indicated as 1. *, p
Figure Legend Snippet: The characterization and putative role of circ_CBFA2T2. ( A ) The genomic loci of circ_CBFA2T2 in the CBFA2T2 gene. The expression of circ_CBFA2T2 was validated by qRT-PCR, followed by Sanger sequencing. Arrows represent divergent primers binding to the genome region of circ_CBFA2T2. ( B ) Cellular characterization of circ_CBFA2T2. Levels of nuclear control transcript (U1), cytoplasmic control transcript (GAPDH and mRNA), and circ_CBFA2T2 were assessed by qRT-PCR in nuclear ( n = 3) and cytoplasmic ( n = 3) fractions of porcine granulosa cells. Data are presented as a percentage of U1, GAPDH, and circ_CBFA2T2 levels. ( C ) qRT-PCR for the abundance of circ_CBFA2T2 (blue line, n = 3) and CBFA2T2 mRNA (red line, n = 3) in granulosa cells treated with actinomycin D at the indicated time points. ( D ) A putative ceRNA network of circ_CBFA2T2 constructed by Cytoscape 3.8. The green V shape represents circ_CBFA2T2, the yellow triangle represents targeted miRNAs, and blue circles denote targeted mRNAs. ( E ) qRT-PCR for the abundance of mRNA content of eight targeted genes in granulosa cells of HA (open circles, n = 6) and AA (filled squares, n = 6) follicles. ( F ) Association of expression levels of circ_CBFA2T2 and GCLC . ( G ) circ_CBFA2T2 expression in cumulus cells of HA (black bar, n = 6) and AA (grey bar, n = 6) follicles, as measured by qRT-PCR. Gene expression, as fold change of AA over HA follicles, with no change, was indicated as 1. *, p

Techniques Used: Expressing, Quantitative RT-PCR, Sequencing, Binding Assay, Construct

40) Product Images from "Knockdown of circ_0000512 Inhibits Cell Proliferation and Promotes Apoptosis in Colorectal Cancer by Regulating miR-296-5p/RUNX1 Axis"

Article Title: Knockdown of circ_0000512 Inhibits Cell Proliferation and Promotes Apoptosis in Colorectal Cancer by Regulating miR-296-5p/RUNX1 Axis

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S250495

The expression of circ_0000512 was enhanced in CRC tissues and cells, and correlated with poor clinical outcomes. ( A ) GSE126094 (10 pairs of CRC tissues and normal tissues) from the GEO database was analyzed to determine the expression of circ_0000512 in CRC tissues and normal tissues. ( B ) The expression of circ_0000512 was detected by qRT-PCR in CRC tissues and normal tissues. ( C ) The overall survival rate was measured between low and high circ_0000512 expression groups in CRC patients by Kaplan-Meier survival analysis. ( D ) The level of circ_0000512 was analyzed by qRT-PCR in CRC cells (SW480, HCT116, SW620, LoVo) and FHC cells. ( E ) The relative levels circ_0000512 and GAPDH were determined after treatment of RNase R by qRT-PCR. * P
Figure Legend Snippet: The expression of circ_0000512 was enhanced in CRC tissues and cells, and correlated with poor clinical outcomes. ( A ) GSE126094 (10 pairs of CRC tissues and normal tissues) from the GEO database was analyzed to determine the expression of circ_0000512 in CRC tissues and normal tissues. ( B ) The expression of circ_0000512 was detected by qRT-PCR in CRC tissues and normal tissues. ( C ) The overall survival rate was measured between low and high circ_0000512 expression groups in CRC patients by Kaplan-Meier survival analysis. ( D ) The level of circ_0000512 was analyzed by qRT-PCR in CRC cells (SW480, HCT116, SW620, LoVo) and FHC cells. ( E ) The relative levels circ_0000512 and GAPDH were determined after treatment of RNase R by qRT-PCR. * P

Techniques Used: Expressing, Quantitative RT-PCR

RUNX1 was a direct target of miR-296-5p in CRC cells. ( A ) The potential binding sites of RUNX1 and miR-296-5p were predicted by starBase. ( B ) The luciferase activity was tested in HCT116 and SW620 cells co-transfected with RUNX1 3ʹUTR-WT or RUNX1 3ʹUTR-MUT and miR-296-5p or miR-NC. ( C and D ) QRT-PCR and Western blot analyses were conducted to determine the mRNA and protein expression of RUNX1 in HCT116 and SW620 cells transfected with miR-296-5p or miR-NC. ( E ) The abundance of miR-296-5p was measured by qRT-PCR in HCT116 and SW620 cells transfected with anti-NC or anti-miR-296-5p. ( F and G ) The mRNA and protein levels of RUNX1 were measured in HCT116 and SW620 cells transfected with sh-NC, sh-circ#2, sh-circ#2 + anti-NC, or sh-circ#2 + anti-miR-296-5p. * P
Figure Legend Snippet: RUNX1 was a direct target of miR-296-5p in CRC cells. ( A ) The potential binding sites of RUNX1 and miR-296-5p were predicted by starBase. ( B ) The luciferase activity was tested in HCT116 and SW620 cells co-transfected with RUNX1 3ʹUTR-WT or RUNX1 3ʹUTR-MUT and miR-296-5p or miR-NC. ( C and D ) QRT-PCR and Western blot analyses were conducted to determine the mRNA and protein expression of RUNX1 in HCT116 and SW620 cells transfected with miR-296-5p or miR-NC. ( E ) The abundance of miR-296-5p was measured by qRT-PCR in HCT116 and SW620 cells transfected with anti-NC or anti-miR-296-5p. ( F and G ) The mRNA and protein levels of RUNX1 were measured in HCT116 and SW620 cells transfected with sh-NC, sh-circ#2, sh-circ#2 + anti-NC, or sh-circ#2 + anti-miR-296-5p. * P

Techniques Used: Binding Assay, Luciferase, Activity Assay, Transfection, Quantitative RT-PCR, Western Blot, Expressing

Circ_0000512 directly interacted with miR-296-5p in CRC cells. ( A ) The qRT-PCR assay determined the subcellular location of circ_0000512 in HCT116 and SW620 cells. ( B ) The potential target miRNAs of circ_0000512 were predicted by starBase and circinteractom. ( C ) The expression levels of miR-296-5p, miR-326 and miR-330-5p were detected by qRT-PCR in HCT116 and SW620 cells transfected with sh-NC or sh-circ#2. ( D ) The abundance of miR-296-5p was measured by qRT-PCR in HCT116 and SW620 cells transfected with miR-NC or miR-296-5p. ( E ) The putative binding sites between circ_0000512 and miR-296-5p were predicted by starBase. ( F and G ) The luciferase activity was measured in HCT116 and SW620 cells co-transfected with circ_0000512-WT or circ_0000512-MUT and miR-296-5p or miR-NC. ( H and I ) The enrichment of miR-296-5p and circ_0000512 was detected in HCT116 and SW620 cells incubated with anti-ago2 or anti-IgG by RIP assay. ( J ) The level of circ_0000512 was examined in HCT116 and SW620 cells transfected with Bio-miR-296-5p or Bio-NC by RNA pull-down assay. ** P
Figure Legend Snippet: Circ_0000512 directly interacted with miR-296-5p in CRC cells. ( A ) The qRT-PCR assay determined the subcellular location of circ_0000512 in HCT116 and SW620 cells. ( B ) The potential target miRNAs of circ_0000512 were predicted by starBase and circinteractom. ( C ) The expression levels of miR-296-5p, miR-326 and miR-330-5p were detected by qRT-PCR in HCT116 and SW620 cells transfected with sh-NC or sh-circ#2. ( D ) The abundance of miR-296-5p was measured by qRT-PCR in HCT116 and SW620 cells transfected with miR-NC or miR-296-5p. ( E ) The putative binding sites between circ_0000512 and miR-296-5p were predicted by starBase. ( F and G ) The luciferase activity was measured in HCT116 and SW620 cells co-transfected with circ_0000512-WT or circ_0000512-MUT and miR-296-5p or miR-NC. ( H and I ) The enrichment of miR-296-5p and circ_0000512 was detected in HCT116 and SW620 cells incubated with anti-ago2 or anti-IgG by RIP assay. ( J ) The level of circ_0000512 was examined in HCT116 and SW620 cells transfected with Bio-miR-296-5p or Bio-NC by RNA pull-down assay. ** P

Techniques Used: Quantitative RT-PCR, Expressing, Transfection, Binding Assay, Luciferase, Activity Assay, Incubation, Pull Down Assay

Downregulation of circ_0000512 repressed proliferation and facilitated apoptosis in CRC cells. ( A ) The abundance of circ_0000512 was examined by qRT-PCR in HCT116 and SW620 cells transfected with sh-NC, sh-circ#1, sh-circ#2, sh-circ#3. ( B – G ) HCT116 and SW620 cells were transfected with sh-NC or sh-circ#2. ( B ) Cell viability was assessed by CCK-8 analysis. ( C ) Colony formation assay was used to examine the number of colonies. ( D ) Flow cytometry was applied to determine the cell cycle distribution. ( E and F ) Flow cytometry analysis was utilized to measure the apoptosis rate. ( G ) The protein levels of Cyclin D1 and Cleaved Caspase-3 were examined by Western blot assay. * P
Figure Legend Snippet: Downregulation of circ_0000512 repressed proliferation and facilitated apoptosis in CRC cells. ( A ) The abundance of circ_0000512 was examined by qRT-PCR in HCT116 and SW620 cells transfected with sh-NC, sh-circ#1, sh-circ#2, sh-circ#3. ( B – G ) HCT116 and SW620 cells were transfected with sh-NC or sh-circ#2. ( B ) Cell viability was assessed by CCK-8 analysis. ( C ) Colony formation assay was used to examine the number of colonies. ( D ) Flow cytometry was applied to determine the cell cycle distribution. ( E and F ) Flow cytometry analysis was utilized to measure the apoptosis rate. ( G ) The protein levels of Cyclin D1 and Cleaved Caspase-3 were examined by Western blot assay. * P

Techniques Used: Quantitative RT-PCR, Transfection, CCK-8 Assay, Colony Assay, Flow Cytometry, Western Blot

Deficiency of circ_0000512 inhibited tumor growth by enhancing miR-296-5p and decreasing RUNX1. Sh-NC or sh-circ#2-transfected SW620 cells were introduced into nude mice to establish mice xenograft model. ( A and B ) Tumor volume and weight were measured. ( C and D ) The expression of circ_0000512 and miR-296-5p was analyzed by qRT-PCR in tumor tissues. ( E ) Western blot assay was used to determine the protein abundance of RUNX1 in tumor tissues. * P
Figure Legend Snippet: Deficiency of circ_0000512 inhibited tumor growth by enhancing miR-296-5p and decreasing RUNX1. Sh-NC or sh-circ#2-transfected SW620 cells were introduced into nude mice to establish mice xenograft model. ( A and B ) Tumor volume and weight were measured. ( C and D ) The expression of circ_0000512 and miR-296-5p was analyzed by qRT-PCR in tumor tissues. ( E ) Western blot assay was used to determine the protein abundance of RUNX1 in tumor tissues. * P

Techniques Used: Transfection, Mouse Assay, Expressing, Quantitative RT-PCR, Western Blot

Related Articles

SYBR Green Assay:

Article Title: The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia
Article Snippet: .. After extracting total RNA using TRIzol reagent, we detected miR-1-3p, its targets, and the internal references U6 and GAPDH using a PrimeScript miRNA RT-PCR Kit (TaKaRa, Dalian, China) or a standard SYBR-Green RT-PCR Kit (TaKaRa) according to the manufacturer's specifications. ..

Transfection:

Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

Isolation:

Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

Infection:

Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

Real-time Polymerase Chain Reaction:

Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis
Article Snippet: .. Reverse transcription was performed according to the instructions of PrimeScript™ RT reagent Kit (Takara). qRT‐PCR analysis was performed following the method outlined by the GoTaq® qPCR Master Mix kit (TaKaRa). ..

Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The reverse-transcribed RNA was primed with oligonucleotides specific for VEGFR1 (Flt-1) (forward: 5′–GGGCAGACTCTTGTCCTCAACT–3′ and reverse: 5′–CAGCTCATTTGCACCCTCGT–3′ ), VEGFR2 (Flk-1) (forward: 5′–GACTGTGGCGAAGTGTTTTTGA–3′ and reverse: 5′–GTGCAGGGGAGGGTTGGCGTAG–3′ ), and β-actin (forward: 5′–GTGCGGGACATCAAGGAGAA–3′ and reverse: 5′–AGGAAGGAGGGCTGGAAGAG–3′ ) (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

Quantitative RT-PCR:

Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis
Article Snippet: .. Reverse transcription was performed according to the instructions of PrimeScript™ RT reagent Kit (Takara). qRT‐PCR analysis was performed following the method outlined by the GoTaq® qPCR Master Mix kit (TaKaRa). ..

Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

miRNA RT:

Article Title: microRNA-153 Targets mTORC2 Component Rictor to Inhibit Glioma Cells
Article Snippet: .. For miRNA analysis, real-time PCR was performed using PrimeScript miRNA RT-PCR Kit (Takara) according to the manufacturer’s instructions. ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: microRNA-153 Targets mTORC2 Component Rictor to Inhibit Glioma Cells
Article Snippet: .. For miRNA analysis, real-time PCR was performed using PrimeScript miRNA RT-PCR Kit (Takara) according to the manufacturer’s instructions. ..

Article Title: The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia
Article Snippet: .. After extracting total RNA using TRIzol reagent, we detected miR-1-3p, its targets, and the internal references U6 and GAPDH using a PrimeScript miRNA RT-PCR Kit (TaKaRa, Dalian, China) or a standard SYBR-Green RT-PCR Kit (TaKaRa) according to the manufacturer's specifications. ..

Article Title: Effects and mechanism of aromatic aminoketone SY0916 on osteoclastic bone destruction
Article Snippet: .. SYBR® PrimeScriptTM RT-PCR kit was from Takara. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    TaKaRa quantitative real time pcr qrt pcr analysis total rna
    Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and <t>qRT-PCR.</t> Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.
    Quantitative Real Time Pcr Qrt Pcr Analysis Total Rna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative real time pcr qrt pcr analysis total rna/product/TaKaRa
    Average 92 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    quantitative real time pcr qrt pcr analysis total rna - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    90
    TaKaRa quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr
    <t>qRT-PCR</t> analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.
    Quantitative Reverse Transcription Qrt Pcr Analysis Quantitative Reverse Transcription Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    quantitative reverse transcription qrt pcr analysis quantitative reverse transcription pcr - by Bioz Stars, 2020-10
    90/100 stars
      Buy from Supplier

    94
    TaKaRa qrt pcr analysis
    Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and <t>qRT-PCR</t> analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale
    Qrt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/TaKaRa
    Average 94 stars, based on 455 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    Image Search Results


    Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and qRT-PCR. Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.

    Journal: PLoS ONE

    Article Title: Quantitative Proteomic Analysis of Wheat Seeds during Artificial Ageing and Priming Using the Isobaric Tandem Mass Tag Labeling

    doi: 10.1371/journal.pone.0162851

    Figure Lengend Snippet: Comparisons of the protein and mRNA expression patterns of three representative DEPs at four artificial ageing stages (WH98, WH50, WH20, and WH01) by iTRAQ and qRT-PCR. Solid lines represent mRNA expression patterns, and dotted lines represent protein expression patterns.

    Article Snippet: RNA isolation and quantitative real-time PCR (qRT-PCR) analysis Total RNA from wheat embryos of WH98, WH50, WH20, and WH01 were extracted by using RNAiso Plus reagent (Takara, Tokyo, Japan), and genomic DNA was removed by treating with DNase I (Takara) following the manufacturer’s protocol.

    Techniques: Expressing, Quantitative RT-PCR

    LncRNA DBH-AS1 is inactivated by p53 A. The potential p53-binding site upstream of DBH-AS1 predicted by JASPAR database. B. Western blot analysis showed the reduced levels of p53 protein in HepG2 cells and LO2 cells transfected with siRNAs. C. Reduced p53 mRNA expression by siRNAs in HepG2 cells and LO2 cells was shown by qRT-PCR. D. Expression of DBH-AS1 transcripts was quantified by qRT-PCR. Data shown are the mean ± SD of three independent experiments. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 is inactivated by p53 A. The potential p53-binding site upstream of DBH-AS1 predicted by JASPAR database. B. Western blot analysis showed the reduced levels of p53 protein in HepG2 cells and LO2 cells transfected with siRNAs. C. Reduced p53 mRNA expression by siRNAs in HepG2 cells and LO2 cells was shown by qRT-PCR. D. Expression of DBH-AS1 transcripts was quantified by qRT-PCR. Data shown are the mean ± SD of three independent experiments. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Binding Assay, Western Blot, Transfection, Expressing, Quantitative RT-PCR

    LncRNA DBH-AS1 induces cell-cycle progression in HCC cells A. HepG2 and SMMC-7721 cells with elevated DBH-AS1 expression were seeded on 96-well plates, and cell proliferation was examined by EdU immunofluorescence staining. Effect of DBH-AS1 knockdown on Hep3B and SK-Hep1 cell proliferation was also measured by EdU immunofluorescence staining. The graph on the right shows the percentage of EdU-positive nuclei. B. Cell-cycle analysis of HepG2 and SMMC-7721 cells overexpressing DBH-AS1 and Hep3B and SK-Hep1 cells with stably silenced DBH-AS1 expression. C. Proportion of cells in various phases of the cell cycle. D. - E. The relative expression levels of cell cycle associated genes, including CDK6, CCND1, CCNE1, P16, P21 and P27, were detected in HepG2 cells overexpressing DBH-AS1 and Hep3B cells with stably down-regulated DBH-AS1 expression by qRT-PCR D. and western blot with quantitative analysis E. . The results show the means ± SD from at least 3 separate experiments. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 induces cell-cycle progression in HCC cells A. HepG2 and SMMC-7721 cells with elevated DBH-AS1 expression were seeded on 96-well plates, and cell proliferation was examined by EdU immunofluorescence staining. Effect of DBH-AS1 knockdown on Hep3B and SK-Hep1 cell proliferation was also measured by EdU immunofluorescence staining. The graph on the right shows the percentage of EdU-positive nuclei. B. Cell-cycle analysis of HepG2 and SMMC-7721 cells overexpressing DBH-AS1 and Hep3B and SK-Hep1 cells with stably silenced DBH-AS1 expression. C. Proportion of cells in various phases of the cell cycle. D. - E. The relative expression levels of cell cycle associated genes, including CDK6, CCND1, CCNE1, P16, P21 and P27, were detected in HepG2 cells overexpressing DBH-AS1 and Hep3B cells with stably down-regulated DBH-AS1 expression by qRT-PCR D. and western blot with quantitative analysis E. . The results show the means ± SD from at least 3 separate experiments. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Expressing, Immunofluorescence, Staining, Cell Cycle Assay, Stable Transfection, Quantitative RT-PCR, Western Blot

    HBx induces the expression of lncRNA DBH-AS1 A. Ectopic re-expression of HBx was detected in Lv-HBx-transfected HepG2 and LO2 cells by qRT-PCR and western blot. β-actin was used as a loading control. B. The relative expression of lncRNA DBH-AS1 in HepG2 and LO2 cells re-expressing HBx compared with controls by qRT-PCR. Data are shown as the mean±SD based on at least three independent experiments. C. Comparison of levels of DBH-AS1 in HCC patients with and without HBV infection (independent t test). D. The correlation between DBH-AS1 transcript level and HBx mRNA level in 31 HCC tissues. The ΔCt values were subjected to Pearson correlation analysis. * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: HBx induces the expression of lncRNA DBH-AS1 A. Ectopic re-expression of HBx was detected in Lv-HBx-transfected HepG2 and LO2 cells by qRT-PCR and western blot. β-actin was used as a loading control. B. The relative expression of lncRNA DBH-AS1 in HepG2 and LO2 cells re-expressing HBx compared with controls by qRT-PCR. Data are shown as the mean±SD based on at least three independent experiments. C. Comparison of levels of DBH-AS1 in HCC patients with and without HBV infection (independent t test). D. The correlation between DBH-AS1 transcript level and HBx mRNA level in 31 HCC tissues. The ΔCt values were subjected to Pearson correlation analysis. * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: Expressing, Transfection, Quantitative RT-PCR, Western Blot, Infection

    LncRNA DBH-AS1 promotes HCC cell proliferation in vitro A. HepG2 and SMMC-7721 cells were infected with lentivirus carrying the DBH-AS1 gene, and HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 were screened by qRT-PCR. B. Short hairpin RNA against DBH-AS1 stably decreased the expression of DBH-AS1 in sh-DBH-AS1 Hep3B and SK-Hep1 cells compared with sh-control cells by qRT-PCR. C. After overexpression of DBH-AS1 in HepG2 and SMMC-7721 cells, the cell viability was assessed by CCK-8 assays daily for 3 days. D. Cell viability was assessed by CCK-8 assays daily for 3 days in Hep3B and SK-Hep1 cells with silenced DBH-AS1 expression. E. Colony formation assays were performed on HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 for 2 weeks. F. In vitro proliferative ability of Hep3B and SK-Hep1 cells was significantly decreased in DBH-AS1-suppressed cells compared to sh-control cells by colony formation assays. Data are presented as mean ± SD for at least three independent experiments, * P

    Journal: Oncotarget

    Article Title: HBx-related long non-coding RNA DBH-AS1 promotes cell proliferation and survival by activating MAPK signaling in hepatocellular carcinoma

    doi:

    Figure Lengend Snippet: LncRNA DBH-AS1 promotes HCC cell proliferation in vitro A. HepG2 and SMMC-7721 cells were infected with lentivirus carrying the DBH-AS1 gene, and HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 were screened by qRT-PCR. B. Short hairpin RNA against DBH-AS1 stably decreased the expression of DBH-AS1 in sh-DBH-AS1 Hep3B and SK-Hep1 cells compared with sh-control cells by qRT-PCR. C. After overexpression of DBH-AS1 in HepG2 and SMMC-7721 cells, the cell viability was assessed by CCK-8 assays daily for 3 days. D. Cell viability was assessed by CCK-8 assays daily for 3 days in Hep3B and SK-Hep1 cells with silenced DBH-AS1 expression. E. Colony formation assays were performed on HepG2 and SMMC-7721 cells stably overexpressing DBH-AS1 for 2 weeks. F. In vitro proliferative ability of Hep3B and SK-Hep1 cells was significantly decreased in DBH-AS1-suppressed cells compared to sh-control cells by colony formation assays. Data are presented as mean ± SD for at least three independent experiments, * P

    Article Snippet: RNA extraction and real-time quantitative PCR analysis (qRT-PCR) Total RNA was extracted from cultured cells or tissues using TRIzol Reagent (Takara, Dalian, China).

    Techniques: In Vitro, Infection, Stable Transfection, Quantitative RT-PCR, shRNA, Expressing, Over Expression, CCK-8 Assay

    qRT-PCR analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.

    Journal: Scientific Reports

    Article Title: Overexpression of the Eggplant (Solanum melongena) NAC Family Transcription Factor SmNAC Suppresses Resistance to Bacterial Wilt

    doi: 10.1038/srep31568

    Figure Lengend Snippet: qRT-PCR analysis of the expression of defense signaling genes in transgenic eggplants. Quantitative reverse-transcription PCR (qPCR) was performed using a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols. Triplicate qPCR reactions were performed for each sample and the relative gene expression data was analyzed using the 2 −ΔΔ Ct method. ( a ) qRT-PCR analysis of defense signaling genes in SmNAC oveexpressing plants. CK represents non-transgenic plants from the E-31 line, whereas 1–3 show the SmNAC overexpressing transgenic T 0 plants EGT 0–87 , EGT 0–145 , and EGT 0–204 , and 4–6 show the SmNAC overexpressing transgenic T 1 plants EGT 1–87 , EGT 1–145 , and EGT 1–204 . ( b ) qRT-PCR analysis of defense signaling genes in RNAi- SmNAC plants. CK represents non-transgenic plants from line E-32. 1–5 show the RNAi- SmNAC transgenic plants (T0) RNAi-1, RNAi-2, RNAi-3, RNAi-4, and RNAi-5.

    Article Snippet: Quantitative reverse-transcription (qRT-PCR) analysis Quantitative reverse-transcription PCR (qPCR) was performed using gene-specific primers ( ) and a SYBR Premix Ex Taq kit (TaKaRa, Dalian, China), following the manufacturer’s protocols.

    Techniques: Quantitative RT-PCR, Expressing, Transgenic Assay, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and qRT-PCR analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale

    Journal: BMC Genomics

    Article Title: Genome-wide identification and expression analysis of the NAC transcription factor family in tomato (Solanum lycopersicum) during aluminum stress

    doi: 10.1186/s12864-020-6689-7

    Figure Lengend Snippet: Expression profiles of the SlNAC genes under Al stress. a Hierachical clustering of expression profiles of SlNAC genes during Al stress. b Correlation of gene expression levels between RNA-Seq data and qRT-PCR analysis. Fifteen SlNACs potentially responding to Al were selected and subjected to qRT-PCR analysis using the same RNA as for RNA-Seq. Both x- and y-axes are shown in Log2 scale

    Article Snippet: For qRT-PCR analysis, one microgram of DNA-free RNA was transcribed into first strand cDNA by PrimeScriptTM RT Master Mix (TaKaRa).

    Techniques: Expressing, RNA Sequencing Assay, Quantitative RT-PCR