qiashredder column  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    QIAshredder
    Description:
    For simple and rapid homogenization of cell and tissue lysates Kit contents Qiagen QIAshredder 50 Disposable Cell lysate Homogenizers for use in Nucleic acid preps Caps For Simple and Rapid Homogenization of Cell and Tissue Lysates Replaces Syringe and needle Homogenization Reduces Loss of Sample Material Eliminates Cross contamination Between Samples Filters out Insoluble Debris and Reduces Viscosity Spin column Format QIAshredder Homogenizer Placed in a Collection Tube and Centrifuged Benefits Replaces syringe and needle homogenization Reduces loss of sample material Eliminates cross contamination between samples Filters out insoluble debris and reduces viscosity
    Catalog Number:
    79654
    Price:
    88
    Category:
    QIAshredder
    Buy from Supplier


    Structured Review

    Qiagen qiashredder column
    QIAshredder
    For simple and rapid homogenization of cell and tissue lysates Kit contents Qiagen QIAshredder 50 Disposable Cell lysate Homogenizers for use in Nucleic acid preps Caps For Simple and Rapid Homogenization of Cell and Tissue Lysates Replaces Syringe and needle Homogenization Reduces Loss of Sample Material Eliminates Cross contamination Between Samples Filters out Insoluble Debris and Reduces Viscosity Spin column Format QIAshredder Homogenizer Placed in a Collection Tube and Centrifuged Benefits Replaces syringe and needle homogenization Reduces loss of sample material Eliminates cross contamination between samples Filters out insoluble debris and reduces viscosity
    https://www.bioz.com/result/qiashredder column/product/Qiagen
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    qiashredder column - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "RNA Preservation Agents and Nucleic Acid Extraction Method Bias Perceived Bacterial Community Composition"

    Article Title: RNA Preservation Agents and Nucleic Acid Extraction Method Bias Perceived Bacterial Community Composition

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0121659

    Analysis of technical bias to perceived community composition. (A) NMDS of the 16S rRNA gene amplicon sequencing data based on a Bray-Curtis dissimilarity matrix generated after random subsampling of 2,800 sequences from each sample. Bars indicate the range of coordinates for the three replicate extractions/sequencing datasets per treatment. (B) Phylum level data (top 10 most abundant phyla, fractions of all reads). Number 1–3 between parentheses indicates the sequencing run from which each dataset is derived. APO combines three slightly different treatments that did not result in significantly different taxonomic representations ( S2 Fig .). Acronyms: Extraction protocols: APS (standard AllPrep protocol), APO (optimized AllPrep protocol), Enz (Enzymatic protocol), Bead (Bead-beating protocol); Preservation methods: NT (none), RL (RNAlater), RP (RNAprotect), BU (Qiagen Lysis Buffer RLT+); Other modifications: LYS (lysozyme), NQ (No QIAshredder column), TL (bead-beating with TissueLyser). Except for the APO samples, none of the Douglas Lake filters were preserved in RNA protection agents.
    Figure Legend Snippet: Analysis of technical bias to perceived community composition. (A) NMDS of the 16S rRNA gene amplicon sequencing data based on a Bray-Curtis dissimilarity matrix generated after random subsampling of 2,800 sequences from each sample. Bars indicate the range of coordinates for the three replicate extractions/sequencing datasets per treatment. (B) Phylum level data (top 10 most abundant phyla, fractions of all reads). Number 1–3 between parentheses indicates the sequencing run from which each dataset is derived. APO combines three slightly different treatments that did not result in significantly different taxonomic representations ( S2 Fig .). Acronyms: Extraction protocols: APS (standard AllPrep protocol), APO (optimized AllPrep protocol), Enz (Enzymatic protocol), Bead (Bead-beating protocol); Preservation methods: NT (none), RL (RNAlater), RP (RNAprotect), BU (Qiagen Lysis Buffer RLT+); Other modifications: LYS (lysozyme), NQ (No QIAshredder column), TL (bead-beating with TissueLyser). Except for the APO samples, none of the Douglas Lake filters were preserved in RNA protection agents.

    Techniques Used: Amplification, Sequencing, Generated, Derivative Assay, Preserving, Lysis

    Related Articles

    Functional Assay:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: DNA sequencing was carried out at the Functional Genomics and Proteomics Laboratory of the University of Birmingham. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Amplification:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 200 ng RNA were used to generate cyanine 3 (Cy3) cRNA with the aid of Low RNA Input Linear Amplification kit, one-color (Agilent Technologies, Wilmington, De) according to the manufacturer's instructions.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit. .. Each sample was amplified in duplicate and target transcripts were normalized to Gapdh mRNA as an internal control.

    Quantitative RT-PCR:

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: Assessment of viremia and viral shedding Mononuclear cells were isolated from blood, biopsy specimens, throat washings and urine according to protocol, and viral replication quantitative RT-PCR to determine virus RNA copy number was done. ( ) Peripheral blood was collected in PAXgene tubes. .. RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder.

    Article Title: Capsular Polysaccharide Interferes with Biofilm Formation by Pasteurella multocida Serogroup A
    Article Snippet: Paragraph title: RNA extraction, PCR, qRT-PCR, and BLAST analysis. ... RNA was isolated with Qiagen RNAprotect bacterial reagent, Qiagen QiaShredder, and Qiagen RNeasy kits (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions for prokaryotic RNA.

    Real-time Polymerase Chain Reaction:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: Paragraph title: RNA isolation, Sybr Green, and Taqman real0time quantitative PCR. ... RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit. .. Real time qPCR was performed using Applied Biosystem 7900HT Fast Real-Time PCR System, FastStart Universal Probe Master (Rox) and the following Taqman primer probe sets (Applied Biosystems): GAPDH-FAM (Mm99999915_g1), Bcl2-FAM (Mm00477631_m1), Bim or Bcl2l11-FAM (Mm00437796_m1), FasL-FAM (Mm00438864_m1), and Fas-FAM (Mm01204974_m1).

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: Paragraph title: Real-time Polymerase Chain Reaction (RT-PCR) ... RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA).

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Paragraph title: Quantitative PCR ... Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    Article Title: Capsular Polysaccharide Interferes with Biofilm Formation by Pasteurella multocida Serogroup A
    Article Snippet: RNA was isolated with Qiagen RNAprotect bacterial reagent, Qiagen QiaShredder, and Qiagen RNeasy kits (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions for prokaryotic RNA. .. RNA was transcribed into cDNA with the Quanta qScript kit (Quanta Biosciences, Gaithersburg, MD) in accordance with the manufacturer’s instructions. qRT-PCR was performed on an Applied Biosciences 7300 real-time PCR system (Applied Biosystems, Foster City, CA) with the Quanta SYBR FastMix kit (Quanta Biosciences, Gaithersburg, MD) in accordance with the manufacturer’s instructions.

    Microarray:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Paragraph title: Microarray and analysis ... Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

    Incubation:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Gene expression analysis in Ect1/E6E7 cells Cultured Ect1/E6E7 cells were incubated with dilutions of GRFT, GRFTLec- , CV-N, ConA, or vehicle only (PBS, pH 7.4) for 16 hours. .. The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Cell Culture:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Gene expression analysis in Ect1/E6E7 cells Cultured Ect1/E6E7 cells were incubated with dilutions of GRFT, GRFTLec- , CV-N, ConA, or vehicle only (PBS, pH 7.4) for 16 hours. .. The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: Paragraph title: Cell culture, adenovirus infection, and RT-PCR ... For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions.

    Expressing:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: Paragraph title: Gene expression analysis in Ect1/E6E7 cells ... The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Quantitative PCR Thymocyte subsets from Cxcr4 f l/fl , Lck-Cre+ Cxcr4 +/+ or, Lck-Cre+ Cxcr4 fl/fl mice were electronically sorted based on CD3, CD4, CD8, c-kit, CD44, and CD25 surface expression after gating out cells expressing hematopoietic lineage markers (CD11b, CD11c, B220, Ly6G, Ter119). .. Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    Derivative Assay:

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Three hES-MC (B4, E22h, and E28h) derived independently from hESC were grown as described. .. Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions.

    Hybridization:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Transfection:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: HEK293FT cells at 90% confluence were transfected with endotoxin-free DNA using Lipofectamine 2000 (Invitrogen) following the manufacturer protocol. .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Infection:

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: Paragraph title: Cell culture, adenovirus infection, and RT-PCR ... For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions.

    other:

    Article Title: Whole transcriptome responses among females of the filariasis and arbovirus vector mosquito Culex pipiens implicate TGF-β signaling and chromatin modification as key drivers of diapause induction
    Article Snippet: Total RNA was extracted from pools of 10 pupae using the Qiagen Qiashredder and RNeasy Extraction Kits (Qiagen).

    DNA Sequencing:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: DNA sequencing was carried out at the Functional Genomics and Proteomics Laboratory of the University of Birmingham. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Polymerase Chain Reaction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: PCR experiments were performed using Phusion high-fidelity DNA polymerase (F530-L; New England BioLabs) or 1× ReddyMix PCR master mix (Ab-0575; Thermo Scientific). .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. Primers specific to necdin (forward: gctggtgcagaaggcgcacga, reverse: gctggtacttcaggtaattc) were used to amplify a 455bp fragment by PCR (Tm = 58, 35 cycles).

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. The PCR product was gel purified and sequenced to determine splice junctions.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    Article Title: Capsular Polysaccharide Interferes with Biofilm Formation by Pasteurella multocida Serogroup A
    Article Snippet: Paragraph title: RNA extraction, PCR, qRT-PCR, and BLAST analysis. ... RNA was isolated with Qiagen RNAprotect bacterial reagent, Qiagen QiaShredder, and Qiagen RNeasy kits (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions for prokaryotic RNA.

    DNA Extraction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Isolation:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: .. RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions. .. Real-time PCR was performed as previously described ( , ) using Sybr Green Fast Universal mix or Taqman Fast Universal Mixes from Applied Biosystems.

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder. .. Subsequently, RNA was isolated using Qiagen's RNeasy minikit and RNase-Free DNase set in accordance with the manufacturer's instructions.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: Assessment of viremia and viral shedding Mononuclear cells were isolated from blood, biopsy specimens, throat washings and urine according to protocol, and viral replication quantitative RT-PCR to determine virus RNA copy number was done. ( ) Peripheral blood was collected in PAXgene tubes. .. RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder.

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: .. RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. Genomic DNA was digested with DNase I (Invitrogen, Carlsbad, CA).

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: .. Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. Total sample RNA was labeled with Cy3 and Universal Human Reference RNA control (#740000; Strategene, Santa Clara, CA) was labeled with Cy5.

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Paragraph title: RNA Isolation ... Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol.

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Paragraph title: mRNA Isolation and cDNA Synthesis ... Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    Article Title: Capsular Polysaccharide Interferes with Biofilm Formation by Pasteurella multocida Serogroup A
    Article Snippet: .. RNA was isolated with Qiagen RNAprotect bacterial reagent, Qiagen QiaShredder, and Qiagen RNeasy kits (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions for prokaryotic RNA. .. RNA was transcribed into cDNA with the Quanta qScript kit (Quanta Biosciences, Gaithersburg, MD) in accordance with the manufacturer’s instructions. qRT-PCR was performed on an Applied Biosciences 7300 real-time PCR system (Applied Biosystems, Foster City, CA) with the Quanta SYBR FastMix kit (Quanta Biosciences, Gaithersburg, MD) in accordance with the manufacturer’s instructions.

    Multiplex Assay:

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Labeling:

    Article Title: Investigation of Griffithsin's Interactions with Human Cells Confirms Its Outstanding Safety and Efficacy Profile as a Microbicide Candidate
    Article Snippet: The cells were lysed using a Qiagen Qiashredder, and total RNA was extracted using a Qiagen RNeasy Mini Kit. .. 1.65 ug of each labeled cRNA sample were fragmented at 60°C for 30 min using an Agilent Gene Expression Hybridization kit (Agilent Technologies, Wilmington, De) followed by hybridization to a whole human genome Agilent oligonucleotide slide containing four high-definition 44 K microarray (Agilent Technologies, Wilmington, De) at 65°C for 17 hours.

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. Total sample RNA was labeled with Cy3 and Universal Human Reference RNA control (#740000; Strategene, Santa Clara, CA) was labeled with Cy5.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Paragraph title: RNA purification, amplification, labeling and hybridization ... Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA.

    Purification:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Q-PCR analysis Purified CD4+ T cells from Itpkb +/+ and Itpkb fl/fl mice were stimulated for 0, 2 or 6 hrs with anti-mouse CD3/28 beads (Invitrogen, 2:1 bead to cell ratio). .. Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit.

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: .. Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA. .. The integrity and concentration of the isolated total RNA was confirmed by analysis on an Agilent Bioanalyzer.

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. The PCR product was gel purified and sequenced to determine splice junctions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder. .. RNA was quantified using NanoDrop prior to cDNA synthesis using SuperScript II reverse transcriptase and random hexamers (Invitrogen) and prior to reverse transcriptase (RT)-PCR using Taq polymerase and primers D3 and RT1.

    Article Title: Phase I Trial of Systemic Administration of Edmonston Strain of Measles Virus, Genetically Engineered to Express the Sodium Iodide Symporter in Patients with Recurrent or Refractory Multiple Myeloma
    Article Snippet: RNA was extracted using the Qiagen RNeasy Total RNA Kit and Qiagen QIAshredder. .. Q-RT-PCR was done using primers, the TaqMan One-step RT-PCR Master Mix Reagents Kit. (Applied Biosystems,Foster City, CA), on a Stratagene MX4000 Multiplex Quantitative PCR System – a spectrophotometric thermocycler (Stratagene, LaJolla, CA).

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: Paragraph title: Real-time Polymerase Chain Reaction (RT-PCR) ... RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA).

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. Combined first-strand cDNA/PCR (Invitrogen SuperScript III One-Step RT-PCR) was performed with the following reaction conditions and primers (all sequences 5′ - > 3′ ): oG: 50°C × 30 min, 94°C × 2 min followed by 40 cycles of 94°C × 20 s, 50°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. TVA-mCherry: 55°C × 30 min, 94°C × 2 min, followed by 40 cycles 94°C × 20 s, 55°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. oG primers: Exon 1 Forward (1F): gctatgaggaaagcctgcac; Exon 1 Reverse (1R): gtgcaggctttcctcatagc; Exon 2 Forward (2F): aagagcgtgagcttcag gag; Exon 2 Reverse (2R): ctcctgaagctcacgctctt.

    Article Title: A thrombospondin-dependent pathway for a protective ER stress response
    Article Snippet: .. For reverse transcriptase PCR (RT-PCR), RNA was isolated from either tissue or cells using the Qiagen fibrous tissue kit coupled with the Qiagen QIAShredder according to manufacturer instructions. .. Invitrogen SuperScript III One-Step RT-PCR system then used to make cDNA before PCR.

    Mouse Assay:

    Article Title: Inhibition of the Inositol Kinase Itpkb Augments Calcium Signaling in Lymphocytes and Reveals a Novel Strategy to Treat Autoimmune Disease
    Article Snippet: Q-PCR analysis Purified CD4+ T cells from Itpkb +/+ and Itpkb fl/fl mice were stimulated for 0, 2 or 6 hrs with anti-mouse CD3/28 beads (Invitrogen, 2:1 bead to cell ratio). .. Cells were removed from the plate and total RNA was extracted using the Qiagen QIAshredder and RNeasy Kit.

    Article Title: CXCR4 acts as a costimulator during thymic ? selection
    Article Snippet: Quantitative PCR Thymocyte subsets from Cxcr4 f l/fl , Lck-Cre+ Cxcr4 +/+ or, Lck-Cre+ Cxcr4 fl/fl mice were electronically sorted based on CD3, CD4, CD8, c-kit, CD44, and CD25 surface expression after gating out cells expressing hematopoietic lineage markers (CD11b, CD11c, B220, Ly6G, Ter119). .. Total RNA was then extracted using the Qiagen Qiashredder and RNeasy kit.

    RNA Extraction:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: Five days post-transfection, RNA extraction was performed (QIAGEN RNeasy Mini). .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder).

    Article Title: Effect of Topical Microbicides on Infectious Human Immunodeficiency Virus Type 1 Binding to Epithelial Cells ▿
    Article Snippet: Paragraph title: RNA extraction. ... Cells were lysed using RNeasy lysis buffer (QIAGEN, Valencia, CA), homogenized with the QIAGEN QIAshredder, and extracted using the RNeasy protocol with optional DNase digestion.

    Article Title: Capsular Polysaccharide Interferes with Biofilm Formation by Pasteurella multocida Serogroup A
    Article Snippet: Paragraph title: RNA extraction, PCR, qRT-PCR, and BLAST analysis. ... RNA was isolated with Qiagen RNAprotect bacterial reagent, Qiagen QiaShredder, and Qiagen RNeasy kits (Qiagen, Hilden, Germany) in accordance with the manufacturer’s instructions for prokaryotic RNA.

    Plasmid Preparation:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Software:

    Article Title: Microvascular Mural Cell Functionality of Human Embryonic Stem Cell-Derived Mesenchymal Cells
    Article Snippet: Confluent cultures were prepared for total RNA isolation using Qiagen Qiashredder and RNeasy kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. .. The samples and control were added to Agilent Human Whole Genome microarray (G4112A) and the array data extracted using Agilent G2567AA Feature Extraction Software v9.5 (Agilent Technologies, Santa Clara, CA).

    SYBR Green Assay:

    Article Title: Hedgehog Signaling in Pancreas Epithelium Regulates Embryonic Organ Formation and Adult ?-Cell Function
    Article Snippet: Paragraph title: RNA isolation, Sybr Green, and Taqman real0time quantitative PCR. ... RNA from isolated islets and microdissected pancreatic buds was prepared according to the Qiagen Qiashredder and RNAEasy Micro protocols. cDNA was transcribed according to BioRad iScript Kit instructions.

    Negative Control:

    Article Title: Necdin and Neurotrophin Receptors: Interactors of Relevance for Neuronal Resistance to Oxidant Stress
    Article Snippet: RNA was isolated from pellets containing 3 × 106 cells using the Qiagen RNeasy Mini Kit and Qiagen QIAshredder (Valencia, CA). .. The reverse transcriptase reaction was performed using the SuperScript III First-Strand Synthesis System (Invitrogen) with or without (negative control) reverse transcriptase.

    Agarose Gel Electrophoresis:

    Article Title: SadA, a Trimeric Autotransporter from Salmonella enterica Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ Serovar Typhimurium, Can Promote Biofilm Formation and Provides Limited Protection against Infection ▿ †
    Article Snippet: Plasmid DNA isolation, genomic DNA isolation, PCR product purification, and agarose gel extractions were performed with the relevant kits from Qiagen according to the manufacturer's instructions. .. To obtain RNA, either bacterial cultures were harvested in the presence of Qiagen RNAprotect bacterial reagent or spleen sections were homogenized using a Qiagen QIAshredder.

    Spectrophotometry:

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol. .. RNA concentration and purity was determined through measurement of A260/A280 ratios with the Spectronic Genesys 6 UV/Vis Spectrophotometer (Thermo Electron).

    Concentration Assay:

    Article Title: Evaluation of Genetic Variation Contributing to Differences in Gene Expression between Populations
    Article Snippet: Cell pellets were thawed and total RNA was extracted with QIAGEN Qiashredder and RNeasy plus kits (QIAGEN) according to the manufacturer's protocol. .. RNA concentration and purity was determined through measurement of A260/A280 ratios with the Spectronic Genesys 6 UV/Vis Spectrophotometer (Thermo Electron).

    Article Title: Genomic Analysis of Reactive Astrogliosis
    Article Snippet: Qiagen Qiashredder and microeasy spin columns were used to lyse purified astrocyte populations and to purify their total RNA. .. The integrity and concentration of the isolated total RNA was confirmed by analysis on an Agilent Bioanalyzer.

    Lysis:

    Article Title: Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs
    Article Snippet: .. Cells were disrupted with lysis buffer and homogenized (QIAGEN QiaShredder). .. Combined first-strand cDNA/PCR (Invitrogen SuperScript III One-Step RT-PCR) was performed with the following reaction conditions and primers (all sequences 5′ - > 3′ ): oG: 50°C × 30 min, 94°C × 2 min followed by 40 cycles of 94°C × 20 s, 50°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. TVA-mCherry: 55°C × 30 min, 94°C × 2 min, followed by 40 cycles 94°C × 20 s, 55°C × 30 s, 68°C × 1.5 min, ending with 68°C × 5 min. oG primers: Exon 1 Forward (1F): gctatgaggaaagcctgcac; Exon 1 Reverse (1R): gtgcaggctttcctcatagc; Exon 2 Forward (2F): aagagcgtgagcttcag gag; Exon 2 Reverse (2R): ctcctgaagctcacgctctt.

    Article Title: Effect of Topical Microbicides on Infectious Human Immunodeficiency Virus Type 1 Binding to Epithelial Cells ▿
    Article Snippet: .. Cells were lysed using RNeasy lysis buffer (QIAGEN, Valencia, CA), homogenized with the QIAGEN QIAshredder, and extracted using the RNeasy protocol with optional DNase digestion. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Qiagen qiashredder spin column
    View of threshold (Ct) values derived from real-time PCR. Ct values were compared among PCR amplifications using three preparation methods and two primer sets. In each of 11 Las-infected citrus leaf samples, real-time PCR using Las606/LSS and OI1/OI2c primer sets with templates obtained from Extracted DNA , Biomasher-pellet , and <t>QIAshredder-pellet</t> was performed to derive each Ct value. The numbers in each graph are Ct values.
    Qiashredder Spin Column, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiashredder spin column/product/Qiagen
    Average 95 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    qiashredder spin column - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    View of threshold (Ct) values derived from real-time PCR. Ct values were compared among PCR amplifications using three preparation methods and two primer sets. In each of 11 Las-infected citrus leaf samples, real-time PCR using Las606/LSS and OI1/OI2c primer sets with templates obtained from Extracted DNA , Biomasher-pellet , and QIAshredder-pellet was performed to derive each Ct value. The numbers in each graph are Ct values.

    Journal: PLoS ONE

    Article Title: Convenient Detection of the Citrus Greening (Huanglongbing) Bacterium 'Candidatus Liberibacter asiaticus' by Direct PCR from the Midrib Extract

    doi: 10.1371/journal.pone.0057011

    Figure Lengend Snippet: View of threshold (Ct) values derived from real-time PCR. Ct values were compared among PCR amplifications using three preparation methods and two primer sets. In each of 11 Las-infected citrus leaf samples, real-time PCR using Las606/LSS and OI1/OI2c primer sets with templates obtained from Extracted DNA , Biomasher-pellet , and QIAshredder-pellet was performed to derive each Ct value. The numbers in each graph are Ct values.

    Article Snippet: However, when the preparation using QIAshredder spin column will be modified, the sensitivity of detection may be improved.

    Techniques: Derivative Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Infection

    Study concept . (A) Total RNA of each of the first 24 samples had been extracted following three different total RNA purification methods A, B, and C. Method A: lysis of the mononuclear cells, followed by lysate homogenization (to reduce viscosity caused by high-molecular-weight cellular components and cell debris) using a biopolymer shredding system in a microcentrifuge spin-column format (QIAshredder, Qiagen) followed by total RNA purification (RNeasy Mini Kit, Qiagen). Method B: TRIzol RNA isolation (Invitrogen). Method C: TRIzol RNA isolation (Invitrogen) followed by an RNeasy purification step (RNeasy Mini Kit, Qiagen). The RNA purification step combines the selective binding properties of a silica-based membrane with the speed of microspin technology. It allows only RNA longer than 200 bases to bind to the silica membrane, providing an enriching for mRNA since nucleotides shorter than 200 nucleotides are selectively excluded. (B) For each of three additional samples, nine aliquots of mononuclear cells had been collected. Total RNA has been processed for each aliquot following one of the three methods and for each method three independent technical replicates were performed (A,A,A, B,B,B, C,C,C).

    Journal: BMC Genomics

    Article Title: New data on robustness of gene expression signatures in leukemia: comparison of three distinct total RNA preparation procedures

    doi: 10.1186/1471-2164-8-188

    Figure Lengend Snippet: Study concept . (A) Total RNA of each of the first 24 samples had been extracted following three different total RNA purification methods A, B, and C. Method A: lysis of the mononuclear cells, followed by lysate homogenization (to reduce viscosity caused by high-molecular-weight cellular components and cell debris) using a biopolymer shredding system in a microcentrifuge spin-column format (QIAshredder, Qiagen) followed by total RNA purification (RNeasy Mini Kit, Qiagen). Method B: TRIzol RNA isolation (Invitrogen). Method C: TRIzol RNA isolation (Invitrogen) followed by an RNeasy purification step (RNeasy Mini Kit, Qiagen). The RNA purification step combines the selective binding properties of a silica-based membrane with the speed of microspin technology. It allows only RNA longer than 200 bases to bind to the silica membrane, providing an enriching for mRNA since nucleotides shorter than 200 nucleotides are selectively excluded. (B) For each of three additional samples, nine aliquots of mononuclear cells had been collected. Total RNA has been processed for each aliquot following one of the three methods and for each method three independent technical replicates were performed (A,A,A, B,B,B, C,C,C).

    Article Snippet: Method A: lysis of the mononuclear cells, followed by lysate homogenization using a biopolymer shredding system in a microcentrifuge spin-column format (QIAshredder, Qiagen, Hilden, Germany), followed by total RNA purification using selective binding columns (RNeasy Mini Kit, Qiagen).

    Techniques: Purification, Lysis, Homogenization, Molecular Weight, Isolation, Binding Assay

    Analysis of technical bias to perceived community composition. (A) NMDS of the 16S rRNA gene amplicon sequencing data based on a Bray-Curtis dissimilarity matrix generated after random subsampling of 2,800 sequences from each sample. Bars indicate the range of coordinates for the three replicate extractions/sequencing datasets per treatment. (B) Phylum level data (top 10 most abundant phyla, fractions of all reads). Number 1–3 between parentheses indicates the sequencing run from which each dataset is derived. APO combines three slightly different treatments that did not result in significantly different taxonomic representations ( S2 Fig .). Acronyms: Extraction protocols: APS (standard AllPrep protocol), APO (optimized AllPrep protocol), Enz (Enzymatic protocol), Bead (Bead-beating protocol); Preservation methods: NT (none), RL (RNAlater), RP (RNAprotect), BU (Qiagen Lysis Buffer RLT+); Other modifications: LYS (lysozyme), NQ (No QIAshredder column), TL (bead-beating with TissueLyser). Except for the APO samples, none of the Douglas Lake filters were preserved in RNA protection agents.

    Journal: PLoS ONE

    Article Title: RNA Preservation Agents and Nucleic Acid Extraction Method Bias Perceived Bacterial Community Composition

    doi: 10.1371/journal.pone.0121659

    Figure Lengend Snippet: Analysis of technical bias to perceived community composition. (A) NMDS of the 16S rRNA gene amplicon sequencing data based on a Bray-Curtis dissimilarity matrix generated after random subsampling of 2,800 sequences from each sample. Bars indicate the range of coordinates for the three replicate extractions/sequencing datasets per treatment. (B) Phylum level data (top 10 most abundant phyla, fractions of all reads). Number 1–3 between parentheses indicates the sequencing run from which each dataset is derived. APO combines three slightly different treatments that did not result in significantly different taxonomic representations ( S2 Fig .). Acronyms: Extraction protocols: APS (standard AllPrep protocol), APO (optimized AllPrep protocol), Enz (Enzymatic protocol), Bead (Bead-beating protocol); Preservation methods: NT (none), RL (RNAlater), RP (RNAprotect), BU (Qiagen Lysis Buffer RLT+); Other modifications: LYS (lysozyme), NQ (No QIAshredder column), TL (bead-beating with TissueLyser). Except for the APO samples, none of the Douglas Lake filters were preserved in RNA protection agents.

    Article Snippet: The lysate was transferred to a QIAshredder column (Qiagen) and the remainder of the protocol was performed according to the manufacturer’s instructions, performing two elution steps with of 30 μl elution buffer for both RNA and DNA.

    Techniques: Amplification, Sequencing, Generated, Derivative Assay, Preserving, Lysis