qiaquick gel extraction kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Qiagen qiaquick gel extraction kit
    Qiaquick Gel Extraction Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 8351 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick gel extraction kit/product/Qiagen
    Average 99 stars, based on 8351 article reviews
    Price from $9.99 to $1999.99
    qiaquick gel extraction kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: .. The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. 2 µl of the In-Fusion reaction was transformed into Stellar chemically competent cells as per the manufacturers protocol (Clontech) and selected on LB agar containing 100 μg/mL ampicillin.

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The 5 UTR of Dv serotype 2, New Guinea C strain was amplified by PCR using the primers BamH1-2.5Dv-5 (s) (CGGGATCCCAGTAATACGACTCACTATTAGTTGTTAG-TCTACGTGGACC) and EcoR1-Dv-351(as) (GGAATTCGGTGGTGCA-GATGAACTTCAG), and cloned in the pUC18 (Fermentas) plasmid using a standard BamH1/EcoR1 restriction-ligation procedure generating the pUC18-2.5-Dv351 plasmid. .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique For absolute and relative quantification of the target gene expression, target and reference genes were PCR-amplified from cDNA preparations using primers listed in Table 1 , cloned, and used to generate standard curves. .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions.

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Paragraph title: Construction of an infectious IBV clone, introduction of mutations into the clones and rescue of recombinant viruses ... Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    Amplification:

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: The mixtures were amplified in 40 cycles of 94 C for 1 min, 50 C for 1 min and 72 C for 1 min and a final extension at 72 C for 10 min in an automated thermal cycler (PerkineElmer Cetus, Gouda, The Netherlands). .. The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany).

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The RNA transcription template was synthesized by PCR amplification performed on the pUC18-2.5-Dv351 plasmid using the primers BamH1-2.5Dv-5 (s) and Dv-351(as) (GGTGGTGCAGATGAACTTCAGGG). .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: .. PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen). .. To obtain additional sequence, an internal reverse primer was designed (primer RooRev TAGTTCTGCCTCGGAGGGTGACGGT) and used in the second round with DFA.

    Article Title: Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The bands were excised and purified using the QIAquick gel extraction kit (Qiagen).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: For the preparation of the standards, relevant fragments were amplified using standard PCR conditions. .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions.

    Positive Control:

    Article Title: A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.
    Article Snippet: The PCR products with correct target size were purified using QIAquick Gel Extraction Kit (Qiagen). .. During the set up of the assays, we initialy used SARS-CoV cDNA as a positive control for RdRp assay and gene-synthesised fragment for Spike assay.

    Synthesized:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The RNA transcription template was synthesized by PCR amplification performed on the pUC18-2.5-Dv351 plasmid using the primers BamH1-2.5Dv-5 (s) and Dv-351(as) (GGTGGTGCAGATGAACTTCAGGG). .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    TA Cloning:

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Construct:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. The final construct with a T7 RNA polymerase promoter and in-frame amino-terminal HSV and carboxyl-terminal HIS tags was verified by Sanger sequencing (Source Bioscience) of plasmid DNA purified using a QIAquick spin miniprep kit (Qiagen).

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: To enable secretion, all HE constructs maintained their own signal peptide (amino acids 1-16). .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers.

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: Paragraph title: Preparation of constructs as standards ... To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Electrophoresis:

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.). .. The final ligation products were extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated with ethanol and detected by electrophoresis on 0.4% agarose gels.

    Incubation:

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany). .. Methods of laboratory investigation For hMPV culture, FRhK-4 cell monolayers in culture tubes were inoculated with 200 ml of NPS and the cells were maintained in serum free medium MEM (minimal essential medium) with trypsin (2.5 mg/ml), and incubated at 35 C for up to 14 days.

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The reaction products obtained after a 48 h incubation period were purified by reverse phase chromatography in HPLC. .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Infection:

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Briefly, five fragments spanning the entire IBV genome were obtained by RT-PCR from Vero cells infected with the Vero cell-adapted IBV p65. .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    Expressing:

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique For absolute and relative quantification of the target gene expression, target and reference genes were PCR-amplified from cDNA preparations using primers listed in Table 1 , cloned, and used to generate standard curves. .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions.

    Transformation Assay:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. 2 µl of the In-Fusion reaction was transformed into Stellar chemically competent cells as per the manufacturers protocol (Clontech) and selected on LB agar containing 100 μg/mL ampicillin.

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    High Performance Liquid Chromatography:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The reaction products obtained after a 48 h incubation period were purified by reverse phase chromatography in HPLC. .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Ligation:

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.). .. The final ligation products were extracted with phenol/chloroform/isoamyl alcohol (25:24:1), precipitated with ethanol and detected by electrophoresis on 0.4% agarose gels.

    Cell Culture:

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Generated:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen). .. The Dv 1-351 RNA substrate was generated by in vitro transcription using the MEGAshortscript T7 RNA polymerase (Ambion) that recognizes the T7 class II 2.5 promoter (underlined in primer) present in the PCR template and initiates RNA synthesis by pppAG (Coleman et al., 2004) .

    Polymerase Chain Reaction:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: .. The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. 2 µl of the In-Fusion reaction was transformed into Stellar chemically competent cells as per the manufacturers protocol (Clontech) and selected on LB agar containing 100 μg/mL ampicillin.

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany). .. Both strands of the PCR products were sequenced twice with an ABI Prism 3700 DNA Analyzer (Applied Biosystems, Foster City, CA, USA), using the PCR primers.

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen). .. The Dv 1-351 RNA substrate was generated by in vitro transcription using the MEGAshortscript T7 RNA polymerase (Ambion) that recognizes the T7 class II 2.5 promoter (underlined in primer) present in the PCR template and initiates RNA synthesis by pppAG (Coleman et al., 2004) .

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.
    Article Snippet: .. The PCR products with correct target size were purified using QIAquick Gel Extraction Kit (Qiagen). .. Both strands of PCR products were sequenced with an ABI 3500xl Dx Genetic Analyzer (Applied Biosystems) using the PCR primers.

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The bands were excised and purified using the QIAquick gel extraction kit (Qiagen).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Subsequently, fragment A was removed from pCR-XL-TOPO by digestion with NheI and EcoRI, and subcloned into pKT0 vector. .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    DNA Sequencing:

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen). .. Direct sequencing was performed using the Big-Dye Terminator Kit (Perki-nElmer, Branchburg, NJ) and analyzed on ABI 377 automated DNA sequencers at the University of Florida Center for Mammalian Genetics DNA Sequencing Facilities.

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted plasmids were screened using EcoR1 restriction enzyme (Invitrogen, Burlington, ON, Canada) and the positive clones were submitted to the University of Calgary's Automated DNA Sequencing Services to be sequenced.

    Sequencing:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. The final construct with a T7 RNA polymerase promoter and in-frame amino-terminal HSV and carboxyl-terminal HIS tags was verified by Sanger sequencing (Source Bioscience) of plasmid DNA purified using a QIAquick spin miniprep kit (Qiagen).

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: This shows a clear sequence similarity between part of the ISAV HE signal peptide and the structural templates. .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers.

    Article Title: A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.
    Article Snippet: The PCR products with correct target size were purified using QIAquick Gel Extraction Kit (Qiagen). .. All positive results were confirmed by Sanger sequencing.

    Article Title: Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus.
    Article Snippet: RNA was prepared as follows: conventional RT-PCR was carried out with primers 3 and 4 (Table 1 ; Primer 3 was identical to the forward primer used for PriProET, except a specific T7 promoter sequence, that was added to its 5 end) on the three viral RNA samples (prepared with QIAmp Viral RNA Mini Kit), using Qiagen One-Step RT-PCR Kit (Qiagen, Hilden, Germany) at 52 • C annealing temperature. .. The amplicons were gel purified using the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: .. PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen). .. To obtain additional sequence, an internal reverse primer was designed (primer RooRev TAGTTCTGCCTCGGAGGGTGACGGT) and used in the second round with DFA.

    Article Title: Detection of multiple viral sequences in the respiratory tract samples of suspected Middle East respiratory syndrome coronavirus patients in Jakarta, Indonesia 2015-2016.
    Article Snippet: .. Purification of PCR products was performed using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol, followed by PCR sequencing and precipitation reaction before loading into an ABI 3130 sequencer. .. Sequencing results were analyzed using Geneious Software R8 version 8.1 and were compared with sequences in the GenBank database.

    Article Title: Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The bands were excised and purified using the QIAquick gel extraction kit (Qiagen).

    Recombinant:

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. The recombinant transfer plasmids with the correct inserts were named pBACgus-1-sHE4 and pBACgus-1-sHE7.

    Article Title: Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus.
    Article Snippet: Sensitivity and specificity of the assay The sensitivity of the system was determined by using known amounts of recombinant RNA prepared from the Lelystad virus, the Ingelvac MLV ® , and the Belarus strain. .. The amplicons were gel purified using the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Paragraph title: Construction of an infectious IBV clone, introduction of mutations into the clones and rescue of recombinant viruses ... Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    Immunofluorescence:

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany). .. They were examined daily for cytopathic effect (CPE), immunofluorescence done on fixed cell smears when CPE appeared or at the end of the incubation period.

    Mutagenesis:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. Site-directed mutagenesis was carried out using the Quikchange II (Agilent) reagents and protocol.

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: Paragraph title: Construction of transfer plasmids and site-directed mutagenesis ... The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers.

    Isolation:

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen).

    Purification:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. The final construct with a T7 RNA polymerase promoter and in-frame amino-terminal HSV and carboxyl-terminal HIS tags was verified by Sanger sequencing (Source Bioscience) of plasmid DNA purified using a QIAquick spin miniprep kit (Qiagen).

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen). .. The Dv 1-351 RNA substrate was generated by in vitro transcription using the MEGAshortscript T7 RNA polymerase (Ambion) that recognizes the T7 class II 2.5 promoter (underlined in primer) present in the PCR template and initiates RNA synthesis by pppAG (Coleman et al., 2004) .

    Article Title: A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.
    Article Snippet: .. The PCR products with correct target size were purified using QIAquick Gel Extraction Kit (Qiagen). .. Both strands of PCR products were sequenced with an ABI 3500xl Dx Genetic Analyzer (Applied Biosystems) using the PCR primers.

    Article Title: Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus.
    Article Snippet: .. The amplicons were gel purified using the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany). .. The purified DNA samples were transcribed to RNA using MEGAscript ® T7 Kit (Ambion, Austin, TX, USA).

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Detection of multiple viral sequences in the respiratory tract samples of suspected Middle East respiratory syndrome coronavirus patients in Jakarta, Indonesia 2015-2016.
    Article Snippet: .. Purification of PCR products was performed using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol, followed by PCR sequencing and precipitation reaction before loading into an ABI 3130 sequencer. .. Sequencing results were analyzed using Geneious Software R8 version 8.1 and were compared with sequences in the GenBank database.

    Article Title: Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
    Article Snippet: .. The bands were excised and purified using the QIAquick gel extraction kit (Qiagen). .. Direct sequencing was performed using the Big-Dye Terminator Kit (PerkinElmer, Branchburg, NJ) and the above second-round primers, and analyzed on ABI 3130 automated DNA sequencers at the University of Florida Interdisciplinary Center for Biotechnology Research Sequencing Facilities.

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: A 267-bp fragment of the polymerase gene of hMPV was amplified by RT-PCR using primers (LPW 4764 5 0 -TGGTGYCARAARYTMTGGACA-3 0 and LPW 4765 5 0 -AAAYT GRAGATCYCTTGATATATA-3 0 ). .. The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany).

    Article Title: Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus.
    Article Snippet: RNA was prepared as follows: conventional RT-PCR was carried out with primers 3 and 4 (Table 1 ; Primer 3 was identical to the forward primer used for PriProET, except a specific T7 promoter sequence, that was added to its 5 end) on the three viral RNA samples (prepared with QIAmp Viral RNA Mini Kit), using Qiagen One-Step RT-PCR Kit (Qiagen, Hilden, Germany) at 52 • C annealing temperature. .. The amplicons were gel purified using the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany).

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Briefly, five fragments spanning the entire IBV genome were obtained by RT-PCR from Vero cells infected with the Vero cell-adapted IBV p65. .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    Gel Extraction:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: .. The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. 2 µl of the In-Fusion reaction was transformed into Stellar chemically competent cells as per the manufacturers protocol (Clontech) and selected on LB agar containing 100 μg/mL ampicillin.

    Article Title: Human metapneumovirus infection in an immunocompetent adult presenting as mononucleosis-like illness.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick gel extraction kit (QIAgen, Hilden, Germany). .. Both strands of the PCR products were sequenced twice with an ABI Prism 3700 DNA Analyzer (Applied Biosystems, Foster City, CA, USA), using the PCR primers.

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen). .. The Dv 1-351 RNA substrate was generated by in vitro transcription using the MEGAshortscript T7 RNA polymerase (Ambion) that recognizes the T7 class II 2.5 promoter (underlined in primer) present in the PCR template and initiates RNA synthesis by pppAG (Coleman et al., 2004) .

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster.
    Article Snippet: .. The PCR products with correct target size were purified using QIAquick Gel Extraction Kit (Qiagen). .. Both strands of PCR products were sequenced with an ABI 3500xl Dx Genetic Analyzer (Applied Biosystems) using the PCR primers.

    Article Title: Development of a one-step real-time quantitative PCR assay based on primer-probe energy transfer for the detection of porcine reproductive and respiratory syndrome virus.
    Article Snippet: .. The amplicons were gel purified using the QiaQuick Gel Extraction kit (Qiagen, Hilden, Germany). .. The purified DNA samples were transcribed to RNA using MEGAscript ® T7 Kit (Ambion, Austin, TX, USA).

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Characterization of an outbreak of astroviral diarrhea in a group of cheetahs (Acinonyx jubatus).
    Article Snippet: .. The bands were excised and purified using the QIAquick gel extraction kit (Qiagen). .. Direct sequencing was performed using the Big-Dye Terminator Kit (PerkinElmer, Branchburg, NJ) and the above second-round primers, and analyzed on ABI 3130 automated DNA sequencers at the University of Florida Interdisciplinary Center for Biotechnology Research Sequencing Facilities.

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.). ..

    Nested PCR:

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: Nested PCR amplification of a partial sequence of the DNAdependent-DNA polymerase gene was performed using previously described methods (VanDevanter et al., 1996) . .. PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen).

    Plasmid Preparation:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech). .. The final construct with a T7 RNA polymerase promoter and in-frame amino-terminal HSV and carboxyl-terminal HIS tags was verified by Sanger sequencing (Source Bioscience) of plasmid DNA purified using a QIAquick spin miniprep kit (Qiagen).

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The RNA transcription template was synthesized by PCR amplification performed on the pUC18-2.5-Dv351 plasmid using the primers BamH1-2.5Dv-5 (s) and Dv-351(as) (GGTGGTGCAGATGAACTTCAGGG). .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Article Title: Structural and functional analysis of the hemagglutinin-esterase of infectious salmon anaemia virus.
    Article Snippet: .. The PCR products were gel-purified using the QIAquick ® Gel Extraction Kit (Qiagen), cloned into the pCR ® 2.1-TOPO vector (Invitrogen), subcloned into the SacI/XhoI sites of the pBACgus-1 transfer plasmid (Novagen), and transformed into Escherichia coli XL10-Gold ® Ultracompetent cells (Stratagene), according to protocols pro-vided by the manufacturers. .. Plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen).

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Article Title: Formation of stable homodimer via the C-terminal alpha-helical domain of coronavirus nonstructural protein 9 is critical for its function in viral replication.
    Article Snippet: Subsequently, fragment A was removed from pCR-XL-TOPO by digestion with NheI and EcoRI, and subcloned into pKT0 vector. .. Bands corresponding to each of the fragments were cut from the gels and purified with QIAquick gel extraction kit (QIAGEN Inc.).

    Software:

    Article Title: Detection of multiple viral sequences in the respiratory tract samples of suspected Middle East respiratory syndrome coronavirus patients in Jakarta, Indonesia 2015-2016.
    Article Snippet: Purification of PCR products was performed using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol, followed by PCR sequencing and precipitation reaction before loading into an ABI 3130 sequencer. .. Sequencing results were analyzed using Geneious Software R8 version 8.1 and were compared with sequences in the GenBank database.

    Reversed-phase Chromatography:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: The reaction products obtained after a 48 h incubation period were purified by reverse phase chromatography in HPLC. .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Agarose Gel Electrophoresis:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: .. The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen). .. The Dv 1-351 RNA substrate was generated by in vitro transcription using the MEGAshortscript T7 RNA polymerase (Ambion) that recognizes the T7 class II 2.5 promoter (underlined in primer) present in the PCR template and initiates RNA synthesis by pppAG (Coleman et al., 2004) .

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. Plasmid DNA was purified using the GeneElute plasmid miniprep kit (Sigma).

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: .. Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    In Vitro:

    Article Title: Flaviviral methyltransferase/RNA interaction: structural basis for enzyme inhibition.
    Article Snippet: Paragraph title: In vitro synthesis of capped RNA ... The PCR reaction product was purified on agarose gel using the QIAquick gel extraction kit (Qiagen).

    Quantitation Assay:

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: Preparation of constructs as standards For quantitation of CRCoV in clinical samples CRCoV nucleocapsid gene was amplified, cloned, and used to generate the standard curve. .. To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega).

    Colony Assay:

    Article Title: Induction of innate immune response following infectious bronchitis corona virus infection in the respiratory tract of chickens.
    Article Snippet: Conventional PCR technique Preparation of constructs as standards PCR products were ran at 100 V for 1 h and 15 min on a 1.5% agarose gel and extracted using QIAquick Gel Extraction Kit (Qiagen Inc.) according to the manufacturer's instructions. .. The extracted DNA was then cloned into the pCR s 2.1-TOPO s vector and amplified through transformation of One Shot s Escherichia (E.) coli, followed by blue/white colony screening (TOPO TA Cloning kit Top 10, Invitrogen, Burlington, ON, Canada).

    Produced:

    Article Title: Description and initial characterization of metatranscriptomic nidovirus-like genomes from the proposed new family Abyssoviridae, and from a sister group to the Coronavirinae, the proposed genus Alphaletovirus.
    Article Snippet: Protein assays Nucleotides 12926-14176 containing the AAbV M pro and flanking regions extending to the preceding and following predicted transmembrane regions was produced as a synthetic GeneArt Strings DNA fragment (Invitrogen). .. The 1283 bp PCR product was gel extracted using a QIAquick gel extraction kit (Qiagen) and cloned into pTriEx1.1 (Novagen/Merck) linearised with XhoI using In-Fusion HD cloning reagents (Clontech).

    Concentration Assay:

    Article Title: Development of a quantitative real-time PCR for the detection of canine respiratory coronavirus.
    Article Snippet: To prepare the standard control plasmid the 140 bp fragment of the CRCoV nucleocapsid gene was amplified from cell culture grown virus using the primers CRCoV NF3 and CRCoV NR4 and the following cycling conditions: 95 • C 1 min followed by 35 cycles of 95 • C 1 min, 45 • C for 40 s, 72 • C for 1 min, with a final extension of 72 • C for 10 min. PCR products were eluted from the agarose gel using the Qiaquick gel extraction kit (Qiagen) and cloned into the pGem ® -T Easy vector (Promega). .. DNA concentration of the plasmid preparation was determined and the copy number calculated using the following formula: (DNA concentration in g/l × 6.0233 × 10 23 copies/mol)/(DNA size (bp) × 660 × 10 6 ).

    Virus Isolation Assay:

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: PCR amplification and sequencing Virus isolation results marked with ''Co'' were negative for herpesvirus, but positive for a coronavirus. .. PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen).

    Direct Fluorescent Antibody Test:

    Article Title: Identification and isolation of a novel herpesvirus in a captive mob of eastern grey kangaroos (Macropus giganteus).
    Article Snippet: Briefly, the first round of amplification utilized forward primers DFA (5 0 -GAYTTYGCNA-GYYTNTAYCC-3 0 , Y = pyrimidine, N = nucleotide) and ILK (5 0 -TCCTGGACAAGCAGCARNYSG-CNMTNAA-3 0 , R = purine, M = A or C) and reverse primer PCR amplification utilized forward primer TGV (5 0 -TGTAACTCGGTGTAYGGNTTYACNGG-NGT-3 0 ) and reverse primer IYG (5 0 -CACAGAGT-CCGTRTCNCCRTADAT-3 0 , D = A, G, or T). .. PCR amplification and sequencing 94 8C for 5 min, followed by 45 cycles of denaturation at 94 8C for 30 s, annealing at 46 8C for 60 s, DNA extension at 72 8C for 60 s, and a final extension step at 72 8C for 7 min. Products were resolved on 1% agarose gels and bands of the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen qiaquick gel extractin kit
    Qiaquick Gel Extractin Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiaquick gel extractin kit/product/Qiagen
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    qiaquick gel extractin kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Qiagen no 114391 5g qiaquick gel extractio kit
    No 114391 5g Qiaquick Gel Extractio Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/no 114391 5g qiaquick gel extractio kit/product/Qiagen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    no 114391 5g qiaquick gel extractio kit - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results