qiaprep spin miniprep kit  (Qiagen)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    QIAprep Spin Miniprep Kit
    Description:
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    Catalog Number:
    27104
    Price:
    92.8
    Category:
    QIAprep Spin Miniprep Kit
    Buy from Supplier


    Structured Review

    Qiagen qiaprep spin miniprep kit
    QIAprep Spin Miniprep Kit
    For purification of up to 20 μg molecular biology grade plasmid DNA Kit contents Qiagen QIAprep Spin Miniprep Kit 50 preps 1 to 100mL Culture Volume 50L Elution Volume Molecular Biology Grade Plasmid DNA Purification Silica Technology Spin Column Format Manual Processing 30 min Time Run 20g Yield Ideal for Fluorescent and Radioactive Sequencing Ligation Cloning Transformation etc For Purification of up to 20μg Molecular Biology Grade Plasmid DNA Includes 50 QIAprep Spin Columns Reagents Buffers 2mL Collection Tubes Benefits Ready to use plasmid DNA in minutes Reproducible yields of molecular biology grade plasmid DNA Single protocol for high and low copy vectors Even higher yields with the High Yield Supplementary Protocol Improved QIAprep 2 0 Spin Column GelPilot loading dye for convenient sample analysis
    https://www.bioz.com/result/qiaprep spin miniprep kit/product/Qiagen
    Average 99 stars, based on 2131 article reviews
    Price from $9.99 to $1999.99
    qiaprep spin miniprep kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿"

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.03050-09

    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).
    Figure Legend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Techniques Used: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    2) Product Images from "Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides"

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    Journal: Journal of Biomolecular Techniques : JBT

    doi:

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,
    Figure Legend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Techniques Used: DNA Sequencing, Mutagenesis, Isolation, Labeling

    3) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    4) Product Images from "Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex"

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-11-599

    Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.
    Figure Legend Snippet: Isolation of the KS14 plasmid prophage . DNA was isolated using a QIAprep Spin Miniprep plasmid isolation kit (Qiagen) and digested with EcoRI (Invitrogen). Lane 1: 1 Kb Plus DNA ladder (Invitrogen), lane 2: B. cenocepacia C6433, lane 3: B. multivorans ATCC 17616, lane 4: B. cenocepacia CEP511 lane 5: B. cenocepacia K56-2, lane 6: blank, lane 7: 1 Kb Plus DNA ladder, lane 8: KS14-resistant C6433 isolate I, lane 9: KS14-resistant C6433 isolate II, lane 10: KS14-resistant C6433 isolate III, lane 11: KS14-resistant C6433 isolate IV, lane 12: KS14-resistant C6433 isolate V. The size of the markers (in kbp) is shown on the left. A KS14 EcoRI DNA digest and the size of the bands predicted for this digest ( > 1 kbp in size) are shown on the far right.

    Techniques Used: Isolation, Plasmid Preparation

    Related Articles

    Nucleic Acid Electrophoresis:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Selection:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Agarose Gel Electrophoresis:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Synthesized:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Isolation:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Construct:

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. Following blue-white selection on LB solid medium containing 100 μg/ml ampicillin, constructs with phage DNA inserts were isolated using a QIAprep Spin Miniprep kit (Qiagen), digested using EcoRI and viewed using gel electrophoresis. .. Inserts were sequenced with the assistance of the University of Alberta Department of Biological Sciences Molecular Biology Service Unit using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA).

    Purification:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Isolation of Predation-Deficient Mutants of Bdellovibrio bacteriovorus by Using Transposon Mutagenesis ▿
    Article Snippet: .. The plasmid pRL27 was purified from E. coli BW20767 using the QIAprep spin miniprep kit (Qiagen, Valencia, CA) and stored at 4°C. .. Frozen cultures of E. coli BW20767 kept at −75°C were streaked onto fresh L agar-Km plates and incubated overnight.

    Produced:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Modification:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Clone Assay:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Staining:

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Polymerase Chain Reaction:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Gel Extraction:

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine
    Article Snippet: .. NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050). .. Klenow fragment (3′→5′ exo−; NEB, cat. no. M0212L) Quick ligation kit (NEB, cat. no. M2200L) TruSeq DNA sample preparation kit (Illumina, cat. no. FC-121-2001) MethylCode bisulfite conversion kit (Invitrogen, cat. no. MECOV-50) PfuTurbo Cx hotstart DNA polymerase (Agilent, cat. no. 600410) Acetonitrile (CH3 CN; Fisher Scientific, cat. no. A9984) Triethylammonium acetate, 1 M solution (TEAA; Calbiochem, cat. no. 625718) Liquid nitrogen S-Adenosylmethionine

    Transformation Assay:

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability
    Article Snippet: .. Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells. .. After plating on agar plates containing IPTG and X-Gal (Sigma-Aldrich), numbers of white and blue colonies were counted.

    Recombinant:

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Plasmid Preparation:

    Article Title: Use of Nonionic Surfactants for Improvement of Terpene Production in Saccharomyces cerevisiae
    Article Snippet: .. Plasmid was isolated from strains that produced high titers of bisabolene by a modified version of the QIAprep Spin Miniprep kit protocol (Qiagen, Valencia, CA). .. Following centrifugation of 1.5 ml of culture and resuspension of cells in 250 μl of P1 buffer, 250 μl of P2 buffer was added along with enough 0.5-mm-diameter acid-washed glass beads to reach the surface of the liquid.

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability
    Article Snippet: .. Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells. .. After plating on agar plates containing IPTG and X-Gal (Sigma-Aldrich), numbers of white and blue colonies were counted.

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿
    Article Snippet: .. Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels. .. Gels were observed in a UV light box and photographed using GeneScan software.

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides
    Article Snippet: .. For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA). .. This methodology requires methylated parental DNA, which is the case for most commonly utilized E. coli strains.

    Article Title: Genomic analysis and relatedness of P2-like phages of the Burkholderia cepacia complex
    Article Snippet: .. KS14 plasmid prophage DNA was isolated from five putatively lysogenized KS14-resistant C6433 isolates [ ] using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany). .. Lysogeny was predicted using PCR with KS14-specifc primers (KS14F: GCAGCTAACCGAGTCGCACG, KS14R: CTCTGAAAAGGTGGGCGGTGG) (Sigma-Genosys, Oakville, ON) and TopTaq DNA polymerase and buffers (Qiagen).

    Article Title: Isolation of Predation-Deficient Mutants of Bdellovibrio bacteriovorus by Using Transposon Mutagenesis ▿
    Article Snippet: .. The plasmid pRL27 was purified from E. coli BW20767 using the QIAprep spin miniprep kit (Qiagen, Valencia, CA) and stored at 4°C. .. Frozen cultures of E. coli BW20767 kept at −75°C were streaked onto fresh L agar-Km plates and incubated overnight.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen post transfection
    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after <t>transfection</t> by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p
    Post Transfection, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 2287 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/post transfection/product/Qiagen
    Average 99 stars, based on 2287 article reviews
    Price from $9.99 to $1999.99
    post transfection - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of NHEJ in MM cells. (A) Map of pEGFP-Pem1-Ad2 modified from reference [ 36 ]. (B) Dot plots of nontransfected LINF903 cells (panel 1), LINF903 cells transfected with 2 μg pDSRed2-N1 (panel 2), with 0.5 μg of pEGFP-Pem1 (panel 3), or with both plasmids together (panel 4). Numbers of green and red cells were determined 24h after transfection by FACS. (C) Dot plots of LINF903 and U266 cell lines transfected with 0.5 μg of pEGFP-Pem1 or 0.5 μg of Hind III-digested pEGFP-Pem1-Ad2 plasmid, together with 2 μg of pDSRed2-N1. Total represented events were adjusted to correct for differences in transfection efficiencies, and same numbers of cells transfected with circular and/or control pDSRed2-N1 are shown (6,000 cells). These numbers of events were then represented in panels corresponding to transfections with digested molecules. (D) Percentage of NHEJ of Hind III - or Sce I -digested plasmid in different cell lines. Mean of a minimum of three independent experiments is shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Non-Homologous End Joining, Modification, Transfection, FACS, Plasmid Preparation

    Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Journal: PLoS ONE

    Article Title: Deregulation of DNA Double-Strand Break Repair in Multiple Myeloma: Implications for Genome Stability

    doi: 10.1371/journal.pone.0121581

    Figure Lengend Snippet: Analysis of HR in normal LINF and MM cell lines. (A) Reporter plasmid for detection of HR [ 22 ]. (B) Cells were transfected with 2 μg of Sce I-digested HR plasmid together with 2 μg of pDSRed2-N1 to normalize for the differences in transfection efficiency. Numbers of green and red cells were determined 48h after transfection by FACS. The ratio of GFP+ cells to DsRed+ cells was used as a measure of repair efficiency. Data are means ± SD of three independent experiments. (C) Representative images showing dot plots corresponding to the indicated cell lines. A total of 6,000 GFP+ and/or DsRed+ cells are shown. (** p

    Article Snippet: Plasmid DNA was extracted from the cells 24h post-transfection [QIAprep spin miniprep kit (Qiagen, Germany)], and transformed into E . coli DH5α cells.

    Techniques: Plasmid Preparation, Transfection, FACS

    Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Journal: Applied and Environmental Microbiology

    Article Title: Biocidal Efficacy of Copper Alloys against Pathogenic Enterococci Involves Degradation of Genomic and Plasmid DNAs ▿

    doi: 10.1128/AEM.03050-09

    Figure Lengend Snippet: Agarose gel electrophoresis of purified enterococcal DNA. (A) Purified genomic DNA of E. faecium NCTC 12202. Lane 2, cells not exposed to metal surfaces; lane 3, cells exposed to stainless steel for 2 h; lane 4, cells exposed to copper for 2 h; lane 5, cells exposed to copper for 4 h. (B) Purified genomic DNA of clinical isolates E. faecium 5 (lanes 7 and 8) and E. faecalis 2 (lanes 9 and 10) exposed to stainless steel (lanes 7 and 9) or copper (lanes 8 and 10) for 2 h at 22°C. (C) Purified plasmid DNA of E. faecium NCTC 12202 not exposed to metal (lane 11) or exposed to stainless steel (lane 12) or copper (lane 13) for 2 h at 22°C. Control lanes are Bioline Hyperladder I (lanes 1) and Hyperladder II (lanes 6). Genomic DNA was purified using the Qiagen DNeasy Blood and Tissue kit (2% agarose) and the Qiaprep Spin Miniprep kit for plasmid DNA (0.9% agarose).

    Article Snippet: Enterococcal DNA (50-kb fragments) were purified using the Qiagen DNeasy Blood and Tissue kit (following pretreatment with lysozyme), and preparations were separated on a 1, 2, or 3% (wt/vol) agarose gel containing the DNA stain SYBRsafe (Invitrogen) exposed to a current of 300 mA for 90 min. Plasmid DNA was extracted using the QIAprep Spin Miniprep kit (Qiagen), and preparations were separated on 0.9% agarose gels.

    Techniques: Agarose Gel Electrophoresis, Purification, Plasmid Preparation

    Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Journal: Nature protocols

    Article Title: Tet-assisted bisulfite sequencing of 5-hydroxymethylcytosine

    doi: 10.1038/nprot.2012.137

    Figure Lengend Snippet: Overview of Tet-assisted bisulfite sequencing (TAB-seq). 5-hmC is protected specifically by β-GT to generate 5-gmC, followed by oxidation of 5-mC to 5-caC by mTet1. Only 5-gmC is read as C after bisulfite treatment and PCR amplification.

    Article Snippet: NaCl (Fisher BioReagents, cat. no. BP358-10; dissolved in H2 O at 2 M) l -Ascorbic acid (Sigma-Aldrich, cat. no. 255564; dissolved in H2 O at 40 mM) DTT (Roche Diagnostics, cat. no. 93889320; dissolved in H2 O at 50 mM) Disodium salt ATP (Fisher BioReagents, cat. no. BP413-25; dissolved in H2 O at 24 mM) α-Ketoglutaric acid disodium salt hydrate (α-KG; Sigma-Aldrich, cat. no. K3752; dissolved in H2 O at 20 mM) Tet oxidation reagent 1 (Reagent Setup) Tet oxidation reagent 2 (Reagent Setup) Micro Bio-Spin 30 columns (Bio-Rad, cat. no. 7326203) Proteinase K (Fermentas, cat. no. EO0491) QIAquick gel extraction kit (Qiagen, cat. no. 28704) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) 5-mC_test_F, 5-mC_test_R, 5-hmC_test_F, 5-hmC_test_F (synthesized by Operon; ) QIAprep spin miniprep kit (Qiagen, cat. no. 27104) Zero Blunt TOPO PCR cloning kit (Invitrogen, cat. no. K2800-20) End-It DNA end-repair kit (Epicentre, cat. no. ER81050).

    Techniques: Methylation Sequencing, Polymerase Chain Reaction, Amplification

    DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Journal: Journal of Biomolecular Techniques : JBT

    Article Title: Efficient Site-Directed Saturation Mutagenesis Using Degenerate Oligonucleotides

    doi:

    Figure Lengend Snippet: DNA sequencing of a site-directed mutagenesis library. DNA was isolated from the library using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA), and sequenced using an infrared dye–labeled primer on a LI-COR Model 4200 Automated Sequencer (Lincoln,

    Article Snippet: For starting template, we utilized a recombinant plasmid (approximately 6.5 kb) isolated using a QIAGEN QIAprep Spin Miniprep Kit (Valencia, CA).

    Techniques: DNA Sequencing, Mutagenesis, Isolation, Labeling