qiagen pcr cloning kit  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    QIAGEN PCR Cloning Kit
    For direct cloning of PCR products generated by Taq DNA polymerases Kit contents Qiagen PCR Cloning Kit 10 rxns For Direct Cloning of PCR Products Generated by Taq DNA Polymerases pDrive Cloning Vector Just 40 min from PCR Product to Plated Cells Ready to use Ligation Master Mix High specificity UA Hybridization for Efficient Cloning Includes 2x Ligation Master Mix 50L pDrive Cloning Vector 0 5g Distilled Water 1 7mL Benefits Just 40 minutes from PCR product to plated cells Ready to use Ligation Master Mix High specificity UA hybridization for efficient cloning Immediate plating of transformed competent cells
    Catalog Number:
    QIAGEN PCR Cloning Kit
    Buy from Supplier

    Structured Review

    Qiagen qiagen pcr cloning kit
    QIAGEN PCR Cloning Kit
    For direct cloning of PCR products generated by Taq DNA polymerases Kit contents Qiagen PCR Cloning Kit 10 rxns For Direct Cloning of PCR Products Generated by Taq DNA Polymerases pDrive Cloning Vector Just 40 min from PCR Product to Plated Cells Ready to use Ligation Master Mix High specificity UA Hybridization for Efficient Cloning Includes 2x Ligation Master Mix 50L pDrive Cloning Vector 0 5g Distilled Water 1 7mL Benefits Just 40 minutes from PCR product to plated cells Ready to use Ligation Master Mix High specificity UA hybridization for efficient cloning Immediate plating of transformed competent cells
    https://www.bioz.com/result/qiagen pcr cloning kit/product/Qiagen
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    qiagen pcr cloning kit - by Bioz Stars, 2020-04
    99/100 stars


    Related Articles

    Clone Assay:

    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: .. PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Chemically competent E. coli Top10 cells (Life Technologies) were transformed by heat-shock with ligated plasmid, and were grown overnight at 37°C on LB agar plates with 100 mg/ml ampicillin selection.

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced. ..

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively. ..

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen). .. Sequencing was performed by GENEWIZ and BaseClear, and the resulting sequence data were analyzed using Sequencher software (Gene Codes).

    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)
    Article Snippet: .. Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD). ..

    Article Title: Characterization of a novel Entamoeba histolytica strain from Burkina Faso, Africa, possessing a unique hexokinase-2 gene
    Article Snippet: .. The amplified SREHP and GPI genes were cloned using the QIAGEN PCR Cloning Kit (Qiagen GmbH, Hilden, Germany). .. In PCR amplifications targeting the HXK , GPI , PGM , and ME genes, LATaq DNA polymerase (Takara Bio Inc.) was used with the following cycle conditions: denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min. All PCR products from the examined E. histolytica strains were sequenced using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 3130 Genetic Analyzer.

    Article Title: Ancient Microbes from Halite Fluid Inclusions: Optimized Surface Sterilization and DNA Extraction
    Article Snippet: .. Cloning and DNA Sequencing Purified ITS1 PCR products were cloned using Qiagen PCR cloning kits following the manufacturer's protocols. .. A subset of colonies per sample was purified and cycle sequenced using ABI's BigDye® Terminator v3.1 system, followed by sequencing on a 96 capillary ABI 3730xl genetic analyzer.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load. ..

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. Ligated plasmids were then transformed into TOP10 chemically competent Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions.


    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: In order to successfully and cleanly amplify through the bisulfite-converted CGG repeats, we used two rounds of amplification with a nested primer set (first round: F: GAGGGAACAGCGTTGATCACGTG R: CACTTAACACCAATTTCAACCCTTCCCACC ; second round: F: GGAACAGCGTTGATCACGTGACGTGGTTTC R: CTTCCCTCCCAACAACATCCCACCAAAC ). .. PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit.

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: Similarly, the 3'-end was amplified using two pairs of nested gene-specific and 3'-adaptor-specific primers. .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced.

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: A B. leachi cytoplasmic actin cDNA fragment of 338 bp was cloned from cDNA of B. leachi colonies and amplified using the following primers (forward: GAAATCGTGCGTGACATCAAAG; reverse: GCGGTGATTCCCTTCTGCATAC). .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively.

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Y′ telomeres and telomere VI-R were amplified by PCR as previously described ( ; ). .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen).

    Article Title: Characterization of a novel Entamoeba histolytica strain from Burkina Faso, Africa, possessing a unique hexokinase-2 gene
    Article Snippet: .. The amplified SREHP and GPI genes were cloned using the QIAGEN PCR Cloning Kit (Qiagen GmbH, Hilden, Germany). .. In PCR amplifications targeting the HXK , GPI , PGM , and ME genes, LATaq DNA polymerase (Takara Bio Inc.) was used with the following cycle conditions: denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min. All PCR products from the examined E. histolytica strains were sequenced using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 3130 Genetic Analyzer.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: Amplification and detection of RNA from virus isolates or clinical specimens were performed using the GeneAmp® 5700 Sequence Detection System (Applied Biosystems). .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load.

    Positive Control:

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: Nuclease-free water was used as negative control and a plasmid containing the N gene of hMPV (kindly provided by James Simon, VIRONOVATIVE, EUR Holding, Erasmus University Rotterdam) was used as a positive control in all PCR runs. .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load.

    Polymerase Chain Reaction:

    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: .. PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Chemically competent E. coli Top10 cells (Life Technologies) were transformed by heat-shock with ligated plasmid, and were grown overnight at 37°C on LB agar plates with 100 mg/ml ampicillin selection.

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced. ..

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively. ..

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen). .. Sequencing was performed by GENEWIZ and BaseClear, and the resulting sequence data were analyzed using Sequencher software (Gene Codes).

    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)
    Article Snippet: .. Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD). ..

    Article Title: Characterization of a novel Entamoeba histolytica strain from Burkina Faso, Africa, possessing a unique hexokinase-2 gene
    Article Snippet: .. The amplified SREHP and GPI genes were cloned using the QIAGEN PCR Cloning Kit (Qiagen GmbH, Hilden, Germany). .. In PCR amplifications targeting the HXK , GPI , PGM , and ME genes, LATaq DNA polymerase (Takara Bio Inc.) was used with the following cycle conditions: denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min. All PCR products from the examined E. histolytica strains were sequenced using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 3130 Genetic Analyzer.

    Article Title: Ancient Microbes from Halite Fluid Inclusions: Optimized Surface Sterilization and DNA Extraction
    Article Snippet: .. Cloning and DNA Sequencing Purified ITS1 PCR products were cloned using Qiagen PCR cloning kits following the manufacturer's protocols. .. A subset of colonies per sample was purified and cycle sequenced using ABI's BigDye® Terminator v3.1 system, followed by sequencing on a 96 capillary ABI 3730xl genetic analyzer.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load. ..

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. Ligated plasmids were then transformed into TOP10 chemically competent Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)
    Article Snippet: .. Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD). ..

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load. ..


    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: Two independent assessors (TN and KY) graded each sample using a modified Mankin scale [ , ]. .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced.

    Transformation Assay:

    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Chemically competent E. coli Top10 cells (Life Technologies) were transformed by heat-shock with ligated plasmid, and were grown overnight at 37°C on LB agar plates with 100 mg/ml ampicillin selection.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. Ligated plasmids were then transformed into TOP10 chemically competent Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions.

    Derivative Assay:

    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..


    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: As only full-length RNAs carried a 5'-phosphate group, the adaptor was expected to ligate exclusively to full-length mRNAs, while the dephosphorylated other RNAs were not able to undergo a ligation reaction. .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced.

    Ligand Binding Assay:

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: A cDNA fragment of 808 bp was amplified using degenerate oligonucleotide primers (forward: GGVTGYAAGGGITTCTT; reverse: TTCATVAKCATYTTIGGGAA) directed against two conserved regions of the ligand-binding domain of hormone receptors present in all RARs. .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively.

    Cell Culture:

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. White colonies were selected and cultured in 2 mL LB media containing 100 mg/mL ampicillin overnight at 37 °C, and plasmid DNA was isolated with a miniprep kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    DNA Sequencing:

    Article Title: Ancient Microbes from Halite Fluid Inclusions: Optimized Surface Sterilization and DNA Extraction
    Article Snippet: .. Cloning and DNA Sequencing Purified ITS1 PCR products were cloned using Qiagen PCR cloning kits following the manufacturer's protocols. .. A subset of colonies per sample was purified and cycle sequenced using ABI's BigDye® Terminator v3.1 system, followed by sequencing on a 96 capillary ABI 3730xl genetic analyzer.


    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Plasmid DNA PCR clones were sequenced (Davis Sequencing, Davis, CA) with M13R or SP6 primers, depending on orientation of the PCR insert.

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: Paragraph title: Sequence analysis ... 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced.

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: A B. leachi Raldh cDNA fragment of 337 bp was cloned from cDNA of regenerating blood vessels and amplified using sequence specific primers (forward: AGAATTTCCTTGGAGCTTGG; reverse: ACCCTGTTCAATGTCGCTG). .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively.

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Paragraph title: Telomere PCR and sequencing ... Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen).

    Article Title: Characterization of a novel Entamoeba histolytica strain from Burkina Faso, Africa, possessing a unique hexokinase-2 gene
    Article Snippet: Paragraph title: PCR and sequence analysis ... The amplified SREHP and GPI genes were cloned using the QIAGEN PCR Cloning Kit (Qiagen GmbH, Hilden, Germany).

    Article Title: Ancient Microbes from Halite Fluid Inclusions: Optimized Surface Sterilization and DNA Extraction
    Article Snippet: Cloning and DNA Sequencing Purified ITS1 PCR products were cloned using Qiagen PCR cloning kits following the manufacturer's protocols. .. A subset of colonies per sample was purified and cycle sequenced using ABI's BigDye® Terminator v3.1 system, followed by sequencing on a 96 capillary ABI 3730xl genetic analyzer.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: Amplification and detection of RNA from virus isolates or clinical specimens were performed using the GeneAmp® 5700 Sequence Detection System (Applied Biosystems). .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load.

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Paragraph title: PCR, cloning, and sequencing ... Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    DNA Extraction:

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Yeast genomic DNA was isolated using a Yeast DNA Extraction Kit (Thermo Scientific) or Wizard Genomic DNA Purification Kit (Promega). .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen).


    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: Non-denaturing Sodium Bisulfite Mapping Harvested nucleic acids (4–10 µg) were digested with HindIII (20 units, ∼5 hours at 37°C; NEB) and then treated with the sodium bisulfite conversion mix from the EZ-DNA Methylation Kit (Zymo Research, Irvine, CA) overnight at 37°C. .. PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit.


    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: Paragraph title: Isolation of the RAR, Raldh, and cytoplasmic actin homologues from B. leachi and analysis of endogenous transcripts by RT-PCR. ... PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively.

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Yeast genomic DNA was isolated using a Yeast DNA Extraction Kit (Thermo Scientific) or Wizard Genomic DNA Purification Kit (Promega). .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen).

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. White colonies were selected and cultured in 2 mL LB media containing 100 mg/mL ampicillin overnight at 37 °C, and plasmid DNA was isolated with a miniprep kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.


    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. .. Digoxigenin (DIG)–labeled riboprobes were transcribed with a DIG RNA labeling kit and T7 polymerase (Roche, Mannheim, Germany).

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. .. Digoxigenin (DIG)—labeled riboprobes were transcribed with a DIG RNA labeling kit and T7 polymerase (Roche, Mannheim, Germany).


    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)
    Article Snippet: Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD). .. Then we purified the plasmids using QIAprep Spin Miniprep Kit (Qiagen Inc.) and sequenced confirmed to verify the presence of the ITS2 locus.

    Article Title: Ancient Microbes from Halite Fluid Inclusions: Optimized Surface Sterilization and DNA Extraction
    Article Snippet: .. Cloning and DNA Sequencing Purified ITS1 PCR products were cloned using Qiagen PCR cloning kits following the manufacturer's protocols. .. A subset of colonies per sample was purified and cycle sequenced using ABI's BigDye® Terminator v3.1 system, followed by sequencing on a 96 capillary ABI 3730xl genetic analyzer.

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Five mL of this purified product was then run on a 1% agarose gel containing 0.4 mg/mL ethidium bromide and examined for amplicons using a ultraviolet gel doc (Alpha Innotech, Santa Clara, CA, USA). .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced. ..

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: Paragraph title: Isolation of the RAR, Raldh, and cytoplasmic actin homologues from B. leachi and analysis of endogenous transcripts by RT-PCR. ... PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively.

    In Situ Hybridization:

    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Plasmid Preparation:

    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Chemically competent E. coli Top10 cells (Life Technologies) were transformed by heat-shock with ligated plasmid, and were grown overnight at 37°C on LB agar plates with 100 mg/ml ampicillin selection.

    Article Title: Characterization of the canine CLCN3 gene and evaluation as candidate for late-onset NCL
    Article Snippet: .. 5'- and 3'-RACE products and an additional 1885 bp RT-PCR product using sense and antisense primers from exon 1 and 10 (Table ) were cloned into pDrive plasmid vectors using the Qiagen PCR cloning kit (Qiagen, Hilden, Germany) and several clones were sequenced. ..

    Article Title: Systemic Bud Induction and Retinoic Acid Signaling Underlie Whole Body Regeneration in the Urochordate Botrylloides leachiFrom One to Many and Back Again: A Systemic Signal Triggers Tunicate Regeneration
    Article Snippet: .. PCR products of B. leachi Actin, RAR, and Raldh were cloned using pGEM-T easy vector (Promega, http://www.promega.com and Qiagen) PCR cloning kit, respectively. ..

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region
    Article Snippet: .. Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions. .. Plasmids were isolated from transformed overnight colonies using QIAprep Spin Miniprep kit (Qiagen).

    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load. ..

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced. ..

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. .. Ligated plasmids were then transformed into TOP10 chemically competent Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions.


    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen). .. Sequencing was performed by GENEWIZ and BaseClear, and the resulting sequence data were analyzed using Sequencher software (Gene Codes).

    Negative Control:

    Article Title: Relevance of human metapneumovirus in exacerbations of COPD
    Article Snippet: Nuclease-free water was used as negative control and a plasmid containing the N gene of hMPV (kindly provided by James Simon, VIRONOVATIVE, EUR Holding, Erasmus University Rotterdam) was used as a positive control in all PCR runs. .. The real-time PCR product was cloned with the QIAGEN® PCR cloning kit (QIAGEN, Hilden, Germany) and this standard plasmid DNA was used for absolute quantification of hMPV viral load.


    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region
    Article Snippet: PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit. .. Chemically competent E. coli Top10 cells (Life Technologies) were transformed by heat-shock with ligated plasmid, and were grown overnight at 37°C on LB agar plates with 100 mg/ml ampicillin selection.

    Agarose Gel Electrophoresis:

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: Five mL of this purified product was then run on a 1% agarose gel containing 0.4 mg/mL ethidium bromide and examined for amplicons using a ultraviolet gel doc (Alpha Innotech, Santa Clara, CA, USA). .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.


    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing
    Article Snippet: The DNA concentrations of these controls was then measured with a NanoDrop spectrophotometer (Thermo Sci., Waltham, MA, USA) and mixed in equimolar concentrations. .. Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    Activation Assay:

    Article Title: Characterization of a novel Entamoeba histolytica strain from Burkina Faso, Africa, possessing a unique hexokinase-2 gene
    Article Snippet: ExTaq DNA polymerase (Takara Bio Inc., Shiga, Japan) was used in these PCR amplifications with the following cycle conditions: Taq activation at 94 °C for 3 min; 35 cycles of denaturation at 94 °C for 40 s, annealing at 50 °C (chitinase, SREHP, and locus 1-2) or 56 °C (SSU rRNA and Gal/GalNAc lectin) for 40 s, and extension at 72 °C for 1 min; and a final extension at 72 °C for 5 min. .. The amplified SREHP and GPI genes were cloned using the QIAGEN PCR Cloning Kit (Qiagen GmbH, Hilden, Germany).

    DNA Purification:

    Article Title: Telomere Length Homeostasis Responds to Changes in Intracellular dNTP Pools
    Article Snippet: Yeast genomic DNA was isolated using a Yeast DNA Extraction Kit (Thermo Scientific) or Wizard Genomic DNA Purification Kit (Promega). .. Telomere VI-R PCR products were cloned using a PCR Cloning Kit (Qiagen).


    Article Title: Expression of MicroRNA-146 in Rheumatoid Arthritis Synovial Tissue
    Article Snippet: Paraffin-embedded tissue was sectioned at 5 μ m and stained with hematoxylin and eosin. .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced.

    Article Title: Expression of microRNA-146 in osteoarthritis cartilage
    Article Snippet: Each paraffin embedded cartilage sample was sectioned at 5 μm and every tenth section was stained with Safranin O-fast green staining. .. For in situ hybridization, primary miR-146a fragments were derived from PCR products, cloned using the Qiagen PCR cloning kit into the pDrive vector (Qiagen, Chatsworth, CA), and sequenced.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen pcr cloning kit
    Removal of <t>PCR</t> inhibitors by the different DNA extraction methods tested. DNA was isolated from 10,000 spores spiked with dust. Resultant DNA was used as template to amplify <t>rDNA</t> sequences. ‘M’ = DNA marker, with the bands representing
    Pcr Cloning Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 266 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr cloning kit/product/Qiagen
    Average 99 stars, based on 266 article reviews
    Price from $9.99 to $1999.99
    pcr cloning kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results

    Removal of PCR inhibitors by the different DNA extraction methods tested. DNA was isolated from 10,000 spores spiked with dust. Resultant DNA was used as template to amplify rDNA sequences. ‘M’ = DNA marker, with the bands representing

    Journal: Journal of environmental monitoring : JEM

    Article Title: Comparison of DNA extraction methodologies used for assessing fungal diversity via ITS sequencing

    doi: 10.1039/c2em10779a

    Figure Lengend Snippet: Removal of PCR inhibitors by the different DNA extraction methods tested. DNA was isolated from 10,000 spores spiked with dust. Resultant DNA was used as template to amplify rDNA sequences. ‘M’ = DNA marker, with the bands representing

    Article Snippet: Fungal rDNA amplicons were cloned into the pDRIVE vector using a PCR cloning kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions.

    Techniques: Polymerase Chain Reaction, DNA Extraction, Isolation, Marker

    DNA copy number for the ITS2 region of Oxyspirura petrowi as determined by quantitative PCR on fecal samples and the corresponding egg per gram counts as determined by fecal flotation.

    Journal: PLoS ONE

    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)

    doi: 10.1371/journal.pone.0166309

    Figure Lengend Snippet: DNA copy number for the ITS2 region of Oxyspirura petrowi as determined by quantitative PCR on fecal samples and the corresponding egg per gram counts as determined by fecal flotation.

    Article Snippet: Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD).

    Techniques: Real-time Polymerase Chain Reaction

    Standard curves from the duplex and single quantitative PCR reactions. Both curves were generated from standards (10 6 −10 1 ) run in triplicate. For the duplex reaction r 2 = 0.994 and the slope = -3.3 and for the single reaction the r 2 = 0.998 and the slope = -3.4.

    Journal: PLoS ONE

    Article Title: A Quantitative PCR Protocol for Detection of Oxyspirura petrowi in Northern Bobwhites (Colinus virginianus)

    doi: 10.1371/journal.pone.0166309

    Figure Lengend Snippet: Standard curves from the duplex and single quantitative PCR reactions. Both curves were generated from standards (10 6 −10 1 ) run in triplicate. For the duplex reaction r 2 = 0.994 and the slope = -3.3 and for the single reaction the r 2 = 0.998 and the slope = -3.4.

    Article Snippet: Standard Curve and Assay Optimization To create a standard curve to determine qPCR efficiency we cloned a 244 base pair fragment using Qiagen PCR Cloning plus kit (Qiagen Inc., Germantown, MD).

    Techniques: Real-time Polymerase Chain Reaction, Generated

    Clustering of C. difficile PCR-ribotypes. (A) Clustering of PRC-ribotypes based on fingerprinting profiles generated by capillary gel electrophoresis-based PCR-ribotyping. Dendrogram is color coded according to MLST type. The exact lengths of the bands, representing the 16S-23S rRNA intergenic spacer regions are given in Table S1 . (B) Minimum spanning tree of MLST results showing relatedness of PCR-ribotypes. Each circle represents one sequence type (ST) and is subdivided into sectors corresponding to the number of PCR-ribotypes represented with this ST. The numbers between circles represent number of differing loci between the STs.

    Journal: PLoS ONE

    Article Title: Recombination Drives Evolution of the Clostridium difficile 16S-23S rRNA Intergenic Spacer Region

    doi: 10.1371/journal.pone.0106545

    Figure Lengend Snippet: Clustering of C. difficile PCR-ribotypes. (A) Clustering of PRC-ribotypes based on fingerprinting profiles generated by capillary gel electrophoresis-based PCR-ribotyping. Dendrogram is color coded according to MLST type. The exact lengths of the bands, representing the 16S-23S rRNA intergenic spacer regions are given in Table S1 . (B) Minimum spanning tree of MLST results showing relatedness of PCR-ribotypes. Each circle represents one sequence type (ST) and is subdivided into sectors corresponding to the number of PCR-ribotypes represented with this ST. The numbers between circles represent number of differing loci between the STs.

    Article Snippet: Cloning and sequencing of 16S-23S rRNA ISR The purified amplification products were cloned into the pDrive vector (PCR Cloning Plus kit; Qiagen) according to the manufactureŕs instructions.

    Techniques: Polymerase Chain Reaction, Generated, Nucleic Acid Electrophoresis, Sequencing

    Non-denaturing bisulfite footprinting of the displaced DNA strand of the FMR1 R-loop. Each row represents an individual sequence clone, grouped together for each allele size, from cultured human dermal fibroblasts. Each column is a cytosine position, with filled boxes representing converted, single-stranded DNA and open boxes representing unconverted, double-stranded DNA. Empty boxes represent sequence gaps from bacterial deletion or loss of clean sequencing signal. Schematic diagram at the top represents the FMR1 5′UTR with marked TSSs (black arrows), translation start (ATG), CGG repeats (striped box with orange border), PCR primers (blue arrows), and G-clusters (red ticks; red dotted lines).

    Journal: PLoS Genetics

    Article Title: Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region

    doi: 10.1371/journal.pgen.1004294

    Figure Lengend Snippet: Non-denaturing bisulfite footprinting of the displaced DNA strand of the FMR1 R-loop. Each row represents an individual sequence clone, grouped together for each allele size, from cultured human dermal fibroblasts. Each column is a cytosine position, with filled boxes representing converted, single-stranded DNA and open boxes representing unconverted, double-stranded DNA. Empty boxes represent sequence gaps from bacterial deletion or loss of clean sequencing signal. Schematic diagram at the top represents the FMR1 5′UTR with marked TSSs (black arrows), translation start (ATG), CGG repeats (striped box with orange border), PCR primers (blue arrows), and G-clusters (red ticks; red dotted lines).

    Article Snippet: PCR-amplified DNA was sub-cloned using the Qiagen PCR Cloning Kit.

    Techniques: Footprinting, Sequencing, Cell Culture, Polymerase Chain Reaction