q5 dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Q5 High-Fidelity DNA Polymerase
    Description:

    Catalog Number:
    M0491L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs q5 dna polymerase
    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    https://www.bioz.com/result/q5 dna polymerase/product/New England Biolabs
    Average 99 stars, based on 142 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    2) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    3) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    4) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    5) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    6) Product Images from "In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR"

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0183974

    Plasmid assembly by  E .  coli in vivo  recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.
    Figure Legend Snippet: Plasmid assembly by E . coli in vivo recombination of multiple DNA fragments (F1, F2, F3, and F4) with overlapping ends. ( A ) Assembly by 2 DNA fragments, ( B ) Assembly by 4 DNA fragments. The length of overlapping ends is indicated by X nt OL (e.g. 18 nt OL). The DNA fragments should contain a replication origin (Ori), an antibiotic resistant gene (AmpR or KanR), a promoter, and one or more target genes (or gene fragments). Each of the DNA fragments is generated by PCR from DNA templates and a pair of primers (P1/P2, P3/P4) with high fidelity Q5 DNA polymerase.

    Techniques Used: Plasmid Preparation, In Vivo, Generated, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Development of a dual-expression vector facilitated with selection-free PCR recombination cloning strategy
    Article Snippet: All forward primers and reverse primers contain 5′CAGCCACCATCATCACCACCAC3′ and 5′TGCACGTAATTTTTGACGCACG3′ at the 5′ termini respectively, which are homologous to correspondent sequences flanking the lysis gene E expression cassette in pOmni (Fig. ). .. Individual PCR product was cloned into pOmni through a 20 μl recombination PCR using Q5 high-fidelity DNA polymerase, which contained 5 ng pOmni as template and 100–200 folds (molar ratio) gel-purified PCR product as primer. .. All recombination PCRs were conducted with the same thermal cycling parameter (95 °C 30 s, 60 °C 45 s, 72 °C 3 min).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. Finally the hygromycin resistance marker gene hph was amplified from plasmid pCAMB-HPT-Hind ( ) with the primer pair Hygro_MDR6_F/Hygro_ipo323_R or Hygro_MDR7_F/Hygro_ipo323_R, respectively.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The P2 form of HNF4A (α7; NP_001025174) ) and HNF1A were amplified from human liver cDNA and cloned in pLVX. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Centrifugation:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The Zymolyase solution was removed by centrifugation, and the pellet resuspended in distilled water (500 μl). .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Amplification:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Fifteen days after genome editing, genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicenter) following the manufacturer’s protocol. .. Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: This suggests that Musashi-1 is a potential CRC therapeutic target. .. Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA). .. For subcloning full length FLAGMusashi-1 into Hind III and Xba I sites of p3xFLAG-CMV-10 (E7658, Sigma, St. Louis, MO).

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: To introduce the various MFS1 MDR alleles into the sensitive IPO323 strain, the following replacement cassettes were constructed. .. The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The P2 form of HNF4A (α7; NP_001025174) ) and HNF1A were amplified from human liver cDNA and cloned in pLVX. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Paragraph title: Nucleic acid extraction and amplification of 16S rRNA genes for Illumina sequencing ... After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: Paragraph title: 16S rRNA gene amplification and sequencing. ... The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: Paragraph title: Tetrad dissection and MAT locus PCR amplification ... Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The resulting constructs encode dynein-2 (amino acids 1,091 – 4,307) with an N-terminal ZZ tag, TEV cleavage cassette, SNAPf tag, GST tag (as indicated), and an intervening glycine-serine spacer, within the pFastBac vector.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Mass Spectrometry:

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. The PCR product was purified with Ampure XP beads at a ratio of 1:1, and 1–10 ng used to add Illumina Index with Nextera XT kit (Illumina).

    Synthesized:

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The human cytoplasmic dynein-1 holoenzyme construct was as described .

    Picogreen Assay:

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Construct:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: Paragraph title: MFS1 gene replacement constructs. ... The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France).

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: Paragraph title: Expression constructs ... PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Paragraph title: DNA constructs ... Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    cDNA Library Assay:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: This suggests that Musashi-1 is a potential CRC therapeutic target. .. Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA). .. For subcloning full length FLAGMusashi-1 into Hind III and Xba I sites of p3xFLAG-CMV-10 (E7658, Sigma, St. Louis, MO).

    Incubation:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The YPD plate was incubated for 2 days at 30°C. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Gel Extraction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    Expressing:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: Paragraph title: Expression constructs ... PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: Paragraph title: Protein expression ... Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    Modification:

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly.

    Transformation Assay:

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Over Expression:

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of S. aureus ferrochelatase ... The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Derivative Assay:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Gas Chromatography:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The CEBPA coding sequence, corresponding to the p42 form (Uniprot identifier P49715-2) was optimized to reduce its GC content using IDT’s ( http://www.idtdna.com/site ) proprietary tool. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Dissection:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: Paragraph title: Tetrad dissection and MAT locus PCR amplification ... Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Introduce:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: To introduce the various MFS1 MDR alleles into the sensitive IPO323 strain, the following replacement cassettes were constructed. .. The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France).

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Double-stranded cDNA was washed three times in 10 mM tris–HCl to remove the remaining primers, and the entire sample was used as template for PCR amplification in 10 µl using Q5 Polymerase with universal FW primer and mix of reverse isotype specific primer (98°C 30 s; 10 cycles of 98°C 10 s, 58°C 15 s, and 72°C 1 min; 72°C 10 min).

    Hemagglutination Assay:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Generated:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    DNA Sequencing:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Paragraph title: Nested-PCR, T7E1 assay and DNA sequencing ... Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Sequencing:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were purified with QIAguick Gel Extraction Kit, normalized in concentration, pooled together, phosphorylated at 5′ end, added dA-Tailing and Y-Shape adapter.

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. .. Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL.

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: The CEBPA coding sequence, corresponding to the p42 form (Uniprot identifier P49715-2) was optimized to reduce its GC content using IDT’s ( http://www.idtdna.com/site ) proprietary tool. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions.

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Paragraph title: Nucleic acid extraction and amplification of 16S rRNA genes for Illumina sequencing ... After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: Paragraph title: High-throughput sequence of nrfA gene ... The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: Paragraph title: 16S rRNA gene amplification and sequencing. ... The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Double-stranded cDNA was washed three times in 10 mM tris–HCl to remove the remaining primers, and the entire sample was used as template for PCR amplification in 10 µl using Q5 Polymerase with universal FW primer and mix of reverse isotype specific primer (98°C 30 s; 10 cycles of 98°C 10 s, 58°C 15 s, and 72°C 1 min; 72°C 10 min).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Sonication:

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    DNA Extraction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Fifteen days after genome editing, genomic DNA was extracted using the QuickExtract DNA Extraction Solution (Epicenter) following the manufacturer’s protocol. .. Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table .

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA).

    Marker:

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Mutagenesis:

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions. .. For the BirA system, the mycBioID plasmid was a gift from Kyle Roux obtained via Addgene (Addgene plasmid 35700).

    Isolation:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min).

    Microscopy:

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: A 10-μl drop was placed in the middle of a YPD plate, and dumbbell-shaped asci were dissected using a Singer Sporeplay dissection microscope. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C.

    Purification:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Nucleic acid was extracted from each sample using a direct lysis protocol involving bead beating (Noll et al. ). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. Amplification of the V4 region of 16S rRNA genes was performed using the universal primers 515F and 806R, both of which were modified to contain an Illumina adapter region, and the latter of which contained a 12 bp barcode for multiplex sequencing (Caporaso et al. ).

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA).

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min). .. Two microliters of the PCR product were used for a semi-nested PCR with inner RV primers for the constant region, which also introduce partial Illumina adaptors.

    Article Title: Intraflagellar Transport Dynein is Autoinhibited by Trapping of its Mechanical and Track-Binding Elements
    Article Snippet: A H. sapiens cytoplasmic dynein-2 construct codon-optimized for expression in Sf9 cells (Addgene #64064) was modified to replace the N-terminal GFP tag with a GST tag and/or SNAPf tag. .. Components were amplified using Q5 polymerase (NEB) and gel purified before Gibson assembly. .. The resulting constructs encode dynein-2 (amino acids 1,091 – 4,307) with an N-terminal ZZ tag, TEV cleavage cassette, SNAPf tag, GST tag (as indicated), and an intervening glycine-serine spacer, within the pFastBac vector.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: Paragraph title: Cloning, overexpression, and purification of S. aureus ferrochelatase ... The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing.

    Polymerase Chain Reaction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. The genome sequence spanned by the corresponding primer pairs were extracted from human genome sequence (Hg19, GRChr37), acting as the reference sequence for analyzing sequence variation caused by genome editing.

    Article Title: Development of a dual-expression vector facilitated with selection-free PCR recombination cloning strategy
    Article Snippet: All forward primers and reverse primers contain 5′CAGCCACCATCATCACCACCAC3′ and 5′TGCACGTAATTTTTGACGCACG3′ at the 5′ termini respectively, which are homologous to correspondent sequences flanking the lysis gene E expression cassette in pOmni (Fig. ). .. Individual PCR product was cloned into pOmni through a 20 μl recombination PCR using Q5 high-fidelity DNA polymerase, which contained 5 ng pOmni as template and 100–200 folds (molar ratio) gel-purified PCR product as primer. .. All recombination PCRs were conducted with the same thermal cycling parameter (95 °C 30 s, 60 °C 45 s, 72 °C 3 min).

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: 5′-TCACGCGTGGAAAGGCCAGT GGG -3′. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA. .. The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL).

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Bacterial DNA was identified by PCR targeting the 16S rRNA gene with the following primers: 5′-CCAGACTCCTACGGGAGGCAG-3′ (V3 region), 5′-ACATTTCACAACACGAGCTGACGA-3′ (V6 region) [ , ]. .. Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s). .. The vector backbone was modified from pGL4.23[luc2/minP ] (Promega).

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: TRIB1 is a positive regulator of hepatocyte nuclear factor 4-alpha
    Article Snippet: All three constructs contained C-terminal spacers and HA tags. .. PCR and Mutagenesis were performed using the Q5 high fidelity polymerase as per the supplier’s (New England Biolab) instructions. .. For the BirA system, the mycBioID plasmid was a gift from Kyle Roux obtained via Addgene (Addgene plasmid 35700).

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Nucleic acid was extracted from each sample using a direct lysis protocol involving bead beating (Noll et al. ). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. Amplification of the V4 region of 16S rRNA genes was performed using the universal primers 515F and 806R, both of which were modified to contain an Illumina adapter region, and the latter of which contained a 12 bp barcode for multiplex sequencing (Caporaso et al. ).

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: After DNA extraction, PCR was conducted in triplicate using PCR Amplifier 2720 under the same conditions as those of Song et al . .. The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA). .. The PCR amplified product was excised from 2% agarose gels and then purified using AMPure Beads (Beckman Coulter, USA).

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions. .. The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Article Title: Evolutionary restoration of fertility in an interspecies hybrid yeast, by whole-genome duplication after a failed mating-type switch
    Article Snippet: The YPD plate was incubated for 2 days at 30°C. .. Individual spore-derived colonies were used for MAT locus genotyping by colony PCR using Q5 polymerase high-fidelity 2x master mix (NEB) and annealing temperature 55°C. .. Sequences of PCR primers A–F are given in .

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR
    Article Snippet: However, the concentrations of template plasmids will need to be reduced further (e.g., 1 fg/μL) to maintain zero background from parental plasmids. .. A 2-consecutive PCR procedure using Q5 DNA polymerase has been developed to prepare high quality DNA fragments up to 12 kb and reduce template plasmid concentrations below 10 fg/μL. .. Directtransformation of a mixture of PCR DNA fragments containing overlapping ends into DH5α cells yields correctly assembled plasmids with a zero background from template plasmids.

    Article Title: Registry in a tube: multiplexed pools of retrievable parts for genetic design space exploration
    Article Snippet: For a desired composite part design, the sequence-perfect construct with greatest number of reads and allowable primer designs was retrieved. .. Retrieval PCRs were performed in 25 μl with Q5 DNA polymerase (New England Biolabs, M0493) with an aliquot of the tagged pool pDNA (0.2 fmol per 1000 constructs) and the protocol according to the manufacturer's recommendations and 25–30 cycles of PCR. .. Retrieval PCR reactions were DpnI digested and purified by a PCR cleanup using Agencourt AMPure XP magnetic beads (Beckman Coulter, A63881) according to the manufacturer's protocol.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: The CY2, Venus and mCherry DNA constructs were purchased from Addgene. .. Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Article Title: Novel Method for High-Throughput Full-Length IGHV-D-J Sequencing of the Immune Repertoire from Bulk B-Cells with Single-Cell Resolution
    Article Snippet: The protocol used was that suggested by the manufacturer, except that mRNA isolation was performed in 200 µl 96-well PCR plates to enable parallel processing with the support of a 96-well magnetic stand. mRNA was used in its entirety for reverse transcription in 10 µl (50°C 1 h, 72°C 10 min) using SuperScript III Enzyme (ThermoFisher) in solid phase with Dynabeads Oligo(dT) as primer. .. After RNase H treatment, second-strand synthesis was performed in solid phase in 10 µl using Q5 Polymerase (NEB) and a mix of 13 primers covering all IGHV leader sequence segments reported in the IMGT database with a maximum of one mismatch, containing 13 to 16 random nt and partial Illumina adaptor sequences (37°C 20 min, 98°C 30 s, 62°C 2 min, and 72°C 10 min).

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Small Interfering RNA:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: Paragraph title: Plasmid constructions and small interfering RNA knockdown ... Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA).

    CRISPR:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study are shown as follow: sgRNA1, 5′-TCGTACGGGGAGATGTCCGG GGG -3′; gRNA2. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs).

    Nested PCR:

    Article Title: A proteomic analysis of LRRK2 binding partners reveals interactions with multiple signaling components of the WNT/PCP pathway
    Article Snippet: Genomic DNA of the CRISPR/Cas9 derived cell lines was isolated according the manufacturer’s instructions using NucleoSpin Tissue (Macherey-Nagel, Germany). .. Isolated genomic DNA was subjected to the nested-PCR with the Q5 high-fidelity polymerase (New England Biolabs). .. The following primers were used sequentially: the first PCR primers 5′-GAAACCGCTTTCCTGAAAGG-3′ and 5′-GGTGCCCAAGATTAAGACTC-3′, and the second PCR primers 5′-GCCCCTTTGCTATTCTTAGT-3′ and 5′-AAAGTTTGCAGAGGAGGGAG-3′.

    Article Title: Microbiota in Exhaled Breath Condensate and the Lung
    Article Snippet: A nested PCR protocol was used to decrease the potential bias introduced by the use of barcoded primers by only including primers with Illumina adaptor sequences and barcodes in the second PCR round ( ). .. The conditions for the second round were 98°C for 30 s followed by 20 cycles of 98°C for 10 s, 67°C for 30 s, and 72°C for 10 s, followed by 72°C for 2 min. Q5 High-fidelity 2× master mix (New England BioLabs, Ipswich, MA, USA) was used for all reactions.

    Plasmid Preparation:

    Article Title: Musashi-1 promotes a cancer stem cell lineage and chemoresistance in colorectal cancer cells
    Article Snippet: Paragraph title: Plasmid constructions and small interfering RNA knockdown ... Musashi-1 (NM_002442.3) was amplified with M1 forward and M1 reverse primers by Q5 high fidelity DNA polymerase (NEB, Ipswich, MA) from cDNA library prepared from HT-29 cells total RNAs with Superscript III (Thermo Fisher Scientific Waltham, MA).

    Article Title: Plasticity of the MFS1 Promoter Leads to Multidrug Resistance in the Wheat Pathogen Zymoseptoria tritici
    Article Snippet: The respective MFS1 allele, 1,380 bp upstream until 518 bp downstream of the open reading frame (ORF), was amplified from the corresponding DNA (09-ASA-3apz, 09-CB01, or other MDR strains) with the primer MDR-pKr_F at the 5′ end and the strain-specific primer MDR6_hygR (09-ASA-3apz) or MDR7_hyg R (09-CB01) at the 3′ end using Q5 high-fidelity DNA polymerase (New England Biolabs, Evry, France). .. A 737-bp 3′ flank of the MFS1 gene to facilitate homologous recombination was amplified from IPO323 genomic DNA with primers Ipo323-hygroF and Ipo323-pKraR.

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Paragraph title: Generation of input plasmid library ... Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    Article Title: In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR
    Article Snippet: However, the concentrations of template plasmids will need to be reduced further (e.g., 1 fg/μL) to maintain zero background from parental plasmids. .. A 2-consecutive PCR procedure using Q5 DNA polymerase has been developed to prepare high quality DNA fragments up to 12 kb and reduce template plasmid concentrations below 10 fg/μL. .. Directtransformation of a mixture of PCR DNA fragments containing overlapping ends into DH5α cells yields correctly assembled plasmids with a zero background from template plasmids.

    Article Title: An intermolecular FRET sensor detects the dynamics of T cell receptor clustering
    Article Snippet: Q5 DNA polymerase (New England BioLabs) was used for all PCR reactions. .. Standard PCR and restriction enzyme cutting, or overlapping extension PCR methods were conducted for the cloning procedures.

    Article Title: Genetically engineered probiotic for the treatment of phenylketonuria (PKU); assessment of a novel treatment in vitro and in the PAHenu2 mouse model of PKU
    Article Snippet: For liquid MRS in 96 well plate counting; dilutions of 10−3 through 10−8 were plated with ten replicates per dilution when using 70μl of each dilution with 180μl MRS with 5μg/ml ery per well and grown at 37°C anaerobically (see above) for 24h. .. pNCKH103 plasmid [ ] (a gift from Drs. Gerald Tannock and Nicholas Heng, University of Otago, New Zealand) harvested from transformed L . reuteri 100–23 cells served as template for extension PCR of the pGT232 fragment using 6μl 10x Q5 polymerase reaction Buffer, 1.5μl of 15ng/μl total DNA including pNCKH103 DNA from L . reuteri 100–23, 1.5μl of 10μM Forward Primer 5’tagctgagtcgacaacagttgttaa 3’, 1.5μl of 10μM Reverse Primer 5’gagagaataaatcctccatggtttcttaga 3’, 2.4μl 10mM dNTP, 18.6μl Molecular water, 0.25μl Q5 DNA polymerase (New England Biolabs, USA). .. Thermocycler conditions: initial denaturation 98.0°C 30 s; 4 cycles of 98°C 10 s, 57°C 12 s, 72°C 90 s; 30 cycles of 98°C 10 s, 65°C 12 s, 72°C 90 s; final extension at 72°C for 120 s then hold at 4°C.

    Article Title: The coproporphyrin ferrochelatase of Staphylococcus aureus: mechanistic insights into a regulatory iron-binding site
    Article Snippet: This work has implications for how staphylococci respond to nutritional immunity (e.g. metal sequestration) encountered during infection. .. The cpfC (hemH ) gene was amplified from S. aureus strain USA300 [ ] via colony PCR using Q5 polymerase (NEB) and cloned into the Nhe I/Hin dIII sites of plasmid pTrcHis (ThermoFischer), and the correct sequence of the resultant pTrcHis-Sa-cpfC vector was confirmed by Sanger sequencing. .. Escherichia coli JM109 cells (Sigma–Aldrich) were transformed with pTrcHis-Sa-cpfC and a 10 ml LB overnight culture of this expression strain was used to inoculate 1 l of Circlegrow medium in a 2-l baffled flask (125 µg ml−1 ampicillin was included throughout for plasmid selection).

    Software:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: We used the online software (MIT CRISPR Design Tool: http://crispr.mit.edu ) to design sgRNAs targeting common sequence of pig and cow PDX1 gene. .. The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Agarose Gel Electrophoresis:

    Article Title: Maternal serum C-reactive protein concentration and intra-amniotic inflammation in women with preterm prelabor rupture of membranes
    Article Snippet: Each reaction contained 3 μL of target DNA, 500 nM forward and reverse primers, and Q5 High-Fidelity DNA polymerase (NEB, Ipswich, MA, USA) in a total volume of 25 μL. .. Amplification was performed on a 2720 Thermal Cycler (Applied Biosystems, Foster City, CA, USA).

    Article Title: Functional assessment of human enhancer activities using whole-genome STARR-sequencing
    Article Snippet: Briefly, human genomic DNA (Promega) was sheared by sonication (Covaris S2) and size-selected on 1% agarose gel (350–650 bp). .. Size-selected DNA fragments were ligated to adaptors (sense: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; antisense: 5’-GATCGGAAGAGCACACGTCT-3’) and polymerase chain reaction (PCR) amplified using Q5 High-Fidelity DNA polymerase (NEB) to add homology arms for cloning (forward primer: 5’-GTAATAATTCTAGAGTCGGGGCGGGAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’; reverse primer: 5’- TATCATGTCTGCTCGAAGCGGCATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; PCR program: 98 °C for 30 s; 12 cycles of 98 °C for 10 s, 65 °C for 30 s, and 72 °C for 30 s).

    In Vitro:

    Article Title: CRISPR-Cas9 mediated one-step disabling of pancreatogenesis in pigs
    Article Snippet: Paragraph title: sgRNA design and in vitro transcription ... The sgRNAs containing T7 promoter were amplified by PCR with the following primers (5′-TAATACGACTCACTATA-G-[19 bp sgRNA target sequence]-GTTTTAGAGCTAGAAATAGC-3′ and 5′-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′) using Q5 High-Fidelity DNA Polymerase (NEB) without template DNA.

    Sampling:

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: Fifty bioreactor samples from the five sampling ports were stored at −20 °C as pellets until use. .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Concentration Assay:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: Potential off-target sites predicted by an online tool ( http://crispr.mit.edu/ ) were amplified using Q5 High-Fidelity DNA polymerase (NEB) with the primers listed in Supplementary Table . .. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from hESCs.

    High Throughput Screening Assay:

    Article Title: Dissimilatory Nitrate Reduction to Ammonium in the Yellow River Estuary: Rates, Abundance, and Community Diversity
    Article Snippet: Paragraph title: High-throughput sequence of nrfA gene ... The 25 μL PCR reaction system contained 5 μL of 5*Reaction Buffer, 5 μL of 5* High GC Buffer, 0.5 μL of dNTP (10 mM), 1 μL of DNA, 1 μL of each primer (10 μM), 11.25 μL of dd H2 O (TaKaRa, Japan) and 0.25 μL of Q5 DNA polymerase (Q5™ High-Fidelity DNA Polymerase, NEB, USA).

    Lysis:

    Article Title: Hydraulic retention time and pH affect the performance and microbial communities of passive bioreactors for treatment of acid mine drainage
    Article Snippet: After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA). .. After treatment with RNase (Type II-A; Sigma-Aldrich, MO, USA), we quantified purified DNA using NanoDrop Lite (Thermo Fisher Scientific, MA, USA), which was subsequently used as a template for PCR with a high-fidelity DNA polymerase (Q5; New England Biolabs, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs q5 high fidelity dna polymerase
    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic <t>DNA</t> ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.
    Q5 High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 597 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 597 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    83
    New England Biolabs q5 high fidelity pcr dna polymerase
    Gene inactivation and integration via homologous recombination into the genome of L. plantarum 423 at the aap adhesion gene locus to create L. plantarum 423 aap ::FRT erm and L. plantarum 423 aap ::frt_um (um-unmarked). a Homologous recombination between the wild-type (WT) L. plantarum 423 chromosome and the aap::FRT erm cassette and selection of unmarked aap double-crossover mutants. Boxed regions show the upstream and downstream regions of homology (~ 0.9 kb) on the WT L. plantarum 423 chromosome and plasmid pNZKIaap::FRTerm knock-in (KI) vector. Cells harboring the aap KI vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by <t>PCR</t> using the primer combinations indicated in purple. b PCR amplification of WT L. plantarum 423 and aap insertion mutants using the primer pair indicated in panel A. Additionally, the Em resistance marker was recycled via excision by FLP recombinase. (m) Lambda <t>DNA</t> digested with Pst I (NEB). Amplicons from one WT, two aap ::FRT erm insertion mutant and two aap ::unmarked colonies are shown. c MRS agar plates showing the effectiveness of the repA asRNA induction of FLP recombinase-bearing plasmid loss in the absence of nisin (no nisin induction) and in the presence of nisin (nisin induction). Colonies that have lost the repA -bearing plasmid were isolated via replica plating
    Q5 High Fidelity Pcr Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity pcr dna polymerase/product/New England Biolabs
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity pcr dna polymerase - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    Image Search Results


    Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Journal: Molecular Oncology

    Article Title: Correlation between circulating cell‐free PIK3CA tumor DNA levels and treatment response in patients with PIK3CA‐mutated metastatic breast cancer

    doi: 10.1002/1878-0261.12305

    Figure Lengend Snippet: Assay specificity for PIK 3 CA mutations. Comparison of mutant PIK 3 CA detection in human control genomic DNA ( gDNA ) and cell‐free plasma DNA following pre‐amplification or no pre‐amplification using Q5 High‐Fidelity DNA Polymerase (New England BioLabs) or TaqMan ® PreAmp Master Mix (Life Technologies). The level of blank (LoB) was 0.04% for the mutation E545K and for H1047R, 0.02% for E542K, and less than 0.01% for H1047L as shown by the graphs.

    Article Snippet: To increase the sensitivity of the analysis, the remaining 75 μL serum DNA was subjected to 12 cycles of PCR pre‐amplification with Q5 High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA) using a multiplex PIK3CA primer mix.

    Techniques: Mutagenesis, Amplification

    Gene inactivation and integration via homologous recombination into the genome of L. plantarum 423 at the aap adhesion gene locus to create L. plantarum 423 aap ::FRT erm and L. plantarum 423 aap ::frt_um (um-unmarked). a Homologous recombination between the wild-type (WT) L. plantarum 423 chromosome and the aap::FRT erm cassette and selection of unmarked aap double-crossover mutants. Boxed regions show the upstream and downstream regions of homology (~ 0.9 kb) on the WT L. plantarum 423 chromosome and plasmid pNZKIaap::FRTerm knock-in (KI) vector. Cells harboring the aap KI vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations indicated in purple. b PCR amplification of WT L. plantarum 423 and aap insertion mutants using the primer pair indicated in panel A. Additionally, the Em resistance marker was recycled via excision by FLP recombinase. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT, two aap ::FRT erm insertion mutant and two aap ::unmarked colonies are shown. c MRS agar plates showing the effectiveness of the repA asRNA induction of FLP recombinase-bearing plasmid loss in the absence of nisin (no nisin induction) and in the presence of nisin (nisin induction). Colonies that have lost the repA -bearing plasmid were isolated via replica plating

    Journal: BMC Molecular Biology

    Article Title: Development of a novel selection/counter-selection system for chromosomal gene integrations and deletions in lactic acid bacteria

    doi: 10.1186/s12867-019-0127-x

    Figure Lengend Snippet: Gene inactivation and integration via homologous recombination into the genome of L. plantarum 423 at the aap adhesion gene locus to create L. plantarum 423 aap ::FRT erm and L. plantarum 423 aap ::frt_um (um-unmarked). a Homologous recombination between the wild-type (WT) L. plantarum 423 chromosome and the aap::FRT erm cassette and selection of unmarked aap double-crossover mutants. Boxed regions show the upstream and downstream regions of homology (~ 0.9 kb) on the WT L. plantarum 423 chromosome and plasmid pNZKIaap::FRTerm knock-in (KI) vector. Cells harboring the aap KI vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations indicated in purple. b PCR amplification of WT L. plantarum 423 and aap insertion mutants using the primer pair indicated in panel A. Additionally, the Em resistance marker was recycled via excision by FLP recombinase. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT, two aap ::FRT erm insertion mutant and two aap ::unmarked colonies are shown. c MRS agar plates showing the effectiveness of the repA asRNA induction of FLP recombinase-bearing plasmid loss in the absence of nisin (no nisin induction) and in the presence of nisin (nisin induction). Colonies that have lost the repA -bearing plasmid were isolated via replica plating

    Article Snippet: PCR amplifications were performed using Q5 high-fidelity PCR DNA polymerase (NEB) in a SwiftMinipro thermal cycler (Esco Healthcare, Malaysia).

    Techniques: Homologous Recombination, Selection, Plasmid Preparation, Knock-In, Expressing, Polymerase Chain Reaction, Amplification, Marker, Lambda DNA Preparation, Mutagenesis, Isolation

    Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the munA bacteriocin gene locus to create E. mundtii ST4SA munA :: cat - ffluc. a Homologous recombination between the wild-type (WT) E. mundtii ST4SA munA -carrying megaplasmid and the munA::catffluc cassette. Boxed regions show the upstream (~ 0.9 kb) and downstream regions (~ 0.6) of homology on the megaplasmid and the pNZKOmunACatFfluc knockout (KO) vector. Cells harboring the munA KO vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing erm and mazF genes. Double crossover mutants were selected and screened by PCR using the indicated primer combinations. b PCR amplification of WT and munA deletion and insertion mutants using the primer pair indicated in panel ( a ). Primer pairs are shown in purple. (m) Lambda DNA digested with Pst I (NEB). Amplicons from four munA mutant and two WT colonies, respectively, are shown

    Journal: BMC Molecular Biology

    Article Title: Development of a novel selection/counter-selection system for chromosomal gene integrations and deletions in lactic acid bacteria

    doi: 10.1186/s12867-019-0127-x

    Figure Lengend Snippet: Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the munA bacteriocin gene locus to create E. mundtii ST4SA munA :: cat - ffluc. a Homologous recombination between the wild-type (WT) E. mundtii ST4SA munA -carrying megaplasmid and the munA::catffluc cassette. Boxed regions show the upstream (~ 0.9 kb) and downstream regions (~ 0.6) of homology on the megaplasmid and the pNZKOmunACatFfluc knockout (KO) vector. Cells harboring the munA KO vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing erm and mazF genes. Double crossover mutants were selected and screened by PCR using the indicated primer combinations. b PCR amplification of WT and munA deletion and insertion mutants using the primer pair indicated in panel ( a ). Primer pairs are shown in purple. (m) Lambda DNA digested with Pst I (NEB). Amplicons from four munA mutant and two WT colonies, respectively, are shown

    Article Snippet: PCR amplifications were performed using Q5 high-fidelity PCR DNA polymerase (NEB) in a SwiftMinipro thermal cycler (Esco Healthcare, Malaysia).

    Techniques: Homologous Recombination, Knock-Out, Plasmid Preparation, Expressing, Polymerase Chain Reaction, Amplification, Lambda DNA Preparation, Mutagenesis

    Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the srtA locus to create E. mundtii ST4SA srtA ::FRT erm , and E. mundtii ST4SA sortase A aggregation substance (AS) cell clumping assay. a Schematic representing the wild-type (WT) E. mundtii ST4SA srtA gene locus and the recombinant srtA deletion and FRT- erm integration site. Boxed regions show the upstream and downstream regions of homology (~ 1 kb) on the WT chromosome and the recombinant srtA ::FRT erm locus. Cells harboring the srtA knockout vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations shown in purple. b PCR amplification of WT and srtA deletion and insertion mutants using the primer pair indicated in panel A. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT and two srtA ::FRT erm insertion mutant colonies are shown. c MRS broth with the WT strain containing SrtA AS. d MRS broth containing the E. mundtii ST4SA srtA ::FRT erm deletion mutant strain lacking SrtA AS. e MRS broth with E. mundtii ST4SA srtC ::FRT erm deletion mutant strain containing SrtA AS

    Journal: BMC Molecular Biology

    Article Title: Development of a novel selection/counter-selection system for chromosomal gene integrations and deletions in lactic acid bacteria

    doi: 10.1186/s12867-019-0127-x

    Figure Lengend Snippet: Gene deletion and integration via homologous recombination into the genome of E. mundtii ST4SA at the srtA locus to create E. mundtii ST4SA srtA ::FRT erm , and E. mundtii ST4SA sortase A aggregation substance (AS) cell clumping assay. a Schematic representing the wild-type (WT) E. mundtii ST4SA srtA gene locus and the recombinant srtA deletion and FRT- erm integration site. Boxed regions show the upstream and downstream regions of homology (~ 1 kb) on the WT chromosome and the recombinant srtA ::FRT erm locus. Cells harboring the srtA knockout vector were selected on Cm and Em, followed by nisin induction for MazF toxin expression to select for mutants that have lost the plasmid backbone bearing cat and mazF genes. Double crossover mutants were selected and screened by PCR using the primer combinations shown in purple. b PCR amplification of WT and srtA deletion and insertion mutants using the primer pair indicated in panel A. (m) Lambda DNA digested with Pst I (NEB). Amplicons from one WT and two srtA ::FRT erm insertion mutant colonies are shown. c MRS broth with the WT strain containing SrtA AS. d MRS broth containing the E. mundtii ST4SA srtA ::FRT erm deletion mutant strain lacking SrtA AS. e MRS broth with E. mundtii ST4SA srtC ::FRT erm deletion mutant strain containing SrtA AS

    Article Snippet: PCR amplifications were performed using Q5 high-fidelity PCR DNA polymerase (NEB) in a SwiftMinipro thermal cycler (Esco Healthcare, Malaysia).

    Techniques: Homologous Recombination, Recombinant, Knock-Out, Plasmid Preparation, Expressing, Polymerase Chain Reaction, Amplification, Lambda DNA Preparation, Mutagenesis