Structured Review

Stratagene puc19
Puc19, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/puc19/product/Stratagene
Average 88 stars, based on 10 article reviews
Price from $9.99 to $1999.99
puc19 - by Bioz Stars, 2019-10
88/100 stars

Images

Related Articles

Clone Assay:

Article Title: The Draft Genome Sequence of Actinokineospora bangkokensis 44EHWT Reveals the Biosynthetic Pathway of the Antifungal Thailandin Compounds with Unusual Butylmalonyl-CoA Extender Units
Article Snippet: For the inactivation of thaBI of the PKS cluster #11, a 3087 bp internal fragment of the PKS I gene was amplified using the primers TTATACTGCAGACCGAGGACGAGGTCATC and ATCGGGAGAACTAGACGAACAG by PCR. .. The PCR product was firstly cloned into pUC19 (Stratagene, La Jolla, CA, USA). .. Subsequently, it was cut by Pst I/Eco RV and cloned into the final vector pKCLP2 [ ].

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: Pfu polymerase (Gennaxon) was used. .. The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Ligation of the NdeI/BamHI fragment of pJK1 into the similarly restricted pET16b (Novagen) resulted in plasmid pJK3.

Article Title: Viable chimaeric viruses confirm the biological importance of sequence specific maize streak virus movement protein and coat protein interactions
Article Snippet: In contrast, the mp-cp cassette behaved in a far more modular fashion, in that exchanging this region had a relatively small effect on both virus infectivity and, judging from symptom development, in planta virus movement; it follows that the remainder of the MSV genome reflected the same degree of modularity. .. The cloning vectors pBluescriptSK+ (pSK+; Stratagene, La Jolla, CA) and pUC19 (Stratagene), and the RecA- Escherichia coli strains DH5α and JM109 were used in all standard cloning procedures. .. The E. coli/A. tumefaciens binary vector pBI121 (Clontech, CA, U.S.A.) was used to produce agroinfectious DNA constructs, and the Agrobacterium tumefaciens strain C58C1 [pMP90][ ] was used for all agroinoculations.

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: Previous genetic studies demonstrated that the MccL gene cluster is plasmid encoded. .. A 13.5-kb Hin dIII- Sal I DNA fragment issued from DNA plasmid was cloned into pUC19, resulting in pL102. .. It directs the production of MccL and immunity to MccL and MccV ( ).

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: A 379-bp region containing ORF3 was amplified and cloned into pGEM-T easy (Promega), generating pL1. .. Plasmid pL2 was constructed by cloning into pUC19 (Stratagene) a DNA fragment of 686 bp (ORFs 3 and 4). .. The recombinant plasmids were introduced into E. coli TG1 strains.

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: E. coli CC118λpir was used to replicate plasmids based on the R6K replicon ( ). .. Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments. .. The helper plasmid pRK600 was used to mobilize tra -lacking mob+ plasmids ( ).

Article Title: The P450 Monooxygenase BcABA1 Is Essential for Abscisic Acid Biosynthesis in Botrytis cinerea
Article Snippet: Paragraph title: Cloning of bccpr1 gene. ... Positive and purified phages were subcloned in pUC19 ( ) and pBluescriptII SK(−) (Stratagene), respectively.

Article Title: Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid
Article Snippet: The Eco RI-3 fragment of Varkud mtDNA was cloned into pBluescript KS(+) (Stratagene) and sequenced by automated sequencing with fluorescent dyes at the University of Texas at Austin DNA sequencing facility. .. The Eco RI-4 fragment of the Hanapepe mtDNA was cloned into pUC19 (Stratagene) and sequenced using the dideoxy chain termination method ( ). .. Sequence comparisons with GenBank were done using the BLAST algorithm with the BLOSUM 62 matrix and an expect value of 10 ( ) at the National Center for Biotechnology Information website.

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: The mouse Cx26 gene was isolated by screening a genomic library from BALB/c mice , using a Cx26 cDNA probe ( ). .. Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany). .. Restriction mapping and DNA sequencing yielded the restriction map of the mouse Cx26 gene shown in Fig. A .

Amplification:

Article Title: The Draft Genome Sequence of Actinokineospora bangkokensis 44EHWT Reveals the Biosynthetic Pathway of the Antifungal Thailandin Compounds with Unusual Butylmalonyl-CoA Extender Units
Article Snippet: For the inactivation of thaBI of the PKS cluster #11, a 3087 bp internal fragment of the PKS I gene was amplified using the primers TTATACTGCAGACCGAGGACGAGGTCATC and ATCGGGAGAACTAGACGAACAG by PCR. .. The PCR product was firstly cloned into pUC19 (Stratagene, La Jolla, CA, USA).

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: The gene encoding acryloyl-CoA reductase was amplified by PCR from S. tokodaii chromosomal DNA by using a forward primer (5′-TAAGTTT CATATG AAAGCAATTGTAGTTCC-3′) introducing an NdeI site (underlined) at the initiation codon and a reverse primer (5′-CTTCACAATA GGATCC TATTCAGTTAA-3′) introducing a BamHI site (underlined) after the stop codon. .. The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1.

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: A 379-bp region containing ORF3 was amplified and cloned into pGEM-T easy (Promega), generating pL1. .. Plasmid pL2 was constructed by cloning into pUC19 (Stratagene) a DNA fragment of 686 bp (ORFs 3 and 4).

Filtration:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The resulting radio-labeled DNA fragments were separated on a 6 % native polyacrylamide gel using electrophoresis in TBE buffer (89 mM Tris base, 89 mM boric acid, 2.5 mM Na2 EDTA, pH 8.3).

Construct:

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: A 379-bp region containing ORF3 was amplified and cloned into pGEM-T easy (Promega), generating pL1. .. Plasmid pL2 was constructed by cloning into pUC19 (Stratagene) a DNA fragment of 686 bp (ORFs 3 and 4). .. The recombinant plasmids were introduced into E. coli TG1 strains.

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Mutant strains of P. putida DOT-T1E generated previously and those constructed in this study are shown in Table . .. Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments.

Electrophoresis:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The generated DNA fragments were 3′-end labeled using α-[32P]-dATP (3000 Ci/mmol each, GE Healthcare, Buckinghamshire, England) and 10 units of Klenow enzyme (BioLabs) for 30 min at 37°C.

Incubation:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The DNA fragments were removed from gel by crushing the portion of gel and dialyzing it over-night against 400 μl of elution buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 100 mM NaCl) prior to filtration through a Millipore 0.22 μm membrane and subsequent ethanol precipitation.

Expressing:

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: Paragraph title: Heterologous expression of the acryloyl-CoA reductase gene from S. tokodaii and production of the enzyme in E. coli . ... The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1.

Western Blot:

Article Title: High-Yield Production of a Bacterial Xylanase in the Filamentous Fungus Trichoderma reesei Requires a Carrier Polypeptide with an Intact Domain Structure
Article Snippet: The vector backbones used in the plasmid constructions were pUC18 (EMBL database accession no. ), pUC19 , and pBluescript SK(−) (Stratagene). .. The vector backbones used in the plasmid constructions were pUC18 (EMBL database accession no. ), pUC19 , and pBluescript SK(−) (Stratagene).

Transformation Assay:

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Introduction of the NdeI/BamHI fragment into the expression vector pET16b results in the expression of an extended 5′ coding region, resulting in a N-terminal 10-His tag for the recombinant protein.

Derivative Assay:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: The TTAA-69 bp DNA fragment was obtained from Eco RI and Pst I double digestion of the pUC19-TTAA vector. .. This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The generated DNA fragments were 3′-end labeled using α-[32P]-dATP (3000 Ci/mmol each, GE Healthcare, Buckinghamshire, England) and 10 units of Klenow enzyme (BioLabs) for 30 min at 37°C.

Hybridization:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: The TTAA-69 bp DNA fragment was obtained from Eco RI and Pst I double digestion of the pUC19-TTAA vector. .. This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The generated DNA fragments were 3′-end labeled using α-[32P]-dATP (3000 Ci/mmol each, GE Healthcare, Buckinghamshire, England) and 10 units of Klenow enzyme (BioLabs) for 30 min at 37°C.

Footprinting:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: Paragraph title: DNase I Footprinting ... This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined).

Generated:

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Mutant strains of P. putida DOT-T1E generated previously and those constructed in this study are shown in Table . .. Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments.

DNA Sequencing:

Article Title: Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid
Article Snippet: Paragraph title: DNA sequencing ... The Eco RI-4 fragment of the Hanapepe mtDNA was cloned into pUC19 (Stratagene) and sequenced using the dideoxy chain termination method ( ).

Sequencing:

Article Title: Characterization of an unusual tRNA-like sequence found inserted in a Neurospora retroplasmid
Article Snippet: The Eco RI-3 fragment of Varkud mtDNA was cloned into pBluescript KS(+) (Stratagene) and sequenced by automated sequencing with fluorescent dyes at the University of Texas at Austin DNA sequencing facility. .. The Eco RI-4 fragment of the Hanapepe mtDNA was cloned into pUC19 (Stratagene) and sequenced using the dideoxy chain termination method ( ).

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany). .. Restriction mapping and DNA sequencing yielded the restriction map of the mouse Cx26 gene shown in Fig. A .

Recombinant:

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Ligation of the NdeI/BamHI fragment of pJK1 into the similarly restricted pET16b (Novagen) resulted in plasmid pJK3.

In Vivo:

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments. .. The helper plasmid pRK600 was used to mobilize tra -lacking mob+ plasmids ( ).

Mutagenesis:

Article Title: Increased Production of Xylanase by Expression of a Truncated Version of the xyn11A Gene from Nonomuraea flexuosa in Trichoderma reesei
Article Snippet: The vector backbones used in constructing the plasmids were pUC18 (EMBL database accession no. ), pUC19 ( ) and pBluescript II KS+ (Stratagene). .. The vector backbones used in constructing the plasmids were pUC18 (EMBL database accession no. ), pUC19 ( ) and pBluescript II KS+ (Stratagene).

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Mutant strains of P. putida DOT-T1E generated previously and those constructed in this study are shown in Table . .. Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments.

Isolation:

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: Pfu polymerase (Gennaxon) was used. .. The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Ligation of the NdeI/BamHI fragment of pJK1 into the similarly restricted pET16b (Novagen) resulted in plasmid pJK3.

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: The mouse Cx26 gene was isolated by screening a genomic library from BALB/c mice , using a Cx26 cDNA probe ( ). .. Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany).

Mouse Assay:

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: The mouse Cx26 gene was isolated by screening a genomic library from BALB/c mice , using a Cx26 cDNA probe ( ). .. Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany).

Polymerase Chain Reaction:

Article Title: The Draft Genome Sequence of Actinokineospora bangkokensis 44EHWT Reveals the Biosynthetic Pathway of the Antifungal Thailandin Compounds with Unusual Butylmalonyl-CoA Extender Units
Article Snippet: For the inactivation of thaBI of the PKS cluster #11, a 3087 bp internal fragment of the PKS I gene was amplified using the primers TTATACTGCAGACCGAGGACGAGGTCATC and ATCGGGAGAACTAGACGAACAG by PCR. .. The PCR product was firstly cloned into pUC19 (Stratagene, La Jolla, CA, USA). .. Subsequently, it was cut by Pst I/Eco RV and cloned into the final vector pKCLP2 [ ].

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: Pfu polymerase (Gennaxon) was used. .. The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Ligation of the NdeI/BamHI fragment of pJK1 into the similarly restricted pET16b (Novagen) resulted in plasmid pJK3.

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: Restriction sites were added at the 5′ end of a number of primers to give the possibility to clone PCR fragments using the corresponding restriction enzymes. .. Plasmid pL2 was constructed by cloning into pUC19 (Stratagene) a DNA fragment of 686 bp (ORFs 3 and 4).

Article Title: The P450 Monooxygenase BcABA1 Is Essential for Abscisic Acid Biosynthesis in Botrytis cinerea
Article Snippet: The resulting 0.45-kb PCR fragment was used as a probe for screening a genomic EMBL3 library of B. cinerea strain SAS56 ( ). .. Positive and purified phages were subcloned in pUC19 ( ) and pBluescriptII SK(−) (Stratagene), respectively.

Purification:

Article Title: The P450 Monooxygenase BcABA1 Is Essential for Abscisic Acid Biosynthesis in Botrytis cinerea
Article Snippet: The resulting 0.45-kb PCR fragment was used as a probe for screening a genomic EMBL3 library of B. cinerea strain SAS56 ( ). .. Positive and purified phages were subcloned in pUC19 ( ) and pBluescriptII SK(−) (Stratagene), respectively. .. For construction of the gene replacement vector pCPR1Rep, the plasmid pOliHP ( ) carrying the E. coli hygromycin phosphotransferase gene hph under control of the Aspergillus nidulans oliC promoter and trpC terminator was used as a basis vector.

Article Title: High-Yield Production of a Bacterial Xylanase in the Filamentous Fungus Trichoderma reesei Requires a Carrier Polypeptide with an Intact Domain Structure
Article Snippet: The vector backbones used in the plasmid constructions were pUC18 (EMBL database accession no. ), pUC19 , and pBluescript SK(−) (Stratagene). .. The vector backbones used in the plasmid constructions were pUC18 (EMBL database accession no. ), pUC19 , and pBluescript SK(−) (Stratagene).

Plasmid Preparation:

Article Title: The Draft Genome Sequence of Actinokineospora bangkokensis 44EHWT Reveals the Biosynthetic Pathway of the Antifungal Thailandin Compounds with Unusual Butylmalonyl-CoA Extender Units
Article Snippet: Paragraph title: 4.8. Cloning of Single Crossover Vector pKCLP2_PKS11 ... The PCR product was firstly cloned into pUC19 (Stratagene, La Jolla, CA, USA).

Article Title: 3-Hydroxypropionyl-Coenzyme A Dehydratase and Acryloyl-Coenzyme A Reductase, Enzymes of the Autotrophic 3-Hydroxypropionate/4-Hydroxybutyrate Cycle in the Sulfolobales
Article Snippet: Pfu polymerase (Gennaxon) was used. .. The PCR products were isolated and cloned into pUC19 (Stratagene), resulting in plasmid pJK1. .. Ligation of the NdeI/BamHI fragment of pJK1 into the similarly restricted pET16b (Novagen) resulted in plasmid pJK3.

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: The TTAA-69 bp DNA fragment was obtained from Eco RI and Pst I double digestion of the pUC19-TTAA vector. .. This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The generated DNA fragments were 3′-end labeled using α-[32P]-dATP (3000 Ci/mmol each, GE Healthcare, Buckinghamshire, England) and 10 units of Klenow enzyme (BioLabs) for 30 min at 37°C.

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: Previous genetic studies demonstrated that the MccL gene cluster is plasmid encoded. .. A 13.5-kb Hin dIII- Sal I DNA fragment issued from DNA plasmid was cloned into pUC19, resulting in pL102. .. It directs the production of MccL and immunity to MccL and MccV ( ).

Article Title: Genetic Analysis and Complete Primary Structure of Microcin L
Article Snippet: A 379-bp region containing ORF3 was amplified and cloned into pGEM-T easy (Promega), generating pL1. .. Plasmid pL2 was constructed by cloning into pUC19 (Stratagene) a DNA fragment of 686 bp (ORFs 3 and 4). .. The recombinant plasmids were introduced into E. coli TG1 strains.

Article Title: Increased Production of Xylanase by Expression of a Truncated Version of the xyn11A Gene from Nonomuraea flexuosa in Trichoderma reesei
Article Snippet: Plasmids were propagated in Escherichia coli XL1-Blue and XL10-Gold (Stratagene, La Jolla, CA). .. The vector backbones used in constructing the plasmids were pUC18 (EMBL database accession no. ), pUC19 ( ) and pBluescript II KS+ (Stratagene). .. The E. coli cultivations were performed overnight at 37°C in Luria-Bertani medium ( ) into which ampicillin had been added (50 to 100 μg/ml).

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments. .. The helper plasmid pRK600 was used to mobilize tra -lacking mob+ plasmids ( ).

Article Title: High-Yield Production of a Bacterial Xylanase in the Filamentous Fungus Trichoderma reesei Requires a Carrier Polypeptide with an Intact Domain Structure
Article Snippet: Plasmids were propagated in Escherichia coli XL1-Blue (Stratagene, La Jolla, Calif.). .. The vector backbones used in the plasmid constructions were pUC18 (EMBL database accession no. ), pUC19 , and pBluescript SK(−) (Stratagene). .. All E. coli cultivations were performed overnight at 37°C in Luria-Bertani medium ( ) to which ampicillin (50 μg/ml) had been added.

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: Paragraph title: Construction of Targeting Vector ... Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany).

Selection:

Article Title: Transplacental Uptake of Glucose Is Decreased in Embryonic Lethal Connexin26-deficient Mice
Article Snippet: Positive clones were subcloned into pUC19 and pBluescript SK+ vectors (Stratagene, Heidelberg, Germany). .. Restriction mapping and DNA sequencing yielded the restriction map of the mouse Cx26 gene shown in Fig. A .

Ethanol Precipitation:

Article Title: DNA Minor Groove Induced Dimerization of Heterocyclic Cations: Compound Structure, Binding Affinity and Specificity for a TTAA Site
Article Snippet: This vector derived from pUC19 (Stratagene) by insertion between Sal I and Bam HI restriction sites of a double-stranded DNA obtained from hybridization of the two phosphorylated oligonucleotides 5′-GATCCCACTGC TTAA CTGGCTTCGACTCAC TATA GGGAGACCCG and 5′-TCGACGGGTCTCCC TATA GTGAGTCGAAGCCAG TTAA GCAGTGG (Eurogentec, Belgium) containing both TTAA and TATA sequences (underlined). .. The resulting radio-labeled DNA fragments were separated on a 6 % native polyacrylamide gel using electrophoresis in TBE buffer (89 mM Tris base, 89 mM boric acid, 2.5 mM Na2 EDTA, pH 8.3).

Concentration Assay:

Article Title: A Set of Genes Encoding a Second Toluene Efflux System in Pseudomonas putida DOT-T1E Is Linked to the tod Genes for Toluene Metabolism
Article Snippet: Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments. .. Competent E. coli cells were prepared according to the method of Inoue et al. ( ). pUC19 ( ) and pBS(SK−) (Stratagene, Inc.) were used for cloning experiments.

Marker:

Article Title: Increased Production of Xylanase by Expression of a Truncated Version of the xyn11A Gene from Nonomuraea flexuosa in Trichoderma reesei
Article Snippet: The vector backbones used in constructing the plasmids were pUC18 (EMBL database accession no. ), pUC19 ( ) and pBluescript II KS+ (Stratagene). .. The vector backbones used in constructing the plasmids were pUC18 (EMBL database accession no. ), pUC19 ( ) and pBluescript II KS+ (Stratagene).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    Stratagene plasmid puc19
    DNA binding properties of Tay1 analyzed by EMSA. A , shown is EMSA analysis using radiolabeled YlTEL (50-bp EcoRI fragment of pMH25) as a probe. The DNA competitors indicated above the lanes were used at a 1000-fold excess over the YlTEL probe. B , Tay1p is able to bind dsDNA probes carrying ≥1.5 telomeric repeats. C , EMSA analysis using radiolabeled dsDNA oligonucleotides containing three telomeric repeats ( telomeric' YlTEL_EMSA-1) and three non-telomeric repeats ( nontelomeric YlTEL_EMSA-C), respectively. 100, 300, and 500 ng of poly(dI-dC) DNA were used as competitor DNA. The two bands ( C1 and C2 ) most likely represent complexes containing one and two Tay1 protein molecules, respectively. D , shown is an EMSA analysis of Tay1p binding to radiolabeled mutated telomeric probes containing either conserved GT and GG dinucleotides with other residues of the telomeric repeat mutated ((AATGTGTGGG)3 ; YlTEL_EMSA-M5) or vice versa ((TTATACATTG)3 ; YlTEL_EMSA-M6). Mutated residues are underlined . 300, 500, and 1000 ng of linearized <t>pUC19</t> were used as a competitor. In all EMSA experiments the dsDNA probes were prepared by annealing ss oligonucleotides as described under “Experimental Procedures.”
    Plasmid Puc19, supplied by Stratagene, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid puc19/product/Stratagene
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    plasmid puc19 - by Bioz Stars, 2019-10
    79/100 stars
      Buy from Supplier

    88
    Stratagene puc19 derived pbluescript sk vector
    DNA binding properties of Tay1 analyzed by EMSA. A , shown is EMSA analysis using radiolabeled YlTEL (50-bp EcoRI fragment of pMH25) as a probe. The DNA competitors indicated above the lanes were used at a 1000-fold excess over the YlTEL probe. B , Tay1p is able to bind dsDNA probes carrying ≥1.5 telomeric repeats. C , EMSA analysis using radiolabeled dsDNA oligonucleotides containing three telomeric repeats ( telomeric' YlTEL_EMSA-1) and three non-telomeric repeats ( nontelomeric YlTEL_EMSA-C), respectively. 100, 300, and 500 ng of poly(dI-dC) DNA were used as competitor DNA. The two bands ( C1 and C2 ) most likely represent complexes containing one and two Tay1 protein molecules, respectively. D , shown is an EMSA analysis of Tay1p binding to radiolabeled mutated telomeric probes containing either conserved GT and GG dinucleotides with other residues of the telomeric repeat mutated ((AATGTGTGGG)3 ; YlTEL_EMSA-M5) or vice versa ((TTATACATTG)3 ; YlTEL_EMSA-M6). Mutated residues are underlined . 300, 500, and 1000 ng of linearized <t>pUC19</t> were used as a competitor. In all EMSA experiments the dsDNA probes were prepared by annealing ss oligonucleotides as described under “Experimental Procedures.”
    Puc19 Derived Pbluescript Sk Vector, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc19 derived pbluescript sk vector/product/Stratagene
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    puc19 derived pbluescript sk vector - by Bioz Stars, 2019-10
    88/100 stars
      Buy from Supplier

    Image Search Results


    DNA binding properties of Tay1 analyzed by EMSA. A , shown is EMSA analysis using radiolabeled YlTEL (50-bp EcoRI fragment of pMH25) as a probe. The DNA competitors indicated above the lanes were used at a 1000-fold excess over the YlTEL probe. B , Tay1p is able to bind dsDNA probes carrying ≥1.5 telomeric repeats. C , EMSA analysis using radiolabeled dsDNA oligonucleotides containing three telomeric repeats ( telomeric' YlTEL_EMSA-1) and three non-telomeric repeats ( nontelomeric YlTEL_EMSA-C), respectively. 100, 300, and 500 ng of poly(dI-dC) DNA were used as competitor DNA. The two bands ( C1 and C2 ) most likely represent complexes containing one and two Tay1 protein molecules, respectively. D , shown is an EMSA analysis of Tay1p binding to radiolabeled mutated telomeric probes containing either conserved GT and GG dinucleotides with other residues of the telomeric repeat mutated ((AATGTGTGGG)3 ; YlTEL_EMSA-M5) or vice versa ((TTATACATTG)3 ; YlTEL_EMSA-M6). Mutated residues are underlined . 300, 500, and 1000 ng of linearized pUC19 were used as a competitor. In all EMSA experiments the dsDNA probes were prepared by annealing ss oligonucleotides as described under “Experimental Procedures.”

    Journal:

    Article Title: Tay1 Protein, a Novel Telomere Binding Factor from Yarrowia lipolytic

    doi: 10.1074/jbc.M110.127605

    Figure Lengend Snippet: DNA binding properties of Tay1 analyzed by EMSA. A , shown is EMSA analysis using radiolabeled YlTEL (50-bp EcoRI fragment of pMH25) as a probe. The DNA competitors indicated above the lanes were used at a 1000-fold excess over the YlTEL probe. B , Tay1p is able to bind dsDNA probes carrying ≥1.5 telomeric repeats. C , EMSA analysis using radiolabeled dsDNA oligonucleotides containing three telomeric repeats ( telomeric' YlTEL_EMSA-1) and three non-telomeric repeats ( nontelomeric YlTEL_EMSA-C), respectively. 100, 300, and 500 ng of poly(dI-dC) DNA were used as competitor DNA. The two bands ( C1 and C2 ) most likely represent complexes containing one and two Tay1 protein molecules, respectively. D , shown is an EMSA analysis of Tay1p binding to radiolabeled mutated telomeric probes containing either conserved GT and GG dinucleotides with other residues of the telomeric repeat mutated ((AATGTGTGGG)3 ; YlTEL_EMSA-M5) or vice versa ((TTATACATTG)3 ; YlTEL_EMSA-M6). Mutated residues are underlined . 300, 500, and 1000 ng of linearized pUC19 were used as a competitor. In all EMSA experiments the dsDNA probes were prepared by annealing ss oligonucleotides as described under “Experimental Procedures.”

    Article Snippet: The resulting dsDNA was digested with BamHI and HindIII restriction endonucleases (New England Biolabs) and cloned into the plasmid pUC19 (Stratagene) digested with BamHI and HindIII.

    Techniques: Binding Assay