puc19  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pUC19 Vector
    Description:
    pUC19 Vector 250 ug
    Catalog Number:
    N3041L
    Price:
    294
    Size:
    250 ug
    Category:
    Vectors Plasmids
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs puc19
    pUC19 Vector
    pUC19 Vector 250 ug
    https://www.bioz.com/result/puc19/product/New England Biolabs
    Average 99 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    puc19 - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct"

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-13-82

    Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.
    Figure Legend Snippet: Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Techniques Used: Recombinant, Derivative Assay, Transformation Assay

    Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.
    Figure Legend Snippet: Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.

    Techniques Used: Plasmid Preparation, Expressing, Sequencing, Subcloning, Construct, Derivative Assay

    Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.
    Figure Legend Snippet: Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Techniques Used: Activation Assay, Derivative Assay, Transformation Assay, Recombinant

    Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.
    Figure Legend Snippet: Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.

    Techniques Used: Inhibition, Derivative Assay, Recombinant, Incubation, Positive Control

    2) Product Images from "Conversion of DNA methyltransferases into azidonucleosidyl transferases via synthetic cofactors"

    Article Title: Conversion of DNA methyltransferases into azidonucleosidyl transferases via synthetic cofactors

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki306

    DNA alkylation reactions with pUC19. DNA alkylation reactions of R.EcoRI linearized pUC19 by aziridine cofactor mimics 1 , 4a and 4b . Reaction mixtures were prepared by addition of appropriate stock solutions to a total volume of 20 μl containing 14.3 nM DNA buffered with 20 mM Tris–OAc (pH 6.0), 50 mM KOAc, 10 mM Mg(OAc) 2 , 0.01% Triton X-100. The mixtures were analyzed on a 2% agarose gel run at 120 V for 2 h. ( A ) Increase in M.TaqI concentration: (1) DNA; (2) DNA, 100 μM cofactor 1 , R.Taq α I; (3) DNA, 100 μM 1 , 20 nM M.TaqI, R.Taq α I; (4) DNA, 100 μM 1 , 100 nM M.TaqI, R.Taq α I; (5) DNA, 100 μM 1 , 200 nM M.TaqI, R.Taq α I; (6–9) same as 2–5, but with aryl azide cofactor 4a ; (10–13) same as 2–5, but with alkyl azide cofactor 4b ; (14) DNA, R.Taq α 1. ( B ) Increase in cofactor concentration. (1) DNA; (2) DNA, 200 nM M.TaqI, R.Taq α I; (3) DNA, 10 μM cofactor 1 , 200 nM M.TaqI, R.Taq α I; (4) DNA, 50 μM 1 , 200 nM M.TaqI, R.Taq α I; (5) DNA, 100 μM 1 , 200 nM M.TaqI, R.Taq α I; (6–9) same as 2–5, but with aryl azide cofactor 4a ; (10–13) same as 2–5, but with alkyl azide cofactor 4b ; (14) DNA, R.Taq α I.
    Figure Legend Snippet: DNA alkylation reactions with pUC19. DNA alkylation reactions of R.EcoRI linearized pUC19 by aziridine cofactor mimics 1 , 4a and 4b . Reaction mixtures were prepared by addition of appropriate stock solutions to a total volume of 20 μl containing 14.3 nM DNA buffered with 20 mM Tris–OAc (pH 6.0), 50 mM KOAc, 10 mM Mg(OAc) 2 , 0.01% Triton X-100. The mixtures were analyzed on a 2% agarose gel run at 120 V for 2 h. ( A ) Increase in M.TaqI concentration: (1) DNA; (2) DNA, 100 μM cofactor 1 , R.Taq α I; (3) DNA, 100 μM 1 , 20 nM M.TaqI, R.Taq α I; (4) DNA, 100 μM 1 , 100 nM M.TaqI, R.Taq α I; (5) DNA, 100 μM 1 , 200 nM M.TaqI, R.Taq α I; (6–9) same as 2–5, but with aryl azide cofactor 4a ; (10–13) same as 2–5, but with alkyl azide cofactor 4b ; (14) DNA, R.Taq α 1. ( B ) Increase in cofactor concentration. (1) DNA; (2) DNA, 200 nM M.TaqI, R.Taq α I; (3) DNA, 10 μM cofactor 1 , 200 nM M.TaqI, R.Taq α I; (4) DNA, 50 μM 1 , 200 nM M.TaqI, R.Taq α I; (5) DNA, 100 μM 1 , 200 nM M.TaqI, R.Taq α I; (6–9) same as 2–5, but with aryl azide cofactor 4a ; (10–13) same as 2–5, but with alkyl azide cofactor 4b ; (14) DNA, R.Taq α I.

    Techniques Used: Agarose Gel Electrophoresis, Concentration Assay

    3) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    4) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    5) Product Images from "Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974"

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974

    Journal:

    doi: 10.1128/AAC.00782-09

    In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive
    Figure Legend Snippet: In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive

    Techniques Used: In Vivo, Mutagenesis, Clone Assay, Plasmid Preparation, Transformation Assay

    6) Product Images from "Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974 "

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974

    Journal:

    doi: 10.1128/AAC.00782-09

    In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive
    Figure Legend Snippet: In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive

    Techniques Used: In Vivo, Mutagenesis, Clone Assay, Plasmid Preparation, Transformation Assay

    7) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    8) Product Images from "Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974 "

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974

    Journal:

    doi: 10.1128/AAC.00782-09

    In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive
    Figure Legend Snippet: In vivo activities of Streptomyces SerRS1 and SerRS2. s erS1 , s erS2 , E. coli s erS , and the s erS2 ( H270G ) mutant were cloned into pUC19 (pUC) vector under the control of the glnS ). (A) The plasmids were transformed into an E. coli temperature-sensitive

    Techniques Used: In Vivo, Mutagenesis, Clone Assay, Plasmid Preparation, Transformation Assay

    9) Product Images from "Selective Microbial Genomic DNA Isolation Using Restriction Endonucleases"

    Article Title: Selective Microbial Genomic DNA Isolation Using Restriction Endonucleases

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0109061

    Analysis of biotinylated DpnI. (A) pUC19 was incubated with DpnI, DpnI-biotin or commercially sourced DpnI in the presence or absence of 10 mM magnesium chloride. The digested fragments were separated on a 1.5% agarose gel. (B) A FAM-labeled DNA duplex containing one G m6 ATC site was incubated with increasing amounts of DpnI or DpnI-biotin (0 to 1200 ng). The reactions were separated on a 20% TBE gel and analyzed with fluorescence imaging. (C) An unmethylated 651 bp DNA fragment and a Dam-methylated 477 bp DNA fragment were combined and incubated with increasing amounts of immobilized DpnI-biotin (80–180 µl). DNA was eluted using GTC and desalted. All fractions were separated on a 3% agarose gel.
    Figure Legend Snippet: Analysis of biotinylated DpnI. (A) pUC19 was incubated with DpnI, DpnI-biotin or commercially sourced DpnI in the presence or absence of 10 mM magnesium chloride. The digested fragments were separated on a 1.5% agarose gel. (B) A FAM-labeled DNA duplex containing one G m6 ATC site was incubated with increasing amounts of DpnI or DpnI-biotin (0 to 1200 ng). The reactions were separated on a 20% TBE gel and analyzed with fluorescence imaging. (C) An unmethylated 651 bp DNA fragment and a Dam-methylated 477 bp DNA fragment were combined and incubated with increasing amounts of immobilized DpnI-biotin (80–180 µl). DNA was eluted using GTC and desalted. All fractions were separated on a 3% agarose gel.

    Techniques Used: Incubation, Agarose Gel Electrophoresis, Labeling, Fluorescence, Imaging, Methylation

    10) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    11) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    12) Product Images from "Impaired STING Pathway in Human Osteosarcoma U2OS Cells Contributes to the Growth of ICP0-Null Mutant Herpes Simplex Virus"

    Article Title: Impaired STING Pathway in Human Osteosarcoma U2OS Cells Contributes to the Growth of ICP0-Null Mutant Herpes Simplex Virus

    Journal:

    doi: 10.1128/JVI.00006-17

    Restoration of STING expression in U2OS cells rescues innate immunity. (A) The U2OS cells were either mock transfected (lanes 2 to 4) or transfected with STING (lanes 8 to 10), IFI16-expressing plasmids (lanes 11 to 13), or pUC19 (lanes 5 to 7) as a control.
    Figure Legend Snippet: Restoration of STING expression in U2OS cells rescues innate immunity. (A) The U2OS cells were either mock transfected (lanes 2 to 4) or transfected with STING (lanes 8 to 10), IFI16-expressing plasmids (lanes 11 to 13), or pUC19 (lanes 5 to 7) as a control.

    Techniques Used: Expressing, Transfection

    13) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    14) Product Images from "Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants"

    Article Title: Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkj483

    Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.
    Figure Legend Snippet: Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.

    Techniques Used: Variant Assay, Plasmid Preparation, Derivative Assay, Incubation

    15) Product Images from "Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants"

    Article Title: Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkj483

    Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.
    Figure Legend Snippet: Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.

    Techniques Used: Variant Assay, Plasmid Preparation, Derivative Assay, Incubation

    16) Product Images from "Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants"

    Article Title: Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkj483

    Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.
    Figure Legend Snippet: Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.

    Techniques Used: Variant Assay, Plasmid Preparation, Derivative Assay, Incubation

    17) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    18) Product Images from "C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents"

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1097

    ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.
    Figure Legend Snippet: ( A ) Influence of ionic strength on pUC19 condensation (400 ng) by OC3 and MC3 (25 μM) opioid compounds. Condensation reactions on pUC19 (400 ng) by opioid compounds in ( B ) acidic NaOAc buffer (80 mM, pH = 4.0), and ( C ) basic Tris buffer (80 mM, pH = 9.0) in the presence of 25 mM NaCl.

    Techniques Used:

    ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.
    Figure Legend Snippet: ( A ) Agarose gel electrophoresis of supercoiled (400 ng) and ( B ) a 742 bp dsDNA fragment of pUC19 (400 ng) exposed to increasing concentrations of MC3, OC3 and HC3 . Reactions were carried out in the presence of 25 mM NaCl for 5 h at 37°C prior to electrophoretic analysis.

    Techniques Used: Agarose Gel Electrophoresis

    Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .
    Figure Legend Snippet: Atomic force microscopy (AFM) images of MC3 -treated supercoiled and HindIII linearized pUC19 DNA; ( A–D ) supercoiled pUC19 with 8, 9, 10 and 20 μM MC3 ; ( E–H ) linear pUC19 with 5, 10, 20 and 50 μM MC3 .

    Techniques Used: Microscopy

    19) Product Images from "Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants"

    Article Title: Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkj483

    Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.
    Figure Legend Snippet: Variant E156K digestion of a substrate containing a single 5′-GCTGCCGC-3′ site. Plasmid pUC-GCT was derived from pUC19. The enzyme/substrate (E/S) molar ratio is given above each lane. Lane M, 1 kb DNA ladder. All reactions were incubated at 37°C for 60 min in 1× NEB BamHI buffer.

    Techniques Used: Variant Assay, Plasmid Preparation, Derivative Assay, Incubation

    20) Product Images from "Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct"

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-13-82

    Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.
    Figure Legend Snippet: Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Techniques Used: Recombinant, Derivative Assay, Transformation Assay

    Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.
    Figure Legend Snippet: Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.

    Techniques Used: Plasmid Preparation, Expressing, Sequencing, Subcloning, Construct, Derivative Assay

    Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.
    Figure Legend Snippet: Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Techniques Used: Activation Assay, Derivative Assay, Transformation Assay, Recombinant

    Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.
    Figure Legend Snippet: Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.

    Techniques Used: Inhibition, Derivative Assay, Recombinant, Incubation, Positive Control

    Related Articles

    Clone Assay:

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The Vibrio cholera VC1422 glycine riboswitch (VC12-WT) and single aptamer glycine riboswitch (VC1, VC2) constructs were made by annealing synthetic oligonucleotides and amplified by PCR. .. The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid. .. The sequence of the cloned plasmid DNA was confirmed by DNA sequencing.

    Article Title: The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine
    Article Snippet: The resulting PCR product was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) to create pTN35. .. The insert of pTN35, containing the upstream region of bscN , was cloned into pUC19 (New England BioLabs, Ipswich, MA) via EcoRI and XbaI sites to obtain pTN41. .. A 1,258-bp DNA fragment extending from codon 436 of bscN into the adjacent downstream region was amplified from KM22 genomic DNA by PCR using primers bscN f2-for and bscN f2-rev , which were designed such that XbaI and HindIII sites would be generated at the 5′ and 3′ ends, respectively.

    Article Title: A New Type of Non-Ca2+-buffering Apo(a)-based Fluorescent Indicator for Intraluminal Ca2+ in the Endoplasmic Reticulum
    Article Snippet: Paragraph title: DNA Cloning ... YC4er and YC2.1 ( ) were transferred into pUC19 (New England Biolabs, Frankfurt, Germany) as full-length HindIII/EcoRI fragments, and the calmodulin-M13 regions were exchanged for the restricted PCR products.

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: The E. coli serS gene, including its native promoter and terminator, was amplified from E. coli JM109 genomic DNA using primers EcserS-F and EcserS-R. .. The product was cloned into the XbaI and EcoRI sites of pUC19 to produce pUC-EcSerRS. .. DNA sequencing was performed by the Ohio University Genomics Facility.

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: Genetic complementation was used to test the in vivo activities of SerRS1 and SerRS2. .. The host strain was an E. coli mutant (K28) that is ineffective at making its own serS gene product at high temperature ( , ). serS1 and serS2 were separately cloned into a high-copy vector, pUC19, under the control of a constitutive glnS ′ promoter, which is a glnS mutant promoter used for aaRS expression in E. coli , and the resulting plasmids were transformed into E. coli K28. .. At the permissive temperature (30°C), strains carrying different plasmids grew at similar rates (Fig. ).

    Amplification:

    Article Title: A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes
    Article Snippet: To generate a high copy vector harboring the PBAD promoter system, the 1693-bp fragment between the start of the araC gene and the end of the rrnB terminator was amplified from pBAD33 with primers 20 and 21. .. The 2284-bp fragment of pUC19 (New England Biolabs) containing the origin and AmpR marker was amplified with primers 22 and 23. .. These two fragments were digested with Xho I and Bgl II and ligated to form plasmid pBAD34.

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The Vibrio cholera VC1422 glycine riboswitch (VC12-WT) and single aptamer glycine riboswitch (VC1, VC2) constructs were made by annealing synthetic oligonucleotides and amplified by PCR. .. The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid.

    Article Title: The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine
    Article Snippet: For construction of KM22Δ bscN , a 1,080-bp DNA fragment covering the region immediately 5′ of bscN and extending to codon 7 was amplified by PCR from KM22 genomic DNA using primers bscN f1-for and bscN f1-rev , which were designed such that EcoRI and XbaI sites would be generated at the 5′ and 3′ ends, respectively. .. The insert of pTN35, containing the upstream region of bscN , was cloned into pUC19 (New England BioLabs, Ipswich, MA) via EcoRI and XbaI sites to obtain pTN41.

    Article Title: A New Type of Non-Ca2+-buffering Apo(a)-based Fluorescent Indicator for Intraluminal Ca2+ in the Endoplasmic Reticulum
    Article Snippet: One and two kringles of apo(a) were amplified by PCR, thereby introducing SphI and SacI restriction sites at their 5′- and 3′-ends, respectively. .. YC4er and YC2.1 ( ) were transferred into pUC19 (New England Biolabs, Frankfurt, Germany) as full-length HindIII/EcoRI fragments, and the calmodulin-M13 regions were exchanged for the restricted PCR products.

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. Cav 2.1 containing the synprint site from Cav 2.2 was constructed by replacement of amino acid residues 747–981 of Cav 2.1 with amino acid residues 741–951 of Cav 2.2 in PUC19/rbA-NT (see above) that was modified at the 3 Sgr AI insert boundary to create a dual-specific Pin AI/ Sgr AI-compatible site, to circumvent an internal Sgr AI site in the Cav 2.2 synprint region.

    Positive Control:

    Article Title: Reconstruction of cysteine biosynthesis using engineered cysteine-free enzymes
    Article Snippet: Colonies that formed on minimal medium were isolated. .. Two control experiments were also conducted: a positive control consisting of electrocompetent ΔcysE cells transformed with cysE in pUC19 vector and the other with electrocompetent ΔcysKΔcysM cells transformed with codon optimized cysM in pUC19 vector. .. The second positive control group supplemented the lack of cysteine through growing the knockout cells with empty pUC19 vectors on a fully supplemented media, LB + Amp, and were allowed to incubate at 37 °C overnight.

    Construct:

    Article Title: A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes
    Article Snippet: The 2284-bp fragment of pUC19 (New England Biolabs) containing the origin and AmpR marker was amplified with primers 22 and 23. .. The Xma I/ Hind III fragments containing BTE or BTE-H204A from pBAD18-BTE and pBAD18-BTE-H204A were inserted into pBAD34 to form plasmids pBAD34-BTE and pBAD34-BTE-H204A.

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: Paragraph title: DNA constructs ... The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid.

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The 243-bp partial duplex substrate was generated from a modified version of pUC19, pUC19-TS. .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI. .. The insert was created by annealing the following synthetic oligonucleotides: 5′-AATTCCTCAGCAATCCTCAGCCAGGCCTCAGCTGGCCTCAGCG-3′ and 5′-GATCCGCTGAGGCCAGCTGAGGCCTGGCTGAGGATTGCTGAGG-3′.

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Our results show that localization and function of exogenous Ca2+ channels in nerve terminals of superior cervical ganglion neurons require a functional synprint site and suggest that binding of soluble NSF attachment protein receptor (SNARE) proteins to the synprint site is a necessary permissive event for nerve terminal localization of presynaptic Ca2+ channels. .. Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. After mutagenesis by loop-out deletion and confirmation of cDNA sequence, the isolated clones were digested with Xho I/ Sgr AI and inserted into Xho I/ Sgr AI-digested rbA-I/pMT2.

    Electrophoresis:

    Article Title: The C-terminal Zinc Finger of UvrA Does Not Bind DNA Directly but Regulates Damage-specific DNA Binding
    Article Snippet: For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend. .. For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend.

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex 147 bp and 207 bp DNA fragments containing the sea-urchin nucleosome positioning sequence were isolated by restriction digestion and preparative electrophoresis from plasmid p5S-207-18 [ ], kindly provided by Dr. Sergei Grigoryev, Penn State University. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease.

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega). .. Following incubation, topoisomers were separated via gel electrophoresis on a 1.0% (w/v) agarose gel for 2 h at 8 V/cm in TAE (Tris/acetate/EDTA) buffer.

    Incubation:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: Topo I (Topoisomerase I) assays were performed as described [ ]. .. Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega). .. Following incubation, topoisomers were separated via gel electrophoresis on a 1.0% (w/v) agarose gel for 2 h at 8 V/cm in TAE (Tris/acetate/EDTA) buffer.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: Unless otherwise noted, the reaction conditions were as follows: purified protein and DNA substrate were combined in standard RpnA buffer (10 mM Tris-HCl, pH 9.0, 50 mM NaCl, 10 mM MgCl2 , 15 mM CaCl2 , 1 mM DTT) and incubated at 37°C. .. Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ).

    Activity Assay:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega). .. After electrophoresis, the gel was stained with ethidium bromide and imaged with a Fuji LAS-3000.

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: We envision that the developed assay could be regarded as a dependable quality control measure for various in vitro DNA transposition technology applications, including those aimed for mammalian genetics research and future gene therapy. .. The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. E. coli strains DH10B and DB3.1 (Invitrogen by Life Technologies) were used for transformations.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: Paragraph title: (ii) Assessing RpnA activity. ... Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ).

    Expressing:

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: Genetic complementation was used to test the in vivo activities of SerRS1 and SerRS2. .. The host strain was an E. coli mutant (K28) that is ineffective at making its own serS gene product at high temperature ( , ). serS1 and serS2 were separately cloned into a high-copy vector, pUC19, under the control of a constitutive glnS ′ promoter, which is a glnS mutant promoter used for aaRS expression in E. coli , and the resulting plasmids were transformed into E. coli K28. .. At the permissive temperature (30°C), strains carrying different plasmids grew at similar rates (Fig. ).

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Our results show that localization and function of exogenous Ca2+ channels in nerve terminals of superior cervical ganglion neurons require a functional synprint site and suggest that binding of soluble NSF attachment protein receptor (SNARE) proteins to the synprint site is a necessary permissive event for nerve terminal localization of presynaptic Ca2+ channels. .. Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. After mutagenesis by loop-out deletion and confirmation of cDNA sequence, the isolated clones were digested with Xho I/ Sgr AI and inserted into Xho I/ Sgr AI-digested rbA-I/pMT2.

    BIA-KA:

    Article Title: The C-terminal Zinc Finger of UvrA Does Not Bind DNA Directly but Regulates Damage-specific DNA Binding
    Article Snippet: The 5′-end-labeled duplex DNA (2 n m , F26 50/NDB) was treated with UvrABC (20 n m Wt or ZnG Bca UvrA, 100 n m Bca UvrB, and 50 n m Tma UvrC) in 20 µl of UvrABC buffer (50 m m Tris-HCl, pH 7.5, 50 m m KCl, 10 m m MgCl2 , 1 m m ATP, and 5 m m DTT) at 55 °C for the indicated time. .. For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend.

    Modification:

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid. .. The sequence of the cloned plasmid DNA was confirmed by DNA sequencing.

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The 243-bp partial duplex substrate was generated from a modified version of pUC19, pUC19-TS. .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI.

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Our results show that localization and function of exogenous Ca2+ channels in nerve terminals of superior cervical ganglion neurons require a functional synprint site and suggest that binding of soluble NSF attachment protein receptor (SNARE) proteins to the synprint site is a necessary permissive event for nerve terminal localization of presynaptic Ca2+ channels. .. Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. After mutagenesis by loop-out deletion and confirmation of cDNA sequence, the isolated clones were digested with Xho I/ Sgr AI and inserted into Xho I/ Sgr AI-digested rbA-I/pMT2.

    Transformation Assay:

    Article Title: Reconstruction of cysteine biosynthesis using engineered cysteine-free enzymes
    Article Snippet: Colonies that formed on minimal medium were isolated. .. Two control experiments were also conducted: a positive control consisting of electrocompetent ΔcysE cells transformed with cysE in pUC19 vector and the other with electrocompetent ΔcysKΔcysM cells transformed with codon optimized cysM in pUC19 vector. .. The second positive control group supplemented the lack of cysteine through growing the knockout cells with empty pUC19 vectors on a fully supplemented media, LB + Amp, and were allowed to incubate at 37 °C overnight.

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: Genetic complementation was used to test the in vivo activities of SerRS1 and SerRS2. .. The host strain was an E. coli mutant (K28) that is ineffective at making its own serS gene product at high temperature ( , ). serS1 and serS2 were separately cloned into a high-copy vector, pUC19, under the control of a constitutive glnS ′ promoter, which is a glnS mutant promoter used for aaRS expression in E. coli , and the resulting plasmids were transformed into E. coli K28. .. At the permissive temperature (30°C), strains carrying different plasmids grew at similar rates (Fig. ).

    Chromatography:

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. Transposons have been described earlier: Cat-Mu, 1.3 kb,24 Kan/Neo-Mu, 1.9 kb,57 and Puro-eGFP-Mu, 2.1 kb.57 Each transposon was released from its corresponding vector plasmid by BglII digestion that leaves 4 nucleotide 5′-overhangs, generating a precut end configuration.

    Ligation:

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks.

    Introduce:

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: The 199-bp circles were obtained by ligation with T4 DNA Ligase (NEB) of 199-bp HindIII fragment at room temperature for 1 h. Gel electrophoresis was performed at 7.5 V/cm in TBE buffer containing 10 mM MgCl2 at 5°C for 2.5 h or at 22°C for 1.5 h using 4–12% gradient Novex polyacrylamide gels (Invitrogen). .. pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. The nicking endonuclease was then inactivated at 65°C for 20 min. 5′-phosphates at the nicks were removed by Calf Intestinal Alkaline Phosphatase (NEB).

    Generated:

    Article Title: The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine
    Article Snippet: For construction of KM22Δ bscN , a 1,080-bp DNA fragment covering the region immediately 5′ of bscN and extending to codon 7 was amplified by PCR from KM22 genomic DNA using primers bscN f1-for and bscN f1-rev , which were designed such that EcoRI and XbaI sites would be generated at the 5′ and 3′ ends, respectively. .. The insert of pTN35, containing the upstream region of bscN , was cloned into pUC19 (New England BioLabs, Ipswich, MA) via EcoRI and XbaI sites to obtain pTN41.

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The 243-bp partial duplex substrate was generated from a modified version of pUC19, pUC19-TS. .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI.

    other:

    Article Title: A DNA break inducer activates the anticodon nuclease RloC and the adaptive immunity in Acinetobacter baylyi ADP1
    Article Snippet: Mitomycin C (MMC), nalidixic acid (NAL), serine hydroxamate (SH), nucleotide solutions, DNA oligonucleotides and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) were purchased from Sigma; RNA oligonucleotides were obtained from Integrated DNA Technologies; [γ-32 P]ATP from PerkinElmer; DNA restriction nucleases, DNA polymerases, T4 DNA ligase, T4 polynucleotide kinase, T4 RNA ligase 1, calf intestinal alkaline phosphatase, DNase I and pUC19 DNA from New England Biolabs; nuclease P1 from USB; RNases T1 and BC from P-L Biochemicals and a His6 tag antibody from Roche.

    Article Title: Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants
    Article Snippet: All single site substrates were created by ligating annealed oligo duplexes into pUC19 digested with SalI and BamHI.

    Polymerase Chain Reaction:

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The Vibrio cholera VC1422 glycine riboswitch (VC12-WT) and single aptamer glycine riboswitch (VC1, VC2) constructs were made by annealing synthetic oligonucleotides and amplified by PCR. .. The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid.

    Article Title: The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine
    Article Snippet: The resulting PCR product was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) to create pTN35. .. The insert of pTN35, containing the upstream region of bscN , was cloned into pUC19 (New England BioLabs, Ipswich, MA) via EcoRI and XbaI sites to obtain pTN41.

    Article Title: A New Type of Non-Ca2+-buffering Apo(a)-based Fluorescent Indicator for Intraluminal Ca2+ in the Endoplasmic Reticulum
    Article Snippet: One and two kringles of apo(a) were amplified by PCR, thereby introducing SphI and SacI restriction sites at their 5′- and 3′-ends, respectively. .. YC4er and YC2.1 ( ) were transferred into pUC19 (New England Biolabs, Frankfurt, Germany) as full-length HindIII/EcoRI fragments, and the calmodulin-M13 regions were exchanged for the restricted PCR products. .. The resultant constructs, termed apoK1/2-cyto/er, were confirmed by automated sequencing.

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI. .. The annealing reaction created compatible ends with the BamHI- and EcoRI-digested pUC19 vector.

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. Cav 2.1 containing the synprint site from Cav 2.2 was constructed by replacement of amino acid residues 747–981 of Cav 2.1 with amino acid residues 741–951 of Cav 2.2 in PUC19/rbA-NT (see above) that was modified at the 3 Sgr AI insert boundary to create a dual-specific Pin AI/ Sgr AI-compatible site, to circumvent an internal Sgr AI site in the Cav 2.2 synprint region.

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks.

    Binding Assay:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: Protein–ssDNA binding was determined with a double filter-binding assay using an ssDNA probe (oligo 826, 5′TGTCTAATCCCGAAAGGCCCTGCCACTGAAATCAACACCTAAAGCATTGA) that was 5′-radiolabelled using T4 polynucleotide kinase and [γ32P]ATP [ ]. .. Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega).

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. Following digestion transposons were purified using anion exchange chromatography as described.

    Nucleic Acid Electrophoresis:

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. The samples were then labeled by T4 Polynucleotide Kinase (NEB) in a 12-µl total volume, containing 7 µl of [γ-32 P]ATP [10 mCi/ml, 6000 Ci/mmol (1 Ci = 37 GBq); PerkinElmer].

    Methylation:

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: pUC19 plasmid DNA (New England Biolabs, Ipswich, MA, USA) was used as a model DNA for establishment of the method. .. pUC19 plasmid DNA (New England Biolabs, Ipswich, MA, USA) was used as a model DNA for establishment of the method.

    Mutagenesis:

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid. .. The sequence of the cloned plasmid DNA was confirmed by DNA sequencing.

    Article Title: The Bordetella bronchiseptica Type III Secretion System Is Required for Persistence and Disease Severity but Not Transmission in Swine
    Article Snippet: Paragraph title: Cloning and construction of the B. bronchiseptica T3SS mutant (KM22Δ bscN ). ... The insert of pTN35, containing the upstream region of bscN , was cloned into pUC19 (New England BioLabs, Ipswich, MA) via EcoRI and XbaI sites to obtain pTN41.

    Article Title: A New Type of Non-Ca2+-buffering Apo(a)-based Fluorescent Indicator for Intraluminal Ca2+ in the Endoplasmic Reticulum
    Article Snippet: YC4er and YC2.1 ( ) were transferred into pUC19 (New England Biolabs, Frankfurt, Germany) as full-length HindIII/EcoRI fragments, and the calmodulin-M13 regions were exchanged for the restricted PCR products. .. The same PCR-based strategy was used to generate apoK12-er, containing 12 kringles of apo(a).

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: Genetic complementation was used to test the in vivo activities of SerRS1 and SerRS2. .. The host strain was an E. coli mutant (K28) that is ineffective at making its own serS gene product at high temperature ( , ). serS1 and serS2 were separately cloned into a high-copy vector, pUC19, under the control of a constitutive glnS ′ promoter, which is a glnS mutant promoter used for aaRS expression in E. coli , and the resulting plasmids were transformed into E. coli K28. .. At the permissive temperature (30°C), strains carrying different plasmids grew at similar rates (Fig. ).

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Paragraph title: Construction of Mutant Cav 2.1 Channels. ... Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker.

    Isolation:

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex 147 bp and 207 bp DNA fragments containing the sea-urchin nucleosome positioning sequence were isolated by restriction digestion and preparative electrophoresis from plasmid p5S-207-18 [ ], kindly provided by Dr. Sergei Grigoryev, Penn State University. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease.

    Labeling:

    Article Title: The C-terminal Zinc Finger of UvrA Does Not Bind DNA Directly but Regulates Damage-specific DNA Binding
    Article Snippet: The 5′-end-labeled duplex DNA (2 n m , F26 50/NDB) was treated with UvrABC (20 n m Wt or ZnG Bca UvrA, 100 n m Bca UvrB, and 50 n m Tma UvrC) in 20 µl of UvrABC buffer (50 m m Tris-HCl, pH 7.5, 50 m m KCl, 10 m m MgCl2 , 1 m m ATP, and 5 m m DTT) at 55 °C for the indicated time. .. For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend. .. The reactions were terminated by addition of EDTA (20 m m ).

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: In each case the shorter DNA strand was radioactively labeled. .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI.

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex DNAs were obtained by mixing a labeled oligonucleotide with a 1.05-fold molar excess of its unlabeled complement. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease.

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. Subsequently, dephosphorylated DNA was purified from phosphatase and salts using QIAGEN PCR purification kit.

    Purification:

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The partial duplex substrate was purified from free nucleotide using a Sephadex G50 spin column and dialyzed into TEN buffer (10 m m Tris-HCl (pH 7.5), 1 m m EDTA, 50 m m NaCl). .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI.

    Article Title: Temperature dependence of DNA persistence length
    Article Snippet: pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks. .. pUC19 DNA (NEB) was treated with Nt.BstNBI nicking endonuclease (NEB) to introduce single-stranded nicks.

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. Transposons have been described earlier: Cat-Mu, 1.3 kb,24 Kan/Neo-Mu, 1.9 kb,57 and Puro-eGFP-Mu, 2.1 kb.57 Each transposon was released from its corresponding vector plasmid by BglII digestion that leaves 4 nucleotide 5′-overhangs, generating a precut end configuration.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: Unless otherwise noted, the reaction conditions were as follows: purified protein and DNA substrate were combined in standard RpnA buffer (10 mM Tris-HCl, pH 9.0, 50 mM NaCl, 10 mM MgCl2 , 15 mM CaCl2 , 1 mM DTT) and incubated at 37°C. .. Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ).

    Sequencing:

    Article Title: A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes
    Article Snippet: The 2284-bp fragment of pUC19 (New England Biolabs) containing the origin and AmpR marker was amplified with primers 22 and 23. .. The Xma I/ Hind III fragments containing BTE or BTE-H204A from pBAD18-BTE and pBAD18-BTE-H204A were inserted into pBAD34 to form plasmids pBAD34-BTE and pBAD34-BTE-H204A.

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The Vibrio cholera VC1422 glycine riboswitch (VC12-WT) and single aptamer glycine riboswitch (VC1, VC2) constructs were made by annealing synthetic oligonucleotides and amplified by PCR. .. The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid. .. The sequence of the cloned plasmid DNA was confirmed by DNA sequencing.

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex 147 bp and 207 bp DNA fragments containing the sea-urchin nucleosome positioning sequence were isolated by restriction digestion and preparative electrophoresis from plasmid p5S-207-18 [ ], kindly provided by Dr. Sergei Grigoryev, Penn State University. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease.

    Filter-binding Assay:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: For the double filter-binding assay, the helicase concentration was 150 nM (hexamer) and the ssDNA concentration was 4 nM. .. Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega).

    Polyacrylamide Gel Electrophoresis:

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex formation was monitored by non-denaturing PAGE. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs).

    Plasmid Preparation:

    Article Title: Reconstruction of cysteine biosynthesis using engineered cysteine-free enzymes
    Article Snippet: Colonies that formed on minimal medium were isolated. .. Two control experiments were also conducted: a positive control consisting of electrocompetent ΔcysE cells transformed with cysE in pUC19 vector and the other with electrocompetent ΔcysKΔcysM cells transformed with codon optimized cysM in pUC19 vector. .. The second positive control group supplemented the lack of cysteine through growing the knockout cells with empty pUC19 vectors on a fully supplemented media, LB + Amp, and were allowed to incubate at 37 °C overnight.

    Article Title: A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes
    Article Snippet: Paragraph title: Plasmid Construction ... The 2284-bp fragment of pUC19 (New England Biolabs) containing the origin and AmpR marker was amplified with primers 22 and 23.

    Article Title: Identification of a tertiary interaction important for cooperative ligand binding by the glycine riboswitch
    Article Snippet: The Vibrio cholera VC1422 glycine riboswitch (VC12-WT) and single aptamer glycine riboswitch (VC1, VC2) constructs were made by annealing synthetic oligonucleotides and amplified by PCR. .. The oligonucleotides were designed to contain the T7 promoter sequence, riboswitch DNA sequence, followed by the antigenomic HDV ribozyme sequence, and flanked by restriction sites to facilitate cloning into the pUC19 (NEB) plasmid. .. The sequence of the cloned plasmid DNA was confirmed by DNA sequencing.

    Article Title: Effect of Heat, Acidification, and Chlorination on Salmonella enterica Serovar Typhimurium Cells in a Biofilm Formed at the Air-Liquid Interface
    Article Snippet: For pellicle production, cells were diluted (1:100) in fresh medium and incubated at 28 or 37°C without shaking in 24-well microplates (1.5 ml) or petri dishes (5 ml) for 1 to 7 days. .. For growth of cells that carry plasmid pGFP or pUC19, ampicillin (100 μg ml−1 ) was added. .. Mixed pellicles were formed by incubation of equal volumes (45 μl; optical density at 600 nm, 0.8) of MAE52 and MAE190 that carry plasmids pUC19 and pGFP, respectively, in 1.5 ml of LB for 24 h at 37°C.

    Article Title: The C-terminal Zinc Finger of UvrA Does Not Bind DNA Directly but Regulates Damage-specific DNA Binding
    Article Snippet: The 5′-end-labeled duplex DNA (2 n m , F26 50/NDB) was treated with UvrABC (20 n m Wt or ZnG Bca UvrA, 100 n m Bca UvrB, and 50 n m Tma UvrC) in 20 µl of UvrABC buffer (50 m m Tris-HCl, pH 7.5, 50 m m KCl, 10 m m MgCl2 , 1 m m ATP, and 5 m m DTT) at 55 °C for the indicated time. .. For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend. .. The reactions were terminated by addition of EDTA (20 m m ).

    Article Title: The UvrD303 Hyper-helicase Exhibits Increased Processivity
    Article Snippet: The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI. .. The pUC19-TS construct was created by digesting pUC19 DNA (New England Biolabs) with BamHI and EcoRI.

    Article Title: INTERACTIONS OF HUMAN O6-ALKYLGUANINE-DNA ALKYLTRANSFERASE (AGT) WITH SHORT DOUBLE-STRANDED DNAS
    Article Snippet: Duplex 147 bp and 207 bp DNA fragments containing the sea-urchin nucleosome positioning sequence were isolated by restriction digestion and preparative electrophoresis from plasmid p5S-207-18 [ ], kindly provided by Dr. Sergei Grigoryev, Penn State University. .. Plasmid pUC19 DNA (New England Biolabs) was linearized with EcoRI endonuclease. .. Restriction fragments were deproteinized by phenol extraction and ethanol precipitation [ ].

    Article Title: Characterization of Two Seryl-tRNA Synthetases in Albomycin-Producing Streptomyces sp. Strain ATCC 700974
    Article Snippet: Genetic complementation was used to test the in vivo activities of SerRS1 and SerRS2. .. The host strain was an E. coli mutant (K28) that is ineffective at making its own serS gene product at high temperature ( , ). serS1 and serS2 were separately cloned into a high-copy vector, pUC19, under the control of a constitutive glnS ′ promoter, which is a glnS mutant promoter used for aaRS expression in E. coli , and the resulting plasmids were transformed into E. coli K28. .. At the permissive temperature (30°C), strains carrying different plasmids grew at similar rates (Fig. ).

    Article Title: Requirement for the synaptic protein interaction site for reconstitution of synaptic transmission by P/Q-type calcium channels
    Article Snippet: Our results show that localization and function of exogenous Ca2+ channels in nerve terminals of superior cervical ganglion neurons require a functional synprint site and suggest that binding of soluble NSF attachment protein receptor (SNARE) proteins to the synprint site is a necessary permissive event for nerve terminal localization of presynaptic Ca2+ channels. .. Mutations in the synprint domain of Cav 2.1 were constructed from the rbA-I cDNA clone in the vertebrate expression vector pMT2 (kindly provided by T. P. Snutch, University of British Columbia, Vancouver), by using a 2,966-bp Xho I– Sgr AI fragment that encodes the N-terminal half (NT) of Cav 2.1 in pUC19 (New England Biolabs) having a modified polylinker with Xho I and Sgr AI sites replacing the Eco RI/ Hind III linker. .. After mutagenesis by loop-out deletion and confirmation of cDNA sequence, the isolated clones were digested with Xho I/ Sgr AI and inserted into Xho I/ Sgr AI-digested rbA-I/pMT2.

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: In our approach, bisulfite-PCR products were purified, digested and then analyzed by CE to yield quantification errors about ±5% in an additional analysis time of 90 min. .. pUC19 plasmid DNA (New England Biolabs, Ipswich, MA, USA) was used as a model DNA for establishment of the method. .. Genomic DNAs from four liver cell lines were used later for validation.

    Article Title: An assay to monitor the activity of DNA transposition complexes yields a general quality control measure for transpositional recombination reactions
    Article Snippet: We envision that the developed assay could be regarded as a dependable quality control measure for various in vitro DNA transposition technology applications, including those aimed for mammalian genetics research and future gene therapy. .. The target plasmid in activity measurements was pZErO-2 (Invitrogen by Life Technologies), and the control plasmid was pUC19 (New England Biolabs). .. E. coli strains DH10B and DB3.1 (Invitrogen by Life Technologies) were used for transformations.

    Software:

    Article Title: The C-terminal Zinc Finger of UvrA Does Not Bind DNA Directly but Regulates Damage-specific DNA Binding
    Article Snippet: For those reactions containing supercoiled undamaged plasmid DNA, varying concentrations of pUC19 DNA (New England Biolabs) were included as labeled in the figure legend. .. Ten percent of the reaction was removed, denatured with formamide and heated to 85 °C for 5 min. Incision products were resolved on a 10% denaturing polyacrylamide gel, and electrophoresis was performed at 325 V in Tris borate-EDTA buffer (89 m m Tris, 89 m m boric acid, and 2 m m EDTA) for 40 min. Gels were dried and exposed to a PhosphorImager screen (Molecular Dynamics) overnight.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ). .. Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ).

    In Vitro:

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR
    Article Snippet: pUC19 plasmid DNA (New England Biolabs, Ipswich, MA, USA) was used as a model DNA for establishment of the method. .. pUC19 plasmid DNA (New England Biolabs, Ipswich, MA, USA) was used as a model DNA for establishment of the method.

    Concentration Assay:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: For the double filter-binding assay, the helicase concentration was 150 nM (hexamer) and the ssDNA concentration was 4 nM. .. Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega).

    Article Title: C3-symmetric opioid scaffolds are pH-responsive DNA condensation agents
    Article Snippet: Data here supports our earlier gel electrophoresis analysis where 20 μM of MC3 was required to fully condense the supercoiled plasmid (see Figure ). .. In the presence of linearized pUC19, a lower concentration of MC3 (5 μM) initiated the onset of condensation (Figure ) with both toroidal and cluster formation evident. .. Toroid condensates, however, were evident at low MC3 concentration only with larger aggregates, > 1 μm, appearing at 10 and 20 μM exposure with compact globules forming thereafter (50 μM).

    Marker:

    Article Title: A Process for Microbial Hydrocarbon Synthesis: Overproduction of Fatty Acids in Escherichia coli and Catalytic Conversion to Alkanes
    Article Snippet: To generate a high copy vector harboring the PBAD promoter system, the 1693-bp fragment between the start of the araC gene and the end of the rrnB terminator was amplified from pBAD33 with primers 20 and 21. .. The 2284-bp fragment of pUC19 (New England Biolabs) containing the origin and AmpR marker was amplified with primers 22 and 23. .. These two fragments were digested with Xho I and Bgl II and ligated to form plasmid pBAD34.

    Staining:

    Article Title: Ciprofloxacin is an inhibitor of the Mcm2-7 replicative helicase
    Article Snippet: Reactions (10 μl) contained 50 mM Tris/HCl (pH 8), 1 mM EDTA, 1 mM DTT, 20% (v/v) glycerol and 50 mM NaCl. pUC19 (50 ng; NEB) was incubated at 37°C for 2.5 h with 4 units of Wheat Germ Topo I (Promega). .. Following incubation, topoisomers were separated via gel electrophoresis on a 1.0% (w/v) agarose gel for 2 h at 8 V/cm in TAE (Tris/acetate/EDTA) buffer.

    Article Title: Rpn (YhgA-Like) Proteins of Escherichia coli K-12 and Their Contribution to RecA-Independent Horizontal Transfer
    Article Snippet: RpnA endonuclease activity was determined by measuring DNA digestion with Tris-borate-EDTA (TBE)–agarose (1.5% or 0.75%) visualization by UV with ethidium bromide (EtBr) staining. .. Substrates (all from NEB) were pUC19 (catalog number N3041), bacteriophage λ DNA (catalog number N3011), M13mp18 ssDNA (catalog number N4040), a dsRNA ladder (catalog number N0363), pUC19 nicked with Nb.BtsI (catalog number R0707), or pUC(AT), a pUC derivative carrying an extruded cruciform ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs puc19
    Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of <t>pUC19</t> transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.
    Puc19, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc19/product/New England Biolabs
    Average 99 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    puc19 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs ecori digested puc19 dna
    Estimation of the rate of <t>pUC19</t> unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 <t>DNA</t> (BamHI-digested; 1.14 pmol of DSB ends),
    Ecori Digested Puc19 Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori digested puc19 dna/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ecori digested puc19 dna - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Journal: BMC Biotechnology

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    doi: 10.1186/1472-6750-13-82

    Figure Lengend Snippet: Immunoblot analysis of viral IL-10 recombinant proteins. E. coli BL21 (DE3) derived recombinant viral IL-10 proteins were analyzed by immunoblot in different concentrations and from different cell compartments under both reducing ( A = HCMV IL-10; C = EBV IL-10) and non-reducing conditions ( B = HCMV IL-10). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of three is shown. SN = supernatant; PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Article Snippet: Plasmids used in this study were pUC19 (New England Biolabs,), pGA4 and pGA6 (GeneArt).

    Techniques: Recombinant, Derivative Assay, Transformation Assay

    Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.

    Journal: BMC Biotechnology

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    doi: 10.1186/1472-6750-13-82

    Figure Lengend Snippet: Plasmid maps of HCMV IL-10 (pAZ1c; A) and EBV (pGA6; B) expression vectors are depicted. The artificial transporter consists of the E. coli ompF signal sequence fused in frame to E. coli codon optimized mature viral IL-10 genes under control of the T7 promoter. For subcloning, the constructs are flanked by Eco RI restriction sites. Plasmid pGA6 contains a ColE1, pAZ1c a pUC19-derived pMB1 origin of replication.

    Article Snippet: Plasmids used in this study were pUC19 (New England Biolabs,), pGA4 and pGA6 (GeneArt).

    Techniques: Plasmid Preparation, Expressing, Sequencing, Subcloning, Construct, Derivative Assay

    Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Journal: BMC Biotechnology

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    doi: 10.1186/1472-6750-13-82

    Figure Lengend Snippet: Activation of STAT3 by E. coli derived viral IL-10. STAT3 phosphorylation (STAT3-pY705) was analyzed by immunoblot of protein extracts from human Daudi cells (HCMV IL-10; A) and J774.1 mouse macrophages (EBV IL-10; B) treated with different concentrations of bacteria-derived viral IL-10. Total STAT3 was used to ensure equal protein loading in all lanes (double bands in Daudi cells represent STAT3 isoforms α and β). Periplasmic and cytoplasmic fractions of pUC19 transformed E. coli BL21 (DE3) cells and commercial viral IL-10 proteins served as controls. One experiment representative of two is shown. PP = periplasmic fraction; CP = cytoplasmic fraction; Com. = commercial; Rec. = recombinant.

    Article Snippet: Plasmids used in this study were pUC19 (New England Biolabs,), pGA4 and pGA6 (GeneArt).

    Techniques: Activation Assay, Derivative Assay, Transformation Assay, Recombinant

    Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.

    Journal: BMC Biotechnology

    Article Title: Secretory expression of biologically active human Herpes virus interleukin-10 analogues in Escherichia coli via a modified Sec-dependent transporter construct

    doi: 10.1186/1472-6750-13-82

    Figure Lengend Snippet: Inhibition of LPS-induced TNF-α release by E. coli derived recombinant EBV IL-10. J774.1 mouse macrophages were incubated with E. coli BL21 (DE3) pGA6 periplasmic fraction alone (bacterial recombinant EBV IL-10 at ~ 400 ng/ml) or in the presence of neutralizing monoclonal anti-EBV IL-10 antibody. Periplasmic fractions of E. coli BL21 (DE3) pUC19 were used as TNF-α induction control. Commercial EBV IL-10 (at ~ 400 ng/ml) served as positive control. TNF-α induction levels were set at 100%, and changes of TNF-α release are the means ± SD of four independent experiments. Statistical significance was determined using the Student t-test. Asterisks indicate statistically significant differences (* p ≤ 0.05; ** p ≤ 0.01) between pGA6 PP, pUC19 PP, and pGA6 after anti-EBV IL-10 treatment. PP = periplasmic fraction; Com. = commercial; Rec. = recombinant; mAb = monoclonal antibody.

    Article Snippet: Plasmids used in this study were pUC19 (New England Biolabs,), pGA4 and pGA6 (GeneArt).

    Techniques: Inhibition, Derivative Assay, Recombinant, Incubation, Positive Control

    Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Estimation of the rate of pUC19 unwinding by the AdnAB motor. Reaction mixtures (50 μl) contained 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol of DSB ends),

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: AdnAB nuclease action at 3′-labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 3′ 32 P-labeled pUC19 DNA (EcoRI-digested and 3′-labeled with [ 32

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Estimating the coupling of ATP hydrolysis and duplex unwinding. A, reaction mixtures (80 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m [α- 32 P]ATP, 1.6 μg of pUC19 DNA (BamHI-digested; 1.82 pmol of DSB ends),

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques:

    AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: AdnAB nuclease action at 5′ - labeled DSB ends. Reaction mixtures (50 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.14 pmol DSB ends), and 6 pmol

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: Duplex unwinding by AdnAB with a crippled AdnA phosphohydrolase module. A, reaction mixtures (60 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 1.2 μg of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 1.37 pmol

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling

    SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of

    Journal:

    Article Title: Double Strand Break Unwinding and Resection by the Mycobacterial Helicase-Nuclease AdnAB in the Presence of Single Strand DNA-binding Protein (SSB)

    doi: 10.1074/jbc.M110.162925

    Figure Lengend Snippet: SSB captures the strands unwound by the AdnAB motor. A, reaction mixtures (10 μl) containing 20 m m Tris-HCl, pH 8.0, 1 m m DTT, 2 m m MgCl 2 , 1 m m ATP, 200 ng of 5′ 32 P-labeled pUC19 DNA (BamHI-digested; 230 fmol of DSB ends), 1.06 pmol of

    Article Snippet: Reaction mixtures (25 μl) containing 10 m m Tris-HCl, pH 7.9, 50 m m NaCl, 1 m m DTT, 10 m m MgCl2 , 3 μ m [α-32 P]dATP, 3 μ m dTTP, 2.7 μg of EcoRI-digested pUC19 DNA, and 10 units of DNA polymerase I Klenow fragment (New England Biolabs) were incubated for 15 min at 25 °C.

    Techniques: Labeling