ptripz doxycycline inducible lentiviral vector  (Thermo Fisher)

Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Thermo Fisher ptripz doxycycline inducible lentiviral vector
    Ptripz Doxycycline Inducible Lentiviral Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more doxycycline inducible lentiviral vector/product/Thermo Fisher
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ptripz doxycycline inducible lentiviral vector - by Bioz Stars, 2020-04
    89/100 stars


    Related Articles


    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. MCF7 cells were transduced with ATR shRNA lentivirus and stably expressing clones identified and grown by selection using 1 μg/ml puromycin.

    Clone Assay:

    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: .. Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Primers used for pri-miRNA-135b amplification were: CGGTCTAGACCATTGTGTGAGGCCTTT (Forward) and CCCGATATCACCCCCCAAATCT (Reverse). miRZip™ anti-sense miR-135b and miRZip™ control (NTC) were purchased by SBI (System Biosciences Inc., Mountain View, CA, USA).

    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. MCF7 cells were transduced with ATR shRNA lentivirus and stably expressing clones identified and grown by selection using 1 μg/ml puromycin.


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Lentiviral particles were produced by the calcium phosphate transfection protocol in 293T packaging cell line and infection performed as previously described [ ].


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Primers used for pri-miRNA-135b amplification were: CGGTCTAGACCATTGTGTGAGGCCTTT (Forward) and CCCGATATCACCCCCCAAATCT (Reverse). miRZip™ anti-sense miR-135b and miRZip™ control (NTC) were purchased by SBI (System Biosciences Inc., Mountain View, CA, USA).

    Stable Transfection:

    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. MCF7 cells were transduced with ATR shRNA lentivirus and stably expressing clones identified and grown by selection using 1 μg/ml puromycin.


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: .. Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Primers used for pri-miRNA-135b amplification were: CGGTCTAGACCATTGTGTGAGGCCTTT (Forward) and CCCGATATCACCCCCCAAATCT (Reverse). miRZip™ anti-sense miR-135b and miRZip™ control (NTC) were purchased by SBI (System Biosciences Inc., Mountain View, CA, USA).


    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. Virus particles released into the media were collected and purified via ultracentrifugation using Lenti‐X concentrator (Clontech, Mountain View, USA).


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Lentiviral particles were produced by the calcium phosphate transfection protocol in 293T packaging cell line and infection performed as previously described [ ].


    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. MCF7 cells were transduced with ATR shRNA lentivirus and stably expressing clones identified and grown by selection using 1 μg/ml puromycin.


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: .. Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Primers used for pri-miRNA-135b amplification were: CGGTCTAGACCATTGTGTGAGGCCTTT (Forward) and CCCGATATCACCCCCCAAATCT (Reverse). miRZip™ anti-sense miR-135b and miRZip™ control (NTC) were purchased by SBI (System Biosciences Inc., Mountain View, CA, USA).


    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. For ADAM12 constitutive expression ADAM12 cDNA (NM 003474) was cloned into Tween lentiviral vector [ ] by XbaI-Xho restriction enzime.

    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. MCF7 cells were transduced with ATR shRNA lentivirus and stably expressing clones identified and grown by selection using 1 μg/ml puromycin.


    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: .. Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. Virus particles released into the media were collected and purified via ultracentrifugation using Lenti‐X concentrator (Clontech, Mountain View, USA).

    Plasmid Preparation:

    Article Title: miR-135b suppresses tumorigenesis in glioblastoma stem-like cells impairing proliferation, migration and self-renewal
    Article Snippet: .. Plasmid constructs and lentivirus infection The miR-135b precursor was cloned in the 3′ untranslated (UTR) region of RFP in the pTRIPZ doxycycline inducible lentiviral vector (Thermo Fisher Scientific, Waltham, MA, USA). .. Primers used for pri-miRNA-135b amplification were: CGGTCTAGACCATTGTGTGAGGCCTTT (Forward) and CCCGATATCACCCCCCAAATCT (Reverse). miRZip™ anti-sense miR-135b and miRZip™ control (NTC) were purchased by SBI (System Biosciences Inc., Mountain View, CA, USA).

    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer
    Article Snippet: .. Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK). .. Virus particles released into the media were collected and purified via ultracentrifugation using Lenti‐X concentrator (Clontech, Mountain View, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Thermo Fisher doxycycline inducible lentiviral vector ptripz
    Doxycycline Inducible Lentiviral Vector Ptripz, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more inducible lentiviral vector ptripz/product/Thermo Fisher
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    doxycycline inducible lentiviral vector ptripz - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    Image Search Results