Structured Review

Thermo Fisher ptrchis
Ptrchis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptrchis/product/Thermo Fisher
Average 99 stars, based on 23 article reviews
Price from $9.99 to $1999.99
ptrchis - by Bioz Stars, 2020-03
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen). .. The resultant plasmids pTrcHis-2C-AtAO and pTrcHis-2C-AtQS were introduced into the E. coli mutant strains Genetic Stock Center nos.

Amplification:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: To generate the recombinant Δ16–17, FLΔ16–17 was amplified using forward primer 5′-GGAGGGGTCCCTGGGGCCATTCC-3′ and reverse primer 5′-TCATTTTCTCTTCCGGCCACAAG-3′. .. The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen).

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: The entire open reading frames of Arabidopsis ( Arabidopsis thaliana ) AO and Arabidopsis QS were amplified from the Institute of Physical and Chemical Research cDNA clones pda01728 and pda01949 , respectively, by PCR using the primer pair 5′-GGTTCCATGGCGGCTCATGTTTCTACTGGAAAC-3′ and 5′-GGCCCTCGAGTGCAATCAATAAGTGAGCTGCTA-3′ for AO; and 5′-TTAACCATGGCGTTAGCTCTCTCCGTCGCACCT-3′ and 5′-GGCCCTCGAGTTCTCTTGCTCTCACAACTTAAT-3′ for QS. .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen).

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: .. The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. Primers used for the PCR were: 5′ATATAGGATCCAGTCCCCAGGTGGGAACCCT3′ and 5′ATAGAATTCTCACATCAGCATCGGGAAAGGTG3′.

Construct:

Article Title: Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing
Article Snippet: The pTrc-TE plasmid was constructed as follows. .. A pTrcHis A (Invitrogen V36020) was linearized by PCR using pTrcHis_rev and pTrcHis_for primers ( ).

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. The construct was then transformed into BL21 E. coli cells and cultures grown with shaking at 37°C.

Electrophoresis:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: .. Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Incubation:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: .. Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Expressing:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: .. The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen). .. Δ16–17 was obtained by overexpression from the plasmid and purified using the same method as for nTE.

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen). .. The resultant plasmids pTrcHis-2C-AtAO and pTrcHis-2C-AtQS were introduced into the E. coli mutant strains Genetic Stock Center nos.

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: .. The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. Primers used for the PCR were: 5′ATATAGGATCCAGTCCCCAGGTGGGAACCCT3′ and 5′ATAGAATTCTCACATCAGCATCGGGAAAGGTG3′.

Western Blot:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen). .. Samples were separated by SDS/PAGE (7.5% gels) and subjected to Western blot analysis.

Transformation Assay:

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. The construct was then transformed into BL21 E. coli cells and cultures grown with shaking at 37°C.

Over Expression:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen). .. Δ16–17 was obtained by overexpression from the plasmid and purified using the same method as for nTE.

Polymerase Chain Reaction:

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen). .. The resultant plasmids pTrcHis-2C-AtAO and pTrcHis-2C-AtQS were introduced into the E. coli mutant strains Genetic Stock Center nos.

Article Title: Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing
Article Snippet: .. A pTrcHis A (Invitrogen V36020) was linearized by PCR using pTrcHis_rev and pTrcHis_for primers ( ). .. Following PCR, plasmid template was digested with DpnI (NEB) and purified using a PCR cleanup kit.

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: .. The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. Primers used for the PCR were: 5′ATATAGGATCCAGTCCCCAGGTGGGAACCCT3′ and 5′ATAGAATTCTCACATCAGCATCGGGAAAGGTG3′.

Binding Assay:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: .. Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Mutagenesis:

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen). .. The resultant plasmids pTrcHis-2C-AtAO and pTrcHis-2C-AtQS were introduced into the E. coli mutant strains Genetic Stock Center nos.

Electrophoretic Mobility Shift Assay:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: Paragraph title: Gel shift assay ... Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel.

Purification:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: Paragraph title: Purification of recombinant human tropoelastin ... The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen).

Article Title: Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing
Article Snippet: A pTrcHis A (Invitrogen V36020) was linearized by PCR using pTrcHis_rev and pTrcHis_for primers ( ). .. Following PCR, plasmid template was digested with DpnI (NEB) and purified using a PCR cleanup kit.

Sequencing:

Article Title: Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing
Article Snippet: A pTrcHis A (Invitrogen V36020) was linearized by PCR using pTrcHis_rev and pTrcHis_for primers ( ). .. Sequences for sfCherry , a double terminator stem (iGEM part BBa_B0015) with restriction sites, and sfGFP ( ) were designed with ~40 nucleotides of overlapping sequence and ordered as geneBlocks (IDT) ( ).

SDS Page:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen). .. Purified recombinant proteins were resuspended in SDS/PAGE sample buffer including 100 mM DTT (dithiothreitol).

Plasmid Preparation:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: .. The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen). .. Δ16–17 was obtained by overexpression from the plasmid and purified using the same method as for nTE.

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen). .. The resultant plasmids pTrcHis-2C-AtAO and pTrcHis-2C-AtQS were introduced into the E. coli mutant strains Genetic Stock Center nos.

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: .. Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Article Title: Pervasive regulatory functions of mRNA structure revealed by high-resolution SHAPE probing
Article Snippet: Paragraph title: Plasmid construction ... A pTrcHis A (Invitrogen V36020) was linearized by PCR using pTrcHis_rev and pTrcHis_for primers ( ).

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: .. The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. Primers used for the PCR were: 5′ATATAGGATCCAGTCCCCAGGTGGGAACCCT3′ and 5′ATAGAATTCTCACATCAGCATCGGGAAAGGTG3′.

Recombinant:

Article Title: Domains 16 and 17 of tropoelastin in elastic fibre formation
Article Snippet: Paragraph title: Purification of recombinant human tropoelastin ... The product was inserted into a bacterial expression vector pTrcHis-TOPO (Invitrogen).

Agarose Gel Electrophoresis:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: .. Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Laser Capture Microdissection:

Article Title: Early Steps in the Biosynthesis of NAD in Arabidopsis Start with Aspartate and Occur in the Plastid 1
Article Snippet: 7419, lam nadB51 ∷ Tn10 rph-1 and 6692, and lam nadA50 ∷ Tn10 relA1 rpsE2130 [ SpcR ]) have disruptions in the nadB gene encoding AO and in the nadA gene encoding QS, respectively, and were used for the complementation assay. .. The PCR products were cloned into the vector pGEM-T (Promega), excised as Nco I- Xho I fragments, and cloned into the expression vector pTrcHis-2C (Invitrogen).

Concentration Assay:

Article Title: COLLAGEN XXVII IS DEVELOPMENTALLY-REGULATED AND FORMS THIN FIBRILLAR STRUCTURES DISTINCT FROM THOSE OF CLASSICAL VERTEBRATE FIBRILLAR COLLAGENS
Article Snippet: The variable domain of Col27A1 was amplified by PCR from mouse genomic DNA, sequenced and ligated, in frame, into the pTrc-His bacterial expression vector (Invitrogen, UK). .. Protein expression was induced by addition of IPTG (final concentration 1 mM).

Staining:

Article Title: Peptides from American alligator plasma are antimicrobial against multi-drug resistant bacterial pathogens including Acinetobacter baumannii
Article Snippet: Briefly, 200 ng of plasmid DNA (pTrcHis, Invitrogen V36020) was incubated with increasing concentrations of peptides in 20 μl of binding buffer (5 % glycerol, 10 mM Tris–HCl [pH 8.0], 1 mM EDTA, 1 mM DTT, 20 mM KCl and 50 μg/ml BSA) at room temperature for 20 min and subjected to electrophoresis on a 1.0 % agarose gel. .. DNA bands were visualized by ethidium bromide staining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher ptrchis2 topo ta
    Ptrchis2 Topo Ta, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptrchis2 topo ta/product/Thermo Fisher
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ptrchis2 topo ta - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    96
    Thermo Fisher ptrchis topo plasmid
    Csm module plasmids, target plasmids, and the plasmid targeting assay. (A) Representative genome organization of a Csm CRISPR-Cas module locus. The organization shown is based on Staphylococcus epidermidis (SEP) RP62a (GenBank NC002976). The CRISPR leader sequence (L, white box) is located upstream of the CRISPR, which can consist of various numbers of spacers (shades of yellow; 17 in SEP, 3 in STH, and 15 in LLA) bracketed by repeats (black). cas1, cas2, cas6, and csm1-csm6 genes are found in proximity to the CRISPR. The relative organization of the cas1, cas2 and cas6 genes is slightly different in Streptococcus thermophilus (STH) JIM 8232 (GenBank FR875178.1) and Lactococcus lactis (LLA) DGCC 7167 plasmid pKLM (GenBank JX524189.1). In addition, the STH Csm system includes a second csm6 gene (csm6-2) that was not used in this work. The LLA-associated module (found on LLA-associated plasmid pKLM) lacks a cas2 gene and includes an lch gene that shows partial homology to the relE/parE toxin gene. (B) Csm module plasmids. For each Csm system (SEP, STH and LLA), csm1-6 and cas6 sequences were codon-optimized for expression in E. coli and inserted as illustrated into a pACYC vector with chloramphenicol resistance and p15-derived origin of replication (ori). A T7 promoter (green) was engineered upstream of the csm and cas6 genes and CRISPR, providing increased expression in the presence of arabinose in BL21AI. A T7 terminator (or variant; red) was engineered downstream of each element. (C) Target plasmids. A target sequence comprised of the spacer of the corresponding Csm system (yellow) was inserted into a <t>pTrcHis-TOPO</t> plasmid with ampicillin resistance and pBR322-derived ori. The Trc promoter element (blue) allows IPTG-inducible increase in expression of a target RNA complementary to the crRNA of the Csm system. The sequence flanking the target (red) was designed so that the sequence of the DNA target strand and the target RNA was identical to, and would not interact with, the crRNA 5’ tag. (D) Plasmid targeting assay. E . coli BL21AI strains containing the Csm module plasmid (orange; chloramphenicol selectable) are transformed with target or non-target plasmids that confer ampicillin resistance (blue; ampicillin selectable). Serial dilutions of transformed cells are spotted onto plates containing chloramphenicol and ampicillin. Plasmid targeting (defense) results in a reduction in colonies able to grow in the presence of ampicillin.
    Ptrchis Topo Plasmid, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptrchis topo plasmid/product/Thermo Fisher
    Average 96 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    ptrchis topo plasmid - by Bioz Stars, 2020-03
    96/100 stars
      Buy from Supplier

    88
    Thermo Fisher ptrchisc vector
    Csm module plasmids, target plasmids, and the plasmid targeting assay. (A) Representative genome organization of a Csm CRISPR-Cas module locus. The organization shown is based on Staphylococcus epidermidis (SEP) RP62a (GenBank NC002976). The CRISPR leader sequence (L, white box) is located upstream of the CRISPR, which can consist of various numbers of spacers (shades of yellow; 17 in SEP, 3 in STH, and 15 in LLA) bracketed by repeats (black). cas1, cas2, cas6, and csm1-csm6 genes are found in proximity to the CRISPR. The relative organization of the cas1, cas2 and cas6 genes is slightly different in Streptococcus thermophilus (STH) JIM 8232 (GenBank FR875178.1) and Lactococcus lactis (LLA) DGCC 7167 plasmid pKLM (GenBank JX524189.1). In addition, the STH Csm system includes a second csm6 gene (csm6-2) that was not used in this work. The LLA-associated module (found on LLA-associated plasmid pKLM) lacks a cas2 gene and includes an lch gene that shows partial homology to the relE/parE toxin gene. (B) Csm module plasmids. For each Csm system (SEP, STH and LLA), csm1-6 and cas6 sequences were codon-optimized for expression in E. coli and inserted as illustrated into a pACYC vector with chloramphenicol resistance and p15-derived origin of replication (ori). A T7 promoter (green) was engineered upstream of the csm and cas6 genes and CRISPR, providing increased expression in the presence of arabinose in BL21AI. A T7 terminator (or variant; red) was engineered downstream of each element. (C) Target plasmids. A target sequence comprised of the spacer of the corresponding Csm system (yellow) was inserted into a <t>pTrcHis-TOPO</t> plasmid with ampicillin resistance and pBR322-derived ori. The Trc promoter element (blue) allows IPTG-inducible increase in expression of a target RNA complementary to the crRNA of the Csm system. The sequence flanking the target (red) was designed so that the sequence of the DNA target strand and the target RNA was identical to, and would not interact with, the crRNA 5’ tag. (D) Plasmid targeting assay. E . coli BL21AI strains containing the Csm module plasmid (orange; chloramphenicol selectable) are transformed with target or non-target plasmids that confer ampicillin resistance (blue; ampicillin selectable). Serial dilutions of transformed cells are spotted onto plates containing chloramphenicol and ampicillin. Plasmid targeting (defense) results in a reduction in colonies able to grow in the presence of ampicillin.
    Ptrchisc Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptrchisc vector/product/Thermo Fisher
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ptrchisc vector - by Bioz Stars, 2020-03
    88/100 stars
      Buy from Supplier

    Image Search Results


    Csm module plasmids, target plasmids, and the plasmid targeting assay. (A) Representative genome organization of a Csm CRISPR-Cas module locus. The organization shown is based on Staphylococcus epidermidis (SEP) RP62a (GenBank NC002976). The CRISPR leader sequence (L, white box) is located upstream of the CRISPR, which can consist of various numbers of spacers (shades of yellow; 17 in SEP, 3 in STH, and 15 in LLA) bracketed by repeats (black). cas1, cas2, cas6, and csm1-csm6 genes are found in proximity to the CRISPR. The relative organization of the cas1, cas2 and cas6 genes is slightly different in Streptococcus thermophilus (STH) JIM 8232 (GenBank FR875178.1) and Lactococcus lactis (LLA) DGCC 7167 plasmid pKLM (GenBank JX524189.1). In addition, the STH Csm system includes a second csm6 gene (csm6-2) that was not used in this work. The LLA-associated module (found on LLA-associated plasmid pKLM) lacks a cas2 gene and includes an lch gene that shows partial homology to the relE/parE toxin gene. (B) Csm module plasmids. For each Csm system (SEP, STH and LLA), csm1-6 and cas6 sequences were codon-optimized for expression in E. coli and inserted as illustrated into a pACYC vector with chloramphenicol resistance and p15-derived origin of replication (ori). A T7 promoter (green) was engineered upstream of the csm and cas6 genes and CRISPR, providing increased expression in the presence of arabinose in BL21AI. A T7 terminator (or variant; red) was engineered downstream of each element. (C) Target plasmids. A target sequence comprised of the spacer of the corresponding Csm system (yellow) was inserted into a pTrcHis-TOPO plasmid with ampicillin resistance and pBR322-derived ori. The Trc promoter element (blue) allows IPTG-inducible increase in expression of a target RNA complementary to the crRNA of the Csm system. The sequence flanking the target (red) was designed so that the sequence of the DNA target strand and the target RNA was identical to, and would not interact with, the crRNA 5’ tag. (D) Plasmid targeting assay. E . coli BL21AI strains containing the Csm module plasmid (orange; chloramphenicol selectable) are transformed with target or non-target plasmids that confer ampicillin resistance (blue; ampicillin selectable). Serial dilutions of transformed cells are spotted onto plates containing chloramphenicol and ampicillin. Plasmid targeting (defense) results in a reduction in colonies able to grow in the presence of ampicillin.

    Journal: PLoS ONE

    Article Title: Programmable type III-A CRISPR-Cas DNA targeting modules

    doi: 10.1371/journal.pone.0176221

    Figure Lengend Snippet: Csm module plasmids, target plasmids, and the plasmid targeting assay. (A) Representative genome organization of a Csm CRISPR-Cas module locus. The organization shown is based on Staphylococcus epidermidis (SEP) RP62a (GenBank NC002976). The CRISPR leader sequence (L, white box) is located upstream of the CRISPR, which can consist of various numbers of spacers (shades of yellow; 17 in SEP, 3 in STH, and 15 in LLA) bracketed by repeats (black). cas1, cas2, cas6, and csm1-csm6 genes are found in proximity to the CRISPR. The relative organization of the cas1, cas2 and cas6 genes is slightly different in Streptococcus thermophilus (STH) JIM 8232 (GenBank FR875178.1) and Lactococcus lactis (LLA) DGCC 7167 plasmid pKLM (GenBank JX524189.1). In addition, the STH Csm system includes a second csm6 gene (csm6-2) that was not used in this work. The LLA-associated module (found on LLA-associated plasmid pKLM) lacks a cas2 gene and includes an lch gene that shows partial homology to the relE/parE toxin gene. (B) Csm module plasmids. For each Csm system (SEP, STH and LLA), csm1-6 and cas6 sequences were codon-optimized for expression in E. coli and inserted as illustrated into a pACYC vector with chloramphenicol resistance and p15-derived origin of replication (ori). A T7 promoter (green) was engineered upstream of the csm and cas6 genes and CRISPR, providing increased expression in the presence of arabinose in BL21AI. A T7 terminator (or variant; red) was engineered downstream of each element. (C) Target plasmids. A target sequence comprised of the spacer of the corresponding Csm system (yellow) was inserted into a pTrcHis-TOPO plasmid with ampicillin resistance and pBR322-derived ori. The Trc promoter element (blue) allows IPTG-inducible increase in expression of a target RNA complementary to the crRNA of the Csm system. The sequence flanking the target (red) was designed so that the sequence of the DNA target strand and the target RNA was identical to, and would not interact with, the crRNA 5’ tag. (D) Plasmid targeting assay. E . coli BL21AI strains containing the Csm module plasmid (orange; chloramphenicol selectable) are transformed with target or non-target plasmids that confer ampicillin resistance (blue; ampicillin selectable). Serial dilutions of transformed cells are spotted onto plates containing chloramphenicol and ampicillin. Plasmid targeting (defense) results in a reduction in colonies able to grow in the presence of ampicillin.

    Article Snippet: Target plasmids To generate target plasmids for each module, a target region containing sequence complementary to a specified crRNA (encoded by the CRISPR spacer on the Csm module plasmid) plus an 8-nt sequence designed not to interact with the crRNA 5’ tag (identical to the 8-nt crRNA tag) was synthesized and cloned into the vector using DNA Topoisomerase I between the Trc promoter element (IPTG inducible) and rrnB T1/T2 terminator of the pTrcHis-TOPO plasmid, which carries the colE1 origin of replication and ampicillin resistance marker (ThermoFisher Scientific) (Figures D-H in ).

    Techniques: Plasmid Preparation, CRISPR, Sequencing, Expressing, Derivative Assay, Variant Assay, Transformation Assay