Structured Review

MJ Research ptc 200 dna engine
Ptc 200 Dna Engine, supplied by MJ Research, used in various techniques. Bioz Stars score: 99/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ptc 200 dna engine/product/MJ Research
Average 99 stars, based on 65 article reviews
Price from $9.99 to $1999.99
ptc 200 dna engine - by Bioz Stars, 2020-01
99/100 stars

Images

Related Articles

Amplification:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification of MMP cDNA in the presence of the primers.

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription (RT) reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification of cDNA in the presence of the primers.

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers.

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers.

Article Title: The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea
Article Snippet: Multiplex PCR amplification was done in a 20 μ L reaction volume, containing 40 ng of template DNA, AmpliTaq Gold 360 Master Mix (Life Technologies, USA), and appropriate concentrations of each primer. .. Thermal cycling was conducted on a PTC-200 DNA engine (MJ Research): 95°C for 10 min; 45 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. To purify PCR products, 5 μ L of the PCR products was treated with 1 μ L of ExoSAP-IT (catalogue number 78201; USB, Cleveland, OH, USA) at 37°C for 45 min. After that, the enzyme was inactivated by incubation at 80°C for 15 min. We used twenty-two single base extension (SBE) primers recommended by Lee et al. [ ].

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers [mouse serine palmitoyltransferase (SPT)1: 5’ primer sequence, AGTGGTGGGAGAGTC CCTTT; 3’ primer sequence, CAGTGACCACAACCCTGATG ].

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Exactly the same sequence areas were amplified from the templates with and without bisulfite treatment. .. A PTC-200 DNA Engine (MJ Research) was used.

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: .. PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA). .. For sequencing, aliquots of PCR products were processed using a PCR Pre-Sequencing Kit (USB Cleveland) to remove residual primers and dNTPs following the manufacturer's protocol.

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: DNA fragments were amplified using the Phusion HT II polymerase according to the manufacturer’s instructions (Thermo Scientific). .. PCR was carried out in a PTC-200 DNA Engine (MJ Research).

Single-particle Tracking:

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers [mouse serine palmitoyltransferase (SPT)1: 5’ primer sequence, AGTGGTGGGAGAGTC CCTTT; 3’ primer sequence, CAGTGACCACAACCCTGATG ].

Synthesized:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: First strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad) using 20 μl of reaction mixture containing 0.25 μg of total RNA, 4 μl of 5× iScript reaction mixture, and 1 μl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad, Hercules, CA) using 20 μl of reaction mixture containing 1 μg of total RNA, 4 μl of 5x iScript reaction mixture, and 1 μl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Statin Intake Is Associated with MMP-1 Level in Gingival Crevicular Fluid of Patients with Periodontitis
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) using 20 µl of reaction mixture containing 0.5 µg of total RNA, 4 µl of 5x iScript reaction mixture, and 1 µl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 minutes at 25°C, 30 minutes at 42°C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) using 20 μl of the reaction mixture containing 0.5 μg of total RNA, 4 μl of 5× iScript reaction mixture, and 1 μl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) using 20 μl of reaction mixture containing 0.5 μg of total RNA, 4 μl of 5x iScript reaction mixture, and 1 μl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScriptTM cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) using 20 μl of reaction mixture containing 0.5 μg of total RNA, 4 μl of 5x iScript reaction mixture, and 1 μl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: First-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA) using 20 µl of reaction mixture containing 0.5 µg of total RNA, 4 µl of 5× iScript reaction mixture, and 1 µl of iScript reverse transcriptase. .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Periodontal CD14 mRNA expression is downregulated in patients with chronic periodontitis and type 2 diabetes
Article Snippet: The first-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad, Hercules, CA) by following the instruction provided by the manufacturer. .. The reaction was cycled for 5 min at 25 °C, 30 min at 42 °C and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Increased and Correlated Expression of CTGF and TGFβ1 in Surgically Removed Periodontal Tissues with Chronic Periodontitis
Article Snippet: The first-strand complementary DNA (cDNA) was synthesized with the iScript™ cDNA synthesis kit (Bio-Rad, Hercules, CA) by following the instruction provided by the manufacturer. .. The reaction was cycled for 5 minutes at 25°C, 30 minutes at 42°C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Construct:

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: Paragraph title: Construction of Retroviral Constructs ... PCR was carried out in a PTC-200 DNA Engine (MJ Research).

Real-time Polymerase Chain Reaction:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: Real Time PCR —Total RNA was isolated from cells using the RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: Paragraph title: 2.3. Real-Time Polymerase Chain Reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: Paragraph title: Real-time PCR. ... The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: Paragraph title: 2.3. Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: Paragraph title: Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: MD-2 is involved in the stimulation of matrix metalloproteinase-1 expression by interferon-γ and high glucose in mononuclear cells – a potential role of MD-2 in Toll-like receptor 4-independent signalling
Article Snippet: Paragraph title: Real-time PCR ... The complete reaction was cycled for 5 min at 25°, 30 min at 42° and 5 min at 85° using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: Paragraph title: 2.3. Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Sandwich ELISA:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: Enzyme-linked Immunosorbent Assay (ELISA) —MMPs, tissue inhibitors of metalloproteinases (TIMPs), and IL-6 in conditioned medium were quantified using sandwich ELISA kits according to the protocol provided by the manufacturer (R & D Systems, Minneapolis, MN). .. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Incubation:

Article Title: The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea
Article Snippet: .. Thermal cycling was conducted on a PTC-200 DNA engine (MJ Research): 95°C for 10 min; 45 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. To purify PCR products, 5 μ L of the PCR products was treated with 1 μ L of ExoSAP-IT (catalogue number 78201; USB, Cleveland, OH, USA) at 37°C for 45 min. After that, the enzyme was inactivated by incubation at 80°C for 15 min. We used twenty-two single base extension (SBE) primers recommended by Lee et al. [ ]. .. SBE reactions were carried out using a SNaPshot Kit (Applied Biosystems, USA) according to the manufacturer's instructions.

Touchdown PCR:

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: A PTC-200 DNA Engine (MJ Research) was used. .. Hot-start touchdown PCR (35 cycles, 72 to 58°C, –1.0°C per cycle) was used to amplify hMLH1 without bisulfite treatment and the sense strand templates with bisulfite treatment [strand-specific PCR (ssPCR) 65 to 45°C for hMLH1 , 57 to 47°C for Cox-2 ].

Modification:

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: These primers for the modified templates amplify both methylated and unmethylated ones, because no CpG sites exist in the primer sequences. .. A PTC-200 DNA Engine (MJ Research) was used.

Derivative Assay:

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: PCR was carried out in a PTC-200 DNA Engine (MJ Research). .. The CAR ectodomain comprised an scFv against human GD2 (clone huk666), and a spacer derived from the human IgG4 CH2-CH3 portion has been described before in third-generation format.

SYBR Green Assay:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. Primers for MMP-1 (5′ primer, CTGGGAAGCCATCACTTACCTTGC; 3′ primer, GTTTCTAGAGTCGCTGGGAAGCTG) were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA), and real time PCR was performed in duplicate using 25 μl of reaction mixture containing 1.0 μl of reverse transcription mixture, 0.2 μm both primers, and 12.5 μl of iQ™ SYBR Green Supermix (Bio-Rad).

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. Real-time PCR was performed in duplicate using 25 μl of reaction mixture containing 1.0 μl of RT mixture, 0.2 μM of both primers, and 12.5 μl of iQTM SYBR Green Supermix (Bio-Rad Laboratories).

Article Title: MD-2 is involved in the stimulation of matrix metalloproteinase-1 expression by interferon-γ and high glucose in mononuclear cells – a potential role of MD-2 in Toll-like receptor 4-independent signalling
Article Snippet: The complete reaction was cycled for 5 min at 25°, 30 min at 42° and 5 min at 85° using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. Primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) and real-time PCR was performed in duplicate using 25 μl of reaction mixture containing 1·0 μl of reverse transcription mixture, 0·2 μ m of both primers, and 12·5 μl of iQ™ SYBR Green Supermix (Bio-Rad Laboratories).

Sequencing:

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (IL-6: 5′ primer sequence, AACAACCTGAACCTTC CAAAGATG; 3′ primer sequence, TCAAACTCCAAAAGACCAGTGATG.

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (Premier Biosoft International, Palo Alto, CA) was used for primer designing (mouse IL-6: 5′ primer sequence, TGGAGTCACAGAAGGAGTGGCTAAG; 3′ primer sequence, TCTGACCACAGTGAGGAATGTCCAC).

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (Human IL6 : Forward sequence, TGGAGTCACAGAAGGAGTGGCTAAG; Reverse sequence, TCTGACCACAGTGAGGAATGTCCAC.

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers [mouse serine palmitoyltransferase (SPT)1: 5’ primer sequence, AGTGGTGGGAGAGTC CCTTT; 3’ primer sequence, CAGTGACCACAACCCTGATG ].

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (IL-6: 5’ primer sequence, AACAACCTGAACCTTCCAAAGATG; 3’ primer sequence, TCAAACTCCAAAAGACCAGTGATG.

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Exactly the same sequence areas were amplified from the templates with and without bisulfite treatment. .. A PTC-200 DNA Engine (MJ Research) was used.

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA). .. For sequencing, aliquots of PCR products were processed using a PCR Pre-Sequencing Kit (USB Cleveland) to remove residual primers and dNTPs following the manufacturer's protocol.

Methylation:

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: These primers for the modified templates amplify both methylated and unmethylated ones, because no CpG sites exist in the primer sequences. .. A PTC-200 DNA Engine (MJ Research) was used.

Mutagenesis:

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: Paragraph title: Mutation Detection and Genotyping ... PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA).

Isolation:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: Real Time PCR —Total RNA was isolated from cells using the RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: Total RNA was isolated from cells using the RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Statin Intake Is Associated with MMP-1 Level in Gingival Crevicular Fluid of Patients with Periodontitis
Article Snippet: After the treatment, total RNA was isolated from cells using RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 minutes at 25°C, 30 minutes at 42°C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: Total RNA was isolated from cells using the RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: Total RNA was isolated from cells using RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: Real-time polymerase chain reaction (PCR) Total RNA was isolated from cells using RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: Total RNA was isolated from cells using the RNeasy minikit (Qiagen, Santa Clarita, CA). .. The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Periodontal CD14 mRNA expression is downregulated in patients with chronic periodontitis and type 2 diabetes
Article Snippet: Paragraph title: Isolation of RNA and RNA Reverse Transcription (RT) ... The reaction was cycled for 5 min at 25 °C, 30 min at 42 °C and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Increased and Correlated Expression of CTGF and TGFβ1 in Surgically Removed Periodontal Tissues with Chronic Periodontitis
Article Snippet: Paragraph title: Isolation of RNA and RNA Reverse Transcription ... The reaction was cycled for 5 minutes at 25°C, 30 minutes at 42°C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Size-exclusion Chromatography:

Article Title: The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea
Article Snippet: Thermal cycling was conducted on a PTC-200 DNA engine (MJ Research): 95°C for 10 min; 45 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. To purify PCR products, 5 μ L of the PCR products was treated with 1 μ L of ExoSAP-IT (catalogue number 78201; USB, Cleveland, OH, USA) at 37°C for 45 min. After that, the enzyme was inactivated by incubation at 80°C for 15 min. We used twenty-two single base extension (SBE) primers recommended by Lee et al. [ ]. .. Thermal cycling conditions for SBE were as follows: denaturation at 96°C for 10 sec; annealing at 50°C for 5 sec; extension at 60°C for 30 sec. SBE was performed using a PTC-200 DNA Engine (Bio-Rad Laboratories, Hercules, CA).

Article Title: Association of the Gene Polymorphisms IFN-? +874, IL-13 -1055 and IL-4 -590 with Patterns of Reinfection with Schistosoma mansoni
Article Snippet: PCR reactions PCR reactions of IL-13 and IL-4 SNPs were performed on a PTC-200 DNA Engine from MJ Research. .. Initial denaturation was performed at 95°C for 3 min followed by 30 cycles of PCR with the following conditions: 95°C for 30 sec, 62°C for 30 sec for annealing, 72°C for 1 min, and a final 72°C for 3 min. PCR of the IL-13 −591 A/G was conducted in a 50 µl reaction containing 100 ng DNA, 5 µl of 1× Qiagen PCR buffer, 0.5 µM of each dNTP, 0.4 µM of each primer, 3 mM MgCl2 , and 2.5 U of Taq polymerase (Qiagen).

Purification:

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA). .. The purified PCR products were subjected to direct sequencing using a ABI PrismTM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit Version 3.1, and a ABI autosequencer 3730 (Perkin Elmer Applied Biosystems, Foster City, USA), according to manufacturer's protocol.

Polymerase Chain Reaction:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification of MMP cDNA in the presence of the primers.

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: Paragraph title: 2.3. Real-Time Polymerase Chain Reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1:10 with nuclease-free water and used for PCR amplification in the presence of the primers.

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: Paragraph title: 2.3. Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea
Article Snippet: .. Thermal cycling was conducted on a PTC-200 DNA engine (MJ Research): 95°C for 10 min; 45 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. To purify PCR products, 5 μ L of the PCR products was treated with 1 μ L of ExoSAP-IT (catalogue number 78201; USB, Cleveland, OH, USA) at 37°C for 45 min. After that, the enzyme was inactivated by incubation at 80°C for 15 min. We used twenty-two single base extension (SBE) primers recommended by Lee et al. [ ]. .. SBE reactions were carried out using a SNaPshot Kit (Applied Biosystems, USA) according to the manufacturer's instructions.

Article Title: Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis
Article Snippet: Paragraph title: Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 o C, 30 minutes at 42 o C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: MD-2 is involved in the stimulation of matrix metalloproteinase-1 expression by interferon-γ and high glucose in mononuclear cells – a potential role of MD-2 in Toll-like receptor 4-independent signalling
Article Snippet: The complete reaction was cycled for 5 min at 25°, 30 min at 42° and 5 min at 85° using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The reverse transcription reaction mixture was then diluted 1 : 10 with nuclease-free water and used for PCR amplification in the presence of the primers.

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: Paragraph title: 2.3. Real-time polymerase chain reaction (PCR) ... The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Article Snippet: Paragraph title: Design of primers and PCR conditions ... A PTC-200 DNA Engine (MJ Research) was used.

Article Title: Association of the Gene Polymorphisms IFN-? +874, IL-13 -1055 and IL-4 -590 with Patterns of Reinfection with Schistosoma mansoni
Article Snippet: .. PCR reactions PCR reactions of IL-13 and IL-4 SNPs were performed on a PTC-200 DNA Engine from MJ Research. .. PCR of the IL-13 −1055 C/T was conducted in a 50 µl reaction containing 100 ng DNA, 5 µl of 1× Qiagen PCR buffer, 0.5 µM of each dNTP, 0.4 µM of each primer, 1 mM MgCl2 , and 2.5 U of Taq polymerase (Qiagen).

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: .. PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA). .. For sequencing, aliquots of PCR products were processed using a PCR Pre-Sequencing Kit (USB Cleveland) to remove residual primers and dNTPs following the manufacturer's protocol.

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: .. PCR was carried out in a PTC-200 DNA Engine (MJ Research). .. PCR products were extracted from 1% agarose gels using the Wizard SV Gel & PCR Clean-Up kit (Promega).

IA:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. Primers for MMP-1 (5′ primer, CTGGGAAGCCATCACTTACCTTGC; 3′ primer, GTTTCTAGAGTCGCTGGGAAGCTG) were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA), and real time PCR was performed in duplicate using 25 μl of reaction mixture containing 1.0 μl of reverse transcription mixture, 0.2 μm both primers, and 12.5 μl of iQ™ SYBR Green Supermix (Bio-Rad).

Article Title: MD-2 is involved in the stimulation of matrix metalloproteinase-1 expression by interferon-γ and high glucose in mononuclear cells – a potential role of MD-2 in Toll-like receptor 4-independent signalling
Article Snippet: The complete reaction was cycled for 5 min at 25°, 30 min at 42° and 5 min at 85° using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. Primers were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA) and real-time PCR was performed in duplicate using 25 μl of reaction mixture containing 1·0 μl of reverse transcription mixture, 0·2 μ m of both primers, and 12·5 μl of iQ™ SYBR Green Supermix (Bio-Rad Laboratories).

RNA Extraction:

Article Title: Statin Intake Is Associated with MMP-1 Level in Gingival Crevicular Fluid of Patients with Periodontitis
Article Snippet: Paragraph title: RNA Extraction and Reverse Transcription ... The complete reaction was cycled for 5 minutes at 25°C, 30 minutes at 42°C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Plasmid Preparation:

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: The retroviral vector used in all constructs was the oncoretroviral vector SFG, pseudotyped with an RD114 envelope. .. PCR was carried out in a PTC-200 DNA Engine (MJ Research).

Software:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing.

Article Title: Coactivation of TLR4 and TLR2/6 Coordinates an Additive Augmentation on IL-6 Gene Transcription via p38 MAPK Pathway in U937 Mononuclear Cells
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (IL-6: 5′ primer sequence, AACAACCTGAACCTTC CAAAGATG; 3′ primer sequence, TCAAACTCCAAAAGACCAGTGATG.

Article Title: Acid sphingomyelinase plays a key role in palmitic acid-amplified inflammatory signaling triggered by lipopolysaccharide at low concentrations in macrophages
Article Snippet: The complete reaction was cycled for 5 min at 25°C, 30 min at 42°C, and 5 min at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (Premier Biosoft International, Palo Alto, CA) was used for primer designing (mouse IL-6: 5′ primer sequence, TGGAGTCACAGAAGGAGTGGCTAAG; 3′ primer sequence, TCTGACCACAGTGAGGAATGTCCAC).

Article Title: GPR40/FFA1 and Neutral Sphingomyelinase Are Involved in Palmitate-Boosted Inflammatory Response of Microvascular Endothelial Cells to LPS
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (Human IL6 : Forward sequence, TGGAGTCACAGAAGGAGTGGCTAAG; Reverse sequence, TCTGACCACAGTGAGGAATGTCCAC.

Article Title: Different Signaling Mechanisms Regulating IL-6 Expression by LPS between Gingival Fibroblasts and Mononuclear Cells: Seeking the Common Target
Article Snippet: The complete reaction was cycled for 5 minutes at 25 °C, 30 minutes at 42 °C and 5 minutes at 85°C using a PTC-200 DNA Engine (MJ Research, Waltham, MA). .. The Beacon designer software (PREMIER Biosoft International, Palo Alto, CA) was used for primer designing (IL-6: 5’ primer sequence, AACAACCTGAACCTTCCAAAGATG; 3’ primer sequence, TCAAACTCCAAAAGACCAGTGATG.

Enzyme-linked Immunosorbent Assay:

Article Title: Interleukin-6 Released from Fibroblasts Is Essential for Up-regulation of Matrix Metalloproteinase-1 Expression by U937 Macrophages in Coculture
Article Snippet: Enzyme-linked Immunosorbent Assay (ELISA) —MMPs, tissue inhibitors of metalloproteinases (TIMPs), and IL-6 in conditioned medium were quantified using sandwich ELISA kits according to the protocol provided by the manufacturer (R & D Systems, Minneapolis, MN). .. The complete reaction was cycled for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C using a PTC-200 DNA Engine (MJ Research, Waltham, MA).

Multiplex Assay:

Article Title: The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea
Article Snippet: Multiplex PCR amplification was done in a 20 μ L reaction volume, containing 40 ng of template DNA, AmpliTaq Gold 360 Master Mix (Life Technologies, USA), and appropriate concentrations of each primer. .. Thermal cycling was conducted on a PTC-200 DNA engine (MJ Research): 95°C for 10 min; 45 cycles of 95°C for 20 s, 58°C for 20 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. To purify PCR products, 5 μ L of the PCR products was treated with 1 μ L of ExoSAP-IT (catalogue number 78201; USB, Cleveland, OH, USA) at 37°C for 45 min. After that, the enzyme was inactivated by incubation at 80°C for 15 min. We used twenty-two single base extension (SBE) primers recommended by Lee et al. [ ].

Spectrophotometry:

Article Title: Avoidance of On-Target Off-Tumor Activation Using a Co-stimulation-Only Chimeric Antigen Receptor
Article Snippet: PCR was carried out in a PTC-200 DNA Engine (MJ Research). .. Sample concentrations were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific).

Variant Assay:

Article Title: Genetic and Functional Analysis of the DLG4 Gene Encoding the Post-Synaptic Density Protein 95 in Schizophrenia
Article Snippet: PCR cycling conditions consisted of an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, optimal annealing temperature of each amplicon for 1 min, and 72°C for 1 min. PCR was performed with a PTC-200 DNA engine (MJ Research, Watertown, MA). .. For the case-control association study, the genotype of each genetic variant of the DLG4 gene in the control subjects was also determined by PCR-based direct sequencing.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    MJ Research dna engine
    2% agarose gel electrophoresis of <t>PCR</t> products corresponding to NOS terminator gene: Lane 1 , 50 bp <t>DNA</t> marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)
    Dna Engine, supplied by MJ Research, used in various techniques. Bioz Stars score: 99/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna engine/product/MJ Research
    Average 99 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    dna engine - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    94
    MJ Research ptc dna engine system
    2% agarose gel electrophoresis of <t>PCR</t> products corresponding to NOS terminator gene: Lane 1 , 50 bp <t>DNA</t> marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)
    Ptc Dna Engine System, supplied by MJ Research, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptc dna engine system/product/MJ Research
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ptc dna engine system - by Bioz Stars, 2020-01
    94/100 stars
      Buy from Supplier

    97
    MJ Research thermocycler
    2% agarose gel electrophoresis of <t>PCR</t> products corresponding to NOS terminator gene: Lane 1 , 50 bp <t>DNA</t> marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)
    Thermocycler, supplied by MJ Research, used in various techniques. Bioz Stars score: 97/100, based on 231 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermocycler/product/MJ Research
    Average 97 stars, based on 231 article reviews
    Price from $9.99 to $1999.99
    thermocycler - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    Image Search Results


    2% agarose gel electrophoresis of PCR products corresponding to NOS terminator gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Journal: Journal of Food Science and Technology

    Article Title: Nucleic acid from beans extracted by ethanediamine magnetic particles

    doi: 10.1007/s13197-013-1168-7

    Figure Lengend Snippet: 2% agarose gel electrophoresis of PCR products corresponding to NOS terminator gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Article Snippet: The PCR was performed using a DNA Engine (PTC-200 Peltier Thermal Cycler, MJ Research, Waltham, MA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    2% agarose gel electrophoresis of PCR products corresponding to CaMV35S promoter gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Journal: Journal of Food Science and Technology

    Article Title: Nucleic acid from beans extracted by ethanediamine magnetic particles

    doi: 10.1007/s13197-013-1168-7

    Figure Lengend Snippet: 2% agarose gel electrophoresis of PCR products corresponding to CaMV35S promoter gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Article Snippet: The PCR was performed using a DNA Engine (PTC-200 Peltier Thermal Cycler, MJ Research, Waltham, MA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    2% agarose gel electrophoresis of PCR products corresponding to CP4-EPSPS gene : Lane 1 , 50 bp DNA marker; Lane 2 ,soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Journal: Journal of Food Science and Technology

    Article Title: Nucleic acid from beans extracted by ethanediamine magnetic particles

    doi: 10.1007/s13197-013-1168-7

    Figure Lengend Snippet: 2% agarose gel electrophoresis of PCR products corresponding to CP4-EPSPS gene : Lane 1 , 50 bp DNA marker; Lane 2 ,soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Article Snippet: The PCR was performed using a DNA Engine (PTC-200 Peltier Thermal Cycler, MJ Research, Waltham, MA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    2% agarose gel electrophoresis of PCR products corresponding to lectin gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Journal: Journal of Food Science and Technology

    Article Title: Nucleic acid from beans extracted by ethanediamine magnetic particles

    doi: 10.1007/s13197-013-1168-7

    Figure Lengend Snippet: 2% agarose gel electrophoresis of PCR products corresponding to lectin gene: Lane 1 , 50 bp DNA marker; Lane 2 , soybeans; Lane 3 , mung beans; Lane 4 , adzuki beans; Lane 5 , runner beans; Lane 6 , GM soybean (GTS-4032)

    Article Snippet: The PCR was performed using a DNA Engine (PTC-200 Peltier Thermal Cycler, MJ Research, Waltham, MA).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker