Structured Review

Stratagene psg5
Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of <t>pSG5</t> (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.
Psg5, supplied by Stratagene, used in various techniques. Bioz Stars score: 91/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/psg5/product/Stratagene
Average 91 stars, based on 118 article reviews
Price from $9.99 to $1999.99
psg5 - by Bioz Stars, 2020-04
91/100 stars

Images

1) Product Images from "A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro"

Article Title: A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro

Journal: Journal of Virology

doi:

Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.
Figure Legend Snippet: Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.

Techniques Used: Expressing, Transfection, Infection, Recombinant, Plasmid Preparation, Polyacrylamide Gel Electrophoresis, Labeling, Lysis, Immunoprecipitation, Incubation, In Vitro, Marker

2) Product Images from "Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿"

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

Journal:

doi: 10.1128/JVI.01817-08

Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified
Figure Legend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

Techniques Used: Plasmid Preparation

Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell
Figure Legend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

Techniques Used: Transfection, Plasmid Preparation

3) Product Images from "Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿"

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

Journal:

doi: 10.1128/JVI.01817-08

Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified
Figure Legend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

Techniques Used: Plasmid Preparation

Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell
Figure Legend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

Techniques Used: Transfection, Plasmid Preparation

4) Product Images from "The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31"

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31

Journal: Journal of Virology

doi: 10.1128/JVI.75.9.4139-4149.2001

E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.
Figure Legend Snippet: E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Binding Assay

Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.
Figure Legend Snippet: Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.

Techniques Used: Inhibition, Luciferase, Plasmid Preparation, Expressing, Activity Assay

Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.
Figure Legend Snippet: Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.

Techniques Used: Activity Assay, Binding Assay, Luciferase, Expressing, Plasmid Preparation, Construct

The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.
Figure Legend Snippet: The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Mutagenesis

E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.
Figure Legend Snippet: E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.

Techniques Used: Expressing, Luciferase, Plasmid Preparation, Activity Assay, Construct

5) Product Images from "Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6"

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6

Journal: Journal of Virology

doi:

Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.
Figure Legend Snippet: Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.

Techniques Used: Transfection, Plasmid Preparation, Expressing, Fractionation, Northern Blot, Generated, Clone Assay

Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.
Figure Legend Snippet: Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.

Techniques Used: Transfection, Expressing, Plasmid Preparation

6) Product Images from "The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins"

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.22.8352-8362.2003

). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.
Figure Legend Snippet: ). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.

Techniques Used: Southern Blot, Mutagenesis, Negative Control, Transfection, Construct, Marker, Derivative Assay, Western Blot, Expressing, Plasmid Preparation, Labeling

E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P
Figure Legend Snippet: E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P

Techniques Used: Activated Clotting Time Assay, Mutagenesis, Generated, Western Blot, Isolation, Transfection, Expressing, Plasmid Preparation, Marker, Luciferase, Activity Assay, Construct

7) Product Images from "Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]"

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]

Journal: Journal of Lipid Research

doi: 10.1194/jlr.M035436

PPARα ligands alter PPARα transactivation. COS-7 cells transfected with pSG5 empty vector, PPARα, RXRα, and both PPARα and RXRα were analyzed for transactivation of the acyl-CoA oxidase-PPRE-luciferase reporter construct in the presence of vehicle (open bars), 1 µM palmitic acid (diagonally upward bars), 1 µM palmitoleic acid (diagonally downward bars), 1 µM stearic acid (cross-hatched bars), 1 µM oleic acid (horizontal lined bars), 1 µM EPA (vertically lined bars), 1 µM DHA (hatched bars), and 1 µM clofibrate (open bars). For comparison between human and mouse effects, COS-7 cells were transfected with human versions of these proteins (A) or mouse versions of these proteins (B). The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where PPARα- and RXRα-overexpressing cells in the presence of 1 μM clofibrate were arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P
Figure Legend Snippet: PPARα ligands alter PPARα transactivation. COS-7 cells transfected with pSG5 empty vector, PPARα, RXRα, and both PPARα and RXRα were analyzed for transactivation of the acyl-CoA oxidase-PPRE-luciferase reporter construct in the presence of vehicle (open bars), 1 µM palmitic acid (diagonally upward bars), 1 µM palmitoleic acid (diagonally downward bars), 1 µM stearic acid (cross-hatched bars), 1 µM oleic acid (horizontal lined bars), 1 µM EPA (vertically lined bars), 1 µM DHA (hatched bars), and 1 µM clofibrate (open bars). For comparison between human and mouse effects, COS-7 cells were transfected with human versions of these proteins (A) or mouse versions of these proteins (B). The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where PPARα- and RXRα-overexpressing cells in the presence of 1 μM clofibrate were arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P

Techniques Used: Transfection, Plasmid Preparation, Luciferase, Construct, Activity Assay

8) Product Images from "Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions"

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions

Journal: Journal of Virology

doi:

(A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.
Figure Legend Snippet: (A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.

Techniques Used: Electrophoretic Mobility Shift Assay, Mutagenesis, Transfection, Plasmid Preparation, Expressing, Labeling, Binding Assay, Luciferase, Activity Assay, Cotransfection, Hybridization, Autoradiography

9) Product Images from "Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections"

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections

Journal: Journal of Clinical Microbiology

doi:

Expression of rhesus LCV sVCA in COS-7 cells. (A) Immunoblot strips with cell lysates of pSG5 rhesus LCV sVCA-transfected cells; (B) cell lysates of pSG5-transfected cells. Immunoblots containing cell lysates positive (A) and negative (B) for rhesus LCV sVCA were probed with five different LCV-immune rhesus sera (lanes 1 to 5) using a cassette Mini-protean II system (Bio-Rad).
Figure Legend Snippet: Expression of rhesus LCV sVCA in COS-7 cells. (A) Immunoblot strips with cell lysates of pSG5 rhesus LCV sVCA-transfected cells; (B) cell lysates of pSG5-transfected cells. Immunoblots containing cell lysates positive (A) and negative (B) for rhesus LCV sVCA were probed with five different LCV-immune rhesus sera (lanes 1 to 5) using a cassette Mini-protean II system (Bio-Rad).

Techniques Used: Expressing, Transfection, Western Blot

10) Product Images from "The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation"

Article Title: The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.102523299

Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.

Techniques Used: Expressing, Transformation Assay, Transfection, Plasmid Preparation, Mouse Assay, Injection

Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.

Techniques Used: Expressing, Transfection

PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.
Figure Legend Snippet: PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.

Techniques Used: Generated, FACS, Incubation, Transmission Assay, Electron Microscopy

11) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

12) Product Images from "Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter"

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter

Journal: Journal of Virology

doi: 10.1128/JVI.75.23.11781-11790.2001

(A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).
Figure Legend Snippet: (A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).

Techniques Used: Polyacrylamide Gel Electrophoresis, Western Blot, Marker, Transfection, Luciferase, Construct, Activity Assay, Expressing, Plasmid Preparation, FACS, Lysis

13) Product Images from "The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins"

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.22.8352-8362.2003

). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.
Figure Legend Snippet: ). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.

Techniques Used: Southern Blot, Mutagenesis, Negative Control, Transfection, Construct, Marker, Derivative Assay, Western Blot, Expressing, Plasmid Preparation, Labeling

E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P
Figure Legend Snippet: E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P

Techniques Used: Activated Clotting Time Assay, Mutagenesis, Generated, Western Blot, Isolation, Transfection, Expressing, Plasmid Preparation, Marker, Luciferase, Activity Assay, Construct

14) Product Images from "The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31"

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31

Journal: Journal of Virology

doi: 10.1128/JVI.75.9.4139-4149.2001

E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.
Figure Legend Snippet: E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Binding Assay

Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.
Figure Legend Snippet: Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.

Techniques Used: Inhibition, Luciferase, Plasmid Preparation, Expressing, Activity Assay

Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.
Figure Legend Snippet: Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.

Techniques Used: Activity Assay, Binding Assay, Luciferase, Expressing, Plasmid Preparation, Construct

The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.
Figure Legend Snippet: The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Mutagenesis

E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.
Figure Legend Snippet: E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.

Techniques Used: Expressing, Luciferase, Plasmid Preparation, Activity Assay, Construct

15) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

16) Product Images from "Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6"

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6

Journal: Journal of Virology

doi:

Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.
Figure Legend Snippet: Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.

Techniques Used: Transfection, Plasmid Preparation, Expressing, Fractionation, Northern Blot, Generated, Clone Assay

Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.
Figure Legend Snippet: Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.

Techniques Used: Transfection, Expressing, Plasmid Preparation

17) Product Images from "Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6"

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6

Journal: Journal of Virology

doi:

Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.
Figure Legend Snippet: Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.

Techniques Used: Transfection, Plasmid Preparation, Expressing, Fractionation, Northern Blot, Generated, Clone Assay

Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.
Figure Legend Snippet: Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.

Techniques Used: Transfection, Expressing, Plasmid Preparation

18) Product Images from "Activated Mouse Notch1 Transactivates Epstein-Barr Virus Nuclear Antigen 2-Regulated Viral Promoters"

Article Title: Activated Mouse Notch1 Transactivates Epstein-Barr Virus Nuclear Antigen 2-Regulated Viral Promoters

Journal: Journal of Virology

doi:

Luciferase activity of the RBP-Jκ multimer construct upon titration of mNotch1-IC and EBNA2 expression plasmids. (A) Twenty micrograms of the reporter construct pGa981-16 was cotransfected with 0.1, 1, or 10 μg of the expression plasmids pSG5 mNotch1-IC (black boxes) or pGa986-20 (white boxes) into the EBNA2-negative cell line BL41-P3HR1. The amount of expression plasmid was adjusted to 10 μg with the vector pSG5. The fold transactivation was standardized to the value obtained from cotransfection with 10 μg of the vector control pSG5. Results are averages from two independent experiments. (B) At 24 h after the transfection of 0.1, 1, or 10 μg of pSG5 mNotch1-IC in BL41-P3HR1 cells, the cells were harvested. Equal amounts of protein were loaded onto the gel, and expression of mNotch1-IC was examined by Western blotting with the anti-FLAG antibody. Available antibodies failed to detect EBNA2 at this concentration.
Figure Legend Snippet: Luciferase activity of the RBP-Jκ multimer construct upon titration of mNotch1-IC and EBNA2 expression plasmids. (A) Twenty micrograms of the reporter construct pGa981-16 was cotransfected with 0.1, 1, or 10 μg of the expression plasmids pSG5 mNotch1-IC (black boxes) or pGa986-20 (white boxes) into the EBNA2-negative cell line BL41-P3HR1. The amount of expression plasmid was adjusted to 10 μg with the vector pSG5. The fold transactivation was standardized to the value obtained from cotransfection with 10 μg of the vector control pSG5. Results are averages from two independent experiments. (B) At 24 h after the transfection of 0.1, 1, or 10 μg of pSG5 mNotch1-IC in BL41-P3HR1 cells, the cells were harvested. Equal amounts of protein were loaded onto the gel, and expression of mNotch1-IC was examined by Western blotting with the anti-FLAG antibody. Available antibodies failed to detect EBNA2 at this concentration.

Techniques Used: Luciferase, Activity Assay, Construct, Titration, Expressing, Plasmid Preparation, Cotransfection, Transfection, Western Blot, Concentration Assay

The EBNA2RE of the Bam HI C promoter can confer mNotch1-IC and EBNA2 responsiveness on either the Bam HI C or the β-globin minimal promoter. (A) Schematic representation of the Bam HI C promoter luciferase constructs used in the cotransfection assays. In the upper part of the illustration the essential regions of the EBNA2RE of the Bam HI C promoter are shown. The two regions interact with RBP-Jκ and CBF2, respectively. In the lower part, the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with 10 μg of the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the Bam HI C promoter can confer mNotch1-IC and EBNA2 responsiveness on either the Bam HI C or the β-globin minimal promoter. (A) Schematic representation of the Bam HI C promoter luciferase constructs used in the cotransfection assays. In the upper part of the illustration the essential regions of the EBNA2RE of the Bam HI C promoter are shown. The two regions interact with RBP-Jκ and CBF2, respectively. In the lower part, the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with 10 μg of the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Hi-C, Luciferase, Construct, Cotransfection, Expressing, Plasmid Preparation

The EBNA2RE of the LMP1 promoter can confer mNotch1-IC and EBNA2 responsiveness on either the LMP1 or the β-globin minimal promoter. (A) Schematic representation of the LMP1 promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the LMP1 promoter EBNA2RE are shown. One sequence element interacts with RBP-Jκ; the other interacts with Spi1. A potential second RBP-Jκ site located beyond the EBNA2RE is indicated. In the lower part the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the LMP1 promoter can confer mNotch1-IC and EBNA2 responsiveness on either the LMP1 or the β-globin minimal promoter. (A) Schematic representation of the LMP1 promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the LMP1 promoter EBNA2RE are shown. One sequence element interacts with RBP-Jκ; the other interacts with Spi1. A potential second RBP-Jκ site located beyond the EBNA2RE is indicated. In the lower part the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Luciferase, Construct, Cotransfection, Sequencing, Expressing, Plasmid Preparation

The EBNA2RE of the LMP2A promoter can confer mNotch1-IC and EBNA2 responsiveness on the LMP2A minimal promoter. (A) Schematic representation of the LMP2A promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the EBNA2RE of the LMP2A promoter are shown. Two regions interact with RBP-Jκ, whereas the two others are designated as L2BF2 and L2BF3. In the lower part of the figure the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct, respectively, into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the LMP2A promoter can confer mNotch1-IC and EBNA2 responsiveness on the LMP2A minimal promoter. (A) Schematic representation of the LMP2A promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the EBNA2RE of the LMP2A promoter are shown. Two regions interact with RBP-Jκ, whereas the two others are designated as L2BF2 and L2BF3. In the lower part of the figure the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct, respectively, into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Luciferase, Construct, Cotransfection, Expressing, Plasmid Preparation

19) Product Images from "Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen"

Article Title: Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen

Journal: Journal of Virology

doi: 10.1128/JVI.75.19.9142-9155.2001

St, but not LT, induces apoptosis in U2OS cells. (A) U2OS cells seeded on Chamberslides were transiently transfected with a pCMV LT expression vector and processed for immunofluorescence staining with PAb419 antibody (left panel). The right panel outlines the nucleus after visualization of the DNA with DAPI. Note the preserved integrity of the nucleus, thus showing no signs of cell death. (B) U2OS cells were transfected as for panel A but with a pSG5 st expression vector. The left panel shows staining for st expression with PAb419 (two different fields), and the right one demonstrates DAPI staining of the cells in the same field. Strikingly, the st-expressing cells have a nuclear morphology very different from that of the nontransfected cell. The cells with fragmented nuclei show signs of cell death by apoptosis. (C) U2OS cells were transfected as for panel A but with the pSG5 st C103S/TR4 expression vector. The left panel shows staining for the st C103S/TR4 protein, and the right panel shows the DAPI staining of the same field. Interestingly, the nuclei are preserved, in contrast with the nuclei of wild-type st-expressing cells. Also note the predominantly nuclear localization pattern of this double mutant.
Figure Legend Snippet: St, but not LT, induces apoptosis in U2OS cells. (A) U2OS cells seeded on Chamberslides were transiently transfected with a pCMV LT expression vector and processed for immunofluorescence staining with PAb419 antibody (left panel). The right panel outlines the nucleus after visualization of the DNA with DAPI. Note the preserved integrity of the nucleus, thus showing no signs of cell death. (B) U2OS cells were transfected as for panel A but with a pSG5 st expression vector. The left panel shows staining for st expression with PAb419 (two different fields), and the right one demonstrates DAPI staining of the cells in the same field. Strikingly, the st-expressing cells have a nuclear morphology very different from that of the nontransfected cell. The cells with fragmented nuclei show signs of cell death by apoptosis. (C) U2OS cells were transfected as for panel A but with the pSG5 st C103S/TR4 expression vector. The left panel shows staining for the st C103S/TR4 protein, and the right panel shows the DAPI staining of the same field. Interestingly, the nuclei are preserved, in contrast with the nuclei of wild-type st-expressing cells. Also note the predominantly nuclear localization pattern of this double mutant.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Immunofluorescence, Staining, Mutagenesis

20) Product Images from "The p68 and p72 DEAD box RNA helicases interact with HDAC1 and repress transcription in a promoter-specific manner"

Article Title: The p68 and p72 DEAD box RNA helicases interact with HDAC1 and repress transcription in a promoter-specific manner

Journal: BMC Molecular Biology

doi: 10.1186/1471-2199-5-11

The involvement of HDAC activity in transcriptional repression by p68/p72. a) Relief of p68/p72 repression of MLP-CAT transcription by TSA. 1 μg of pcDNA3-GAL4 (pcG4) or GAL4-tagged p68/p72 (p68G4/p72G4) were co-transfected with 9 μg of MLP-CAT and TSA was added 16 hr after transfection, at a final concentration of 300 nM. The values for p68G4 and p72G4 are given relative to the baseline value for the pcG4 vector control, which was set at 1, and represent the average from three experiments. b) Immunoprecipitation/western blotting of myc-tagged p68 and p72 from 293 cells expressing these proteins. Myc-tagged proteins were immunoprecipitated with the anti-myc epitope antibody, 9E10, and western blotted with the same antibody to detect the presence of p68-myc and p72-myc fusion proteins. A myc-tagged pSG5 vector control is included. pSG5, p68 and p72 all refer to myc-tagged versions. H denotes cross reaction with the antibody heavy chain. Molecular weight markers (in kDa) are indicated. Equal amounts of these immunoprecipitated proteins were used in the HDAC activity assay shown in c. c) HDAC activity assay of immunoprecipitated p68 and p72 (see b). HDAC activity in the presence and absence of TSA is shown relative to that of the myc-tagged pSG5 vector control, which was set at 1, and represent the average from three experiments.
Figure Legend Snippet: The involvement of HDAC activity in transcriptional repression by p68/p72. a) Relief of p68/p72 repression of MLP-CAT transcription by TSA. 1 μg of pcDNA3-GAL4 (pcG4) or GAL4-tagged p68/p72 (p68G4/p72G4) were co-transfected with 9 μg of MLP-CAT and TSA was added 16 hr after transfection, at a final concentration of 300 nM. The values for p68G4 and p72G4 are given relative to the baseline value for the pcG4 vector control, which was set at 1, and represent the average from three experiments. b) Immunoprecipitation/western blotting of myc-tagged p68 and p72 from 293 cells expressing these proteins. Myc-tagged proteins were immunoprecipitated with the anti-myc epitope antibody, 9E10, and western blotted with the same antibody to detect the presence of p68-myc and p72-myc fusion proteins. A myc-tagged pSG5 vector control is included. pSG5, p68 and p72 all refer to myc-tagged versions. H denotes cross reaction with the antibody heavy chain. Molecular weight markers (in kDa) are indicated. Equal amounts of these immunoprecipitated proteins were used in the HDAC activity assay shown in c. c) HDAC activity assay of immunoprecipitated p68 and p72 (see b). HDAC activity in the presence and absence of TSA is shown relative to that of the myc-tagged pSG5 vector control, which was set at 1, and represent the average from three experiments.

Techniques Used: Activity Assay, Transfection, Concentration Assay, Plasmid Preparation, Immunoprecipitation, Western Blot, Expressing, Molecular Weight, HDAC Activity Assay

21) Product Images from "p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction"

Article Title: p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkj437

K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.
Figure Legend Snippet: K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.

Techniques Used: Transfection, Construct, Purification, Western Blot, Mutagenesis, Luciferase, Expressing, Binding Assay

22) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

23) Product Images from "The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation"

Article Title: The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.102523299

Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.

Techniques Used: Expressing, Transformation Assay, Transfection, Plasmid Preparation, Mouse Assay, Injection

Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.

Techniques Used: Expressing, Transfection

PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.
Figure Legend Snippet: PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.

Techniques Used: Generated, FACS, Incubation, Transmission Assay, Electron Microscopy

24) Product Images from "Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen"

Article Title: Induction of p53-Independent Apoptosis by Simian Virus 40 Small t Antigen

Journal: Journal of Virology

doi: 10.1128/JVI.75.19.9142-9155.2001

St, but not LT, induces apoptosis in U2OS cells. (A) U2OS cells seeded on Chamberslides were transiently transfected with a pCMV LT expression vector and processed for immunofluorescence staining with PAb419 antibody (left panel). The right panel outlines the nucleus after visualization of the DNA with DAPI. Note the preserved integrity of the nucleus, thus showing no signs of cell death. (B) U2OS cells were transfected as for panel A but with a pSG5 st expression vector. The left panel shows staining for st expression with PAb419 (two different fields), and the right one demonstrates DAPI staining of the cells in the same field. Strikingly, the st-expressing cells have a nuclear morphology very different from that of the nontransfected cell. The cells with fragmented nuclei show signs of cell death by apoptosis. (C) U2OS cells were transfected as for panel A but with the pSG5 st C103S/TR4 expression vector. The left panel shows staining for the st C103S/TR4 protein, and the right panel shows the DAPI staining of the same field. Interestingly, the nuclei are preserved, in contrast with the nuclei of wild-type st-expressing cells. Also note the predominantly nuclear localization pattern of this double mutant.
Figure Legend Snippet: St, but not LT, induces apoptosis in U2OS cells. (A) U2OS cells seeded on Chamberslides were transiently transfected with a pCMV LT expression vector and processed for immunofluorescence staining with PAb419 antibody (left panel). The right panel outlines the nucleus after visualization of the DNA with DAPI. Note the preserved integrity of the nucleus, thus showing no signs of cell death. (B) U2OS cells were transfected as for panel A but with a pSG5 st expression vector. The left panel shows staining for st expression with PAb419 (two different fields), and the right one demonstrates DAPI staining of the cells in the same field. Strikingly, the st-expressing cells have a nuclear morphology very different from that of the nontransfected cell. The cells with fragmented nuclei show signs of cell death by apoptosis. (C) U2OS cells were transfected as for panel A but with the pSG5 st C103S/TR4 expression vector. The left panel shows staining for the st C103S/TR4 protein, and the right panel shows the DAPI staining of the same field. Interestingly, the nuclei are preserved, in contrast with the nuclei of wild-type st-expressing cells. Also note the predominantly nuclear localization pattern of this double mutant.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Immunofluorescence, Staining, Mutagenesis

25) Product Images from "The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31"

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31

Journal: Journal of Virology

doi: 10.1128/JVI.75.9.4139-4149.2001

E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.
Figure Legend Snippet: E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Binding Assay

Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.
Figure Legend Snippet: Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.

Techniques Used: Inhibition, Luciferase, Plasmid Preparation, Expressing, Activity Assay

Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.
Figure Legend Snippet: Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.

Techniques Used: Activity Assay, Binding Assay, Luciferase, Expressing, Plasmid Preparation, Construct

The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.
Figure Legend Snippet: The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Mutagenesis

E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.
Figure Legend Snippet: E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.

Techniques Used: Expressing, Luciferase, Plasmid Preparation, Activity Assay, Construct

26) Product Images from "Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions"

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions

Journal: Journal of Virology

doi:

(A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.
Figure Legend Snippet: (A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.

Techniques Used: Electrophoretic Mobility Shift Assay, Mutagenesis, Transfection, Plasmid Preparation, Expressing, Labeling, Binding Assay, Luciferase, Activity Assay, Cotransfection, Hybridization, Autoradiography

27) Product Images from "Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿"

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

Journal:

doi: 10.1128/JVI.01817-08

Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified
Figure Legend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

Techniques Used: Plasmid Preparation

Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell
Figure Legend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

Techniques Used: Transfection, Plasmid Preparation

28) Product Images from "Determination of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal Latency-Associated Nuclear Antigen Residues Mediating Chromosome Association and DNA Binding ▿"

Article Title: Determination of Kaposi's Sarcoma-Associated Herpesvirus C-Terminal Latency-Associated Nuclear Antigen Residues Mediating Chromosome Association and DNA Binding ▿

Journal:

doi: 10.1128/JVI.01289-06

DNA replication mediated by LANA alanine substitution mutants. 293 cells were cotransfected with p8TR and pSG5 or pSG5 expressing LANA or LANA containing alanine substitutions. After ∼80 h, low-molecular-weight DNA was digested with BglII (lanes
Figure Legend Snippet: DNA replication mediated by LANA alanine substitution mutants. 293 cells were cotransfected with p8TR and pSG5 or pSG5 expressing LANA or LANA containing alanine substitutions. After ∼80 h, low-molecular-weight DNA was digested with BglII (lanes

Techniques Used: Expressing, Molecular Weight

29) Product Images from "Coreceptor restriction within the HLA-DQ locus for Epstein-Barr virus infection"

Article Title: Coreceptor restriction within the HLA-DQ locus for Epstein-Barr virus infection

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

The N-terminal 87 aa of HLA-DQ β*0201 provide a vital epitope involved in EBV entry. ( A ) Schematic representation of the HLA-DQ β-chains. Clear regions represent β*03032 amino acid sequence; gray regions represent β*0201 sequence. Hatched portions represent signal peptides. Arrowhead indicates the position of the amino acid encoded at the Sac I cleavage site. ( B ) Susceptibility of 721.174 cells transfected with the indicated HLA-DQ cDNAs to infection by EBfaV-GFP as analyzed by two-color flow cytometry. Numbers in the upper right-hand quadrants represent the percentage of HLA-DQ-expressing cells infected by EBfaV-GFP. The value for pSG5-transfected cells is > 0.00%. Dot plots contain 40,000 events.
Figure Legend Snippet: The N-terminal 87 aa of HLA-DQ β*0201 provide a vital epitope involved in EBV entry. ( A ) Schematic representation of the HLA-DQ β-chains. Clear regions represent β*03032 amino acid sequence; gray regions represent β*0201 sequence. Hatched portions represent signal peptides. Arrowhead indicates the position of the amino acid encoded at the Sac I cleavage site. ( B ) Susceptibility of 721.174 cells transfected with the indicated HLA-DQ cDNAs to infection by EBfaV-GFP as analyzed by two-color flow cytometry. Numbers in the upper right-hand quadrants represent the percentage of HLA-DQ-expressing cells infected by EBfaV-GFP. The value for pSG5-transfected cells is > 0.00%. Dot plots contain 40,000 events.

Techniques Used: Sequencing, Transfection, Infection, Flow Cytometry, Cytometry, Expressing

30) Product Images from "Coreceptor restriction within the HLA-DQ locus for Epstein-Barr virus infection"

Article Title: Coreceptor restriction within the HLA-DQ locus for Epstein-Barr virus infection

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

The N-terminal 87 aa of HLA-DQ β*0201 provide a vital epitope involved in EBV entry. ( A ) Schematic representation of the HLA-DQ β-chains. Clear regions represent β*03032 amino acid sequence; gray regions represent β*0201 sequence. Hatched portions represent signal peptides. Arrowhead indicates the position of the amino acid encoded at the Sac I cleavage site. ( B ) Susceptibility of 721.174 cells transfected with the indicated HLA-DQ cDNAs to infection by EBfaV-GFP as analyzed by two-color flow cytometry. Numbers in the upper right-hand quadrants represent the percentage of HLA-DQ-expressing cells infected by EBfaV-GFP. The value for pSG5-transfected cells is > 0.00%. Dot plots contain 40,000 events.
Figure Legend Snippet: The N-terminal 87 aa of HLA-DQ β*0201 provide a vital epitope involved in EBV entry. ( A ) Schematic representation of the HLA-DQ β-chains. Clear regions represent β*03032 amino acid sequence; gray regions represent β*0201 sequence. Hatched portions represent signal peptides. Arrowhead indicates the position of the amino acid encoded at the Sac I cleavage site. ( B ) Susceptibility of 721.174 cells transfected with the indicated HLA-DQ cDNAs to infection by EBfaV-GFP as analyzed by two-color flow cytometry. Numbers in the upper right-hand quadrants represent the percentage of HLA-DQ-expressing cells infected by EBfaV-GFP. The value for pSG5-transfected cells is > 0.00%. Dot plots contain 40,000 events.

Techniques Used: Sequencing, Transfection, Infection, Flow Cytometry, Cytometry, Expressing

31) Product Images from "The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31"

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31

Journal: Journal of Virology

doi: 10.1128/JVI.75.9.4139-4149.2001

E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.
Figure Legend Snippet: E 8 ̂ E2C represses a minimal promoter consisting of E2BS and the adenovirus major late TATA box-initiator elements. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the pC18-SP1-luc, pC18-luc, or pML44-luc luciferase reporter plasmids, respectively. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structures of the luciferase reporter plasmids are shown below the graph. Transcriptional control elements representing E2BS, SP1 binding sites (SP1), the adenovirus major late promoter TATA box-initiator element (INR), and the RNA initiation site (arrow) are indicated.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Binding Assay

Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.
Figure Legend Snippet: Long-distance repression by E 8 ̂ E2C is not required for inhibition of E2-mediated transactivation of transcription. NHKs were cotransfected with 200 ng of the pC18-SP1-luc luciferase reporter plasmid and 10 ng of E2 expression vector (pSXE2) together with 0, 3, 10, or 30 ng of the E 8 ̂ E2C or E 8 ̂ E2C KWK expression vector. The total amount of expression vector was kept constant by adding the pSG5 plasmid. The average relative luciferase activity in the presence of 10 ng of pSXE2 was set to 1. The average basal promoter activity in the presence of the parental expression vector pSG5 was 0.01 and is indicated in the graph as a reference. Standard deviations are indicated by the vertical lines.

Techniques Used: Inhibition, Luciferase, Plasmid Preparation, Expressing, Activity Assay

Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.
Figure Legend Snippet: Repression of HPV31 P97 activity by E 8 ̂ E2C in NHKs does not require promoter-proximal E2 binding sites. NHK were cotransfected with different HPV31 P97 luciferase reporter plasmids and eukaryotic expression vectors for E 8 ̂ E2C, E2 and E 8 ̂ E2C d3-12 or with the parental plasmid pSG5. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the pGL31URR plasmid is shown below the graph. Conserved E2BS1 to -4 and the P97 RNA initiation site are indicated.

Techniques Used: Activity Assay, Binding Assay, Luciferase, Expressing, Plasmid Preparation, Construct

The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.
Figure Legend Snippet: The E8 domain is necessary for long-distance repression of the HPV6a P2 early promoter by E 8 ̂ E2C. RTS3b cells were cotransfected with expression vectors for E 8 ̂ E2C or E 8 ̂ E2C d3-12 and the 6aNCR-P1∗P2-luc luciferase reporter plasmids indicated on the right. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars. The structure of the 6aNCR-P1∗P2-luc plasmid is shown below the graph. Conserved E2BS1 to -4 (gray boxes) and the initiation sites for the P1 and P2 promoters are indicated. No transcripts initiate at P1 because of a TATA box mutation.

Techniques Used: Expressing, Luciferase, Activity Assay, Construct, Plasmid Preparation, Mutagenesis

E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.
Figure Legend Snippet: E 8 ̂ E2C specifically represses the SV40 early promoter. NHK were cotransfected with expression vectors for E2, E 8 ̂ E2C, or E 8 ̂ E2C KWK (KWK) and the 6×E2BS-luc luciferase reporter plasmid. The structure of the 6×E2BS-luc plasmid is shown below the graph. HPV31-specific E2BS3 and -4, the minimal SV40 early promoter (SV40 early), and the RNA initiation site (arrow) are indicated. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. Standard deviations are indicated by the vertical lines above the bars.

Techniques Used: Expressing, Luciferase, Plasmid Preparation, Activity Assay, Construct

32) Product Images from "Sustained Activation of Mitogen-Activated Protein Kinases and Activator Protein 1 by the Hepatitis B Virus X Protein in Mouse Hepatocytes In Vivo"

Article Title: Sustained Activation of Mitogen-Activated Protein Kinases and Activator Protein 1 by the Hepatitis B Virus X Protein in Mouse Hepatocytes In Vivo

Journal: Journal of Virology

doi: 10.1128/JVI.75.21.10348-10358.2001

Exogenous expression of HBx in mouse liver. (a) Immunodetection of HBx protein following virosome-mediated HBx gene delivery to mouse liver. Hepatocyte lysates prepared from mouse livers were resolved by SDS-PAGE and visualized by Western blotting as described in Materials and Methods. (b) Analysis of HBx transcript. Total RNA from a portion of the same liver samples was isolated and analyzed by RT-PCR. The ethidium bromide staining of the PCR product is shown in the upper panel, and Southern hybridization of the same is shown in the middle panel. Corresponding samples were also analyzed for β-actin mRNA (lower panel). (c) Immunohistochemical analysis of HBx protein in fixed liver tissues as a function of DNA dose. Two days postinjection, liver sections from mice injected with 2 μg (panel 1) and 5 μg (panel 3) of HBx DNA-loaded virosomes were immunostained with an HBx-specific monoclonal antibody (B-8/2/8). Nuclei were visualized (blue color) by counterstaining with hematoxylin. The immunoreactive cells appeared pink with Fast-Red dye. Panels 2 and 4 represent liver sections from mice injected with 2 and 5 μg of pSG5 vector DNA-loaded F-virosomes, respectively.
Figure Legend Snippet: Exogenous expression of HBx in mouse liver. (a) Immunodetection of HBx protein following virosome-mediated HBx gene delivery to mouse liver. Hepatocyte lysates prepared from mouse livers were resolved by SDS-PAGE and visualized by Western blotting as described in Materials and Methods. (b) Analysis of HBx transcript. Total RNA from a portion of the same liver samples was isolated and analyzed by RT-PCR. The ethidium bromide staining of the PCR product is shown in the upper panel, and Southern hybridization of the same is shown in the middle panel. Corresponding samples were also analyzed for β-actin mRNA (lower panel). (c) Immunohistochemical analysis of HBx protein in fixed liver tissues as a function of DNA dose. Two days postinjection, liver sections from mice injected with 2 μg (panel 1) and 5 μg (panel 3) of HBx DNA-loaded virosomes were immunostained with an HBx-specific monoclonal antibody (B-8/2/8). Nuclei were visualized (blue color) by counterstaining with hematoxylin. The immunoreactive cells appeared pink with Fast-Red dye. Panels 2 and 4 represent liver sections from mice injected with 2 and 5 μg of pSG5 vector DNA-loaded F-virosomes, respectively.

Techniques Used: Expressing, Immunodetection, SDS Page, Western Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Staining, Polymerase Chain Reaction, Hybridization, Immunohistochemistry, Mouse Assay, Injection, Plasmid Preparation

Kinetics of ERK activation by HBx. (a) Extent of phosphorylation of ERKs (upper panel) and total ERK level (lower panel) in the hepatocyte lysates made from mice livers at different time points following a single injection of either virosomal HBx DNA or pSG5 vector. d, days. (b) MBP phosphorylation levels (upper panel), MBP levels (middle panel), and total ERK status (lower panel) in the same lysates. (c) Fold activation of MBP phosphorylation. (d) Tissue samples taken from all the time points were evaluated for the presence of HBx (upper panel) and β-actin mRNA transcripts (lower panel). (e) Western blot analysis of HBx protein following immunoprecipitation with anti-HBx monoclonal antibody (B-8/2/8) from liver cytosolic extracts. V, cell lysates from mice sacrificed 30 days after injection of the virosomal pSG5 vector.
Figure Legend Snippet: Kinetics of ERK activation by HBx. (a) Extent of phosphorylation of ERKs (upper panel) and total ERK level (lower panel) in the hepatocyte lysates made from mice livers at different time points following a single injection of either virosomal HBx DNA or pSG5 vector. d, days. (b) MBP phosphorylation levels (upper panel), MBP levels (middle panel), and total ERK status (lower panel) in the same lysates. (c) Fold activation of MBP phosphorylation. (d) Tissue samples taken from all the time points were evaluated for the presence of HBx (upper panel) and β-actin mRNA transcripts (lower panel). (e) Western blot analysis of HBx protein following immunoprecipitation with anti-HBx monoclonal antibody (B-8/2/8) from liver cytosolic extracts. V, cell lysates from mice sacrificed 30 days after injection of the virosomal pSG5 vector.

Techniques Used: Activation Assay, Mouse Assay, Injection, Plasmid Preparation, Western Blot, Immunoprecipitation

33) Product Images from "Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿"

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

Journal:

doi: 10.1128/JVI.01817-08

Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified
Figure Legend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

Techniques Used: Plasmid Preparation

Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell
Figure Legend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

Techniques Used: Transfection, Plasmid Preparation

34) Product Images from "p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction"

Article Title: p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkj437

K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.
Figure Legend Snippet: K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.

Techniques Used: Transfection, Construct, Purification, Western Blot, Mutagenesis, Luciferase, Expressing, Binding Assay

35) Product Images from "Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions"

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions

Journal: Journal of Virology

doi:

(A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.
Figure Legend Snippet: (A) Gel retardation analysis of HPV31 wt E2 and E2 mutant proteins EN20, RK37, EQ39, and IL73 expressed in SCC-13 cells. Control lanes received no protein extract (lane −) or extract from cells transfected with the parental pSG5 vector (lane SG5). Lanes E2, 20, 37, 39, and 73 received identical amounts of extracts from cells transfected with the respective expression vectors. The retarded band corresponding to the E2-DNA complex is indicated with an arrow labeled c. The free 32 P-labeled oligonucleotide containing an E2 binding site is indicated by an arrow labeled f. (B) Transient luciferase expression assays. SCC-13 cells were transfected with expression vectors for HPV31 wt E2 or E2 mutant protein EN20, RK37, EQ39, or IL73 and the E2-responsive reporter plasmid p6XE2BS-luc and analyzed for luciferase activity. The reporter plasmid consists of six E2-binding sites (E2) upstream of the minimal SV40 early promoter (SV) that drives the expression of the luciferase gene (luc) and is diagrammed below the graph. The luciferase activity obtained by cotransfection of the E2 mutant expression plasmids is given relative to the activity of wt E2-transfected cells, which was set to 1. The standard deviations are indicated by error bars. (C) Transient replication assay. SCC-13 cells were transfected with plasmid pGL31URR alone (−) or together with an expression vector for HPV31 E1 or both vectors together with expression vectors for HPV31 wt E2 or E2 mutant proteins EN20, RK37, EQ39, and IL73. Transient replication of pGL31URR was analyzed by Southern hybridization. A representative autoradiograph is shown below the graph. Replication levels of pGL31URR were quantitated by phosphoimaging analysis and are represented relative to the replication levels induced by HPV31 wt E2, which was set to 1. The standard deviations are indicated by error bars.

Techniques Used: Electrophoretic Mobility Shift Assay, Mutagenesis, Transfection, Plasmid Preparation, Expressing, Labeling, Binding Assay, Luciferase, Activity Assay, Cotransfection, Hybridization, Autoradiography

36) Product Images from "The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins"

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.22.8352-8362.2003

). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.
Figure Legend Snippet: ). (B) Representative Southern blot of a transient replication analysis of HPV31 wild-type (31WT) and mutant genomes. The replication-deficient HPV31-E1NTTL genomeserved as a negative control. The positions of Dpn I-resistant (replicated) DNA and Dpn I-sensitive (input) DNA are indicated. Signal intensities of input DNA reveal similar transfection and recovery efficiencies for all constructs. One hundred picograms of Eco RI-digested HPV31 DNA was used as a size marker in lane M. (C) Graphic representation of the relative replication levels of HPV31 genomes. Signal intensities of Dpn I-resistant DNA were quantified by phosphorimager analysis. The replication levels of the different HPV31 genomes are presented relative to that of wild-type HPV31 (31WT), which was set to 1. Error bars indicate standard deviations derived from data from three to five experiments. (D) Western blot analysis of E8Ê2C wild-type and mutant proteins. 293 cells were transfected with the empty expression vector pSG5 (vec) or expression vectors encoding wild-type E8 ∧ E2C or mutant E8 ∧ E2C W6A, K7A, or KWK proteins. A polyclonal antipeptide rabbit antiserum was used for the detection of E8 ∧ E2C proteins. Bands representing E8 ∧ E2C proteins are indicated by an arrow labeled “s.” A nonspecific band is also indicated (ns) and served as a loading control. A molecular mass marker (in kilodaltons) is shown on the left.

Techniques Used: Southern Blot, Mutagenesis, Negative Control, Transfection, Construct, Marker, Derivative Assay, Western Blot, Expressing, Plasmid Preparation, Labeling

E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P
Figure Legend Snippet: E8 ∧ E2C-GAL4 fusion proteins act as transcriptional repressors. (A) Schematic representation of the structure of HPV31 E8 ∧ E2C and E8 ∧ E2C-GAL4 fusion proteins. The E8 part is depicted in white, the E2C part is depicted in black, and the GAL4 DBD is depicted in gray. The LDTR-deficient E8 ∧ E2C KWK mutant protein was generated by changing residues 5 to 8 from KWK to AEA, and this is indicated by a striped box. Identical mutations were introduced into E8 ∧ E2C(1-37) KWK-GAL4. Either 12, 21, or 37 amino-terminal residues of E8 ∧ E2C or E8 ∧ E2C KWK were fused to aa 1 to 147 of the DBD of the yeast transcription factor GAL4. (B) Western blot analysis of extracts isolated from transiently transfected 293 cells. Cells were transfected with the empty expression vector pSG5 or with plasmids expressing unfused or E8 ∧ E2C-GAL4 proteins and analyzed with an antibody specific for the GAL4 DBD. A molecular mass marker is indicated to the right in kilodaltons. (C) SCC13 cells were cotransfected with 30 ng of expression vectors for E8 ∧ E2C or E8 ∧ E2C KWK, E8(1-12)-GAL4, E8 ∧ E2C(1-21)-GAL4, E8 ∧ E2C(1-37)-GAL4, E8 ∧ E2C(1-37) KWK-GAL4, and 200 ng of the pC18-SP1-4xGAL4-luc luciferase reporter plasmid, respectively. In addition, 30 ng of pSG5 was included when transfecting expression vectors for GAL4 fusions, and 30 ng of pSG-GAL4 was added when E8 ∧ E2C expression vectors were used. The average relative luciferase activities were calculated with respect to the activity of each construct in the presence of the parental pSG5 expression vector, which was set to 1. The luciferase activities are presented relative to the activity of pC18-SP1-4xGAL4-luc cotransfected withboth 30 ng of pSG5 and 30 ng of pSG-GAL4 expression vectors, which was set to 1 (control). Standard deviations are indicated by error bars. A Student′s t test analysis revealed that the observed differences between the control and E8(1-12)-GAL4 as well as between E8 ∧ E2C(1-37)-GAL4 and E8 ∧ E2C(1-37) KWK-GAL4 are statistically significant ( P

Techniques Used: Activated Clotting Time Assay, Mutagenesis, Generated, Western Blot, Isolation, Transfection, Expressing, Plasmid Preparation, Marker, Luciferase, Activity Assay, Construct

37) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

38) Product Images from "Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter"

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter

Journal: Journal of Virology

doi: 10.1128/JVI.75.23.11781-11790.2001

(A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).
Figure Legend Snippet: (A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).

Techniques Used: Polyacrylamide Gel Electrophoresis, Western Blot, Marker, Transfection, Luciferase, Construct, Activity Assay, Expressing, Plasmid Preparation, FACS, Lysis

39) Product Images from "Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter"

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter

Journal: Journal of Virology

doi: 10.1128/JVI.75.23.11781-11790.2001

(A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).
Figure Legend Snippet: (A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).

Techniques Used: Polyacrylamide Gel Electrophoresis, Western Blot, Marker, Transfection, Luciferase, Construct, Activity Assay, Expressing, Plasmid Preparation, FACS, Lysis

40) Product Images from "Np9 Protein of Human Endogenous Retrovirus K Interacts with Ligand of Numb Protein X"

Article Title: Np9 Protein of Human Endogenous Retrovirus K Interacts with Ligand of Numb Protein X

Journal: Journal of Virology

doi: 10.1128/JVI.78.19.10310-10319.2004

(A) Half-life of ectopically expressed Np9 in Tera-1 cells. Tera-1 cultures were transfected for 24 h with pSG5-Np9. The cultures were then treated either with MG132 (5 μM) for another 24 h or with CHX (25 μg/ml) for the indicated times at 48 h after transfection. Np9 protein was subjected to immunoprecipitation with K82 antiserum and analyzed by immunoblotting. Untreated Tera-1 extracts served as negative controls. (B) Half-life of transfected cytoplasmic Np9NLS1 in Tera-1 cells. Tera-1 cultures were treated and analyzed as described in panel A but were transfected with plasmid pSG5-Np9NLS1. (C) Stability of transfected Np9 in the presence of transfected p65 Numb. Tera-1 cultures were transfected and analyzed as outlined in panel A, except that pSG5-Np9 was cotransfected with Numb-pSG5-HA. Transfection efficiency was controlled by Western blotting (results not shown).
Figure Legend Snippet: (A) Half-life of ectopically expressed Np9 in Tera-1 cells. Tera-1 cultures were transfected for 24 h with pSG5-Np9. The cultures were then treated either with MG132 (5 μM) for another 24 h or with CHX (25 μg/ml) for the indicated times at 48 h after transfection. Np9 protein was subjected to immunoprecipitation with K82 antiserum and analyzed by immunoblotting. Untreated Tera-1 extracts served as negative controls. (B) Half-life of transfected cytoplasmic Np9NLS1 in Tera-1 cells. Tera-1 cultures were treated and analyzed as described in panel A but were transfected with plasmid pSG5-Np9NLS1. (C) Stability of transfected Np9 in the presence of transfected p65 Numb. Tera-1 cultures were transfected and analyzed as outlined in panel A, except that pSG5-Np9 was cotransfected with Numb-pSG5-HA. Transfection efficiency was controlled by Western blotting (results not shown).

Techniques Used: Transfection, Immunoprecipitation, Plasmid Preparation, Western Blot

(A) Changes in steady-state levels of Np9 in dependence of Numb. Cos-1 cells were transiently transfected with pSG5-Np9 plus Numb-pSG5-HA at increasing quantities (0.1 to 2 μg) or with pSG5-Np9 and empty vector only. MG132 (5 μM) was added to the latter, and protein extracts were prepared at 48 h after transfection. Numb was detected with anti-Numb polyclonal antibody at a 1:500 dilution; β-actin was detected with anti-β-actin monoclonal antibody at a 1:1,000 dilution, and Np9 was detected with anti-Np9 polyclonal antibody at a 1:100 dilution. (B) Results of a GST pulldown assay documenting that Numb fails to directly interact with Np9.
Figure Legend Snippet: (A) Changes in steady-state levels of Np9 in dependence of Numb. Cos-1 cells were transiently transfected with pSG5-Np9 plus Numb-pSG5-HA at increasing quantities (0.1 to 2 μg) or with pSG5-Np9 and empty vector only. MG132 (5 μM) was added to the latter, and protein extracts were prepared at 48 h after transfection. Numb was detected with anti-Numb polyclonal antibody at a 1:500 dilution; β-actin was detected with anti-β-actin monoclonal antibody at a 1:1,000 dilution, and Np9 was detected with anti-Np9 polyclonal antibody at a 1:100 dilution. (B) Results of a GST pulldown assay documenting that Numb fails to directly interact with Np9.

Techniques Used: Transfection, Plasmid Preparation, GST Pulldown Assay

(A) Western blot analysis of protein extracts prepared from Cos-1 cells transiently transfected with pSG5-Np9. Twenty-four hours posttransfection, cells were treated with 5 μM MG132 (MG132 +), and extracts were harvested at the designated time points posttreatment with MG132. Untreated transiently transfected cells (MG132 −) and Cos-1 cells served as controls. Extracts were separated on a SDS-9.5 to 20% PAGE gradient and immunoblotted. Np9 was detected with the anti-Np9 polyclonal antiserum K82. (B) Western blot analysis of Tera-1 cell extracts partly treated with 5 μM MG132 for the times shown. A transiently pSG5-Np9-transfected Cos-1 cell extract served as a positive control. The total cellular protein extracts were separated on a SDS-9.5 to 20% PAGE gradient. Panel 1 shows a blot stained with anti-Np9 serum K82 preincubated with bacterially expressed Np9 protein. Panel 2 shows a blot stained with anti-Np9 serum K82 preincubated with the corresponding bacterial vector control. Np9-specific signals are marked with an arrowhead. (C) Western blot analysis of a cytolplasmic Np9 mutant (pSG5-Np9NLS1) in transiently transfected Cos-1 cells. Parallel cultures of Cos-1 cells were transiently transfected with pSG5-Np9 or a pSG5-Np9NLS1 mutant. One culture was treated 24 h posttransfection with 5 μM MG132 for an additional 24 h (MG132 +); the other culture remained untreated (MG132 −). Untransfected Cos-1 cells, with and without MG132 treatment, served as controls. Total cellular protein extracts were separated on a SDS-9.5 to 20% PAGE gradient. The arrowhead marks Np9-specific signals detected with the anti-Np9 polyclonal antiserum K82.
Figure Legend Snippet: (A) Western blot analysis of protein extracts prepared from Cos-1 cells transiently transfected with pSG5-Np9. Twenty-four hours posttransfection, cells were treated with 5 μM MG132 (MG132 +), and extracts were harvested at the designated time points posttreatment with MG132. Untreated transiently transfected cells (MG132 −) and Cos-1 cells served as controls. Extracts were separated on a SDS-9.5 to 20% PAGE gradient and immunoblotted. Np9 was detected with the anti-Np9 polyclonal antiserum K82. (B) Western blot analysis of Tera-1 cell extracts partly treated with 5 μM MG132 for the times shown. A transiently pSG5-Np9-transfected Cos-1 cell extract served as a positive control. The total cellular protein extracts were separated on a SDS-9.5 to 20% PAGE gradient. Panel 1 shows a blot stained with anti-Np9 serum K82 preincubated with bacterially expressed Np9 protein. Panel 2 shows a blot stained with anti-Np9 serum K82 preincubated with the corresponding bacterial vector control. Np9-specific signals are marked with an arrowhead. (C) Western blot analysis of a cytolplasmic Np9 mutant (pSG5-Np9NLS1) in transiently transfected Cos-1 cells. Parallel cultures of Cos-1 cells were transiently transfected with pSG5-Np9 or a pSG5-Np9NLS1 mutant. One culture was treated 24 h posttransfection with 5 μM MG132 for an additional 24 h (MG132 +); the other culture remained untreated (MG132 −). Untransfected Cos-1 cells, with and without MG132 treatment, served as controls. Total cellular protein extracts were separated on a SDS-9.5 to 20% PAGE gradient. The arrowhead marks Np9-specific signals detected with the anti-Np9 polyclonal antiserum K82.

Techniques Used: Western Blot, Transfection, Polyacrylamide Gel Electrophoresis, Positive Control, Staining, Plasmid Preparation, Mutagenesis

41) Product Images from "The E7 proteins of low- and high-risk human papillomaviruses share the ability to target the pRB family member p130 for degradation"

Article Title: The E7 proteins of low- and high-risk human papillomaviruses share the ability to target the pRB family member p130 for degradation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0510012103

Construction of HPV-6 E7 mutants and their characterization with respect to p130 binding and degradation. ( A ) Map of HPV-6 E7 mutants. ( B ) Stability of mutants. COS-7 cells were transfected with pSG5, pSG5(6E7), pSG5(H2AR4AH5A), pSG5(K9AD10A), pSG5(C25A),
Figure Legend Snippet: Construction of HPV-6 E7 mutants and their characterization with respect to p130 binding and degradation. ( A ) Map of HPV-6 E7 mutants. ( B ) Stability of mutants. COS-7 cells were transfected with pSG5, pSG5(6E7), pSG5(H2AR4AH5A), pSG5(K9AD10A), pSG5(C25A),

Techniques Used: Binding Assay, Transfection

42) Product Images from "Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]"

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]

Journal: Journal of Lipid Research

doi: 10.1194/jlr.M035436

PPARα ligands alter PPARα transactivation. COS-7 cells transfected with pSG5 empty vector, PPARα, RXRα, and both PPARα and RXRα were analyzed for transactivation of the acyl-CoA oxidase-PPRE-luciferase reporter construct in the presence of vehicle (open bars), 1 µM palmitic acid (diagonally upward bars), 1 µM palmitoleic acid (diagonally downward bars), 1 µM stearic acid (cross-hatched bars), 1 µM oleic acid (horizontal lined bars), 1 µM EPA (vertically lined bars), 1 µM DHA (hatched bars), and 1 µM clofibrate (open bars). For comparison between human and mouse effects, COS-7 cells were transfected with human versions of these proteins (A) or mouse versions of these proteins (B). The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where PPARα- and RXRα-overexpressing cells in the presence of 1 μM clofibrate were arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P
Figure Legend Snippet: PPARα ligands alter PPARα transactivation. COS-7 cells transfected with pSG5 empty vector, PPARα, RXRα, and both PPARα and RXRα were analyzed for transactivation of the acyl-CoA oxidase-PPRE-luciferase reporter construct in the presence of vehicle (open bars), 1 µM palmitic acid (diagonally upward bars), 1 µM palmitoleic acid (diagonally downward bars), 1 µM stearic acid (cross-hatched bars), 1 µM oleic acid (horizontal lined bars), 1 µM EPA (vertically lined bars), 1 µM DHA (hatched bars), and 1 µM clofibrate (open bars). For comparison between human and mouse effects, COS-7 cells were transfected with human versions of these proteins (A) or mouse versions of these proteins (B). The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where PPARα- and RXRα-overexpressing cells in the presence of 1 μM clofibrate were arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P

Techniques Used: Transfection, Plasmid Preparation, Luciferase, Construct, Activity Assay

43) Product Images from "Epstein-Barr Virus Entry Utilizing HLA-DP or HLA-DQ as a Coreceptor"

Article Title: Epstein-Barr Virus Entry Utilizing HLA-DP or HLA-DQ as a Coreceptor

Journal: Journal of Virology

doi:

Expression of HLA-DR, -DP, or -DQ mediates EBV entry into 721.174 and HPB-ALL cells. Daudi or HPB-ALL cells (10 6 ) electroporated with HLA-DR, HLA-DP, or HLA-DQ were infected with EBfaV-GFP and analyzed by two-color flow cytometry. The flow cytometer was gated for EGFP fluorescence and class II expression using a pan-class II antibody, TÜ39, detected by a goat anti-mouse allophycocyanin-conjugated secondary antibody. pSG5-electroporated cells were exposed to EBfaV-GFP and stained identically to class II-transfected cells. The number given in the lower right quadrant represents the percentage of cells expressing the appropriate class II molecule which are infected by EBfaV-GFP. Each plot shows 40,000 events.
Figure Legend Snippet: Expression of HLA-DR, -DP, or -DQ mediates EBV entry into 721.174 and HPB-ALL cells. Daudi or HPB-ALL cells (10 6 ) electroporated with HLA-DR, HLA-DP, or HLA-DQ were infected with EBfaV-GFP and analyzed by two-color flow cytometry. The flow cytometer was gated for EGFP fluorescence and class II expression using a pan-class II antibody, TÜ39, detected by a goat anti-mouse allophycocyanin-conjugated secondary antibody. pSG5-electroporated cells were exposed to EBfaV-GFP and stained identically to class II-transfected cells. The number given in the lower right quadrant represents the percentage of cells expressing the appropriate class II molecule which are infected by EBfaV-GFP. Each plot shows 40,000 events.

Techniques Used: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Staining, Transfection

44) Product Images from "The ETO Protein Disrupted in t(8;21)-Associated Acute Myeloid Leukemia Is a Corepressor for the Promyelocytic Leukemia Zinc Finger Protein"

Article Title: The ETO Protein Disrupted in t(8;21)-Associated Acute Myeloid Leukemia Is a Corepressor for the Promyelocytic Leukemia Zinc Finger Protein

Journal: Molecular and Cellular Biology

doi:

ETO enhances transcriptional repression mediated by PLZF. (A) Schematic representation of a reporter plasmid containing four binding sites for PLZF from the IL-3Rα chain promoter and a reporter plasmid containing five multimerized GAL4 operators. (B and C) Repression by PLZF through its cognate binding site. Transient transfection assays performed in duplicate in 293 T cells. Results are expressed as fold repression of luciferase expression from the reporter gene in the presence of PLZF and ETO compared to luciferase activity in the presence of parental expression vectors. (B) Lanes 1 to 4, 293T cells in six-well dishes were transfected with the tk -Luc reporter (100 ng) without PLZF binding sites and with pSG5 (800 ng [lane 1]), pSG5 (800 ng) plus CMV-ETO (400 ng) (lane 2), pSG5-PLZF (800 ng [lane 3]), and pSG5-PLZF (800 ng) plus CMV-ETO (400 ng) (lane 4). Lanes 5 to 8 contained IL3R- tk -Luc reporter with similar effectors as lanes 1 to 4. (C) 293T cells in 12-well dishes were transfected in duplicate with the IL3R- tk -Luc reporter (50 ng) and pCDNA (800 ng) plus pCMV (300 ng) (lane 1), pCDNA-PLZF (800 ng) plus pCMV (300 ng) (lane 2), pCDNA (800 ng) plus pCMV-ETO (300 ng) (lane 3), and pCDNA-PLZF (800 ng) plus pCMV-ETO (300 ng) (lane 4). (D) Dose-dependent corepression by ETO. 293T cells in six-well dishes were transfected in duplicate with the IL3R- tk -Luc reporter (100 ng) and pSG5 alone (400 ng [lane 1]) or pSG5 (400 ng) plus 200 ng (lane 2), 400 ng (lane 3) and 1,600 ng (lane 4) of pCMV ETO. Lanes: 5, pSG5-PLZF (400 ng); 6 to 8, pSG5-PLZF (400 ng) plus 200 ng (lane 6), 400 ng (lane 7), and 1,600 ng (lane 8) of ETO. (E) ETO enhances transcriptional repression by a Gal4-PLZF 1–400 fusion protein. 293T cells were transfected with the Gal4- tk -Luc reporter (100 ng) and Gal(1–147) (400 ng [lane 1]) or Gal(1–147) (400 ng) plus CMV-ETO (400 ng) (lane 2). Lanes 3 and 4: Gal-PLZF 1–400 (400 ng [lane 3]) and Gal-PLZF 1–400 (400 ng) plus CMV-ETO (400 ng) (lane 4).
Figure Legend Snippet: ETO enhances transcriptional repression mediated by PLZF. (A) Schematic representation of a reporter plasmid containing four binding sites for PLZF from the IL-3Rα chain promoter and a reporter plasmid containing five multimerized GAL4 operators. (B and C) Repression by PLZF through its cognate binding site. Transient transfection assays performed in duplicate in 293 T cells. Results are expressed as fold repression of luciferase expression from the reporter gene in the presence of PLZF and ETO compared to luciferase activity in the presence of parental expression vectors. (B) Lanes 1 to 4, 293T cells in six-well dishes were transfected with the tk -Luc reporter (100 ng) without PLZF binding sites and with pSG5 (800 ng [lane 1]), pSG5 (800 ng) plus CMV-ETO (400 ng) (lane 2), pSG5-PLZF (800 ng [lane 3]), and pSG5-PLZF (800 ng) plus CMV-ETO (400 ng) (lane 4). Lanes 5 to 8 contained IL3R- tk -Luc reporter with similar effectors as lanes 1 to 4. (C) 293T cells in 12-well dishes were transfected in duplicate with the IL3R- tk -Luc reporter (50 ng) and pCDNA (800 ng) plus pCMV (300 ng) (lane 1), pCDNA-PLZF (800 ng) plus pCMV (300 ng) (lane 2), pCDNA (800 ng) plus pCMV-ETO (300 ng) (lane 3), and pCDNA-PLZF (800 ng) plus pCMV-ETO (300 ng) (lane 4). (D) Dose-dependent corepression by ETO. 293T cells in six-well dishes were transfected in duplicate with the IL3R- tk -Luc reporter (100 ng) and pSG5 alone (400 ng [lane 1]) or pSG5 (400 ng) plus 200 ng (lane 2), 400 ng (lane 3) and 1,600 ng (lane 4) of pCMV ETO. Lanes: 5, pSG5-PLZF (400 ng); 6 to 8, pSG5-PLZF (400 ng) plus 200 ng (lane 6), 400 ng (lane 7), and 1,600 ng (lane 8) of ETO. (E) ETO enhances transcriptional repression by a Gal4-PLZF 1–400 fusion protein. 293T cells were transfected with the Gal4- tk -Luc reporter (100 ng) and Gal(1–147) (400 ng [lane 1]) or Gal(1–147) (400 ng) plus CMV-ETO (400 ng) (lane 2). Lanes 3 and 4: Gal-PLZF 1–400 (400 ng [lane 3]) and Gal-PLZF 1–400 (400 ng) plus CMV-ETO (400 ng) (lane 4).

Techniques Used: Plasmid Preparation, Binding Assay, Transfection, Luciferase, Expressing, Activity Assay

45) Product Images from "Temporal Regulation of Herpes Simplex Virus Type 2 VP22 Expression and Phosphorylation"

Article Title: Temporal Regulation of Herpes Simplex Virus Type 2 VP22 Expression and Phosphorylation

Journal: Journal of Virology

doi: 10.1128/JVI.75.22.10721-10729.2001

(A) UL13 can induce the phosphorylation of VP22. Vero cells were mock transfected (lane 1) or transfected with pcDNA-VP22(2) in combination with pSG5 (empty vector, lane 2), pSG5-UL13 (lane 3), pSG5-US3 (lane 4), or pSG5-UL13 plus pSG5-US3 (lane 5). Transfections were incubated for 24 h and lysed with 1× Laemmli buffer, and proteins were resolved by SDS-PAGE. Lysates from HSV-2-infected cells are shown in lane 6. VP22 was detected by Western analysis with MAb 22-3. (B) VP22 phosphorylation is responsive to the concentration of cotransfected UL13-expressing plasmid. Vero cells were transfected with pcDNA-VP22(2) alone (lane 1) or with increasing amounts of pSG5-UL13 (125 ng, lane 2; 250 ng, lane 3; 500 ng, lane 4; 1,000 ng, lane 5). Transfected cells were incubated for 24 h and lysed with 1× Laemmli buffer, and proteins were resolved by SDS-PAGE. VP22 was detected by Western analysis by using MAb 22-3.
Figure Legend Snippet: (A) UL13 can induce the phosphorylation of VP22. Vero cells were mock transfected (lane 1) or transfected with pcDNA-VP22(2) in combination with pSG5 (empty vector, lane 2), pSG5-UL13 (lane 3), pSG5-US3 (lane 4), or pSG5-UL13 plus pSG5-US3 (lane 5). Transfections were incubated for 24 h and lysed with 1× Laemmli buffer, and proteins were resolved by SDS-PAGE. Lysates from HSV-2-infected cells are shown in lane 6. VP22 was detected by Western analysis with MAb 22-3. (B) VP22 phosphorylation is responsive to the concentration of cotransfected UL13-expressing plasmid. Vero cells were transfected with pcDNA-VP22(2) alone (lane 1) or with increasing amounts of pSG5-UL13 (125 ng, lane 2; 250 ng, lane 3; 500 ng, lane 4; 1,000 ng, lane 5). Transfected cells were incubated for 24 h and lysed with 1× Laemmli buffer, and proteins were resolved by SDS-PAGE. VP22 was detected by Western analysis by using MAb 22-3.

Techniques Used: Transfection, Plasmid Preparation, Incubation, SDS Page, Infection, Western Blot, Concentration Assay, Expressing

46) Product Images from "Telomerase Activation by Human Papillomavirus Type 16 E6 Protein: Induction of Human Telomerase Reverse Transcriptase Expression through Myc and GC-Rich Sp1 Binding Sites"

Article Title: Telomerase Activation by Human Papillomavirus Type 16 E6 Protein: Induction of Human Telomerase Reverse Transcriptase Expression through Myc and GC-Rich Sp1 Binding Sites

Journal: Journal of Virology

doi: 10.1128/JVI.75.12.5559-5566.2001

Effects of mutations in Sp1 binding sites and Myc binding sites. (A) C33A cells were transfected with hTERT promoter-reporter plasmids and either pSG5 (control) or pSG5-16E6 (E6) ( P
Figure Legend Snippet: Effects of mutations in Sp1 binding sites and Myc binding sites. (A) C33A cells were transfected with hTERT promoter-reporter plasmids and either pSG5 (control) or pSG5-16E6 (E6) ( P

Techniques Used: Binding Assay, Transfection

Activation of hTERT promoter-reporter plasmids by E6. (A) Structure of TL 800 and TL DM. Each reporter contains approximately 800 bp of the hTERT promoter fused to the firefly luciferase gene. TL DM contains a point mutation (CACGTG→CACCTG) in each of the two Myc binding sites, located at −242 and −34 relative to the ATG initiation codon. (B) C33A cells were transfected with TL 800 and either pSG5-Myc (Myc), pSG5-16E6 (E6), pSG5-16E7 (E7), or both pSG5-16E6 and pSG5-16E7 (E6/E7) ( P
Figure Legend Snippet: Activation of hTERT promoter-reporter plasmids by E6. (A) Structure of TL 800 and TL DM. Each reporter contains approximately 800 bp of the hTERT promoter fused to the firefly luciferase gene. TL DM contains a point mutation (CACGTG→CACCTG) in each of the two Myc binding sites, located at −242 and −34 relative to the ATG initiation codon. (B) C33A cells were transfected with TL 800 and either pSG5-Myc (Myc), pSG5-16E6 (E6), pSG5-16E7 (E7), or both pSG5-16E6 and pSG5-16E7 (E6/E7) ( P

Techniques Used: Activation Assay, Luciferase, Mutagenesis, Binding Assay, Transfection

Specificity of hTERT promoter activation by E6. (A) HFKs were transfected with TL 800 and either pSG5 (control), pSG5-16E6 (E6), pSG5-16E6Δ9–13 (E6 Δ9–13), or pSG5-11E6 (11-E6) ( P
Figure Legend Snippet: Specificity of hTERT promoter activation by E6. (A) HFKs were transfected with TL 800 and either pSG5 (control), pSG5-16E6 (E6), pSG5-16E6Δ9–13 (E6 Δ9–13), or pSG5-11E6 (11-E6) ( P

Techniques Used: Activation Assay, Transfection

Deletion analysis of hTERT promoter activation by E6. (A) Schematic of hTERT promoter deletion mutants. Deletions were created by recombinant PCR. (B) HFKs were transfected with hTERT promoter-reporter plasmids and either pSG5 (control), pSG5-Myc (Myc), or pSG5-16E6 (E6). Cells were harvested 48 h posttransfection, and luciferase activity was normalized to total cellular protein concentration. Results are the means ± standard deviations of data from at least three experiments. P
Figure Legend Snippet: Deletion analysis of hTERT promoter activation by E6. (A) Schematic of hTERT promoter deletion mutants. Deletions were created by recombinant PCR. (B) HFKs were transfected with hTERT promoter-reporter plasmids and either pSG5 (control), pSG5-Myc (Myc), or pSG5-16E6 (E6). Cells were harvested 48 h posttransfection, and luciferase activity was normalized to total cellular protein concentration. Results are the means ± standard deviations of data from at least three experiments. P

Techniques Used: Activation Assay, Recombinant, Polymerase Chain Reaction, Transfection, Luciferase, Activity Assay, Protein Concentration

Mutational analysis of individual Sp1 binding sites in the hTERT promoter. (A) Schematic of hTERT promoter region containing Sp1 binding sites. (B) HFKs were transfected with hTERT promoter-reporters and either pSG5 (control) or pSG5-16E6 (E6). Cells were harvested 48 h posttransfection, and luciferase activity was normalized to total cellular protein concentration. Results are means ± standard deviations of data from five experiments. P
Figure Legend Snippet: Mutational analysis of individual Sp1 binding sites in the hTERT promoter. (A) Schematic of hTERT promoter region containing Sp1 binding sites. (B) HFKs were transfected with hTERT promoter-reporters and either pSG5 (control) or pSG5-16E6 (E6). Cells were harvested 48 h posttransfection, and luciferase activity was normalized to total cellular protein concentration. Results are means ± standard deviations of data from five experiments. P

Techniques Used: Binding Assay, Transfection, Luciferase, Activity Assay, Protein Concentration

47) Product Images from "Identification of a Novel RING Finger Protein as a Coregulator in Steroid Receptor-Mediated Gene Transcription"

Article Title: Identification of a Novel RING Finger Protein as a Coregulator in Steroid Receptor-Mediated Gene Transcription

Journal: Molecular and Cellular Biology

doi:

RING finger mutated SNURF is capable of enhancing AR-dependent transactivation but not basal transcription. (A) Influence of SNURF and SNURF(C→S) on transcription from the AR-dependent probasin promoter. CV-1 cells were transfected with 5 μg of pPB(−285/+32)-LUC reporter, 1 μg of pSG5-rAR, 2 μg of pCMVβ, and 5 μg of expression vectors of SNURF, SNURF(C→S), or SNURFΔID/(C→S) or the empty expression vector (pcDNA-3.1+) in the presence or absence of 100 nM testosterone (T) as indicated. (B) Transcription from a minimal AR-dependent promoter. Experimental conditions were as described for panel A, except that 5 μg of pARE 2 -TATA-LUC was used as the reporter. (C) Effect of SNURF and SNURF(C→S) on transcription from a minimal TATA-LUC promoter. Experimental conditions were as described for panel A, except that 5 μg of pTATA-LUC in the absence of pSG5-rAR was used. (D) Influence of SNURF and SNURF(C→S) on transcription from a simple Sp1-AP1-TATA promoter. CV-1 cells were transfected as described above but in the absence of pSG5-rAR, and 5 μg of pSp1-AP1-TATA-LUC containing a Sp1 and an AP1 binding site upstream of TATA sequence was used as the reporter. The amounts of pcDNA-SNURF and pcDNA-SNURF(C→S) are given in micrograms. Luciferase (LUC) activities were normalized for transfection efficiency by using the β-galactosidase activity.
Figure Legend Snippet: RING finger mutated SNURF is capable of enhancing AR-dependent transactivation but not basal transcription. (A) Influence of SNURF and SNURF(C→S) on transcription from the AR-dependent probasin promoter. CV-1 cells were transfected with 5 μg of pPB(−285/+32)-LUC reporter, 1 μg of pSG5-rAR, 2 μg of pCMVβ, and 5 μg of expression vectors of SNURF, SNURF(C→S), or SNURFΔID/(C→S) or the empty expression vector (pcDNA-3.1+) in the presence or absence of 100 nM testosterone (T) as indicated. (B) Transcription from a minimal AR-dependent promoter. Experimental conditions were as described for panel A, except that 5 μg of pARE 2 -TATA-LUC was used as the reporter. (C) Effect of SNURF and SNURF(C→S) on transcription from a minimal TATA-LUC promoter. Experimental conditions were as described for panel A, except that 5 μg of pTATA-LUC in the absence of pSG5-rAR was used. (D) Influence of SNURF and SNURF(C→S) on transcription from a simple Sp1-AP1-TATA promoter. CV-1 cells were transfected as described above but in the absence of pSG5-rAR, and 5 μg of pSp1-AP1-TATA-LUC containing a Sp1 and an AP1 binding site upstream of TATA sequence was used as the reporter. The amounts of pcDNA-SNURF and pcDNA-SNURF(C→S) are given in micrograms. Luciferase (LUC) activities were normalized for transfection efficiency by using the β-galactosidase activity.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Binding Assay, Sequencing, Luciferase, Activity Assay

Interaction between AR and SNURF in mammalian cells. (A) The ability of rAR (residues 3 to 902) fused to the DBD of Gal4 (Gal4-AR) to interact with VP16 AD fused to SNURF residues 20 to 177 (VP16-SNURF) or to polyomavirus coat protein (VP16-CP) was examined in CV-1 cells by assaying chloramphenicol acetyltransferase (CAT) activity from the reporter plasmid pG5CAT. Cells (2.3 × 10 5 ). (B) AR and SNURF are physically associated in COS-1 cells. COS-1 cells were transfected by electroporation with pFLAG-SNURF or pFLAG-SNURFΔID and pSG5-rAR as indicated. After a 30-h culture in the presence of 100 nM testosterone, whole-cell extracts were prepared and subjected to immunoprecipitation (IP) with mouse monoclonal anti-FLAG antibody. Immunoprecipitated proteins were analyzed by immunoblotting with a rabbit anti-AR antibody. Lanes 1 to 4 (input) represent portions of the cell extracts (5%) that were subjected to immunoblotting without prior immunoprecipitation.
Figure Legend Snippet: Interaction between AR and SNURF in mammalian cells. (A) The ability of rAR (residues 3 to 902) fused to the DBD of Gal4 (Gal4-AR) to interact with VP16 AD fused to SNURF residues 20 to 177 (VP16-SNURF) or to polyomavirus coat protein (VP16-CP) was examined in CV-1 cells by assaying chloramphenicol acetyltransferase (CAT) activity from the reporter plasmid pG5CAT. Cells (2.3 × 10 5 ). (B) AR and SNURF are physically associated in COS-1 cells. COS-1 cells were transfected by electroporation with pFLAG-SNURF or pFLAG-SNURFΔID and pSG5-rAR as indicated. After a 30-h culture in the presence of 100 nM testosterone, whole-cell extracts were prepared and subjected to immunoprecipitation (IP) with mouse monoclonal anti-FLAG antibody. Immunoprecipitated proteins were analyzed by immunoblotting with a rabbit anti-AR antibody. Lanes 1 to 4 (input) represent portions of the cell extracts (5%) that were subjected to immunoblotting without prior immunoprecipitation.

Techniques Used: Activity Assay, Plasmid Preparation, Transfection, Electroporation, Immunoprecipitation

Influence of SNURF overexpression on AR-dependent transactivation. (A) SNURF enhances AR-dependent and basal transcription from the rat probasin promoter. COS-1 cells were transfected by the calcium phosphate method with 5 μg of pPB(−285/+32)-LUC reporter plasmid along with 1 μg of pSG5-rAR or empty pSG5 and 5 μg of SNURF expression vector (pcDNA-SNURF) or empty expression vector (pcDNA-3.1+) in the presence 25 nM testosterone (T) as depicted. β-Galactosidase expression plasmid, pCMVβ (2 μg), was used as a control for transfection efficiency. (B) CV-1 cells were transfected with 1 μg of pSG5-rAR, 5 μg of pARE 2 -TATA-LUC reporter, 2 μg of pCMVβ, and 5 μg of pcDNA-SNURF or empty expression vector in the presence or absence of testosterone (T) as depicted. (C) The experimental conditions were as in panel B, except that 5 μg of pTATA-LUC (devoid of AREs) was used as a reporter. Reporter gene activities are expressed relative to that achieved with pSG5-rAR in the presence of testosterone (100 in panels A and B; 1 in panel C), and the mean ± standard error values of at least three independent experiments are given. (D and E) SNURF activates PR- and GR-dependent transcription. (D) Effect of SNURF on the transcriptional activity of PR. CV-1 cells were transfected with 5 μg of pARE 2 -tk-LUC reporter containing two copies of the GRE-PRE-ARE element of the rat TAT gene upstream of the thymidine kinase promoter along with 1 μg of pSG5-hPR1, 5 μg of pcDNA-SNURF or empty expression vector pcDNA-3.1+, and 2 μg of pCMVβ in the presence or absence of 100 nM progesterone (P). (E) CV-1 cells were transfected as for panel D but with 1 μg of pSG5-hGR instead of pSG5-hPR1 in the presence or absence of 100 nM dexamethasone (D). Luciferase (LUC) activities are expressed relative to those achieved with pSG5-hPR1 and pSG5-hGR in the presence of progesterone and dexamethasone, respectively (those values being equal to 100), and the mean ± standard error values of at least three independent experiments are shown. (F) Effect of SNURF overexpression on Sp1 activity. CV-1 cells were transiently transfected with 5 μg of pTATA-LUC, pSp1-TATA-LUC, or pSp1 2 -TATA-LUC reporters along with 5 μg of SNURF expression vector (pFLAG-SNURF) or empty expression vector (pFLAG-CMV-2) and also 2 μg of pCMVβ. Transcriptional activities are expressed as relative luciferase (LUC) activity normalized by using the β-galactosidase activity.
Figure Legend Snippet: Influence of SNURF overexpression on AR-dependent transactivation. (A) SNURF enhances AR-dependent and basal transcription from the rat probasin promoter. COS-1 cells were transfected by the calcium phosphate method with 5 μg of pPB(−285/+32)-LUC reporter plasmid along with 1 μg of pSG5-rAR or empty pSG5 and 5 μg of SNURF expression vector (pcDNA-SNURF) or empty expression vector (pcDNA-3.1+) in the presence 25 nM testosterone (T) as depicted. β-Galactosidase expression plasmid, pCMVβ (2 μg), was used as a control for transfection efficiency. (B) CV-1 cells were transfected with 1 μg of pSG5-rAR, 5 μg of pARE 2 -TATA-LUC reporter, 2 μg of pCMVβ, and 5 μg of pcDNA-SNURF or empty expression vector in the presence or absence of testosterone (T) as depicted. (C) The experimental conditions were as in panel B, except that 5 μg of pTATA-LUC (devoid of AREs) was used as a reporter. Reporter gene activities are expressed relative to that achieved with pSG5-rAR in the presence of testosterone (100 in panels A and B; 1 in panel C), and the mean ± standard error values of at least three independent experiments are given. (D and E) SNURF activates PR- and GR-dependent transcription. (D) Effect of SNURF on the transcriptional activity of PR. CV-1 cells were transfected with 5 μg of pARE 2 -tk-LUC reporter containing two copies of the GRE-PRE-ARE element of the rat TAT gene upstream of the thymidine kinase promoter along with 1 μg of pSG5-hPR1, 5 μg of pcDNA-SNURF or empty expression vector pcDNA-3.1+, and 2 μg of pCMVβ in the presence or absence of 100 nM progesterone (P). (E) CV-1 cells were transfected as for panel D but with 1 μg of pSG5-hGR instead of pSG5-hPR1 in the presence or absence of 100 nM dexamethasone (D). Luciferase (LUC) activities are expressed relative to those achieved with pSG5-hPR1 and pSG5-hGR in the presence of progesterone and dexamethasone, respectively (those values being equal to 100), and the mean ± standard error values of at least three independent experiments are shown. (F) Effect of SNURF overexpression on Sp1 activity. CV-1 cells were transiently transfected with 5 μg of pTATA-LUC, pSp1-TATA-LUC, or pSp1 2 -TATA-LUC reporters along with 5 μg of SNURF expression vector (pFLAG-SNURF) or empty expression vector (pFLAG-CMV-2) and also 2 μg of pCMVβ. Transcriptional activities are expressed as relative luciferase (LUC) activity normalized by using the β-galactosidase activity.

Techniques Used: Over Expression, Transfection, Plasmid Preparation, Expressing, Activity Assay, Luciferase

48) Product Images from "Hereditary 1,25-dihydroxyvitamin D-resistant rickets with alopecia resulting from a novel missense mutation in the DNA-binding domain of the vitamin D receptor"

Article Title: Hereditary 1,25-dihydroxyvitamin D-resistant rickets with alopecia resulting from a novel missense mutation in the DNA-binding domain of the vitamin D receptor

Journal: Molecular genetics and metabolism

doi: 10.1016/j.ymgme.2009.09.004

The recreated V26M mutant VDR is transcriptionally inactive. A, Functional activity analyzed by transactivation assays. The WT and V26M mutant VDRs in pSG5 or the pSG5 vector were transfected individually into COS-7 cells along with the CYP24A1 promoter
Figure Legend Snippet: The recreated V26M mutant VDR is transcriptionally inactive. A, Functional activity analyzed by transactivation assays. The WT and V26M mutant VDRs in pSG5 or the pSG5 vector were transfected individually into COS-7 cells along with the CYP24A1 promoter

Techniques Used: Mutagenesis, Functional Assay, Activity Assay, Plasmid Preparation, Transfection

49) Product Images from "Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6"

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6

Journal: Journal of Virology

doi:

Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.
Figure Legend Snippet: Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.

Techniques Used: Transfection, Plasmid Preparation, Expressing, Fractionation, Northern Blot, Generated, Clone Assay

Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.
Figure Legend Snippet: Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.

Techniques Used: Transfection, Expressing, Plasmid Preparation

50) Product Images from "The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation"

Article Title: The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.102523299

Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.

Techniques Used: Expressing, Transformation Assay, Transfection, Plasmid Preparation, Mouse Assay, Injection

Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.

Techniques Used: Expressing, Transfection

PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.
Figure Legend Snippet: PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.

Techniques Used: Generated, FACS, Incubation, Transmission Assay, Electron Microscopy

51) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

52) Product Images from "Activated Mouse Notch1 Transactivates Epstein-Barr Virus Nuclear Antigen 2-Regulated Viral Promoters"

Article Title: Activated Mouse Notch1 Transactivates Epstein-Barr Virus Nuclear Antigen 2-Regulated Viral Promoters

Journal: Journal of Virology

doi:

Luciferase activity of the RBP-Jκ multimer construct upon titration of mNotch1-IC and EBNA2 expression plasmids. (A) Twenty micrograms of the reporter construct pGa981-16 was cotransfected with 0.1, 1, or 10 μg of the expression plasmids pSG5 mNotch1-IC (black boxes) or pGa986-20 (white boxes) into the EBNA2-negative cell line BL41-P3HR1. The amount of expression plasmid was adjusted to 10 μg with the vector pSG5. The fold transactivation was standardized to the value obtained from cotransfection with 10 μg of the vector control pSG5. Results are averages from two independent experiments. (B) At 24 h after the transfection of 0.1, 1, or 10 μg of pSG5 mNotch1-IC in BL41-P3HR1 cells, the cells were harvested. Equal amounts of protein were loaded onto the gel, and expression of mNotch1-IC was examined by Western blotting with the anti-FLAG antibody. Available antibodies failed to detect EBNA2 at this concentration.
Figure Legend Snippet: Luciferase activity of the RBP-Jκ multimer construct upon titration of mNotch1-IC and EBNA2 expression plasmids. (A) Twenty micrograms of the reporter construct pGa981-16 was cotransfected with 0.1, 1, or 10 μg of the expression plasmids pSG5 mNotch1-IC (black boxes) or pGa986-20 (white boxes) into the EBNA2-negative cell line BL41-P3HR1. The amount of expression plasmid was adjusted to 10 μg with the vector pSG5. The fold transactivation was standardized to the value obtained from cotransfection with 10 μg of the vector control pSG5. Results are averages from two independent experiments. (B) At 24 h after the transfection of 0.1, 1, or 10 μg of pSG5 mNotch1-IC in BL41-P3HR1 cells, the cells were harvested. Equal amounts of protein were loaded onto the gel, and expression of mNotch1-IC was examined by Western blotting with the anti-FLAG antibody. Available antibodies failed to detect EBNA2 at this concentration.

Techniques Used: Luciferase, Activity Assay, Construct, Titration, Expressing, Plasmid Preparation, Cotransfection, Transfection, Western Blot, Concentration Assay

The EBNA2RE of the Bam HI C promoter can confer mNotch1-IC and EBNA2 responsiveness on either the Bam HI C or the β-globin minimal promoter. (A) Schematic representation of the Bam HI C promoter luciferase constructs used in the cotransfection assays. In the upper part of the illustration the essential regions of the EBNA2RE of the Bam HI C promoter are shown. The two regions interact with RBP-Jκ and CBF2, respectively. In the lower part, the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with 10 μg of the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the Bam HI C promoter can confer mNotch1-IC and EBNA2 responsiveness on either the Bam HI C or the β-globin minimal promoter. (A) Schematic representation of the Bam HI C promoter luciferase constructs used in the cotransfection assays. In the upper part of the illustration the essential regions of the EBNA2RE of the Bam HI C promoter are shown. The two regions interact with RBP-Jκ and CBF2, respectively. In the lower part, the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with 10 μg of the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Hi-C, Luciferase, Construct, Cotransfection, Expressing, Plasmid Preparation

The EBNA2RE of the LMP1 promoter can confer mNotch1-IC and EBNA2 responsiveness on either the LMP1 or the β-globin minimal promoter. (A) Schematic representation of the LMP1 promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the LMP1 promoter EBNA2RE are shown. One sequence element interacts with RBP-Jκ; the other interacts with Spi1. A potential second RBP-Jκ site located beyond the EBNA2RE is indicated. In the lower part the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the LMP1 promoter can confer mNotch1-IC and EBNA2 responsiveness on either the LMP1 or the β-globin minimal promoter. (A) Schematic representation of the LMP1 promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the LMP1 promoter EBNA2RE are shown. One sequence element interacts with RBP-Jκ; the other interacts with Spi1. A potential second RBP-Jκ site located beyond the EBNA2RE is indicated. In the lower part the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Luciferase, Construct, Cotransfection, Sequencing, Expressing, Plasmid Preparation

The EBNA2RE of the LMP2A promoter can confer mNotch1-IC and EBNA2 responsiveness on the LMP2A minimal promoter. (A) Schematic representation of the LMP2A promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the EBNA2RE of the LMP2A promoter are shown. Two regions interact with RBP-Jκ, whereas the two others are designated as L2BF2 and L2BF3. In the lower part of the figure the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct, respectively, into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.
Figure Legend Snippet: The EBNA2RE of the LMP2A promoter can confer mNotch1-IC and EBNA2 responsiveness on the LMP2A minimal promoter. (A) Schematic representation of the LMP2A promoter luciferase constructs used in the cotransfection assays. In the upper part of the figure the essential regions of the EBNA2RE of the LMP2A promoter are shown. Two regions interact with RBP-Jκ, whereas the two others are designated as L2BF2 and L2BF3. In the lower part of the figure the EBNA2REs and mutated sequences of the essential regions are indicated by solid and open boxes, respectively. (B and C) Portions (10 μg) of the expression plasmids pSG5 mNotch1-IC (B) or pGa986-20 (C) were cotransfected with 20 μg of the reporter construct, respectively, into the EBNA2-negative cell line BL41-P3HR1. The fold transactivation was standardized to the value from cotransfection with the vector control pSG5. The mean values and the standard deviations of four independent experiments are shown.

Techniques Used: Luciferase, Construct, Cotransfection, Expressing, Plasmid Preparation

53) Product Images from "Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter"

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter

Journal: Journal of Virology

doi: 10.1128/JVI.75.23.11781-11790.2001

(A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).
Figure Legend Snippet: (A) Interaction of DP103 and SMN in B lymphocytes. Coimmunoprecipitations (IP) from Raji cell extracts were performed with DP103-specific MAb 9A3 (IP: DP103 Ab) or an irrelevant control antibody (anti-TrypE 3A6, IP: control Ab), followed by SDS–10% PAGE and Western blotting. Precipitated proteins were detected with anti-SMN-N serum (Santa Cruz Biochemicals) (left panel, WB: anti SMN) or anti-DP103 MAb 8H4 (right panel, WB: anti DP103). The positions of SMN and DP103 are indicated by arrows. Lanes designated Raji input represent ca. 1% of unprecipitated Raji cell extract. The positions of the molecular mass marker proteins are indicated on the left side (in kilodaltons). (B) SMN coactivates the viral LMP1 promoter in the presence of EBNA2. BJAB cells were transfected with luciferase reporter constructs encoding positions −327/+40 (EBNA2 responsive) or −154/+40 (nonresponsive) of the LMP1 promoter (4 μg) and the indicated combinations of pSG5 constructs encoding EBNA2 or HA-tagged SMN and DP103 (10 μg). After 48 h, the cells were lysed by freeze-thawing, and the luciferase activity was measured. The transfection efficiency was determined by scanning the expression of cotransfected pEGFP-C1 vector (2 μg) by FACS analysis prior to lysis of the cells. For each experiment, luciferase values standardized for transfection efficiency were calculated relative to the values obtained by EBNA2 and the respective full-length promoter construct (set to 100%). Graphs represent the mean values of five independent experiments (± the standard error of the mean [SEM]).

Techniques Used: Polyacrylamide Gel Electrophoresis, Western Blot, Marker, Transfection, Luciferase, Construct, Activity Assay, Expressing, Plasmid Preparation, FACS, Lysis

54) Product Images from "HMG-I/Y, a New c-Myc Target Gene and Potential Oncogene"

Article Title: HMG-I/Y, a New c-Myc Target Gene and Potential Oncogene

Journal: Molecular and Cellular Biology

doi:

Rat 1a-HMG-I cells form tumors in nude mice. (A) Rat 1a-HMG-I, Rat 1a-myc, and control Rat 1a-pSG5 cells were injected into nude mice. Only mice injected with Rat 1a cells overexpressing HMG-I or c-Myc formed tumors. This photograph shows a representative mouse injected with Rat 1a-HMG-I cells. (B) Pathologic evaluation of the tumors showed that all tumors formed from Rat 1a-HMG-I or Rat 1a-myc cells were fibrosarcomas. This photograph shows a 12× magnification of the large subcutaneous tumor in a mouse injected with Rat 1a-HMG-I cells (H E). (C) Tumor at 300× magnification. Note the bundles of spindle-shaped cells (H E). (D) Characteristics of tumors from nude mice injected with Rat 1a-HMG-I and Rat 1a-myc cells.
Figure Legend Snippet: Rat 1a-HMG-I cells form tumors in nude mice. (A) Rat 1a-HMG-I, Rat 1a-myc, and control Rat 1a-pSG5 cells were injected into nude mice. Only mice injected with Rat 1a cells overexpressing HMG-I or c-Myc formed tumors. This photograph shows a representative mouse injected with Rat 1a-HMG-I cells. (B) Pathologic evaluation of the tumors showed that all tumors formed from Rat 1a-HMG-I or Rat 1a-myc cells were fibrosarcomas. This photograph shows a 12× magnification of the large subcutaneous tumor in a mouse injected with Rat 1a-HMG-I cells (H E). (C) Tumor at 300× magnification. Note the bundles of spindle-shaped cells (H E). (D) Characteristics of tumors from nude mice injected with Rat 1a-HMG-I and Rat 1a-myc cells.

Techniques Used: Mouse Assay, Injection

Rat 1a cells overexpressing HMG-I form colonies in the soft agar assay. (A) Rat 1a cells overexpressing HMG-I (Rat 1a-HMG-I) or c-Myc (Rat 1a-myc) or control Rat 1a cells transfected with the vector alone (Rat 1a pSG5) were subjected to analysis in the soft agar assay. Both Rat 1a-HMG-I and Rat 1a-myc cells formed colonies capable of anchorage-independent growth in the soft agar assay. Bar, 100 μm. (B) Rat 1a-HMG-I and Rat 1a-myc cells exhibit similar cell cycle profiles when grown on top of soft agar. This experiment was repeated three times with similar results. (C) The number of colonies formed by Rat 1a-HMG-I and Rat 1a-myc cells was similar. Assays were performed in duplicate, and the results are taken from two separate experiments. The solid bar represents the mean from two different experiments; the error bars indicate the standard deviation. (D) Rat 1a-HMG-I and Rat 1a-myc cells overexpress HMG-I protein. Western analysis shows that both Rat 1a-HMG-I and Rat 1a-myc cells overexpress HMG-I compared to control Rat 1a cells transfected with pSG5 vector alone. The lanes were blotted with the HMG-I/Y antibody as well as a β-actin antibody to control for sample loading. (E) Cell growth rates of Rat 1a cell lines. This experiment was performed with duplicate plates and repeated twice. The data points represent the average counts from duplicate plates; the error bars depict the standard deviations from a representative experiment. Note that all Rat 1a cell lines grow at similar rates.
Figure Legend Snippet: Rat 1a cells overexpressing HMG-I form colonies in the soft agar assay. (A) Rat 1a cells overexpressing HMG-I (Rat 1a-HMG-I) or c-Myc (Rat 1a-myc) or control Rat 1a cells transfected with the vector alone (Rat 1a pSG5) were subjected to analysis in the soft agar assay. Both Rat 1a-HMG-I and Rat 1a-myc cells formed colonies capable of anchorage-independent growth in the soft agar assay. Bar, 100 μm. (B) Rat 1a-HMG-I and Rat 1a-myc cells exhibit similar cell cycle profiles when grown on top of soft agar. This experiment was repeated three times with similar results. (C) The number of colonies formed by Rat 1a-HMG-I and Rat 1a-myc cells was similar. Assays were performed in duplicate, and the results are taken from two separate experiments. The solid bar represents the mean from two different experiments; the error bars indicate the standard deviation. (D) Rat 1a-HMG-I and Rat 1a-myc cells overexpress HMG-I protein. Western analysis shows that both Rat 1a-HMG-I and Rat 1a-myc cells overexpress HMG-I compared to control Rat 1a cells transfected with pSG5 vector alone. The lanes were blotted with the HMG-I/Y antibody as well as a β-actin antibody to control for sample loading. (E) Cell growth rates of Rat 1a cell lines. This experiment was performed with duplicate plates and repeated twice. The data points represent the average counts from duplicate plates; the error bars depict the standard deviations from a representative experiment. Note that all Rat 1a cell lines grow at similar rates.

Techniques Used: Soft Agar Assay, Transfection, Plasmid Preparation, Standard Deviation, Western Blot

55) Product Images from "Growth Inhibition of HeLa Cells Is a Conserved Feature of High-Risk Human Papillomavirus E8^E2C Proteins and Can Also Be Achieved by an Artificial Repressor Protein ▿Growth Inhibition of HeLa Cells Is a Conserved Feature of High-Risk Human Papillomavirus E8^E2C Proteins and Can Also Be Achieved by an Artificial Repressor Protein ▿ †"

Article Title: Growth Inhibition of HeLa Cells Is a Conserved Feature of High-Risk Human Papillomavirus E8^E2C Proteins and Can Also Be Achieved by an Artificial Repressor Protein ▿Growth Inhibition of HeLa Cells Is a Conserved Feature of High-Risk Human Papillomavirus E8^E2C Proteins and Can Also Be Achieved by an Artificial Repressor Protein ▿ †

Journal: Journal of Virology

doi: 10.1128/JVI.01647-10

E8∧E2C and E2 expression in HeLa cells results in morphological changes and senescence markers. HeLa cells were transfected with a puromycin resistance plasmid and plasmids expressing 16E8∧E2C, 18E8∧E2C, 31E8∧E2C, 16E2, 18E2, 31E2, or the empty vector pSG5 (control). After drug selection, the cells were fixed and stained for senescence-associated β-galactosidase activity (blue cells). The pictures were recorded with a Zeiss Axiovert 400 M microscope using a bright field and a 10× objective.
Figure Legend Snippet: E8∧E2C and E2 expression in HeLa cells results in morphological changes and senescence markers. HeLa cells were transfected with a puromycin resistance plasmid and plasmids expressing 16E8∧E2C, 18E8∧E2C, 31E8∧E2C, 16E2, 18E2, 31E2, or the empty vector pSG5 (control). After drug selection, the cells were fixed and stained for senescence-associated β-galactosidase activity (blue cells). The pictures were recorded with a Zeiss Axiovert 400 M microscope using a bright field and a 10× objective.

Techniques Used: Expressing, Transfection, Plasmid Preparation, Selection, Staining, Activity Assay, Microscopy

Transcriptional-repression activity is conserved among the E8∧E2C proteins of HPV16, -18, and -31. (a to c) HeLa cells were transfected with 50 ng each of pGL 16URR-luc (HPV16 URR), pGL 18URR-luc (HPV18 URR), or pGL 31URR-luc (HPV31 URR) (a); 50 ng of pGL 31URR-luc BS2,3,4 mt (HPV31 URR BS 2,3,4 mt) (b); or 50 ng of pC18-SP1-luc (pC18 SP1) (c) and 10 ng of expression plasmids for 16E8∧E2C (bar 16), 18E8∧E2C (bar 18), 31E8∧E2C (bar 31), or the empty vector pSG5 (vector). (d) HPV-negative RTS3b keratinocytes were cotransfected with 50 ng of pGL 18URR-luc (HPV 18 URR) or pC18-SP1 luc (pC18 SP1) and 10 ng of expression plasmids for 16E8∧E2C (bar 16), 18E8∧E2C (bar 18), 31E8∧E2C (bar 31), or the empty vector pSG5 (vector). Luciferase activities were determined 48 h after transfection. The data represent the averages of at least 3 independent transfections performed in duplicate. Luciferase activities are relative to the activity of the indicated luciferase reporter plasmid in the presence of the empty vector, which was set to 1. The error bars indicate the standard deviations.
Figure Legend Snippet: Transcriptional-repression activity is conserved among the E8∧E2C proteins of HPV16, -18, and -31. (a to c) HeLa cells were transfected with 50 ng each of pGL 16URR-luc (HPV16 URR), pGL 18URR-luc (HPV18 URR), or pGL 31URR-luc (HPV31 URR) (a); 50 ng of pGL 31URR-luc BS2,3,4 mt (HPV31 URR BS 2,3,4 mt) (b); or 50 ng of pC18-SP1-luc (pC18 SP1) (c) and 10 ng of expression plasmids for 16E8∧E2C (bar 16), 18E8∧E2C (bar 18), 31E8∧E2C (bar 31), or the empty vector pSG5 (vector). (d) HPV-negative RTS3b keratinocytes were cotransfected with 50 ng of pGL 18URR-luc (HPV 18 URR) or pC18-SP1 luc (pC18 SP1) and 10 ng of expression plasmids for 16E8∧E2C (bar 16), 18E8∧E2C (bar 18), 31E8∧E2C (bar 31), or the empty vector pSG5 (vector). Luciferase activities were determined 48 h after transfection. The data represent the averages of at least 3 independent transfections performed in duplicate. Luciferase activities are relative to the activity of the indicated luciferase reporter plasmid in the presence of the empty vector, which was set to 1. The error bars indicate the standard deviations.

Techniques Used: Activity Assay, Transfection, Expressing, Plasmid Preparation, Luciferase

Expression of E8∧E2C of HPV16, -18, and -31 reduces colony formation of HeLa cells. HeLa cells were transfected with a puromycin resistance plasmid, pPur, and expression plasmids for 16-, 18-, or 31E8∧E2C (bars 16, 18, and 31) or the empty vector pSG5 (vector). After selection with puromycin for 12 to 14 days, the resistant colonies were counted. The graph represents the average of the puromycin-resistant colonies derived from three independent experiments relative (rel.) to the colonies formed by the empty vector, which was set to 1. Standard deviations are indicated by error bars.
Figure Legend Snippet: Expression of E8∧E2C of HPV16, -18, and -31 reduces colony formation of HeLa cells. HeLa cells were transfected with a puromycin resistance plasmid, pPur, and expression plasmids for 16-, 18-, or 31E8∧E2C (bars 16, 18, and 31) or the empty vector pSG5 (vector). After selection with puromycin for 12 to 14 days, the resistant colonies were counted. The graph represents the average of the puromycin-resistant colonies derived from three independent experiments relative (rel.) to the colonies formed by the empty vector, which was set to 1. Standard deviations are indicated by error bars.

Techniques Used: Expressing, Transfection, Plasmid Preparation, Selection, Derivative Assay

Expression of E8∧E2C or E2 proteins of HPV16, -18, and -31 in HeLa cells leads to stabilization of p53 and CDKN1A/p21 and to cell cycle arrest. (a) HeLa cells were transfected with 1 μg of empty vector pSG5 (V); expression vectors for the respective HA-tagged E8∧E2C or E2 proteins of HPV16, HPV18, or HPV31; or the KRAB-E2C fusion protein. Whole-cell lysates were prepared and analyzed by immunoblotting for the presence of p53, p21, and HSP90 as a loading control. E8∧E2C-HA, E2-HA, and KRAB-E2C-HA proteins were detected using an anti-HA antibody. (b) For flow cytometry analysis, HeLa cells were transfected with 1 μg of pSG5 (vector) or expression vectors for the respective E8∧E2C or E2 proteins. DNA was stained with propidium iodide, and the DNA content was determined using CellQuest Pro analysis software and a FACSCalibur. The averaged percentages and standard errors of cell numbers in G 1 phase (G1), G 2 phase (G2), or sub-G1 phase (apoptosis) derived from five independent transfection experiments are shown. (c) HeLa cells were transfected with an HPV18E7 siRNA or a control siRNA (siControl). Forty-eight hours posttransfection, p53 and HSP90 levels were determined by immunoblotting. A molecular mass marker in kDa is shown on the right of the gel. Cell cycle distribution and apoptotic cells were measured as described above and represent averages derived from three independent transfection experiments.
Figure Legend Snippet: Expression of E8∧E2C or E2 proteins of HPV16, -18, and -31 in HeLa cells leads to stabilization of p53 and CDKN1A/p21 and to cell cycle arrest. (a) HeLa cells were transfected with 1 μg of empty vector pSG5 (V); expression vectors for the respective HA-tagged E8∧E2C or E2 proteins of HPV16, HPV18, or HPV31; or the KRAB-E2C fusion protein. Whole-cell lysates were prepared and analyzed by immunoblotting for the presence of p53, p21, and HSP90 as a loading control. E8∧E2C-HA, E2-HA, and KRAB-E2C-HA proteins were detected using an anti-HA antibody. (b) For flow cytometry analysis, HeLa cells were transfected with 1 μg of pSG5 (vector) or expression vectors for the respective E8∧E2C or E2 proteins. DNA was stained with propidium iodide, and the DNA content was determined using CellQuest Pro analysis software and a FACSCalibur. The averaged percentages and standard errors of cell numbers in G 1 phase (G1), G 2 phase (G2), or sub-G1 phase (apoptosis) derived from five independent transfection experiments are shown. (c) HeLa cells were transfected with an HPV18E7 siRNA or a control siRNA (siControl). Forty-eight hours posttransfection, p53 and HSP90 levels were determined by immunoblotting. A molecular mass marker in kDa is shown on the right of the gel. Cell cycle distribution and apoptotic cells were measured as described above and represent averages derived from three independent transfection experiments.

Techniques Used: Expressing, Transfection, Plasmid Preparation, Flow Cytometry, Cytometry, Staining, Software, Derivative Assay, Marker

56) Product Images from "A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro"

Article Title: A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro

Journal: Journal of Virology

doi:

Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.
Figure Legend Snippet: Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.

Techniques Used: Expressing, Transfection, Infection, Recombinant, Plasmid Preparation, Polyacrylamide Gel Electrophoresis, Labeling, Lysis, Immunoprecipitation, Incubation, In Vitro, Marker

57) Product Images from "Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5"

Article Title: Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkm1080

miR-BART2 down-regulates the BALF5 3′UTR. ( A ) Northern blot detection of ectopically expressed miR-BART2 and miR-155 using the indicated probes. RNA extracted from HeLa cells 48 h after transfection with the vector pSG5-miR-BART2 (lane designated ‘HeLa+miR-BART2’) was analysed in parallel with RNA from BL41 and B95.8 cells (EBV-negative and -positive, respectively). Total RNA of HeLa cells either transfected or untransfected with pSG5-mir-155 was analysed by northern blotting for the expression of miR-155. The positions of the precursor and the mature miRNA are indicated. ( B ) Effect of miR-BART2 on the BALF5 3′UTR. miR-BART2 and the Luc-BALF5-3′UTR reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. Graph B represents the mean values of six independent experiments carried out in duplicate (±SEM). ( C ) miR-BART2 and a luciferase reporter containing the BALF5 3′UTR with a deletion of the BART2-recognition site were co-expressed in the indicated combinations and analysed as in (B). ( D ) Effect of miR-BART2 on the parental (empty) vector pGL3-promoter (‘Luc’). MiR-BART2 and the pGL3-reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.257). ( E ) miR-BART2 and a luciferase reporter containing the LMP2A 3′UTR were co-expressed in the indicated combinations and analysed as in (B). The activity obtained with the reporter alone was set to 100%. ( F ) Effect of miR-155 on the pGL3-BALF5 3′-UTR reporter; the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.092). Graphs C, D, E and F represent the mean values of four independent experiments carried out in duplicate (±SEM).
Figure Legend Snippet: miR-BART2 down-regulates the BALF5 3′UTR. ( A ) Northern blot detection of ectopically expressed miR-BART2 and miR-155 using the indicated probes. RNA extracted from HeLa cells 48 h after transfection with the vector pSG5-miR-BART2 (lane designated ‘HeLa+miR-BART2’) was analysed in parallel with RNA from BL41 and B95.8 cells (EBV-negative and -positive, respectively). Total RNA of HeLa cells either transfected or untransfected with pSG5-mir-155 was analysed by northern blotting for the expression of miR-155. The positions of the precursor and the mature miRNA are indicated. ( B ) Effect of miR-BART2 on the BALF5 3′UTR. miR-BART2 and the Luc-BALF5-3′UTR reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. Graph B represents the mean values of six independent experiments carried out in duplicate (±SEM). ( C ) miR-BART2 and a luciferase reporter containing the BALF5 3′UTR with a deletion of the BART2-recognition site were co-expressed in the indicated combinations and analysed as in (B). ( D ) Effect of miR-BART2 on the parental (empty) vector pGL3-promoter (‘Luc’). MiR-BART2 and the pGL3-reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.257). ( E ) miR-BART2 and a luciferase reporter containing the LMP2A 3′UTR were co-expressed in the indicated combinations and analysed as in (B). The activity obtained with the reporter alone was set to 100%. ( F ) Effect of miR-155 on the pGL3-BALF5 3′-UTR reporter; the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.092). Graphs C, D, E and F represent the mean values of four independent experiments carried out in duplicate (±SEM).

Techniques Used: Northern Blot, Transfection, Plasmid Preparation, Expressing, Activity Assay, Luciferase

miR-BART2 down-regulates BALF5 polymerase. ( A ) Identification of BALF5 protein using the monoclonal antibody 4C12. Whole-cell extracts of B95.8 B-cells either treated (+) or untreated (−) with TPA were analysed by western blotting as shown in the left panel. The blots were stained with the novel BALF5-specific antibody 4C12, an antibody directed against β-actin as a loading control and BZLF1-specific monoclonal antibody BZ-1 to verify the induction of EBV lytic replication. Detection of BALF5 in EBV-infected 293 cells without (–) and after (+) induction of lytic replication by BZLF1 using the vector p509 ( 18 ) is shown in the right panel. ( B ) Immunoprecipitation of BALF5. Extract of TPA-treated Raji cells was incubated either with BALF5-specific antibody 4C12 or irrelevant isotype control as indicated. Immune complexes were collected using protein G Sepharose (Amersham-Pharmacia). The precipitated BALF5 protein was analysed in a western blot using 4C12 as primary antibody; bound antibody was visualized by the ECL method; the lanes designated ‘Raji’, shows whole-cell extract prior to precipitation. ( C ) Reduction of BALF5 protein levels by miR-BART2. 293-EBV cells were transfected with BZLF1 expression vector p509 in combination with miR-BART2 expression vector or pSG5 control. BALF5 protein was stained using the monoclonal antibody 4C12, β-actin served as a loading control (left panel); statistical analysis of the BALF5 protein reduction by miR-BART2. The amount of BALF5 protein with or without BART2 expression from three independent assays as shown in (C) was determined and statistically analysed. The reduction of 30–40% after co-expression of miR-BART2 was statistically significant (right panel; P = 0.0037). ( D ) Reduction in virus load by miR-BART2. Viral replication in 293-EBV cells was induced by expression of BZLF1 using the vector p509. The amount of virus released was determined by quantitative real-time PCR. The value obtained by co-transfection of the empty control vector pSG5 was set to 100%. Co-expression of miR-BART2 resulted in a statistically significant reduction of the virus load by 20% ( P = 0.039), co-expression of miR-155 resulted in a non-significant reduction by 5–10% ( P = 0.155).
Figure Legend Snippet: miR-BART2 down-regulates BALF5 polymerase. ( A ) Identification of BALF5 protein using the monoclonal antibody 4C12. Whole-cell extracts of B95.8 B-cells either treated (+) or untreated (−) with TPA were analysed by western blotting as shown in the left panel. The blots were stained with the novel BALF5-specific antibody 4C12, an antibody directed against β-actin as a loading control and BZLF1-specific monoclonal antibody BZ-1 to verify the induction of EBV lytic replication. Detection of BALF5 in EBV-infected 293 cells without (–) and after (+) induction of lytic replication by BZLF1 using the vector p509 ( 18 ) is shown in the right panel. ( B ) Immunoprecipitation of BALF5. Extract of TPA-treated Raji cells was incubated either with BALF5-specific antibody 4C12 or irrelevant isotype control as indicated. Immune complexes were collected using protein G Sepharose (Amersham-Pharmacia). The precipitated BALF5 protein was analysed in a western blot using 4C12 as primary antibody; bound antibody was visualized by the ECL method; the lanes designated ‘Raji’, shows whole-cell extract prior to precipitation. ( C ) Reduction of BALF5 protein levels by miR-BART2. 293-EBV cells were transfected with BZLF1 expression vector p509 in combination with miR-BART2 expression vector or pSG5 control. BALF5 protein was stained using the monoclonal antibody 4C12, β-actin served as a loading control (left panel); statistical analysis of the BALF5 protein reduction by miR-BART2. The amount of BALF5 protein with or without BART2 expression from three independent assays as shown in (C) was determined and statistically analysed. The reduction of 30–40% after co-expression of miR-BART2 was statistically significant (right panel; P = 0.0037). ( D ) Reduction in virus load by miR-BART2. Viral replication in 293-EBV cells was induced by expression of BZLF1 using the vector p509. The amount of virus released was determined by quantitative real-time PCR. The value obtained by co-transfection of the empty control vector pSG5 was set to 100%. Co-expression of miR-BART2 resulted in a statistically significant reduction of the virus load by 20% ( P = 0.039), co-expression of miR-155 resulted in a non-significant reduction by 5–10% ( P = 0.155).

Techniques Used: Western Blot, Staining, Infection, Plasmid Preparation, Immunoprecipitation, Incubation, Transfection, Expressing, Real-time Polymerase Chain Reaction, Cotransfection

58) Product Images from "G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor"

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor

Journal: Journal of Virology

doi: 10.1128/JVI.78.5.2460-2471.2004

) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.
Figure Legend Snippet: ) and its use to detect [Ca 2+ ]-dependent FRET. (B) The Y-CAM-2 expression plasmid was cotransfected into HEK293 cells with vGPCR, vGPCR.8, or vGPCR.15 expression vector (or pSG5 [negative control]) for FRET-based calcium mobilization assays. Excitation of CFP in transfected cells was effected by using a wavelength of 410 nm; emission wavelength shifts from 475 nm (CFP emission peak) to 527 nm (YFP emission peak) result from increased FRET due to Ca 2+ -induced conformational change in the CFP-calmodulin-YFP reporter encoded by pY-CAM-2. Representative scans from one of multiple experiments are shown. WT, wild type.

Techniques Used: Chick Chorioallantoic Membrane Assay, Expressing, Plasmid Preparation, Negative Control, Transfection

) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.
Figure Legend Snippet: ) for the detection of wild-type (WT) and variant receptors in transfected cells. Similar cell surface fluorescence was seen for all variants, with no significant staining of pSG5 (empty vector)-transfected cells. (B) 125 I-GROα binding assays (see Materials and Methods) to measure surface expression of the wild-type and engineered vGPCRs. Data were derived from five independent transfections for each receptor and are expressed relative to 125 I-GROα binding by wild-type vGPCR (100%). Results are shown as means ± standard deviations. Background binding (to pSG5-transfected cells) has been subtracted from the data presented. (C) Western blotting for the detection of vGPCR-Fc fusion proteins. Those tested showed expression levels equivalent to that of wild-type vGPCR.

Techniques Used: Variant Assay, Transfection, Fluorescence, Staining, Plasmid Preparation, Binding Assay, Expressing, Derivative Assay, Western Blot

Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.
Figure Legend Snippet: Gα q protein coupling by vGPCR, vGPCR.8, and vGPCR.15. Receptor-coupled and activated Gα proteins in HEK293 cells transfected with expression vector for vGPCR, vGPCR.8, or vGPCR.15, or with pSG5 (negative control), were labeled by addition of [ 35 S]GTPγS to membrane fractions derived from these cells. The relative abilities of the different receptors to couple to Gα q and Gα 11 were determined by immunoprecipitation of these G proteins (with an antibody recognizing both), followed by gamma radiation counting of the precipitated material. The results shown are derived from triplicate experiments. Nonspecific background counts, present in protein A-agarose precipitates in the absence of antibody, have been subtracted from the presented data; values shown are means ± standard deviations.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Negative Control, Labeling, Derivative Assay, Immunoprecipitation

) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.
Figure Legend Snippet: ) or NF-κB-Luc (see Materials and Methods) and each of the vGPCR expression vectors or pSG5 (negative control). After 48 h, luciferase activities in cell extracts were determined. Data were derived from four independent experiments and normalized to activities obtained for wild-type vGPCR (set at 100%). Values shown are means ± standard deviations.

Techniques Used: Expressing, Negative Control, Luciferase, Derivative Assay

Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.
Figure Legend Snippet: Activation of ERK by vGPCR and signaling-altered variants 8 (R322W) and 15 (M325S). (A) HEK293 cells were transfected with pSG5 (vector) or pSG5-vGPCR, either with or without cotransfected pSG5-ERK1GFP. Cell extracts were analyzed by Western blotting for the presence of tyrosine-phosphorylated ERK (top panel) or total ERK. (B) ERK1-GFP activation as a function of vGPCR, vGPCR.8, and vGPCR.15 expression in transfected HEK293 cells. WT, wild type.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Western Blot, Expressing

59) Product Images from "Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6"

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6

Journal: Journal of Virology

doi:

Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.
Figure Legend Snippet: Acute-phase gene induction by vIL-6. Hep3B cell monolayers were transfected with pSG5 (empty vector), pSVvIL-6 promoter (simian virus 40 promoter-driven vIL-6 expression vector), pvIL-6 (cytomegalovirus MIE-driven vIL-6 expression vector), or pvIL-6neg (vIL-6 in negative orientation relative to MIE). Other Hep3B cells were either untreated (“medium”) or treated with rhIL-6 (500 U/ml). After 48 h, the cells were harvested for RNA, and 5 μg of RNA per sample was analyzed by size fractionation and Northern blot techniques (see Materials and Methods). 32 P-radiolabelled haptoglobin, hemopexin, and complement factor B (CFB) probes were generated from the respective cloned cDNA sequences. The positions of 28S and 18S rRNA markers and the estimated sizes of the detected acute-phase transcripts are indicated.

Techniques Used: Transfection, Plasmid Preparation, Expressing, Fractionation, Northern Blot, Generated, Clone Assay

Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.
Figure Legend Snippet: Receptor utilization by vIL-6. (A) Hep3B cells were transfected with pSG5, pSVvIL-6, or pSVhIL-6 in the presence of IL-6R and/or gp130 expression vectors (pEFBOS-IL-6R and pEFBOS-gp130) or empty vector (pEF-BOS) and pα 2 MCAT. CAT activities were determined in cell extracts after 48 h. The results, expressed as fold induction above CAT activities obtained with pEF-BOS vector controls, of duplicate experiments are shown.

Techniques Used: Transfection, Expressing, Plasmid Preparation

60) Product Images from "Evidence for secretory pathway localization of a voltage-dependent anion channel isoform"

Article Title: Evidence for secretory pathway localization of a voltage-dependent anion channel isoform

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Cytotoxicity resulting from overexpression of pl-VDAC-1. The percentage of GFP-positive cells after 48 h was quantitated: bar 1, 250 ng of pSG5 expression plasmid without GFP expression cassette; bars 2–4, GFP + pSG5 at ratios of 1:1, 1:3, and 1:5, respectively; bars 5–7, GFP + mt-VDAC-1 at ratios of 1:1, 1:3, and 1:5, respectively; and bars 8–10, GFP + pl-VDAC-1 at ratios of 1:1, 1:3, and 1:5, respectively. A significant dominant-negative effect is evident with a ratio of 1:5 of GFP + pl-VDAC-1 (bar 10), which is not evident after transfection with GFP + mt-VDAC-1 (bar 7).
Figure Legend Snippet: Cytotoxicity resulting from overexpression of pl-VDAC-1. The percentage of GFP-positive cells after 48 h was quantitated: bar 1, 250 ng of pSG5 expression plasmid without GFP expression cassette; bars 2–4, GFP + pSG5 at ratios of 1:1, 1:3, and 1:5, respectively; bars 5–7, GFP + mt-VDAC-1 at ratios of 1:1, 1:3, and 1:5, respectively; and bars 8–10, GFP + pl-VDAC-1 at ratios of 1:1, 1:3, and 1:5, respectively. A significant dominant-negative effect is evident with a ratio of 1:5 of GFP + pl-VDAC-1 (bar 10), which is not evident after transfection with GFP + mt-VDAC-1 (bar 7).

Techniques Used: Over Expression, Expressing, Plasmid Preparation, Dominant Negative Mutation, Transfection

61) Product Images from "The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation"

Article Title: The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.102523299

Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time, transformation, and apoptosis in R1a- myc cells. ( A ) Immunoblot analysis of cell lysates from R1a- myc cells transfected with pSG5 empty vector, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of R1a- myc transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 10.4, 10.9, and 19.0 h, respectively. ( C ) Photomicrographs of methylcellulose colonies. (Bar = 500 μM.) The bar graph represents the average colony number per 35-mm dish ± SD. ( E ) Tumor formation in nude mice. The average estimated tumor mass was plotted at 2, 3, and 4 weeks after injection ± SD ( n = 8). ( D ) Percentage of apoptotic cells 24 h after serum deprivation (light bars) or glucose deprivation (dark bars). The average ± SD of three experiments is shown.

Techniques Used: Expressing, Transformation Assay, Transfection, Plasmid Preparation, Mouse Assay, Injection

Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.
Figure Legend Snippet: Effect of PRDX3 expression on doubling time and apoptosis in MCF7/ADR cells. ( A ) Immunoblot analysis of cells lysates from MCF7/ADR cells transfected with pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS. ( B ) Growth curves of MCF7/ADR transfectants: pSG5 (□), PRDX3 (▵), and PRDX3 AS (○). Doubling times were 43.0, 37.6, and 60.2 h, respectively. ( C ) Percentage of apoptotic cells 24 h after glucose withdrawal. The average ± SD of three separate experiments is shown.

Techniques Used: Expressing, Transfection

PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.
Figure Legend Snippet: PRDX3 affects mitochondrial membrane integrity and morphology. ( A ) Histograms generated by FACS analysis of cells incubated with dye specific for cellular reactive oxygen species (DCF), mitochondrial mass (NAO), or mitochondrial membrane potential (DiOC 6 ): pSG5 (solid black line), PRDX3 (solid gray line), PRDX3 AS (dotted line). ( B ) Transmission electron microscopy of R1a- myc -pSG5 and R1a- myc - PRDX3 AS cells. (Bar = 1 μM.) ( C ) Analysis of ROS after glucose deprivation. Cells were exposed to glucose-free media for 1.5 h before incubation with DCFH-DA.

Techniques Used: Generated, FACS, Incubation, Transmission Assay, Electron Microscopy

62) Product Images from "Direct interactions between Epstein-Barr virus leader protein LP and the EBNA2 acidic domain underlie coordinate transcriptional regulation"

Article Title: Direct interactions between Epstein-Barr virus leader protein LP and the EBNA2 acidic domain underlie coordinate transcriptional regulation

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0307808100

EBNA2 and EBNALP binding to EBNALP. ( A ) Schematic depiction of EBNALP (LP), which is encoded by four repeats of W01 (21 aa) or W1 (22 aa) and W2 (44 aa) exons and by Y1 (11 aa) and Y2 (34 aa) exons. EBNALPd10 (LPd10) and EBNALPd45 (LPD45) are deleted for the C-terminal 10 or 45 aa. Smaller EBNALP components were expressed as GST fusion proteins 1–6. ( B ) BJAB lymphoblasts were transfected with 10 μg each of EBNA2 and EBNALP, mutant EBNALP, or vector control (pSG5) expression plasmids. F is Flag epitope. After 48 h, lysates were immunoprecipitated with PE2 or M2 antibody to E2AD or the Flag epitope. Precipitates were separated by SDS/PAGE and immunoblotted with PE2 or JF186 monoclonal antibody to EBNALP. ( C ) BJAB cells were transfected with 5 μg of pSG5-FLP that has two W1W2 repeats (FLP2W) and with increasing amounts of pSG5 expressing EBNALP. M2 immunoprecipitates were analyzed by SDS/PAGE and immunoblotted with JF186 antibody, which recognizes FLP2W less well than EBNALP. ( D and E ) Binding of EBNA2 or EBNALP from LCL or EBNA2 or EBNALP transfected BJAB cell lysates to GST, GLP, GST-LPd45 (GLPD45), or GLP polypeptides 1–6 was assayed by SDS/PAGE and immunoblot. ( F ) Binding of nickel-bead-purified (His) 6 -tagged EBNA2 from Escherichia coli to GST, GLP, or mutant GST EBNALP fusion proteins as assayed by SDS/PAGE and immunoblot with PE2 antibody.
Figure Legend Snippet: EBNA2 and EBNALP binding to EBNALP. ( A ) Schematic depiction of EBNALP (LP), which is encoded by four repeats of W01 (21 aa) or W1 (22 aa) and W2 (44 aa) exons and by Y1 (11 aa) and Y2 (34 aa) exons. EBNALPd10 (LPd10) and EBNALPd45 (LPD45) are deleted for the C-terminal 10 or 45 aa. Smaller EBNALP components were expressed as GST fusion proteins 1–6. ( B ) BJAB lymphoblasts were transfected with 10 μg each of EBNA2 and EBNALP, mutant EBNALP, or vector control (pSG5) expression plasmids. F is Flag epitope. After 48 h, lysates were immunoprecipitated with PE2 or M2 antibody to E2AD or the Flag epitope. Precipitates were separated by SDS/PAGE and immunoblotted with PE2 or JF186 monoclonal antibody to EBNALP. ( C ) BJAB cells were transfected with 5 μg of pSG5-FLP that has two W1W2 repeats (FLP2W) and with increasing amounts of pSG5 expressing EBNALP. M2 immunoprecipitates were analyzed by SDS/PAGE and immunoblotted with JF186 antibody, which recognizes FLP2W less well than EBNALP. ( D and E ) Binding of EBNA2 or EBNALP from LCL or EBNA2 or EBNALP transfected BJAB cell lysates to GST, GLP, GST-LPd45 (GLPD45), or GLP polypeptides 1–6 was assayed by SDS/PAGE and immunoblot. ( F ) Binding of nickel-bead-purified (His) 6 -tagged EBNA2 from Escherichia coli to GST, GLP, or mutant GST EBNALP fusion proteins as assayed by SDS/PAGE and immunoblot with PE2 antibody.

Techniques Used: Binding Assay, Transfection, Mutagenesis, Plasmid Preparation, Expressing, FLAG-tag, Immunoprecipitation, SDS Page, Purification

E2AD is critical for EBNA2 activation and for LP coactivation. ( A ), defective acidic domain point mutant, EBNA2W 454 T, and EBNA2 with a stop codon after codon 400, E2ΔAD. ( B ) BJAB cells were transfected with 10 μg of LMP1 promoter–luciferase reporter plasmid, 5 μg of WT or mutant EBNA2, 10 μg of EBNALP, or an appropriate amount of control expression vector DNA and 5 μg of GK-β-galactosidase. Fold EBNA2 activation and EBNALP coactivation are shown. An EBV-immune human serum was used to detect WT and mutant EBNA2. ( C )( Left ) BJAB cells were transfected with 5 μg of GAL4DBD-E2AD expression vector and 5 μgof control pSG5 DNA or pSG5-ELP. ( Right ) BJAB cells were transfected with increasing amounts of GALDBD–E2AD expression vector and 5 μg of pSG5 DNA or pSG5-ELP DNA. ( B – C ) Luciferase activities were corrected for cotransfected β-galactosidase activity.
Figure Legend Snippet: E2AD is critical for EBNA2 activation and for LP coactivation. ( A ), defective acidic domain point mutant, EBNA2W 454 T, and EBNA2 with a stop codon after codon 400, E2ΔAD. ( B ) BJAB cells were transfected with 10 μg of LMP1 promoter–luciferase reporter plasmid, 5 μg of WT or mutant EBNA2, 10 μg of EBNALP, or an appropriate amount of control expression vector DNA and 5 μg of GK-β-galactosidase. Fold EBNA2 activation and EBNALP coactivation are shown. An EBV-immune human serum was used to detect WT and mutant EBNA2. ( C )( Left ) BJAB cells were transfected with 5 μg of GAL4DBD-E2AD expression vector and 5 μgof control pSG5 DNA or pSG5-ELP. ( Right ) BJAB cells were transfected with increasing amounts of GALDBD–E2AD expression vector and 5 μg of pSG5 DNA or pSG5-ELP DNA. ( B – C ) Luciferase activities were corrected for cotransfected β-galactosidase activity.

Techniques Used: Activation Assay, Mutagenesis, Transfection, Luciferase, Plasmid Preparation, Expressing, Activity Assay

63) Product Images from "CREB-binding protein in androgen receptor-mediated signaling"

Article Title: CREB-binding protein in androgen receptor-mediated signaling

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi:

Coexpression of CBP abrogates AR-mediated repression of AP-1 activity. ( A ) CV-1 cells were transfected with 5 μg of p75–1050CAT reporter, 1 μg of pSG5-rAR, and 10 μg of pSG5-CBP. Total amount of DNA was kept constant by adding empty pSG5 DNA when necessary. The cells were cultured in the presence of 25 nM testosterone (T) for 30 h. For the relative CAT activity, the value of p75–1050CAT alone was set as 100. Data are the mean ± SEM of four experiments. ( B ) CV-1 cells were transfected with 1 μg of pSG5-rARΔ641–902 instead of pSG5-rAR in experiments otherwise identical with those in A . Data are the mean ± SEM for two experiments.
Figure Legend Snippet: Coexpression of CBP abrogates AR-mediated repression of AP-1 activity. ( A ) CV-1 cells were transfected with 5 μg of p75–1050CAT reporter, 1 μg of pSG5-rAR, and 10 μg of pSG5-CBP. Total amount of DNA was kept constant by adding empty pSG5 DNA when necessary. The cells were cultured in the presence of 25 nM testosterone (T) for 30 h. For the relative CAT activity, the value of p75–1050CAT alone was set as 100. Data are the mean ± SEM of four experiments. ( B ) CV-1 cells were transfected with 1 μg of pSG5-rARΔ641–902 instead of pSG5-rAR in experiments otherwise identical with those in A . Data are the mean ± SEM for two experiments.

Techniques Used: Activity Assay, Transfection, Cell Culture

CBP stimulates RelA-dependent transactivation and counteracts AR-mediated repression of RelA function. ( A ) CV-1 cells were transfected with pκB 6 tk-LUC reporter (5 μg), pCMV-hAR (1 μg), pCMV-RelA (1 μg), and pSG5-CBP (10 μg) expression vectors. For the relative LUC activity, RelA alone was set at 100. Testosterone (25 nM) was present in all cultures. Data are the mean ± SEM of four experiments are shown. ( B ) CV-1 cells were transfected with expression vectors for pCMV-RelA (1 μg), pSG5-rARΔ38–296/Δ641–902 (1 μg), and pSG5-CBP (10 μg) and with pκB 6 tk-LUC reporter. Data are the mean ± SEM of two experiments.
Figure Legend Snippet: CBP stimulates RelA-dependent transactivation and counteracts AR-mediated repression of RelA function. ( A ) CV-1 cells were transfected with pκB 6 tk-LUC reporter (5 μg), pCMV-hAR (1 μg), pCMV-RelA (1 μg), and pSG5-CBP (10 μg) expression vectors. For the relative LUC activity, RelA alone was set at 100. Testosterone (25 nM) was present in all cultures. Data are the mean ± SEM of four experiments are shown. ( B ) CV-1 cells were transfected with expression vectors for pCMV-RelA (1 μg), pSG5-rARΔ38–296/Δ641–902 (1 μg), and pSG5-CBP (10 μg) and with pκB 6 tk-LUC reporter. Data are the mean ± SEM of two experiments.

Techniques Used: Transfection, Expressing, Activity Assay

AR interacts with CBP in transfected COS-1 cells. COS-1 cells were transfected by electroporation with pcDNA 3.1-FLAG-rAR and pSG5-CBP as indicated. After a 30-h culture in the presence or absence of 25 nM testosterone, whole cell extracts were prepared and subjected to immunoprecipitation with mouse monoclonal anti-FLAG antibody. Immunoprecipitated proteins were resolved by SDS/PAGE and subjected to immunoblotting with rabbit anti-CBP antibody. A portion of the cell extract (5%) was subjected to immunoblotting without prior immunoprecipitation with anti-FLAG antibody (lane 4).
Figure Legend Snippet: AR interacts with CBP in transfected COS-1 cells. COS-1 cells were transfected by electroporation with pcDNA 3.1-FLAG-rAR and pSG5-CBP as indicated. After a 30-h culture in the presence or absence of 25 nM testosterone, whole cell extracts were prepared and subjected to immunoprecipitation with mouse monoclonal anti-FLAG antibody. Immunoprecipitated proteins were resolved by SDS/PAGE and subjected to immunoblotting with rabbit anti-CBP antibody. A portion of the cell extract (5%) was subjected to immunoblotting without prior immunoprecipitation with anti-FLAG antibody (lane 4).

Techniques Used: Transfection, Electroporation, Immunoprecipitation, SDS Page

Regions of AR involved in the interaction with CBP. CV-1 cells were transfected with 5 μg of pARE 4 tk-LUC, 1 μg of pSG5-rARΔ641–902 ( A ) or 1 μg of pSG5-rARΔ38–296/Δ641–902 ( B ), and 10 μg pSG5-CBP vectors as indicated. Reporter gene activities are expressed relative to that achieved with pSG5-rAR mutant alone, and data are the mean ± SEM of three experiments given as percentages.
Figure Legend Snippet: Regions of AR involved in the interaction with CBP. CV-1 cells were transfected with 5 μg of pARE 4 tk-LUC, 1 μg of pSG5-rARΔ641–902 ( A ) or 1 μg of pSG5-rARΔ38–296/Δ641–902 ( B ), and 10 μg pSG5-CBP vectors as indicated. Reporter gene activities are expressed relative to that achieved with pSG5-rAR mutant alone, and data are the mean ± SEM of three experiments given as percentages.

Techniques Used: Transfection, Mutagenesis

AR-dependent transactivation is repressed by 12S E1A and the repression relieved by coexpressed CBP. ( A ) CV-1 cells (1.5 × 10 6 cells per 10-cm dish) were transfected with pARE 2 -E1b-CAT (5 μg), AR expression vector (pSG5-rAR, 1 μg), and the indicated amounts of 12S E1A expression vector. Eighteen hours after transfection, the cells received fresh medium containing 25 nM testosterone (T) and were harvested 30 h later to assay CAT activity. Reporter gene activities are expressed relative to that of pSG5-rAR plus testosterone. Data are the mean ± SEM of two experiments. ( B ) CV-1 cells were transfected with 5 μg of pARE 2 -E1b-CAT, 1 μg of pSG5-rAR, 0.1 μg of pRSV-E1A 12S, and the indicated amount of pSG5-CBP (in μg). For the relative CAT activity, the value from the pSG5-rAR plus testosterone result was set as 100. Data are the mean ± SEM of two experiments.
Figure Legend Snippet: AR-dependent transactivation is repressed by 12S E1A and the repression relieved by coexpressed CBP. ( A ) CV-1 cells (1.5 × 10 6 cells per 10-cm dish) were transfected with pARE 2 -E1b-CAT (5 μg), AR expression vector (pSG5-rAR, 1 μg), and the indicated amounts of 12S E1A expression vector. Eighteen hours after transfection, the cells received fresh medium containing 25 nM testosterone (T) and were harvested 30 h later to assay CAT activity. Reporter gene activities are expressed relative to that of pSG5-rAR plus testosterone. Data are the mean ± SEM of two experiments. ( B ) CV-1 cells were transfected with 5 μg of pARE 2 -E1b-CAT, 1 μg of pSG5-rAR, 0.1 μg of pRSV-E1A 12S, and the indicated amount of pSG5-CBP (in μg). For the relative CAT activity, the value from the pSG5-rAR plus testosterone result was set as 100. Data are the mean ± SEM of two experiments.

Techniques Used: Transfection, Expressing, Plasmid Preparation, Activity Assay

Coexpression of CBP does not relieve AP-1 repression brought about by GR but increases GR-mediated transcriptional activation. ( A ) CV-1 cells were transfected with 5 μg of p75–1050CAT reporter, 1 μg of pSG5-GR, and 10 μg of pSG5-CBP. The total amount of DNA was kept constant by adding pSG5 DNA when appropriate. The cells were cultured in the presence of 25 nM dexamethasone (DEX) for 30 h. For the relative CAT activity, the value of p75–1050CAT alone was set as 100. Data are the mean ± SEM values of three experiments. ( B ) CV-1 cells were transfected with 5 μg of pARE 4 -tk-LUC, 1 μg of pSG5-GR, 10 μg of pSG5-CBP, and 0.5 μg of pRSV-E1A 12S as indicated. The cells were treated and the reporter gene activity determined. For the relative LUC value, results of the pSG5-GR plus 25 nM dexamethasone experiment were set at 100. Data are the mean ± SEM of three experiments.
Figure Legend Snippet: Coexpression of CBP does not relieve AP-1 repression brought about by GR but increases GR-mediated transcriptional activation. ( A ) CV-1 cells were transfected with 5 μg of p75–1050CAT reporter, 1 μg of pSG5-GR, and 10 μg of pSG5-CBP. The total amount of DNA was kept constant by adding pSG5 DNA when appropriate. The cells were cultured in the presence of 25 nM dexamethasone (DEX) for 30 h. For the relative CAT activity, the value of p75–1050CAT alone was set as 100. Data are the mean ± SEM values of three experiments. ( B ) CV-1 cells were transfected with 5 μg of pARE 4 -tk-LUC, 1 μg of pSG5-GR, 10 μg of pSG5-CBP, and 0.5 μg of pRSV-E1A 12S as indicated. The cells were treated and the reporter gene activity determined. For the relative LUC value, results of the pSG5-GR plus 25 nM dexamethasone experiment were set at 100. Data are the mean ± SEM of three experiments.

Techniques Used: Activation Assay, Transfection, Cell Culture, Activity Assay

CBP stimulates AR-mediated transactivation without altering the amount of receptor protein. ( A ) CV-1 cells (0.5 × 10 6 cells per 60-mm dish) were transfected with pARE 4 tk-LUC (1.5 μg), AR expression vector (pSG5-rAR, 0.3 μg), and CBP expression plasmid (pSG5-CBP, 3 μg). The total amount of DNA was kept constant by adding empty pSG5 DNA when appropriate. Eighteen hours after transfection, the cells received fresh medium with vehicle or 25 nM testosterone (T) as indicated. After a 30-h culture, the cells were harvested and LUC activity was determined. Reporter gene activities are expressed relative to that achieved with pSG5-rAR in the presence of testosterone, and data are the mean ± SEM of three experiments given as percentages. ( B ).
Figure Legend Snippet: CBP stimulates AR-mediated transactivation without altering the amount of receptor protein. ( A ) CV-1 cells (0.5 × 10 6 cells per 60-mm dish) were transfected with pARE 4 tk-LUC (1.5 μg), AR expression vector (pSG5-rAR, 0.3 μg), and CBP expression plasmid (pSG5-CBP, 3 μg). The total amount of DNA was kept constant by adding empty pSG5 DNA when appropriate. Eighteen hours after transfection, the cells received fresh medium with vehicle or 25 nM testosterone (T) as indicated. After a 30-h culture, the cells were harvested and LUC activity was determined. Reporter gene activities are expressed relative to that achieved with pSG5-rAR in the presence of testosterone, and data are the mean ± SEM of three experiments given as percentages. ( B ).

Techniques Used: Transfection, Expressing, Plasmid Preparation, Activity Assay

64) Product Images from "Activation of Androgen Receptor Function by a Novel Nuclear Protein Kinase"

Article Title: Activation of Androgen Receptor Function by a Novel Nuclear Protein Kinase

Journal: Molecular Biology of the Cell

doi:

ANPK enhances androgen-induced transcriptional activation. (A) CV-1 cells were transfected using the calcium phosphate method with 5 μg of pPB(-285/+32)-LUC reporter plasmid along with 0.5 μg of pSG5-rAR and indicated amounts (μg) of pFLAG-ANPK(159–1191) or kinase-defective pFLAG-ANPK(K226R) in the presence or absence of 100 nM testosterone (T) as depicted. Total amount of DNA was kept constant by adding empty pFLAG-CMV-2 expression vector as needed. β-Gal expression plasmid, pCMVβ (2 μg/10-cm plate), was used to control for transfection efficiency. Luciferase (LUC) activities were normalized using β-gal activity. LUC activities are expressed relative to that of pSG5-rAR in the presence of testosterone (= 100), and the mean ± SE values of at least six independent experiments are given. (B and C) ANPK does not modulate PR- and GR-dependent transcription. (B) CV-1 cells were transfected with 5 μg of pARE 2 -E1b-CAT reporter containing two copies of the GRE/PRE/ARE motif of the rat tyrosine aminotransferase gene upstream of the adenovirus E1b TATA sequence along with 0.5 μg of pSG5-hGR, 5 μg of empty expression vector (pFLAG-CMV-2) (open bar) or pFLAG-ANPK(159–1191) (solid bar), and 2 μg of pCMVβ in the presence or absence of 100 nM dexamethasone (D). (C) CV-1 cells were transfected as in panel B, but using 0.5 μg of pSG5-hPR1 instead of pSG5-hGR in the presence or absence of 100 nM progesterone (P). CAT activities are normalized to β-gal activity and expressed relative to those achieved with pSG5-hGR or pSG5-hPR1 in the presence of P or D, respectively (= 100), and the mean ± SE values of at least three independent experiments are shown.
Figure Legend Snippet: ANPK enhances androgen-induced transcriptional activation. (A) CV-1 cells were transfected using the calcium phosphate method with 5 μg of pPB(-285/+32)-LUC reporter plasmid along with 0.5 μg of pSG5-rAR and indicated amounts (μg) of pFLAG-ANPK(159–1191) or kinase-defective pFLAG-ANPK(K226R) in the presence or absence of 100 nM testosterone (T) as depicted. Total amount of DNA was kept constant by adding empty pFLAG-CMV-2 expression vector as needed. β-Gal expression plasmid, pCMVβ (2 μg/10-cm plate), was used to control for transfection efficiency. Luciferase (LUC) activities were normalized using β-gal activity. LUC activities are expressed relative to that of pSG5-rAR in the presence of testosterone (= 100), and the mean ± SE values of at least six independent experiments are given. (B and C) ANPK does not modulate PR- and GR-dependent transcription. (B) CV-1 cells were transfected with 5 μg of pARE 2 -E1b-CAT reporter containing two copies of the GRE/PRE/ARE motif of the rat tyrosine aminotransferase gene upstream of the adenovirus E1b TATA sequence along with 0.5 μg of pSG5-hGR, 5 μg of empty expression vector (pFLAG-CMV-2) (open bar) or pFLAG-ANPK(159–1191) (solid bar), and 2 μg of pCMVβ in the presence or absence of 100 nM dexamethasone (D). (C) CV-1 cells were transfected as in panel B, but using 0.5 μg of pSG5-hPR1 instead of pSG5-hGR in the presence or absence of 100 nM progesterone (P). CAT activities are normalized to β-gal activity and expressed relative to those achieved with pSG5-hGR or pSG5-hPR1 in the presence of P or D, respectively (= 100), and the mean ± SE values of at least three independent experiments are shown.

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Expressing, Luciferase, Activity Assay, Sequencing

Influence of ANPK on the function of various AR mutants. (A) Structural features of AR mutants studied. (B) Effect of ANPK on AR mutants was examined in CV-1 cells by coexpressing rAR or the deletion mutants rAR▵40–147, rAR▵641–902, and rAR▵46–408/▵641–902 (0.5 μg of each pSG5 expression vector) in the presence of empty pFLAG-CMV2 expression vector (5 μg, open bars) or with pFLAG-ANPK(159–1191) (5 μg, solid bars) and 5 μg of pARE 2 -E1b-CAT reporter in the presence of 100 nM testosterone. Cells were transiently transfected using the calcium phosphate method. β-Gal expression plasmid, pCMVβ (2 μg/10-cm plate), was used to control for transfection efficiency. CAT activities are expressed relative to that of pSG5-rAR in the presence of testosterone (= 100), and the mean ± SE values of at least three independent experiments are given.
Figure Legend Snippet: Influence of ANPK on the function of various AR mutants. (A) Structural features of AR mutants studied. (B) Effect of ANPK on AR mutants was examined in CV-1 cells by coexpressing rAR or the deletion mutants rAR▵40–147, rAR▵641–902, and rAR▵46–408/▵641–902 (0.5 μg of each pSG5 expression vector) in the presence of empty pFLAG-CMV2 expression vector (5 μg, open bars) or with pFLAG-ANPK(159–1191) (5 μg, solid bars) and 5 μg of pARE 2 -E1b-CAT reporter in the presence of 100 nM testosterone. Cells were transiently transfected using the calcium phosphate method. β-Gal expression plasmid, pCMVβ (2 μg/10-cm plate), was used to control for transfection efficiency. CAT activities are expressed relative to that of pSG5-rAR in the presence of testosterone (= 100), and the mean ± SE values of at least three independent experiments are given.

Techniques Used: Expressing, Plasmid Preparation, Transfection

65) Product Images from "The BRRF1 Early Gene of Epstein-Barr Virus Encodes a Transcription Factor That Enhances Induction of Lytic Infection by BRLF1"

Article Title: The BRRF1 Early Gene of Epstein-Barr Virus Encodes a Transcription Factor That Enhances Induction of Lytic Infection by BRLF1

Journal: Journal of Virology

doi: 10.1128/JVI.78.10.4983-4992.2004

293 R-KO cells cannot transcribe BRRF1 mRNA. 293 WT, 293 Z-KO, or 293 R-KO cells were transfected with pSG5 (vector), pSG5-Z (Z), or pSG5-R (R). At 24 h posttransfection, total RNAs were harvested and Northern blotted as described in Materials and Methods. Membranes were hybridized with probes specific for BRRF1 (Na), R, Z, and GAPDH transcripts, as indicated by arrows.
Figure Legend Snippet: 293 R-KO cells cannot transcribe BRRF1 mRNA. 293 WT, 293 Z-KO, or 293 R-KO cells were transfected with pSG5 (vector), pSG5-Z (Z), or pSG5-R (R). At 24 h posttransfection, total RNAs were harvested and Northern blotted as described in Materials and Methods. Membranes were hybridized with probes specific for BRRF1 (Na), R, Z, and GAPDH transcripts, as indicated by arrows.

Techniques Used: Transfection, Plasmid Preparation, Northern Blot

Na enhances R-induced lytic infection in 293 R-KO cells. (A) 293 R-KO or 293 WT cells were transfected with pSG5 (vector) or pSG5-R (R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with antibodies specific for the early lytic protein BMRF1 (upper panel) or R (lower panel). (B) 293 R-KO cells were transfected with pSG5 (vector), pRC-FLAG-BRRF1 (Na), pSG5-R (R), or pRC-FLAG-BRRF1 and pSG5-R (Na+R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with antibodies specific for BMRF1, Z, R, FLAG (to detect FLAG-tagged Na), and β-actin, as indicated by arrows.
Figure Legend Snippet: Na enhances R-induced lytic infection in 293 R-KO cells. (A) 293 R-KO or 293 WT cells were transfected with pSG5 (vector) or pSG5-R (R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with antibodies specific for the early lytic protein BMRF1 (upper panel) or R (lower panel). (B) 293 R-KO cells were transfected with pSG5 (vector), pRC-FLAG-BRRF1 (Na), pSG5-R (R), or pRC-FLAG-BRRF1 and pSG5-R (Na+R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with antibodies specific for BMRF1, Z, R, FLAG (to detect FLAG-tagged Na), and β-actin, as indicated by arrows.

Techniques Used: Infection, Transfection, Plasmid Preparation

Na enhances R-induced lytic infection in a cell-line-dependent manner. AGS R-KO (A), BL30 R-KO (B), or LCL R-KO (C) cells were transfected with pRC (vector), pRC-FLAG-BRRF1 (Na), pSG5-R (R), or pRC-FLAG-BRRF1 and pSG5-R (Na+R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with the indicated antibodies. Densitometric analysis was performed with NIH Image software. AGS(−), EBV-negative AGS cells.
Figure Legend Snippet: Na enhances R-induced lytic infection in a cell-line-dependent manner. AGS R-KO (A), BL30 R-KO (B), or LCL R-KO (C) cells were transfected with pRC (vector), pRC-FLAG-BRRF1 (Na), pSG5-R (R), or pRC-FLAG-BRRF1 and pSG5-R (Na+R). Cells were harvested at 48 h posttransfection, and 35 μg of protein was immunoblotted with the indicated antibodies. Densitometric analysis was performed with NIH Image software. AGS(−), EBV-negative AGS cells.

Techniques Used: Infection, Transfection, Plasmid Preparation, Software

Na activates Zp through a CRE site. (A) Diagram of the Zp reporter constructs used. The primary elements that positively regulate Zp are denoted in boxes, with the known transcription factors that bind them represented above. Site-directed mutations in either ZIA and ZIB or ZII are indicated with an “X.” (B) HeLa cells were transfected with one of the indicated reporter constructs (Zp-CAT, Zp-CAT ΔZIA/ZIB, Zp-CAT ΔZII) in conjunction with either pSG5 (vector) or pRC-FLAG-BRRF1 (Na). Cells were harvested at 48 h posttransfection and CAT assays were performed. The data represent the results of two independent experiments. (C) HeLa cells were transfected with one of the indicated reporter constructs [3CRE-CAT or 3CRE(mut)-CAT] in conjunction with either pRC (vector) or pRC-FLAG-BRRF1 (Na). Cells were harvested at 48 h posttransfection and CAT assays were performed. The data shown represent the results of two independent experiments.
Figure Legend Snippet: Na activates Zp through a CRE site. (A) Diagram of the Zp reporter constructs used. The primary elements that positively regulate Zp are denoted in boxes, with the known transcription factors that bind them represented above. Site-directed mutations in either ZIA and ZIB or ZII are indicated with an “X.” (B) HeLa cells were transfected with one of the indicated reporter constructs (Zp-CAT, Zp-CAT ΔZIA/ZIB, Zp-CAT ΔZII) in conjunction with either pSG5 (vector) or pRC-FLAG-BRRF1 (Na). Cells were harvested at 48 h posttransfection and CAT assays were performed. The data represent the results of two independent experiments. (C) HeLa cells were transfected with one of the indicated reporter constructs [3CRE-CAT or 3CRE(mut)-CAT] in conjunction with either pRC (vector) or pRC-FLAG-BRRF1 (Na). Cells were harvested at 48 h posttransfection and CAT assays were performed. The data shown represent the results of two independent experiments.

Techniques Used: Construct, Transfection, Plasmid Preparation

66) Product Images from "Fatty acid binding profile of the liver X receptor α [S]"

Article Title: Fatty acid binding profile of the liver X receptor α [S]

Journal: Journal of Lipid Research

doi: 10.1194/jlr.M072447

MCFA, lauric acid, or its metabolite, lauroyl-CoA, alter LXRα transactivation. COS-7 cells transfected with pSG5 empty vector, LXRα, PPARα, or both PPARα and LXRα were analyzed for transactivation of the SREBP-1c-LXRE-luciferase reporter construct in the presence of vehicle or 10 μM ligands. The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where no ligand empty vector (pSG5) sample was arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P
Figure Legend Snippet: MCFA, lauric acid, or its metabolite, lauroyl-CoA, alter LXRα transactivation. COS-7 cells transfected with pSG5 empty vector, LXRα, PPARα, or both PPARα and LXRα were analyzed for transactivation of the SREBP-1c-LXRE-luciferase reporter construct in the presence of vehicle or 10 μM ligands. The y axis represents values for firefly luciferase activity that have been normalized to Renilla luciferase (internal control), where no ligand empty vector (pSG5) sample was arbitrarily set to 1. The bar graph represents the mean values (n ≥ 3) ± SE. * P

Techniques Used: Transfection, Plasmid Preparation, Luciferase, Construct, Activity Assay

67) Product Images from "CD40 and LMP-1 both signal from lipid rafts but LMP-1 assembles a distinct, more efficient signaling complex"

Article Title: CD40 and LMP-1 both signal from lipid rafts but LMP-1 assembles a distinct, more efficient signaling complex

Journal: The EMBO Journal

doi: 10.1093/emboj/20.11.2641

Fig. 2. LMP-1 activates NF-κB-mediated transcription more efficiently than does CD40 when treated with ligand, and a portion of LMP-1 associates with DRMs. ( A ) Assay for NF-κB activity in cells transfected with vectors expressing: CD40 (gray); treated with CD40L (black); and LMP-1 (red). 293 cells were transfected with the amount of expression vectors for CD40 or LMP-1 indicated, an NF-κB-responsive firefly luciferase reporter, an expression vector for Renilla luciferase or pEGFPN-1, and brought up to equal concentrations with pSG5. All transfections were normalized to Renilla luciferase levels or to the number of GFP-positive cells. The fold activation of firefly luciferase over cells transfected with pSG5 alone is shown. The relative light units (RLUs) in these experiments varied from ∼4.0 × 10 4 to up to ∼2.0 × 10 5 in cells transfected with empty vector to ∼1.0 × 10 7 in the presence of expression vectors for CD40 or LMP-1. The data represent the average ± SD for three separate experiments with two measurements each. The number of molecules per cell of CD40 and LMP-1 was calculated from known amounts of MYPACATCD40 or GSTLMP-1 assayed on the same blot as described in Materials and methods. ND, not detectable. ( B ) Biochemical fractionation of cells to separate their soluble and DRM fractions. 293 cells that express LMP-1 under the control of tetracycline were transfected with expression vectors encoding GFP and GαiRFP, extracted with Triton X-100, and separated on a nycodenz flotation gradient as described in Materials and methods. Eleven fractions were collected from the bottom of the gradient and subjected to western blot analysis. The fractions were loaded from left (which corresponds to the bottom fraction of the gradient) to right (which corresponds to the top fraction of the gradient). The DRM fraction of the cells is defined by the presence of GαiRFP and consists of the top five fractions. The soluble fraction of the cells is defined by the presence of GFP and consists of the bottom six fractions. ( C ) 293 cells that express LMP-1 under the control of tetracycline were left untreated, or treated with 10 ng/ml or 1 µg/ml tetracycline for 48 h, fractionated, and probed with anti-LMP-1 antiserum. The number of molecules per cell was calculated from the known amount of GSTLMP-1 assayed on the same blot as described in Materials and methods. The percentage of LMP-1 in the DRM fraction is indicated and was determined by quantifying the amount of LMP-1 by PhosphorImager analysis in the fractions that contained GαiRFP. One representative blot of three is shown. The fold activation of NF-κB in these cells was measured in parallel by introducing into them an NF-κB-responsive luciferase reporter and measuring luciferase activity as described in Materials and methods.
Figure Legend Snippet: Fig. 2. LMP-1 activates NF-κB-mediated transcription more efficiently than does CD40 when treated with ligand, and a portion of LMP-1 associates with DRMs. ( A ) Assay for NF-κB activity in cells transfected with vectors expressing: CD40 (gray); treated with CD40L (black); and LMP-1 (red). 293 cells were transfected with the amount of expression vectors for CD40 or LMP-1 indicated, an NF-κB-responsive firefly luciferase reporter, an expression vector for Renilla luciferase or pEGFPN-1, and brought up to equal concentrations with pSG5. All transfections were normalized to Renilla luciferase levels or to the number of GFP-positive cells. The fold activation of firefly luciferase over cells transfected with pSG5 alone is shown. The relative light units (RLUs) in these experiments varied from ∼4.0 × 10 4 to up to ∼2.0 × 10 5 in cells transfected with empty vector to ∼1.0 × 10 7 in the presence of expression vectors for CD40 or LMP-1. The data represent the average ± SD for three separate experiments with two measurements each. The number of molecules per cell of CD40 and LMP-1 was calculated from known amounts of MYPACATCD40 or GSTLMP-1 assayed on the same blot as described in Materials and methods. ND, not detectable. ( B ) Biochemical fractionation of cells to separate their soluble and DRM fractions. 293 cells that express LMP-1 under the control of tetracycline were transfected with expression vectors encoding GFP and GαiRFP, extracted with Triton X-100, and separated on a nycodenz flotation gradient as described in Materials and methods. Eleven fractions were collected from the bottom of the gradient and subjected to western blot analysis. The fractions were loaded from left (which corresponds to the bottom fraction of the gradient) to right (which corresponds to the top fraction of the gradient). The DRM fraction of the cells is defined by the presence of GαiRFP and consists of the top five fractions. The soluble fraction of the cells is defined by the presence of GFP and consists of the bottom six fractions. ( C ) 293 cells that express LMP-1 under the control of tetracycline were left untreated, or treated with 10 ng/ml or 1 µg/ml tetracycline for 48 h, fractionated, and probed with anti-LMP-1 antiserum. The number of molecules per cell was calculated from the known amount of GSTLMP-1 assayed on the same blot as described in Materials and methods. The percentage of LMP-1 in the DRM fraction is indicated and was determined by quantifying the amount of LMP-1 by PhosphorImager analysis in the fractions that contained GαiRFP. One representative blot of three is shown. The fold activation of NF-κB in these cells was measured in parallel by introducing into them an NF-κB-responsive luciferase reporter and measuring luciferase activity as described in Materials and methods.

Techniques Used: Activity Assay, Transfection, Expressing, Luciferase, Plasmid Preparation, Activation Assay, Fractionation, Western Blot

68) Product Images from "Genotype-Phenotype Relationship in Patients with Mutations in Thyroid Hormone Transporter MCT8"

Article Title: Genotype-Phenotype Relationship in Patients with Mutations in Thyroid Hormone Transporter MCT8

Journal:

doi: 10.1210/en.2007-1475

A, Uptake of T 3 by JEG3 cells cotransfected with wild-type (WT) or mutant hMCT8 cDNA and pSG5-hCRYM, shown as percentage of added T 3 after 30 min. Empty pcDNA3 plus pSG5-hCRYM served as control. B, Metabolism of T 3 after 4 h in JEG3 cells cotransfected
Figure Legend Snippet: A, Uptake of T 3 by JEG3 cells cotransfected with wild-type (WT) or mutant hMCT8 cDNA and pSG5-hCRYM, shown as percentage of added T 3 after 30 min. Empty pcDNA3 plus pSG5-hCRYM served as control. B, Metabolism of T 3 after 4 h in JEG3 cells cotransfected

Techniques Used: Mutagenesis

69) Product Images from "p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction"

Article Title: p66? and p66? of the Mi-2/NuRD complex mediate MBD2 and histone interaction

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkj437

K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.
Figure Legend Snippet: K149 of p66α is required for the MBD2 interaction as well as for the MBD2-mediated repression. ( A ) HEK293 cells were harvested 48 h after transfection with various combinations of DNA constructs, as indicated above the figure. Nuclear protein extracts were prepared (input) and purified with glutathione–Sepharose beads. The bound protein together with the input fractions were analyzed by western blotting using the anti-Gal antibody. ( B ) K149R mutant of p66α decreases MBD2-mediated repression. HeLa cells were cotransfected with a 4xUAStk luciferase reporter together with vectors expressing the Gal-DNA binding domain, or Gal-MBD2b and increasing amount of pSG5-p66α or pSG5-p66αK149R. Fold repression was determined relative to the Gal-DNA binding domain, significant changes relative to Gal-MBD2b (asterisk) and relative to comparable amounts of p66α (open triangle) are indicated.

Techniques Used: Transfection, Construct, Purification, Western Blot, Mutagenesis, Luciferase, Expressing, Binding Assay

70) Product Images from "Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5"

Article Title: Epstein-Barr virus-encoded microRNA miR-BART2 down-regulates the viral DNA polymerase BALF5

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkm1080

miR-BART2 down-regulates the BALF5 3′UTR. ( A ) Northern blot detection of ectopically expressed miR-BART2 and miR-155 using the indicated probes. RNA extracted from HeLa cells 48 h after transfection with the vector pSG5-miR-BART2 (lane designated ‘HeLa+miR-BART2’) was analysed in parallel with RNA from BL41 and B95.8 cells (EBV-negative and -positive, respectively). Total RNA of HeLa cells either transfected or untransfected with pSG5-mir-155 was analysed by northern blotting for the expression of miR-155. The positions of the precursor and the mature miRNA are indicated. ( B ) Effect of miR-BART2 on the BALF5 3′UTR. miR-BART2 and the Luc-BALF5-3′UTR reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. Graph B represents the mean values of six independent experiments carried out in duplicate (±SEM). ( C ) miR-BART2 and a luciferase reporter containing the BALF5 3′UTR with a deletion of the BART2-recognition site were co-expressed in the indicated combinations and analysed as in (B). ( D ) Effect of miR-BART2 on the parental (empty) vector pGL3-promoter (‘Luc’). MiR-BART2 and the pGL3-reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.257). ( E ) miR-BART2 and a luciferase reporter containing the LMP2A 3′UTR were co-expressed in the indicated combinations and analysed as in (B). The activity obtained with the reporter alone was set to 100%. ( F ) Effect of miR-155 on the pGL3-BALF5 3′-UTR reporter; the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.092). Graphs C, D, E and F represent the mean values of four independent experiments carried out in duplicate (±SEM).
Figure Legend Snippet: miR-BART2 down-regulates the BALF5 3′UTR. ( A ) Northern blot detection of ectopically expressed miR-BART2 and miR-155 using the indicated probes. RNA extracted from HeLa cells 48 h after transfection with the vector pSG5-miR-BART2 (lane designated ‘HeLa+miR-BART2’) was analysed in parallel with RNA from BL41 and B95.8 cells (EBV-negative and -positive, respectively). Total RNA of HeLa cells either transfected or untransfected with pSG5-mir-155 was analysed by northern blotting for the expression of miR-155. The positions of the precursor and the mature miRNA are indicated. ( B ) Effect of miR-BART2 on the BALF5 3′UTR. miR-BART2 and the Luc-BALF5-3′UTR reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. Graph B represents the mean values of six independent experiments carried out in duplicate (±SEM). ( C ) miR-BART2 and a luciferase reporter containing the BALF5 3′UTR with a deletion of the BART2-recognition site were co-expressed in the indicated combinations and analysed as in (B). ( D ) Effect of miR-BART2 on the parental (empty) vector pGL3-promoter (‘Luc’). MiR-BART2 and the pGL3-reporter were co-expressed in the indicated combinations. The activity obtained with the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.257). ( E ) miR-BART2 and a luciferase reporter containing the LMP2A 3′UTR were co-expressed in the indicated combinations and analysed as in (B). The activity obtained with the reporter alone was set to 100%. ( F ) Effect of miR-155 on the pGL3-BALF5 3′-UTR reporter; the reporter alone was set to 100%. The statistical analysis showed an insignificant effect ( P = 0.092). Graphs C, D, E and F represent the mean values of four independent experiments carried out in duplicate (±SEM).

Techniques Used: Northern Blot, Transfection, Plasmid Preparation, Expressing, Activity Assay, Luciferase

miR-BART2 down-regulates BALF5 polymerase. ( A ) Identification of BALF5 protein using the monoclonal antibody 4C12. Whole-cell extracts of B95.8 B-cells either treated (+) or untreated (−) with TPA were analysed by western blotting as shown in the left panel. The blots were stained with the novel BALF5-specific antibody 4C12, an antibody directed against β-actin as a loading control and BZLF1-specific monoclonal antibody BZ-1 to verify the induction of EBV lytic replication. Detection of BALF5 in EBV-infected 293 cells without (–) and after (+) induction of lytic replication by BZLF1 using the vector p509 ( 18 ) is shown in the right panel. ( B ) Immunoprecipitation of BALF5. Extract of TPA-treated Raji cells was incubated either with BALF5-specific antibody 4C12 or irrelevant isotype control as indicated. Immune complexes were collected using protein G Sepharose (Amersham-Pharmacia). The precipitated BALF5 protein was analysed in a western blot using 4C12 as primary antibody; bound antibody was visualized by the ECL method; the lanes designated ‘Raji’, shows whole-cell extract prior to precipitation. ( C ) Reduction of BALF5 protein levels by miR-BART2. 293-EBV cells were transfected with BZLF1 expression vector p509 in combination with miR-BART2 expression vector or pSG5 control. BALF5 protein was stained using the monoclonal antibody 4C12, β-actin served as a loading control (left panel); statistical analysis of the BALF5 protein reduction by miR-BART2. The amount of BALF5 protein with or without BART2 expression from three independent assays as shown in (C) was determined and statistically analysed. The reduction of 30–40% after co-expression of miR-BART2 was statistically significant (right panel; P = 0.0037). ( D ) Reduction in virus load by miR-BART2. Viral replication in 293-EBV cells was induced by expression of BZLF1 using the vector p509. The amount of virus released was determined by quantitative real-time PCR. The value obtained by co-transfection of the empty control vector pSG5 was set to 100%. Co-expression of miR-BART2 resulted in a statistically significant reduction of the virus load by 20% ( P = 0.039), co-expression of miR-155 resulted in a non-significant reduction by 5–10% ( P = 0.155).
Figure Legend Snippet: miR-BART2 down-regulates BALF5 polymerase. ( A ) Identification of BALF5 protein using the monoclonal antibody 4C12. Whole-cell extracts of B95.8 B-cells either treated (+) or untreated (−) with TPA were analysed by western blotting as shown in the left panel. The blots were stained with the novel BALF5-specific antibody 4C12, an antibody directed against β-actin as a loading control and BZLF1-specific monoclonal antibody BZ-1 to verify the induction of EBV lytic replication. Detection of BALF5 in EBV-infected 293 cells without (–) and after (+) induction of lytic replication by BZLF1 using the vector p509 ( 18 ) is shown in the right panel. ( B ) Immunoprecipitation of BALF5. Extract of TPA-treated Raji cells was incubated either with BALF5-specific antibody 4C12 or irrelevant isotype control as indicated. Immune complexes were collected using protein G Sepharose (Amersham-Pharmacia). The precipitated BALF5 protein was analysed in a western blot using 4C12 as primary antibody; bound antibody was visualized by the ECL method; the lanes designated ‘Raji’, shows whole-cell extract prior to precipitation. ( C ) Reduction of BALF5 protein levels by miR-BART2. 293-EBV cells were transfected with BZLF1 expression vector p509 in combination with miR-BART2 expression vector or pSG5 control. BALF5 protein was stained using the monoclonal antibody 4C12, β-actin served as a loading control (left panel); statistical analysis of the BALF5 protein reduction by miR-BART2. The amount of BALF5 protein with or without BART2 expression from three independent assays as shown in (C) was determined and statistically analysed. The reduction of 30–40% after co-expression of miR-BART2 was statistically significant (right panel; P = 0.0037). ( D ) Reduction in virus load by miR-BART2. Viral replication in 293-EBV cells was induced by expression of BZLF1 using the vector p509. The amount of virus released was determined by quantitative real-time PCR. The value obtained by co-transfection of the empty control vector pSG5 was set to 100%. Co-expression of miR-BART2 resulted in a statistically significant reduction of the virus load by 20% ( P = 0.039), co-expression of miR-155 resulted in a non-significant reduction by 5–10% ( P = 0.155).

Techniques Used: Western Blot, Staining, Infection, Plasmid Preparation, Immunoprecipitation, Incubation, Transfection, Expressing, Real-time Polymerase Chain Reaction, Cotransfection

71) Product Images from "Epstein-Barr Virus Entry Utilizing HLA-DP or HLA-DQ as a Coreceptor"

Article Title: Epstein-Barr Virus Entry Utilizing HLA-DP or HLA-DQ as a Coreceptor

Journal: Journal of Virology

doi:

Expression of HLA-DR, -DP, or -DQ mediates EBV entry into 721.174 and HPB-ALL cells. Daudi or HPB-ALL cells (10 6 ) electroporated with HLA-DR, HLA-DP, or HLA-DQ were infected with EBfaV-GFP and analyzed by two-color flow cytometry. The flow cytometer was gated for EGFP fluorescence and class II expression using a pan-class II antibody, TÜ39, detected by a goat anti-mouse allophycocyanin-conjugated secondary antibody. pSG5-electroporated cells were exposed to EBfaV-GFP and stained identically to class II-transfected cells. The number given in the lower right quadrant represents the percentage of cells expressing the appropriate class II molecule which are infected by EBfaV-GFP. Each plot shows 40,000 events.
Figure Legend Snippet: Expression of HLA-DR, -DP, or -DQ mediates EBV entry into 721.174 and HPB-ALL cells. Daudi or HPB-ALL cells (10 6 ) electroporated with HLA-DR, HLA-DP, or HLA-DQ were infected with EBfaV-GFP and analyzed by two-color flow cytometry. The flow cytometer was gated for EGFP fluorescence and class II expression using a pan-class II antibody, TÜ39, detected by a goat anti-mouse allophycocyanin-conjugated secondary antibody. pSG5-electroporated cells were exposed to EBfaV-GFP and stained identically to class II-transfected cells. The number given in the lower right quadrant represents the percentage of cells expressing the appropriate class II molecule which are infected by EBfaV-GFP. Each plot shows 40,000 events.

Techniques Used: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Staining, Transfection

72) Product Images from "Human Cytomegalovirus pp71 Stimulates Cell Cycle Progression by Inducing the Proteasome-Dependent Degradation of the Retinoblastoma Family of Tumor Suppressors"

Article Title: Human Cytomegalovirus pp71 Stimulates Cell Cycle Progression by Inducing the Proteasome-Dependent Degradation of the Retinoblastoma Family of Tumor Suppressors

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.6.1885-1895.2003

pp71 targets the hypophosphorylated forms of the Rb family. (A) U-2 OS cells were transfected with pCMV-Rb, pCMV-p107, or pCMV-p130 and either pCMVE1A or pCGN71. Lysates were harvested 48 h later, separated on 10% gels, and probed with antibodies to the indicated Rb family members. (B) U-2 OS cells were transfected with pSG5L-HApRB, pHAp107, or pHAp130 and either the empty pSG5 vector or pSG5-pp71. Lysates were harvested 48 h later, separated on 6% gels, and probed with the HA antibody. Asterisks represent phosphorylated protein species. (C) U-2 OS cells were transfected with pHAp130 and either pCGNpp65 or pCGN71. Lysates were harvested 48 h later, separated on 6% gels, and probed with the HA antibody. Asterisks represent phosphorylated protein species. (D) Glutathione-Sepharose beads preloaded with GST or a GST-pp71 fusion protein were incubated with lysates of U-2 OS cells transfected with pSG5L-HApRb and then processed for immunoblotting with an HA-specific antibody. Asterisks indicate phosphorylated Rb proteins.
Figure Legend Snippet: pp71 targets the hypophosphorylated forms of the Rb family. (A) U-2 OS cells were transfected with pCMV-Rb, pCMV-p107, or pCMV-p130 and either pCMVE1A or pCGN71. Lysates were harvested 48 h later, separated on 10% gels, and probed with antibodies to the indicated Rb family members. (B) U-2 OS cells were transfected with pSG5L-HApRB, pHAp107, or pHAp130 and either the empty pSG5 vector or pSG5-pp71. Lysates were harvested 48 h later, separated on 6% gels, and probed with the HA antibody. Asterisks represent phosphorylated protein species. (C) U-2 OS cells were transfected with pHAp130 and either pCGNpp65 or pCGN71. Lysates were harvested 48 h later, separated on 6% gels, and probed with the HA antibody. Asterisks represent phosphorylated protein species. (D) Glutathione-Sepharose beads preloaded with GST or a GST-pp71 fusion protein were incubated with lysates of U-2 OS cells transfected with pSG5L-HApRb and then processed for immunoblotting with an HA-specific antibody. Asterisks indicate phosphorylated Rb proteins.

Techniques Used: Transfection, Plasmid Preparation, Incubation

pp71 degrades the Rb family. (A) U-2 OS cells cotransfected with pSG5L-HApRb, pHAp107, or pHAp130 and either pSG5 (filled squares) or pSG5-pp71 (open circles) were subjected to a pulse-chase analysis as described in Materials and Methods. The relative amounts of total protein (hypo- and hyperphosphorylated forms) are shown. (B) Phosphorimages of the 0- and 1-h time points of a representative Rb pulse-chase experiment are shown. The asterisk indicates the phosphorylated Rb species. (C) The relative amount of each individual form of Rb (lower, hypophosphorylated band; upper, hyperphosphorylated band) in the presence and absence of pp71 was determined after chase times of 0 and 1 h for two independent experiments, and the percent change during that time period is shown for each species.
Figure Legend Snippet: pp71 degrades the Rb family. (A) U-2 OS cells cotransfected with pSG5L-HApRb, pHAp107, or pHAp130 and either pSG5 (filled squares) or pSG5-pp71 (open circles) were subjected to a pulse-chase analysis as described in Materials and Methods. The relative amounts of total protein (hypo- and hyperphosphorylated forms) are shown. (B) Phosphorimages of the 0- and 1-h time points of a representative Rb pulse-chase experiment are shown. The asterisk indicates the phosphorylated Rb species. (C) The relative amount of each individual form of Rb (lower, hypophosphorylated band; upper, hyperphosphorylated band) in the presence and absence of pp71 was determined after chase times of 0 and 1 h for two independent experiments, and the percent change during that time period is shown for each species.

Techniques Used: Pulse Chase

73) Product Images from "Epstein-Barr Virus Nuclear Antigen 3C Putative Repression Domain Mediates Coactivation of the LMP1 Promoter with EBNA-2"

Article Title: Epstein-Barr Virus Nuclear Antigen 3C Putative Repression Domain Mediates Coactivation of the LMP1 Promoter with EBNA-2

Journal: Journal of Virology

doi: 10.1128/JVI.76.1.232-242.2002

EBNA-3C can enhance transcriptional activity of the EBNA-2AD (aa 426 to 462) but not the VP16AD. (A) BJAB cells were transfected with reporter plasmid pFR-Luc, which contains five Gal4-binding sites, and the indicated amounts of pGal4-EBNA-2AD (E2-AD) and pSG5-EBNA-3C (E3C). The results from a representative experiment are depicted. (B) BJAB cells were transfected with pFR-Luc and the indicated amounts of pGal4-VP16 (VP16-AD) and pSG5-EBNA-3C. The results from a representative experiment are depicted. Luciferase activities are shown relative to those of reporter and empty expression vector control.
Figure Legend Snippet: EBNA-3C can enhance transcriptional activity of the EBNA-2AD (aa 426 to 462) but not the VP16AD. (A) BJAB cells were transfected with reporter plasmid pFR-Luc, which contains five Gal4-binding sites, and the indicated amounts of pGal4-EBNA-2AD (E2-AD) and pSG5-EBNA-3C (E3C). The results from a representative experiment are depicted. (B) BJAB cells were transfected with pFR-Luc and the indicated amounts of pGal4-VP16 (VP16-AD) and pSG5-EBNA-3C. The results from a representative experiment are depicted. Luciferase activities are shown relative to those of reporter and empty expression vector control.

Techniques Used: Activity Assay, Transfection, Plasmid Preparation, Binding Assay, Luciferase, Expressing

EBNA-3C potentiates EBNA-2 activation of the LMP1 promoter in BJAB, a non-EBV-infected BL cell line. (A) BJAB cells were transfected with reporter plasmid p(−512/+72)LMP1p-Luc, which has two tandem copies of the −512/+72 LMP1 promoter upstream of the luciferase gene, in addition to the indicated amounts of the pSG5-EBNA-2 (E2) and pSG5-EBNA-3C (E3C) expression vectors. Fold increase in luciferase activity is shown on the left. The panels below the graph show corresponding immunoblots using a monoclonal antibody against EBNA-2 (PE2). The results are representative of at least two independent experiments. WB, Western blot. (B) Response of p(−512/+72)LMP1p-Luc activity to 1 μg of pSG5-EBNA-2 and various increasing amounts (0.1 to 20 μg) of pSG5-EBNA-3C. The values shown are representative ratios of observed luciferase activity relative to that of EBNA-2 alone from at least two experiments. (C) Representative reporter assay using BJAB cells transfected with a reporter construct (pLuc-Cp) containing eight copies of the RBP-Jκ-binding site from the Cp promoter, 1 μg of pSG5-EBNA-2, and various amounts of pSG5-EBNA-3C. The relative luciferase values, indicated on the left in all experiments, were normalized to the β-galactosidase activity of a cotransfected plasmid, pGK-βgal.
Figure Legend Snippet: EBNA-3C potentiates EBNA-2 activation of the LMP1 promoter in BJAB, a non-EBV-infected BL cell line. (A) BJAB cells were transfected with reporter plasmid p(−512/+72)LMP1p-Luc, which has two tandem copies of the −512/+72 LMP1 promoter upstream of the luciferase gene, in addition to the indicated amounts of the pSG5-EBNA-2 (E2) and pSG5-EBNA-3C (E3C) expression vectors. Fold increase in luciferase activity is shown on the left. The panels below the graph show corresponding immunoblots using a monoclonal antibody against EBNA-2 (PE2). The results are representative of at least two independent experiments. WB, Western blot. (B) Response of p(−512/+72)LMP1p-Luc activity to 1 μg of pSG5-EBNA-2 and various increasing amounts (0.1 to 20 μg) of pSG5-EBNA-3C. The values shown are representative ratios of observed luciferase activity relative to that of EBNA-2 alone from at least two experiments. (C) Representative reporter assay using BJAB cells transfected with a reporter construct (pLuc-Cp) containing eight copies of the RBP-Jκ-binding site from the Cp promoter, 1 μg of pSG5-EBNA-2, and various amounts of pSG5-EBNA-3C. The relative luciferase values, indicated on the left in all experiments, were normalized to the β-galactosidase activity of a cotransfected plasmid, pGK-βgal.

Techniques Used: Activation Assay, Infection, Transfection, Plasmid Preparation, Luciferase, Expressing, Activity Assay, Western Blot, Reporter Assay, Construct, Binding Assay

). Repeats containing prolines (PP) and glutamine-proline residues (QP) are noted, as are two potential nuclear localization signal sequences (NLS). (B) EBNA-3C deletion constructs utilized in this study. (C) Immunoblots of lysates from 12 million BJAB cells that had been transfected 40 to 48 h previously with 1 μg of pSG5 expression vector for the indicated EBNA-3C deletion construct. The left panel used the EBNA-3C-specific A10 monoclonal antibody, while the right panel used M2 and M5 monoclonal antibodies against the Flag epitope tag. The top arrow indicates the position of Flag-EBNA-3C aa 363 to 992, which migrates just below a background band present in both lanes, and the bottom arrow indicates the position of Flag-EBNA-3C aa 365 to 545. WB, Western blot; wt, wild type.
Figure Legend Snippet: ). Repeats containing prolines (PP) and glutamine-proline residues (QP) are noted, as are two potential nuclear localization signal sequences (NLS). (B) EBNA-3C deletion constructs utilized in this study. (C) Immunoblots of lysates from 12 million BJAB cells that had been transfected 40 to 48 h previously with 1 μg of pSG5 expression vector for the indicated EBNA-3C deletion construct. The left panel used the EBNA-3C-specific A10 monoclonal antibody, while the right panel used M2 and M5 monoclonal antibodies against the Flag epitope tag. The top arrow indicates the position of Flag-EBNA-3C aa 363 to 992, which migrates just below a background band present in both lanes, and the bottom arrow indicates the position of Flag-EBNA-3C aa 365 to 545. WB, Western blot; wt, wild type.

Techniques Used: Construct, Western Blot, Transfection, Expressing, Plasmid Preparation, FLAG-tag

EBNA-3C coactivation of the LMP1 promoter element is independent of RBP-Jκ. (A) Representative assay (of two repetitions) using BJAB cells transfected with the reporter plasmid p(−236/−145)LMP1p-Luc containing the −236/−145 LMP1 promoter element upstream of a minimal SV40 early promoter and the luciferase ORF, along with the indicated amounts of pSG5-EBNA-2 (E2) and pSG5-EBNA-3C (E3C). Fold increase in luciferase activity is indicated. (B) BJAB cells were transfected with CAT reporter plasmids containing wild-type (wt) or mutant LMP1 promoter sequences and the indicated amounts of pSG5-EBNA-2 and pSG5-EBNA-3C. Results are representative of two independent repetitions. Percent conversion was determined using ImageQuant software and a PhosphorImager. Fold activity is relative to that of the vector-only control, which was assigned a value of 1. (C) BJAB cells were transfected with p(−512/+72)LMP1p-Luc and the indicated amounts of pSG5-EBNA-2-SS (E2-SS) and pSG5-EBNA-3C. Results are representative of independent duplicate experiments. Fold activation of luciferase is indicated. (D) BJAB cells were transfected with p(−512/+72)LMP1p-Luc and the indicated amounts of pSG5-EBNA-2 and pSG5-flagEBNA-3C, pSG5-flagEBNA-3A, or pSG5-flagEBNA-3B. The results are representative of two independent experiments. Relative luciferase activity is indicated. The panel below the graph shows a corresponding immunoblot with monoclonal antibodies directed against the Flag epitope tag. WB, Western blot.
Figure Legend Snippet: EBNA-3C coactivation of the LMP1 promoter element is independent of RBP-Jκ. (A) Representative assay (of two repetitions) using BJAB cells transfected with the reporter plasmid p(−236/−145)LMP1p-Luc containing the −236/−145 LMP1 promoter element upstream of a minimal SV40 early promoter and the luciferase ORF, along with the indicated amounts of pSG5-EBNA-2 (E2) and pSG5-EBNA-3C (E3C). Fold increase in luciferase activity is indicated. (B) BJAB cells were transfected with CAT reporter plasmids containing wild-type (wt) or mutant LMP1 promoter sequences and the indicated amounts of pSG5-EBNA-2 and pSG5-EBNA-3C. Results are representative of two independent repetitions. Percent conversion was determined using ImageQuant software and a PhosphorImager. Fold activity is relative to that of the vector-only control, which was assigned a value of 1. (C) BJAB cells were transfected with p(−512/+72)LMP1p-Luc and the indicated amounts of pSG5-EBNA-2-SS (E2-SS) and pSG5-EBNA-3C. Results are representative of independent duplicate experiments. Fold activation of luciferase is indicated. (D) BJAB cells were transfected with p(−512/+72)LMP1p-Luc and the indicated amounts of pSG5-EBNA-2 and pSG5-flagEBNA-3C, pSG5-flagEBNA-3A, or pSG5-flagEBNA-3B. The results are representative of two independent experiments. Relative luciferase activity is indicated. The panel below the graph shows a corresponding immunoblot with monoclonal antibodies directed against the Flag epitope tag. WB, Western blot.

Techniques Used: Transfection, Plasmid Preparation, Luciferase, Activity Assay, Mutagenesis, Software, Activation Assay, FLAG-tag, Western Blot

Amino acid residues 365 to 545 of EBNA-3C are necessary and sufficient for coactivating activity with EBNA-2. Reporter assay in BJAB cells using p(−512/+72)LMP1p-Luc, 1 μg of pSG5-EBNA-2 (E2), and 2 μg of either pSG5-EBNA-3C (E3C) or the indicated EBNA-3C deletion construct. Relative luciferase activity is indicated. The results are averages of duplicate samples and are representative of at least three independent repetitions. Error bars indicate standard deviations.
Figure Legend Snippet: Amino acid residues 365 to 545 of EBNA-3C are necessary and sufficient for coactivating activity with EBNA-2. Reporter assay in BJAB cells using p(−512/+72)LMP1p-Luc, 1 μg of pSG5-EBNA-2 (E2), and 2 μg of either pSG5-EBNA-3C (E3C) or the indicated EBNA-3C deletion construct. Relative luciferase activity is indicated. The results are averages of duplicate samples and are representative of at least three independent repetitions. Error bars indicate standard deviations.

Techniques Used: Activity Assay, Reporter Assay, Construct, Luciferase

74) Product Images from "Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿"

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

Journal:

doi: 10.1128/JVI.01817-08

Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified
Figure Legend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

Techniques Used: Plasmid Preparation

Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell
Figure Legend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

Techniques Used: Transfection, Plasmid Preparation

Related Articles

Diagnostic Assay:

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿
Article Snippet: The insertion generated a unique PmeI restriction site, which was used for diagnostic purposes. .. The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ).

Clone Assay:

Article Title: The c-Myc target gene PRDX3 is required for mitochondrial homeostasis and neoplastic transformation
Article Snippet: .. The 1.5-kb fragment corresponding to PRDX3 was filled with Klenow and cloned into the blunt Klenow-filled Eco RI site of pSG5. .. Stable pooled cell lines were generated by cotransfection of pSG5, pSG5- PRDX3 , or pSG5- PRDX3 AS with the puromycin resistance plasmid pBabe-puro ( ) by using Lipofectamine (GIBCO) according to the manufacturer's instructions.

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31
Article Snippet: .. The PCR-generated fragment was cloned into pSG5, giving rise to plasmid pSGE 8 ̂ E2C, which lacks the sequences upstream of the E8 start codon (HPV31 nt 1212 to 1258). .. Site-specific mutagenesis of pSGE 8 ̂ E2C was performed by PCR with the oligonucleotides shown in Table .

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections
Article Snippet: .. Multiple PCR products were cloned to derive the nucleotide sequence, and the open reading frame was cloned into pSG5 (Stratagene) for eukaryotic expression. ..

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: Plasmid pRPA31L1 consists of HPV31 nt 5521 to 5703 cloned into pSP72 (Promega, Madison, Wis.) and has been described previously ( ). .. The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ).

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: The PCR products were cloned into the pGEM-T easy vector. .. A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively.

Amplification:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections
Article Snippet: Rhesus LCV sVCA was cloned by PCR amplification from the rhesus LCV cosmid clone QA15, using EBV-specific primers (5′ GAGGTAGAATTGCCACCTGG 3′ and 5′ TTCGTGAGCCAGCTTCGCCG 3′) at reduced stringency. .. Multiple PCR products were cloned to derive the nucleotide sequence, and the open reading frame was cloned into pSG5 (Stratagene) for eukaryotic expression.

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ). .. E2 mutants EN20, RK37, and EQ39 (see Results) were amplified by PCR from mutant genomes, used to replace the Bam HI- Acc B7I fragment in pSBE2, and resequenced.

Synthesized:

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter
Article Snippet: .. Bgl II fragments, including the sequences encoding the HA tag from these pACT2 constructs, were ligated into pSG5 to generate the corresponding pSG5-HA constructs. pSG5-myc SMN and pSG5-HA SMN ΔN27 were synthesized by PCR using the 5′-primer Myc5′EcoSMN (5′-GCG GAATTC CATATGGAGCAAAAGCTAATATCGGAAGAAGATCTCGCGATGAGCAGCGGCGGCAGTGG-3′) or Eco-HA-SMN27 (5′-GCG GAATTC CACCATGTACCCTTACGATGTACCGGATTACGCAGCGAGCGATGATTCTGACATTTGG-3′) and 3′-primer SMN3′XhoBam (5′-CGC GGATCC TCGAGCTGCTCTATGCCAGCA-3′) and ligation of the Eco RI/ Bam HI-digested fragments into pSG5. .. Ligation of an Nco I/ Sal I fragment from pGEM-T DP103 ( ) into pACT2 resulted in pACT2 DP103. pSG5-HA DP103 WT, Δ456-547, and Δ341-461 were generated by ligation of a DP103 Bgl II fragment from the respective pACT2 DP103 mutants into pSG5.

Construct:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. N-terminal in-frame fusions between parts of E8∧ E2C and the GAL4 DBD were constructed by subcloning Eco RI fragments from pSG E8∧ E2C and pSG E8∧ E2C KWK or by inserting double-stranded oligonucleotides encoding the respective amino acids in the Eco RI site of pSG-GAL4, giving rise to the expression vectors pSG-E8(1-12)-GAL4, pSG-E8∧ E2C(1-21)-GAL4, pSG-E8∧ E2C(1-37)-GAL4, and pSG-E8∧ E2C(1-37) KWK-GAL4.

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter
Article Snippet: .. Bgl II fragments, including the sequences encoding the HA tag from these pACT2 constructs, were ligated into pSG5 to generate the corresponding pSG5-HA constructs. pSG5-myc SMN and pSG5-HA SMN ΔN27 were synthesized by PCR using the 5′-primer Myc5′EcoSMN (5′-GCG GAATTC CATATGGAGCAAAAGCTAATATCGGAAGAAGATCTCGCGATGAGCAGCGGCGGCAGTGG-3′) or Eco-HA-SMN27 (5′-GCG GAATTC CACCATGTACCCTTACGATGTACCGGATTACGCAGCGAGCGATGATTCTGACATTTGG-3′) and 3′-primer SMN3′XhoBam (5′-CGC GGATCC TCGAGCTGCTCTATGCCAGCA-3′) and ligation of the Eco RI/ Bam HI-digested fragments into pSG5. .. Ligation of an Nco I/ Sal I fragment from pGEM-T DP103 ( ) into pACT2 resulted in pACT2 DP103. pSG5-HA DP103 WT, Δ456-547, and Δ341-461 were generated by ligation of a DP103 Bgl II fragment from the respective pACT2 DP103 mutants into pSG5.

Luciferase:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The luciferase reporter vector pC18-SP1-4xGAL4-luc was constructed by insertion of a double-stranded oligonucleotide containing four GAL4 binding sites (4xGAL4; 5′-AGCTCGGAAGACTCTCCTCCGACGGAAGACTCTCCTCCGACGGAAGACTCTCCTCCGACGGAAGACTCTCCTCCGA-3′) in the Hin dIII site of plasmid pC18-SP1-luc ( ).

Expressing:

Article Title: A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro
Article Snippet: .. In order to examine BGLF4 protein expression in transfected cells, a similar tag strategy was used to clone the E1/BGLF4 DNA fragment into pSG5. ..

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: .. Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections
Article Snippet: .. Multiple PCR products were cloned to derive the nucleotide sequence, and the open reading frame was cloned into pSG5 (Stratagene) for eukaryotic expression. ..

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: .. The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ). .. To facilitate subcloning of the mutated E2 genes, the E2-containing fragment was released with Bam HI from pSG31E2 and then cloned into the Bgl II site of pSG5, resulting in pSBE2.

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: Paragraph title: Mammalian expression plasmids ... A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively.

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
Article Snippet: .. Cells transfected with expression plasmids for vGPCR, vGPCR variant 8 or 15, or pSG5 (negative control) were lysed by Dounce homogenization (using a disposable microcentrifuge tube Dounce homogenizer) in buffer A (10 mM HEPES, 10 mM EDTA [pH 7.4]), and membranes were pelleted at 16,000 × g in a microcentrifuge. .. The pellets were resuspended in buffer B (10 mM HEPES, 0.1 mM EDTA [pH 7.4]), homogenized by Dounce homogenization, and repelleted by centrifugation.

Modification:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: Plasmid pUKHPV31 contains the complete genome of HPV31 cloned into the Eco RI site of a modified pUC18 plasmid ( ). .. The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ).

Over Expression:

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿
Article Snippet: .. LCL10 cells were nucleofected as described in Materials and Methods with either pSG5 or gB to determine if gB overexpression affected focus formation. ..

Derivative Assay:

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6
Article Snippet: .. Extracts of cells treated with rhIL-6, vIL-6 (derived from pSVvIL-6-transfected Hep3B cells), or negative control medium, comprising either fresh medium without added rhIL-6 or conditioned medium from Hep3B cells transfected with pSG5, were probed for the presence of either phospho-STAT1 (left panel) or phospho-STAT3 (right panel). ..

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively. .. The mRXRα coding sequence was amplified from cDNA derived from mouse liver with the following primers: 5′-cgaattc caccATGGACACCAAACATTTCCTGCCGCT-3′ and 5′-actcgagCTAGGTGGCTTGATGTGGT-3′.

Transfection:

Article Title: A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro
Article Snippet: .. In order to examine BGLF4 protein expression in transfected cells, a similar tag strategy was used to clone the E1/BGLF4 DNA fragment into pSG5. ..

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6
Article Snippet: .. Extracts of cells treated with rhIL-6, vIL-6 (derived from pSVvIL-6-transfected Hep3B cells), or negative control medium, comprising either fresh medium without added rhIL-6 or conditioned medium from Hep3B cells transfected with pSG5, were probed for the presence of either phospho-STAT1 (left panel) or phospho-STAT3 (right panel). ..

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
Article Snippet: .. Cells transfected with expression plasmids for vGPCR, vGPCR variant 8 or 15, or pSG5 (negative control) were lysed by Dounce homogenization (using a disposable microcentrifuge tube Dounce homogenizer) in buffer A (10 mM HEPES, 10 mM EDTA [pH 7.4]), and membranes were pelleted at 16,000 × g in a microcentrifuge. .. The pellets were resuspended in buffer B (10 mM HEPES, 0.1 mM EDTA [pH 7.4]), homogenized by Dounce homogenization, and repelleted by centrifugation.

Ligation:

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter
Article Snippet: .. Bgl II fragments, including the sequences encoding the HA tag from these pACT2 constructs, were ligated into pSG5 to generate the corresponding pSG5-HA constructs. pSG5-myc SMN and pSG5-HA SMN ΔN27 were synthesized by PCR using the 5′-primer Myc5′EcoSMN (5′-GCG GAATTC CATATGGAGCAAAAGCTAATATCGGAAGAAGATCTCGCGATGAGCAGCGGCGGCAGTGG-3′) or Eco-HA-SMN27 (5′-GCG GAATTC CACCATGTACCCTTACGATGTACCGGATTACGCAGCGAGCGATGATTCTGACATTTGG-3′) and 3′-primer SMN3′XhoBam (5′-CGC GGATCC TCGAGCTGCTCTATGCCAGCA-3′) and ligation of the Eco RI/ Bam HI-digested fragments into pSG5. .. Ligation of an Nco I/ Sal I fragment from pGEM-T DP103 ( ) into pACT2 resulted in pACT2 DP103. pSG5-HA DP103 WT, Δ456-547, and Δ341-461 were generated by ligation of a DP103 Bgl II fragment from the respective pACT2 DP103 mutants into pSG5.

Generated:

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿
Article Snippet: The insertion generated a unique PmeI restriction site, which was used for diagnostic purposes. .. The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ).

Polymerase Chain Reaction:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Mutations were introduced into the HPV31 wild-type genome or the respective mutants by subcloning restriction fragments obtained by overlap-extension PCR using the appropriate synthetic primers and restriction digest. .. Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ).

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31
Article Snippet: .. The PCR-generated fragment was cloned into pSG5, giving rise to plasmid pSGE 8 ̂ E2C, which lacks the sequences upstream of the E8 start codon (HPV31 nt 1212 to 1258). .. Site-specific mutagenesis of pSGE 8 ̂ E2C was performed by PCR with the oligonucleotides shown in Table .

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections
Article Snippet: .. Multiple PCR products were cloned to derive the nucleotide sequence, and the open reading frame was cloned into pSG5 (Stratagene) for eukaryotic expression. ..

Article Title: Functional Cooperation of Epstein-Barr Virus Nuclear Antigen 2 and the Survival Motor Neuron Protein in Transactivation of the Viral LMP1 Promoter
Article Snippet: .. Bgl II fragments, including the sequences encoding the HA tag from these pACT2 constructs, were ligated into pSG5 to generate the corresponding pSG5-HA constructs. pSG5-myc SMN and pSG5-HA SMN ΔN27 were synthesized by PCR using the 5′-primer Myc5′EcoSMN (5′-GCG GAATTC CATATGGAGCAAAAGCTAATATCGGAAGAAGATCTCGCGATGAGCAGCGGCGGCAGTGG-3′) or Eco-HA-SMN27 (5′-GCG GAATTC CACCATGTACCCTTACGATGTACCGGATTACGCAGCGAGCGATGATTCTGACATTTGG-3′) and 3′-primer SMN3′XhoBam (5′-CGC GGATCC TCGAGCTGCTCTATGCCAGCA-3′) and ligation of the Eco RI/ Bam HI-digested fragments into pSG5. .. Ligation of an Nco I/ Sal I fragment from pGEM-T DP103 ( ) into pACT2 resulted in pACT2 DP103. pSG5-HA DP103 WT, Δ456-547, and Δ341-461 were generated by ligation of a DP103 Bgl II fragment from the respective pACT2 DP103 mutants into pSG5.

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ). .. E2 mutants EN20, RK37, and EQ39 (see Results) were amplified by PCR from mutant genomes, used to replace the Bam HI- Acc B7I fragment in pSBE2, and resequenced.

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: The PCR products were cloned into the pGEM-T easy vector. .. A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively.

Binding Assay:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Mutagenesis:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: With exception of the HPV31 E8ATG mutation, which is silent in E1, the mutations E8W6A, E8K7A, and E8KWK also lead to amino acid changes in the overlapping E1 gene (Fig. ). .. Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ).

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: Mutations in the E2 gene were introduced with the Chameleon Mutagenesis Kit (Stratagene) and primers that contain specific mutations in the E2 gene. pHPV31 E2:EN20 contains mutations at nucleotides (nt) 2750 (G to A) and 2752 (A to C), pHPV31 E2:RK37 contains mutations at nt 2801 and 2802 (CG to AA), pHPV31 E2:EQ39 was mutated at nt 2807 (G to C), and pHPV31 E2:IL73 was mutated at nt 2909 (A to C). .. The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ).

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿
Article Snippet: Paragraph title: Generation of gB mutants by random linker insertion mutagenesis. ... The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ).

Subcloning:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Mutations were introduced into the HPV31 wild-type genome or the respective mutants by subcloning restriction fragments obtained by overlap-extension PCR using the appropriate synthetic primers and restriction digest. .. Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ).

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ). .. To facilitate subcloning of the mutated E2 genes, the E2-containing fragment was released with Bam HI from pSG31E2 and then cloned into the Bgl II site of pSG5, resulting in pSBE2.

Sequencing:

Article Title: Cloning of the Rhesus Lymphocryptovirus Viral Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and Use in Diagnosis of Acute and Persistent Infections
Article Snippet: .. Multiple PCR products were cloned to derive the nucleotide sequence, and the open reading frame was cloned into pSG5 (Stratagene) for eukaryotic expression. ..

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively. .. The human retinoid X receptor α (hRXRα) coding sequence was amplified from HepG2 cDNA using the following primers: 5′-catcgaattccaccATGGACACCAAACATTTCCTGCCGCT-3′ and 5′-ctcgagCTAAGTCATTTGGGTGCGGCGCCTCC-3′.

Plasmid Preparation:

Article Title: The Papillomavirus E8∧E2C Protein Represses DNA Replication from Extrachromosomal Origins
Article Snippet: Eukaryotic expression plasmids for HPV31 E1 (pSG-31E1), E2 (pSX-E2), E8∧ E2C (pSG-E8∧ E2C), and E8∧ E2C KWK (pSG-E8∧ E2C KWK) are all based on pSG5 (Stratagene, Amsterdam, The Netherlands) and have been described previously ( , ). .. The GAL4 DNA binding domain (DBD) (aa 1 to 147) was amplified by PCR with plasmid pM (Clontech, Heidelberg, Germany) as a template and cloned into the Bgl II site of a modified pSG5 plasmid that contains an additional Sma I restriction site, giving rise to pSG-GAL4.

Article Title: The E8 Domain Confers a Novel Long-Distance Transcriptional Repression Activity on the E8?E2C Protein of High-Risk Human Papillomavirus Type 31
Article Snippet: .. The PCR-generated fragment was cloned into pSG5, giving rise to plasmid pSGE 8 ̂ E2C, which lacks the sequences upstream of the E8 start codon (HPV31 nt 1212 to 1258). .. Site-specific mutagenesis of pSGE 8 ̂ E2C was performed by PCR with the oligonucleotides shown in Table .

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: Plasmid pRPA31L1 consists of HPV31 nt 5521 to 5703 cloned into pSP72 (Promega, Madison, Wis.) and has been described previously ( ). .. The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ).

Article Title: Divergence between human and murine peroxisome proliferator-activated receptor alpha ligand specificities [S]
Article Snippet: The PCR products were cloned into the pGEM-T easy vector. .. A Bam HI / end-filled Sal I fragment for hPPARα and a Bam HI / end-filled Xho I mouse PPARα fragment were subcloned into the Bam HI / end-filled Bgl II multiple-cloning site of pSG5 (Stratagene, La Jolla, CA) to produce pSG5-hPPARα and pSG5-mPPARα, respectively.

Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿
Article Snippet: .. The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ). .. The linker insertion contained the PmeI site; the gB gene had an NheI site, whereas the XbaI site was present within the pSG5 vector plasmid.

Negative Control:

Article Title: Human Herpesvirus 8 Interleukin-6 (vIL-6) Signals through gp130 but Has Structural and Receptor-Binding Properties Distinct from Those of Human IL-6
Article Snippet: .. Extracts of cells treated with rhIL-6, vIL-6 (derived from pSVvIL-6-transfected Hep3B cells), or negative control medium, comprising either fresh medium without added rhIL-6 or conditioned medium from Hep3B cells transfected with pSG5, were probed for the presence of either phospho-STAT1 (left panel) or phospho-STAT3 (right panel). ..

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
Article Snippet: .. Cells transfected with expression plasmids for vGPCR, vGPCR variant 8 or 15, or pSG5 (negative control) were lysed by Dounce homogenization (using a disposable microcentrifuge tube Dounce homogenizer) in buffer A (10 mM HEPES, 10 mM EDTA [pH 7.4]), and membranes were pelleted at 16,000 × g in a microcentrifuge. .. The pellets were resuspended in buffer B (10 mM HEPES, 0.1 mM EDTA [pH 7.4]), homogenized by Dounce homogenization, and repelleted by centrifugation.

Recombinant:

Article Title: Transactivation by the E2 Protein of Oncogenic Human Papillomavirus Type 31 Is Not Essential for Early and Late Viral Functions
Article Snippet: Paragraph title: Recombinant plasmids. ... The HPV31 E1 and E2 expression vectors are based upon pSG5 (Stratagene) and have been described previously ( ).

Homogenization:

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
Article Snippet: .. Cells transfected with expression plasmids for vGPCR, vGPCR variant 8 or 15, or pSG5 (negative control) were lysed by Dounce homogenization (using a disposable microcentrifuge tube Dounce homogenizer) in buffer A (10 mM HEPES, 10 mM EDTA [pH 7.4]), and membranes were pelleted at 16,000 × g in a microcentrifuge. .. The pellets were resuspended in buffer B (10 mM HEPES, 0.1 mM EDTA [pH 7.4]), homogenized by Dounce homogenization, and repelleted by centrifugation.

Variant Assay:

Article Title: G? Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
Article Snippet: .. Cells transfected with expression plasmids for vGPCR, vGPCR variant 8 or 15, or pSG5 (negative control) were lysed by Dounce homogenization (using a disposable microcentrifuge tube Dounce homogenizer) in buffer A (10 mM HEPES, 10 mM EDTA [pH 7.4]), and membranes were pelleted at 16,000 × g in a microcentrifuge. .. The pellets were resuspended in buffer B (10 mM HEPES, 0.1 mM EDTA [pH 7.4]), homogenized by Dounce homogenization, and repelleted by centrifugation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Stratagene psg5
    Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of <t>pSG5</t> (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.
    Psg5, supplied by Stratagene, used in various techniques. Bioz Stars score: 91/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/psg5/product/Stratagene
    Average 91 stars, based on 118 article reviews
    Price from $9.99 to $1999.99
    psg5 - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    86
    Stratagene expression plasmid vector psg5
    Induction of adhesion molecule expression by ORF74. KSIMM cells were transfected with <t>pSG5-ORF74</t> or pSG5 alone. Cells were detached at 20 h posttransfection with 1 mM EDTA and counted. Aliquots (0.5 × 10 6 ) of transfected cells were stained with the indicated antibodies. Cells treated with TNF-α (5 ng/ml) were included as a positive control for the induction of adhesion marker expression (data not shown). Samples were analyzed using a Becton Dickinson FACSCalibur flow cytometer. PE-conjugated antibodies for VCAM-1, ICAM-1, E-selectin, and αVβ3 integrin were obtained from PharMingen. Appropriate isotype-matched controls were used for each antibody as a control for nonspecific antibody binding. Cell Quest Analysis (Becton Dickinson version 3.1f) software was used to analyze the raw fluorescence-activated cell-sorting data and obtain quantitative values. (A) Analysis of expression of cell surface ICAM-1. (B) Analysis of expression of cell surface VCAM-1. (C) Analysis of expression of cell surface E-selectin. (D) Analysis of expression of cell surface αVβ3. The solid line represents the isotype control, the dotted line represents pSG5-transfected cells, and the dashed line represents ORF74-transfected cells. The transfection efficiency was ca. 35%.
    Expression Plasmid Vector Psg5, supplied by Stratagene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression plasmid vector psg5/product/Stratagene
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expression plasmid vector psg5 - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.

    Journal: Journal of Virology

    Article Title: A Protein Kinase Activity Associated with Epstein-Barr Virus BGLF4 Phosphorylates the Viral Early Antigen EA-D In Vitro

    doi:

    Figure Lengend Snippet: Expression of BGLF4 (pSJC2) and E1/BGLF4 (pSJC12) in 293 cells after transfection and infection with recombinant vaccinia virus vTF7-3, which carries a copy of the T7 RNA polymerase. (A) After transfection and infection, cell lysates of pSG5 (vector), pSJC2(pSG5-BGLF4), and pSJC12(pSG5-E1/BGLF4) were harvested, displayed on an SDS–10% PAGE gel, and reacted with BGLF4-specific antiserum in an immunoblotting assay. The 48-kDa product of BGLF4 and the 52-kDa product of E1/BGLF4 can be seen in lanes 1 and 3, respectively. (B) The cell lysates expressing BGLF4 and E1/BGLF4 were immunoblotted with EBNA-1 monoclonal antibody 5C11. Arrowhead, E1/BGLF4. (C) After transfection of BGLF4 or E1/BGLF4 expression plasmids and infection with vTF7-3, the cells were labeled with [ 35 S]methionine for 4 h before lysis. The cell lysates were immunoprecipitated with preimmunized-rabbit sera, BGLF4-specific antisera, or the 5C11 monoclonal antibody. Arrowhead, E1/BGLF4. (D) Autophosphorylation of BGLF4. Protein A-Sepharose beads containing immunoprecipitated E1/BGLF4 were incubated in kinase buffer in the presence of [γ- 32 P]ATP. Autophosphorylation of BGLF4 may be seen in lane 4. Lane 1, in vitro transcription/translation product as a marker.

    Article Snippet: In order to examine BGLF4 protein expression in transfected cells, a similar tag strategy was used to clone the E1/BGLF4 DNA fragment into pSG5.

    Techniques: Expressing, Transfection, Infection, Recombinant, Plasmid Preparation, Polyacrylamide Gel Electrophoresis, Labeling, Lysis, Immunoprecipitation, Incubation, In Vitro, Marker

    Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

    Journal:

    Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

    doi: 10.1128/JVI.01817-08

    Figure Lengend Snippet: Oligomer formation of gB linker insertion mutants. Oligomer formation of gB linker insertion mutants determined in whole cell lysates under nonreducing conditions. pSG5, vector control; gB and gBΔ798, positive controls. Oligomers are identified

    Article Snippet: The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ).

    Techniques: Plasmid Preparation

    Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

    Journal:

    Article Title: Analysis of Epstein-Barr Virus Glycoprotein B Functional Domains via Linker Insertion Mutagenesis ▿

    doi: 10.1128/JVI.01817-08

    Figure Lengend Snippet: Biotinylation control experiments. CHO cells were transfected with pSG5 vector, full-length gB, and the gBΔ798 truncation as previously described. Actin was chosen as a representative intracellular protein to show that only biotinylation of cell

    Article Snippet: The target plasmid for the random insertions contained full-length gB in pSG5 (Stratagene) ( ).

    Techniques: Transfection, Plasmid Preparation

    Induction of adhesion molecule expression by ORF74. KSIMM cells were transfected with pSG5-ORF74 or pSG5 alone. Cells were detached at 20 h posttransfection with 1 mM EDTA and counted. Aliquots (0.5 × 10 6 ) of transfected cells were stained with the indicated antibodies. Cells treated with TNF-α (5 ng/ml) were included as a positive control for the induction of adhesion marker expression (data not shown). Samples were analyzed using a Becton Dickinson FACSCalibur flow cytometer. PE-conjugated antibodies for VCAM-1, ICAM-1, E-selectin, and αVβ3 integrin were obtained from PharMingen. Appropriate isotype-matched controls were used for each antibody as a control for nonspecific antibody binding. Cell Quest Analysis (Becton Dickinson version 3.1f) software was used to analyze the raw fluorescence-activated cell-sorting data and obtain quantitative values. (A) Analysis of expression of cell surface ICAM-1. (B) Analysis of expression of cell surface VCAM-1. (C) Analysis of expression of cell surface E-selectin. (D) Analysis of expression of cell surface αVβ3. The solid line represents the isotype control, the dotted line represents pSG5-transfected cells, and the dashed line represents ORF74-transfected cells. The transfection efficiency was ca. 35%.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Induction of adhesion molecule expression by ORF74. KSIMM cells were transfected with pSG5-ORF74 or pSG5 alone. Cells were detached at 20 h posttransfection with 1 mM EDTA and counted. Aliquots (0.5 × 10 6 ) of transfected cells were stained with the indicated antibodies. Cells treated with TNF-α (5 ng/ml) were included as a positive control for the induction of adhesion marker expression (data not shown). Samples were analyzed using a Becton Dickinson FACSCalibur flow cytometer. PE-conjugated antibodies for VCAM-1, ICAM-1, E-selectin, and αVβ3 integrin were obtained from PharMingen. Appropriate isotype-matched controls were used for each antibody as a control for nonspecific antibody binding. Cell Quest Analysis (Becton Dickinson version 3.1f) software was used to analyze the raw fluorescence-activated cell-sorting data and obtain quantitative values. (A) Analysis of expression of cell surface ICAM-1. (B) Analysis of expression of cell surface VCAM-1. (C) Analysis of expression of cell surface E-selectin. (D) Analysis of expression of cell surface αVβ3. The solid line represents the isotype control, the dotted line represents pSG5-transfected cells, and the dashed line represents ORF74-transfected cells. The transfection efficiency was ca. 35%.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Expressing, Transfection, Staining, Positive Control, Marker, Flow Cytometry, Cytometry, Binding Assay, Software, Fluorescence, FACS

    Paracrine stimulation of NF-κB by CM from cells transfected with ORF74. KSIMM cells (10 6 ) were transfected with ORF74-pSG5 or pSG5. CM from these cells was collected at 24 h posttransfection. Equal numbers of KSIMM target cells transfected with an NF-κB reporter plasmid were suspended in dilutions of 10, 25, and 50% CM in fresh medium, cultured for 6 h, and harvested. Luciferase activity was assayed as described in Materials and Methods. Datum points are the average of triplicate results from three wells.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Paracrine stimulation of NF-κB by CM from cells transfected with ORF74. KSIMM cells (10 6 ) were transfected with ORF74-pSG5 or pSG5. CM from these cells was collected at 24 h posttransfection. Equal numbers of KSIMM target cells transfected with an NF-κB reporter plasmid were suspended in dilutions of 10, 25, and 50% CM in fresh medium, cultured for 6 h, and harvested. Luciferase activity was assayed as described in Materials and Methods. Datum points are the average of triplicate results from three wells.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Transfection, Plasmid Preparation, Cell Culture, Luciferase, Activity Assay

    Dose response of ORF74-induced activation of NF-κB in KSIMM cells. (A) Dose response to transfected ORF74. KSIMM cells (10 5 ) were transfected with a NF-κB luciferase reporter construct (100 ng/sample) and increasing amounts (20 to 500 ng) of an expression vector encoding ORF74 (ORF74-pSG5). Total input DNA was balanced with the empty expression vector (pSG5). A CMV–β-Gal vector (200 ng) was cotransfected to serve as an internal control for the efficiency of transfection. Transfection efficiencies were ca. 20%. Cells were harvested and assayed for luciferase and β-Gal activity 24 h after transfection. Luciferase values are expressed as relative light units (RLU) and were normalized to the constant β-Gal activity. The values shown are averages of three independent samples, with standard deviations represented by the error bars. (B) ORF74 protein expression. KSIMM cells were transfected with increasing amounts of ORF74-pSG5 DNA (lanes 2 to 5) as described for panel A. Cell lysates were analyzed for ORF74 protein by SDS-PAGE and Western blotting. Lane 1 contains protein lysate from KSIMM cells transfected with pSG5 alone. The band in lane 1 is a nonspecific band given by the ORF74 rabbit polyclonal antibody. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded in each lane.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Dose response of ORF74-induced activation of NF-κB in KSIMM cells. (A) Dose response to transfected ORF74. KSIMM cells (10 5 ) were transfected with a NF-κB luciferase reporter construct (100 ng/sample) and increasing amounts (20 to 500 ng) of an expression vector encoding ORF74 (ORF74-pSG5). Total input DNA was balanced with the empty expression vector (pSG5). A CMV–β-Gal vector (200 ng) was cotransfected to serve as an internal control for the efficiency of transfection. Transfection efficiencies were ca. 20%. Cells were harvested and assayed for luciferase and β-Gal activity 24 h after transfection. Luciferase values are expressed as relative light units (RLU) and were normalized to the constant β-Gal activity. The values shown are averages of three independent samples, with standard deviations represented by the error bars. (B) ORF74 protein expression. KSIMM cells were transfected with increasing amounts of ORF74-pSG5 DNA (lanes 2 to 5) as described for panel A. Cell lysates were analyzed for ORF74 protein by SDS-PAGE and Western blotting. Lane 1 contains protein lysate from KSIMM cells transfected with pSG5 alone. The band in lane 1 is a nonspecific band given by the ORF74 rabbit polyclonal antibody. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded in each lane.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Activation Assay, Transfection, Luciferase, Construct, Expressing, Plasmid Preparation, Activity Assay, SDS Page, Western Blot

    Time course of ORF74-induced activation of NF-κB in KSIMM cells. (A) Time course of NF-κB signaling. KSIMM cells (10 5 ) were transfected with an NF-κB luciferase reporter construct (100 ng) and 100 or 500 ng of pSG5-ORF74. Transfection efficiencies were ca. 20%. Controls were transfected with pSG5 alone. Cells were harvested at the indicated time points and assayed for luciferase activity. Readings are expressed as the fold increase of luciferase above the control vector-transfected cells. Values shown are averages of three independent samples, with standard deviations represented by the error bars. (B) ORF74 protein expression. KSIMM cells were transfected with 100 ng (lanes 1 to 4) or 500 ng (lanes 6 to 9) of ORF74 DNA as described for panel A. The cells for lanes 5 and 10 (designated “c” for control) were transfected with pSG5 alone and harvested at 24 h posttransfection. Cell lysates were analyzed for ORF74 protein by SDS-PAGE and Western blotting. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded into each lane.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Time course of ORF74-induced activation of NF-κB in KSIMM cells. (A) Time course of NF-κB signaling. KSIMM cells (10 5 ) were transfected with an NF-κB luciferase reporter construct (100 ng) and 100 or 500 ng of pSG5-ORF74. Transfection efficiencies were ca. 20%. Controls were transfected with pSG5 alone. Cells were harvested at the indicated time points and assayed for luciferase activity. Readings are expressed as the fold increase of luciferase above the control vector-transfected cells. Values shown are averages of three independent samples, with standard deviations represented by the error bars. (B) ORF74 protein expression. KSIMM cells were transfected with 100 ng (lanes 1 to 4) or 500 ng (lanes 6 to 9) of ORF74 DNA as described for panel A. The cells for lanes 5 and 10 (designated “c” for control) were transfected with pSG5 alone and harvested at 24 h posttransfection. Cell lysates were analyzed for ORF74 protein by SDS-PAGE and Western blotting. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded into each lane.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Activation Assay, Transfection, Luciferase, Construct, Activity Assay, Plasmid Preparation, Expressing, SDS Page, Western Blot

    Induction of NF-κB binding activity by ORF74. (A) NF-κB binding activity is induced by ORF74. KSIMM cells were transfected with ORF74-pSG5 or pSG5 control vector; the transfection efficiency was 28%. Cells were harvested and nuclear extracts were prepared and used in an electrophoretic mobility shift assay as described in Materials and Methods. Supershift assays were performed with the indicated antibodies. Complexes supershifted with p65 antibody are marked with an asterisk. (B) ELISA-based NF-κB DNA binding assay. KSIMM cells were transfected with 100 or 500 ng of ORF74-pSG5 or pSG5. Cells were harvested at 16 h posttransfection. Cell lysates were assayed for NF-κB DNA binding using an ELISA-based assay kit (Active Motif) in which 96-well plates are coated with oligonucleotides containing the NF-κB consensus site. Excess (20 pmol) mutant (ORF/exc. mut oligo) or wild-type (ORF/exc. wt oligo) probes were added to the indicated samples as competitors. Plates were incubated with rabbit anti-p65 antibody for 1 h, followed by an HRP-conjugated anti-rabbit IgG, and developed with TMB (see Materials and Methods). The binding was quantified spectrophotometrically.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Induction of NF-κB binding activity by ORF74. (A) NF-κB binding activity is induced by ORF74. KSIMM cells were transfected with ORF74-pSG5 or pSG5 control vector; the transfection efficiency was 28%. Cells were harvested and nuclear extracts were prepared and used in an electrophoretic mobility shift assay as described in Materials and Methods. Supershift assays were performed with the indicated antibodies. Complexes supershifted with p65 antibody are marked with an asterisk. (B) ELISA-based NF-κB DNA binding assay. KSIMM cells were transfected with 100 or 500 ng of ORF74-pSG5 or pSG5. Cells were harvested at 16 h posttransfection. Cell lysates were assayed for NF-κB DNA binding using an ELISA-based assay kit (Active Motif) in which 96-well plates are coated with oligonucleotides containing the NF-κB consensus site. Excess (20 pmol) mutant (ORF/exc. mut oligo) or wild-type (ORF/exc. wt oligo) probes were added to the indicated samples as competitors. Plates were incubated with rabbit anti-p65 antibody for 1 h, followed by an HRP-conjugated anti-rabbit IgG, and developed with TMB (see Materials and Methods). The binding was quantified spectrophotometrically.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Binding Assay, Activity Assay, Transfection, Plasmid Preparation, Electrophoretic Mobility Shift Assay, Enzyme-linked Immunosorbent Assay, DNA Binding Assay, Mutagenesis, Incubation

    Inhibition of NF-κB activation by ORF74 by DN mutants. KSIMM cells (3 × 10 5 cells) were transfected with pSG5-ORF74, the NF-κB luciferase reporter plasmid, and increasing amounts of the indicated DN mutant expression constructs. Total DNA inputs were equalized with control vector. Cells were lysed and luciferase expression was quantified at 18 h posttransfection. KSIMM cells were transfected with ORF74 and increasing amounts of DN constructs of IKKα, IKKβ, and IκB. All samples were analyzed in triplicate, and the values were averaged. The transfection efficiencies were ca. 30%.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: Inhibition of NF-κB activation by ORF74 by DN mutants. KSIMM cells (3 × 10 5 cells) were transfected with pSG5-ORF74, the NF-κB luciferase reporter plasmid, and increasing amounts of the indicated DN mutant expression constructs. Total DNA inputs were equalized with control vector. Cells were lysed and luciferase expression was quantified at 18 h posttransfection. KSIMM cells were transfected with ORF74 and increasing amounts of DN constructs of IKKα, IKKβ, and IκB. All samples were analyzed in triplicate, and the values were averaged. The transfection efficiencies were ca. 30%.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Inhibition, Activation Assay, Transfection, Luciferase, Plasmid Preparation, Mutagenesis, Expressing, Construct

    ORF74 activates NF-κB in primary endothelial cells. (A) Activation of NF-κB DNA binding in endothelial cells expressing ORF74. dMVECs were infected with a retrovirus expressing ORF74 from the Moloney murine leukemia virus LTR (ORF74-MIGR1) (see Materials and Methods) or control virus alone (MIGR1). Lysates from these cells were assayed for activation of NF-κB DNA binding by ELISA-based NF-κB DNA-binding assays (see Materials and Methods). Excess (20 pmol) mutant probe (ORF/exc. mut oligo) or probes (ORF/exc. wt oligo) wild-type were added to reactions as competitors. (B) Expression of ORF74 protein in primary endothelial cells. Cell lysates were harvested 10 days postinfection, and 25 μg of protein lysate was analyzed by SDS-PAGE and Western blotting for ORF74. Twenty-five micrograms of protein lysate from KSIMM cells transfected with 100 ng of ORF74-pSG5 or empty vector (pSG5) was included for comparison of the protein expression levels. Lysates from transfected cells were harvested at 24 h posttransfection. The transfection efficiency was 25%. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded in each lane.

    Journal: Journal of Virology

    Article Title: Activation of NF-?B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis

    doi: 10.1128/JVI.75.18.8660-8673.2001

    Figure Lengend Snippet: ORF74 activates NF-κB in primary endothelial cells. (A) Activation of NF-κB DNA binding in endothelial cells expressing ORF74. dMVECs were infected with a retrovirus expressing ORF74 from the Moloney murine leukemia virus LTR (ORF74-MIGR1) (see Materials and Methods) or control virus alone (MIGR1). Lysates from these cells were assayed for activation of NF-κB DNA binding by ELISA-based NF-κB DNA-binding assays (see Materials and Methods). Excess (20 pmol) mutant probe (ORF/exc. mut oligo) or probes (ORF/exc. wt oligo) wild-type were added to reactions as competitors. (B) Expression of ORF74 protein in primary endothelial cells. Cell lysates were harvested 10 days postinfection, and 25 μg of protein lysate was analyzed by SDS-PAGE and Western blotting for ORF74. Twenty-five micrograms of protein lysate from KSIMM cells transfected with 100 ng of ORF74-pSG5 or empty vector (pSG5) was included for comparison of the protein expression levels. Lysates from transfected cells were harvested at 24 h posttransfection. The transfection efficiency was 25%. Blots were stripped and reprobed with an antibody to β-actin to ensure that equal amounts of protein were loaded in each lane.

    Article Snippet: The purified fragment was ligated into the Eco RI/ Bgl II sites of the expression plasmid vector pSG5 (Stratagene) with T4 ligase and transfected into STBL2 bacterial cells (LTI).

    Techniques: Activation Assay, Binding Assay, Expressing, Infection, Enzyme-linked Immunosorbent Assay, Mutagenesis, SDS Page, Western Blot, Transfection, Plasmid Preparation