proteinase k  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Proteinase K
    Description:
    Proteinase K, FS from the fungus Engyodontium album is a non-specific serine protease that is useful for general digestion of proteins. Proteinase K, FS is supplied specifically for use in food and environmental testing workflows. It is typically used in conjunction with Lysis Buffer, FS (available separately) to lyse microbial organisms in order to prepare the microbial DNA for downstream analysis by real-time PCR. Proteinase K, FS can be used as a part of both the Pathatrix Auto Instrument and RapidFinder Direct Lysis workflows. When used as a part of the Pathatrix Auto Instrument workflow, one bottle of Proteinase K, FS is sufficient for 1250 reactions. When used as a part of the RapidFinder Direct Lysis workflow, one bottle of Proteinase K, FS is sufficient for 100 reactions. Proteinase K, FS is supplied in 50% glycerol at a concentration of 20 mg/ml. Unit Definition: One unit liberates 1 µmol of Folin-positive amino acids, measured as tyrosine, at 37°C, pH 7.5, using denatured bovine hemoglobin as the substrate.
    Catalog Number:
    4480715
    Price:
    None
    Applications:
    Clinical
    Size:
    1 25 mL
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Proteinase K
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher proteinase k
    Diagram of the protocol of  in situ  RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of  in situ  RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.
    Proteinase K, FS from the fungus Engyodontium album is a non-specific serine protease that is useful for general digestion of proteins. Proteinase K, FS is supplied specifically for use in food and environmental testing workflows. It is typically used in conjunction with Lysis Buffer, FS (available separately) to lyse microbial organisms in order to prepare the microbial DNA for downstream analysis by real-time PCR. Proteinase K, FS can be used as a part of both the Pathatrix Auto Instrument and RapidFinder Direct Lysis workflows. When used as a part of the Pathatrix Auto Instrument workflow, one bottle of Proteinase K, FS is sufficient for 1250 reactions. When used as a part of the RapidFinder Direct Lysis workflow, one bottle of Proteinase K, FS is sufficient for 100 reactions. Proteinase K, FS is supplied in 50% glycerol at a concentration of 20 mg/ml. Unit Definition: One unit liberates 1 µmol of Folin-positive amino acids, measured as tyrosine, at 37°C, pH 7.5, using denatured bovine hemoglobin as the substrate.
    https://www.bioz.com/result/proteinase k/product/Thermo Fisher
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    proteinase k - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "In situ RT-PCR Optimized for Electron Microscopy Allows Description of Subcellular Morphology of Target mRNA-Expressing Cells in the Brain"

    Article Title: In situ RT-PCR Optimized for Electron Microscopy Allows Description of Subcellular Morphology of Target mRNA-Expressing Cells in the Brain

    Journal: Frontiers in Cellular Neuroscience

    doi: 10.3389/fncel.2017.00141

    Diagram of the protocol of  in situ  RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of  in situ  RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.
    Figure Legend Snippet: Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.

    Techniques Used: In Situ, Reverse Transcription Polymerase Chain Reaction, Labeling, Electron Microscopy, Polymerase Chain Reaction

    2) Product Images from "Employing Escherichia coli-derived outer membrane vesicles as an antigen delivery platform elicits protective immunity against Acinetobacter baumannii infection"

    Article Title: Employing Escherichia coli-derived outer membrane vesicles as an antigen delivery platform elicits protective immunity against Acinetobacter baumannii infection

    Journal: Scientific Reports

    doi: 10.1038/srep37242

    Presentation of Omp22 on the  E. coli -derived OMVs. ( A ) SDS-PAGE and immunoblotting analyses of the expression of the ClyA-Omp22 fusion protein in  E. coli  DH5α within whole-cell protein samples (left), and SDS-PAGE shows its presence in OMVs (right). Arrows point to the protein bands representing ClyA-Omp22. ( B ) Immunoblotting analyses of displaying Omp22 on the surface of engineered OMVs using  A. baumannii  Ab1 OMV ( Ab OMV) antiserum to provide detection antibodies.  Ab OMVs,  E. coli  DH5α wild-type OMVs (wtOMVs), and recombinant Omp22-OMVs were treated with proteinase K (PK). The blots were imaged with the ChemiDoc™ MP imaging system (Bio-Rad). The figure is a representative result from three repeated experiments. Asterisks (*) indicate non-specific cross-reactive protein bands in  E. coli  wtOMVs. ( C ) Transmission electron microscope images of wtOMVs (left) and recombinant Omp22-OMVs (right). The bar indicates 500 nm. ( D ) Size distribution of OMVs according to diameter determined by dynamic light scattering. wtOMVs are in red and Omp22-OMVs are in green. ( E ) Immune fluorescence/flow cytometry analyses of the location of recombinant Omp22. DH5α cells and OMVs were surface stained with anti-Omp22 antibodies. Alexa Fluor 647-conjugated donkey anti-mouse IgG was used as the fluorescently labeled secondary antibody. ( F ) Schematic diagram of the construction of recombinant Omp22-OMVs.
    Figure Legend Snippet: Presentation of Omp22 on the E. coli -derived OMVs. ( A ) SDS-PAGE and immunoblotting analyses of the expression of the ClyA-Omp22 fusion protein in E. coli DH5α within whole-cell protein samples (left), and SDS-PAGE shows its presence in OMVs (right). Arrows point to the protein bands representing ClyA-Omp22. ( B ) Immunoblotting analyses of displaying Omp22 on the surface of engineered OMVs using A. baumannii Ab1 OMV ( Ab OMV) antiserum to provide detection antibodies. Ab OMVs, E. coli DH5α wild-type OMVs (wtOMVs), and recombinant Omp22-OMVs were treated with proteinase K (PK). The blots were imaged with the ChemiDoc™ MP imaging system (Bio-Rad). The figure is a representative result from three repeated experiments. Asterisks (*) indicate non-specific cross-reactive protein bands in E. coli wtOMVs. ( C ) Transmission electron microscope images of wtOMVs (left) and recombinant Omp22-OMVs (right). The bar indicates 500 nm. ( D ) Size distribution of OMVs according to diameter determined by dynamic light scattering. wtOMVs are in red and Omp22-OMVs are in green. ( E ) Immune fluorescence/flow cytometry analyses of the location of recombinant Omp22. DH5α cells and OMVs were surface stained with anti-Omp22 antibodies. Alexa Fluor 647-conjugated donkey anti-mouse IgG was used as the fluorescently labeled secondary antibody. ( F ) Schematic diagram of the construction of recombinant Omp22-OMVs.

    Techniques Used: Derivative Assay, SDS Page, Expressing, Recombinant, Imaging, Transmission Assay, Microscopy, Fluorescence, Flow Cytometry, Cytometry, Staining, Labeling

    3) Product Images from "The Non-catalytic “Cap Domain” of a Mycobacterial Metallophosphoesterase Regulates Its Expression and Localization in the Cell"

    Article Title: The Non-catalytic “Cap Domain” of a Mycobacterial Metallophosphoesterase Regulates Its Expression and Localization in the Cell

    Journal:

    doi: 10.1074/jbc.M114.578328

    Interaction of Rv0805 with the mycobacterial cell wall. a , M. smegmatis cells expressing Rv0805 or Rv0805Δ40 were treated with proteinase K ( PK ) for the indicated times, and cell pellets were subjected to immunoblotting using an Rv0805-specific monoclonal antibody. CRP was used as a representative intracellular protein. Cells incubated at 37 °C without proteinase K treatment (− PK ) were used as control. b , M. smegmatis cells expressing Rv0805 or Rv0805Δ40 were treated with PBS or PBS supplemented with 1% OBG. Cell pellets were subjected to immunoblotting using Rv0805-specific monoclonal antibody. CRP was used as a representative intracellular protein. c , a crude cell wall fraction from M. smegmatis was incubated with purified Rv0805 or cap domain deletion mutants. The presence of Rv0805 in cell wall pellets was monitored by immunoblotting using an Rv0805-specific monoclonal antibody. d , interaction of Rv0805 with cell wall fractions from M. tuberculosis H37Rv or M. bovis bacillus Calmette-Guérin. − and + refer to the addition of recombinant Rv0805 to the interaction mix. e , Western blot analysis showing i n vitro interaction between Rv0805 or Rv0805Δ40 (Δ 40 ) and crude cell wall ( 1 ) or deproteinated ( 2 ) and delipidated ( 3 ) cell wall from M. smegmatis. f , Western blot analysis showing in vitro interaction between Rv0805 or Rv0805Δ40 and purified mAGP from M. tuberculosis H37Rv. Data shown are representative of experiments performed three times. In panels c–f , input refers to 2% of the total protein used for interaction experiments.
    Figure Legend Snippet: Interaction of Rv0805 with the mycobacterial cell wall. a , M. smegmatis cells expressing Rv0805 or Rv0805Δ40 were treated with proteinase K ( PK ) for the indicated times, and cell pellets were subjected to immunoblotting using an Rv0805-specific monoclonal antibody. CRP was used as a representative intracellular protein. Cells incubated at 37 °C without proteinase K treatment (− PK ) were used as control. b , M. smegmatis cells expressing Rv0805 or Rv0805Δ40 were treated with PBS or PBS supplemented with 1% OBG. Cell pellets were subjected to immunoblotting using Rv0805-specific monoclonal antibody. CRP was used as a representative intracellular protein. c , a crude cell wall fraction from M. smegmatis was incubated with purified Rv0805 or cap domain deletion mutants. The presence of Rv0805 in cell wall pellets was monitored by immunoblotting using an Rv0805-specific monoclonal antibody. d , interaction of Rv0805 with cell wall fractions from M. tuberculosis H37Rv or M. bovis bacillus Calmette-Guérin. − and + refer to the addition of recombinant Rv0805 to the interaction mix. e , Western blot analysis showing i n vitro interaction between Rv0805 or Rv0805Δ40 (Δ 40 ) and crude cell wall ( 1 ) or deproteinated ( 2 ) and delipidated ( 3 ) cell wall from M. smegmatis. f , Western blot analysis showing in vitro interaction between Rv0805 or Rv0805Δ40 and purified mAGP from M. tuberculosis H37Rv. Data shown are representative of experiments performed three times. In panels c–f , input refers to 2% of the total protein used for interaction experiments.

    Techniques Used: Expressing, Incubation, Purification, Recombinant, Western Blot, In Vitro

    4) Product Images from "Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking"

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1804091115

    Wnt3a treatment triggers the accumulation of arginine-methylated proteins inside endolysosomes. ( A ) Wnt signaling rapidly increased the number of puncta visualized by phase microscopy in HeLa cells (ImageJ). ( B ) Wnt-induced vesicles accumulated within 5–30 min. ( C  and  C′ ) Wnt signaling by Wnt3a triggered relocalization of arginine-methylated proteins (meArg) (green) into LAMP1 vesicles (red) in 3T3 cells. Panel  C′  was treated with Wnt3a for 20 min. ( D ) Diagram of protease protection assay. ( E ) meArg proteins were increased by Wnt activation following CA-LRP6 transfection (lanes 1–2) and became protected from proteinase K treatment (lanes 3–4), but only in the absence of Triton X-100 (lanes 3–6). GSK3 and actin served as MVBs and cytosolic protein controls, respectively. ( F – H ) In situ protease protection assay showing that Wnt-induced meArg proteins localized inside the same vesicles as GSK3 (arrowhead). ( I ) During Wnt signaling, cytosolic substrates modified by meArg, GSK3 phosphorylation, and K48-polyUb are sequestered into endolysosomes through microautophagy via the ESCRT/Vps4 machinery. (Scale bars, 10 μm.)
    Figure Legend Snippet: Wnt3a treatment triggers the accumulation of arginine-methylated proteins inside endolysosomes. ( A ) Wnt signaling rapidly increased the number of puncta visualized by phase microscopy in HeLa cells (ImageJ). ( B ) Wnt-induced vesicles accumulated within 5–30 min. ( C and C′ ) Wnt signaling by Wnt3a triggered relocalization of arginine-methylated proteins (meArg) (green) into LAMP1 vesicles (red) in 3T3 cells. Panel C′ was treated with Wnt3a for 20 min. ( D ) Diagram of protease protection assay. ( E ) meArg proteins were increased by Wnt activation following CA-LRP6 transfection (lanes 1–2) and became protected from proteinase K treatment (lanes 3–4), but only in the absence of Triton X-100 (lanes 3–6). GSK3 and actin served as MVBs and cytosolic protein controls, respectively. ( F – H ) In situ protease protection assay showing that Wnt-induced meArg proteins localized inside the same vesicles as GSK3 (arrowhead). ( I ) During Wnt signaling, cytosolic substrates modified by meArg, GSK3 phosphorylation, and K48-polyUb are sequestered into endolysosomes through microautophagy via the ESCRT/Vps4 machinery. (Scale bars, 10 μm.)

    Techniques Used: Methylation, Microscopy, Activation Assay, Transfection, In Situ, Modification

    Protein arginine methyltransferase 1 (PRMT1) is sequestered in MVBs by Wnt3a and is required for Wnt signaling. ( A  and  B ) Endogenous PRMT1 was sequestered in vesicles by Wnt signaling in in situ protease protection assays (arrowheads). ( C ) PRMT1 was depleted by siRNA. ( D  and  E ) GSK3 was sequestered by Wnt3a into the same vesicles as PRMT1 (arrowheads). ( F ) PRMT1 was required for the Wnt-induced endolysosomal sequestration of GSK3. siRNA targeting PRMT1 ablated GSK3 relocalization into vesicles following treatment with Wnt3a. ( G ) PRMT1 was protected by proteinase K inside membrane organelles during Wnt signaling. Actin serves as a negative control. ( H ) PRMT1 was required for Wnt signaling (lanes 2 and 4, bracket). Signaling was partially rescued by expression of a  Xenopus  PRMT1 (  26 ) in siPRMT1-treated cells (lane 6, bracket). (Scale bars, 10 μm.) * P
    Figure Legend Snippet: Protein arginine methyltransferase 1 (PRMT1) is sequestered in MVBs by Wnt3a and is required for Wnt signaling. ( A and B ) Endogenous PRMT1 was sequestered in vesicles by Wnt signaling in in situ protease protection assays (arrowheads). ( C ) PRMT1 was depleted by siRNA. ( D and E ) GSK3 was sequestered by Wnt3a into the same vesicles as PRMT1 (arrowheads). ( F ) PRMT1 was required for the Wnt-induced endolysosomal sequestration of GSK3. siRNA targeting PRMT1 ablated GSK3 relocalization into vesicles following treatment with Wnt3a. ( G ) PRMT1 was protected by proteinase K inside membrane organelles during Wnt signaling. Actin serves as a negative control. ( H ) PRMT1 was required for Wnt signaling (lanes 2 and 4, bracket). Signaling was partially rescued by expression of a Xenopus PRMT1 ( 26 ) in siPRMT1-treated cells (lane 6, bracket). (Scale bars, 10 μm.) * P

    Techniques Used: In Situ, Negative Control, Expressing

    Smad4 provides an example of a protein that must be methylated before it can be phosphorylated by GSK3 and translocated into MVBs by Wnt signaling. ( A ) Diagram of how FGF/EGF, Wnt, and TGF-β/BMP signaling cross-talk at the level of Smad4. MAPK/FGF (green) primes phosphorylation by GSK3 (blue) at three sites; the meArg site discovered in this study is shown in red. ( B ) Wnt addition for 20 min increased Smad4 methylation in transfected HEK-293T cells. S4-Flag and GAPDH serve as loading controls. ( C – E ) Phospho-Smad4-Flag relocalized to vesicular structures after 15 min of Wnt3a addition, but only in the absence of the competitive methylation inhibitor Adox. ( F ) A potential Smad4 arginine-methylation site was mutated (R272K) to prevent arginine methylation with minimal effect on the protein. ( G ) Smad4-Flag-WT immunoprecipitated from transfected HEK-293T lysates was recognized by asymmetric dimethyl-Arg antibody while the Smad4-Flag-R272K mutant was not. Thus, Smad4 contains a single meArg site. ( H ) Smad4 phosphorylation by GSK3 requires arginine methylation. Ratios under each lane and the merge panels indicate GSK3 phosphorylated Smad4/total Smad4-Flag. ( I – N ) In situ protease protection assay using digitonin and proteinase K showing that wild-type Smad4-Flag was translocated inside membrane-bound organelles when Wnt was added for 15 min ( J ) but digested when Triton X-100 was added ( K ). Smad4-R272K-Flag was not translocated into membrane vesicles and was degraded by proteinase K ( L  and  M ). Panels  I′ – N′  show DAPI staining and differential interference contrast microscopy to visualize cellular contours in the corresponding cells shown above. ( O ) Smad4 wild type (WT), Smad4-R272K, and Smad4 mutated at the three GSK3 sites (phosphorylation-resistant Smad4-GM) were tested in TGF-β signaling assays. HaCaT cells permanently transfected with the CAGA12-luciferase reporter and constitutive CMV-Renilla (in which MAPK activation was primed by addition of EGF) were used. This indicates that in the context of TGF-β signaling arginine methylation is required for the integration of FGF, Wnt, and TGF-β signals. ** P
    Figure Legend Snippet: Smad4 provides an example of a protein that must be methylated before it can be phosphorylated by GSK3 and translocated into MVBs by Wnt signaling. ( A ) Diagram of how FGF/EGF, Wnt, and TGF-β/BMP signaling cross-talk at the level of Smad4. MAPK/FGF (green) primes phosphorylation by GSK3 (blue) at three sites; the meArg site discovered in this study is shown in red. ( B ) Wnt addition for 20 min increased Smad4 methylation in transfected HEK-293T cells. S4-Flag and GAPDH serve as loading controls. ( C – E ) Phospho-Smad4-Flag relocalized to vesicular structures after 15 min of Wnt3a addition, but only in the absence of the competitive methylation inhibitor Adox. ( F ) A potential Smad4 arginine-methylation site was mutated (R272K) to prevent arginine methylation with minimal effect on the protein. ( G ) Smad4-Flag-WT immunoprecipitated from transfected HEK-293T lysates was recognized by asymmetric dimethyl-Arg antibody while the Smad4-Flag-R272K mutant was not. Thus, Smad4 contains a single meArg site. ( H ) Smad4 phosphorylation by GSK3 requires arginine methylation. Ratios under each lane and the merge panels indicate GSK3 phosphorylated Smad4/total Smad4-Flag. ( I – N ) In situ protease protection assay using digitonin and proteinase K showing that wild-type Smad4-Flag was translocated inside membrane-bound organelles when Wnt was added for 15 min ( J ) but digested when Triton X-100 was added ( K ). Smad4-R272K-Flag was not translocated into membrane vesicles and was degraded by proteinase K ( L and M ). Panels I′ – N′ show DAPI staining and differential interference contrast microscopy to visualize cellular contours in the corresponding cells shown above. ( O ) Smad4 wild type (WT), Smad4-R272K, and Smad4 mutated at the three GSK3 sites (phosphorylation-resistant Smad4-GM) were tested in TGF-β signaling assays. HaCaT cells permanently transfected with the CAGA12-luciferase reporter and constitutive CMV-Renilla (in which MAPK activation was primed by addition of EGF) were used. This indicates that in the context of TGF-β signaling arginine methylation is required for the integration of FGF, Wnt, and TGF-β signals. ** P

    Techniques Used: Methylation, Transfection, Immunoprecipitation, Mutagenesis, In Situ, Staining, Microscopy, Luciferase, Activation Assay

    5) Product Images from "Immune stealth-driven O2 serotype prevalence and potential for therapeutic antibodies against multidrug resistant Klebsiella pneumoniae"

    Article Title: Immune stealth-driven O2 serotype prevalence and potential for therapeutic antibodies against multidrug resistant Klebsiella pneumoniae

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02223-7

    K. pneumoniae  O2 LPS is less immunogenic than  K. pneumoniae  O1 LPS. Purified O1 and O2 LPS were used for immunization of mice ( a ) or rabbits ( b ) with 0.5 mg LPS per animal. Immune sera were collected from O1 and O2 immunized animals and used to assess antibody titer against KP O1 or O2 LPS by ELISA. Sera from mock immunized animals with adjuvant only (black open circle) were used as a negative control.  c  Mice were immunized subcutaneously with either heat killed Kp1131115 (WT, an O1 strain) or the isogenic matched Kp1131115Δ wbbYZ  (ΔwbbYZ, O2 serotype). Sera were collected 7 days after the final injection and used to assess antibody titer against  K. pneumoniae  O1 or O2 LPS by ELISA.  d  Sera collected in  c  were used to assess antibody binding to a protein target (OmpA) and to proteinase K bacterial lysate by ELISA.  e  Immune activation of cells in vitro was compared for purified O1 and O2 LPS. RAW264.7 cells stably transfected with a NF-κB driven luciferase promoter were stimulated with various doses of  K. pneumoniae  O1 or  K. pneumoniae  O2 LPS for 2 h. Percent activation was calculated as the amount of luminescence in stimulated cells vs. non-stimulated. Error bars indicate s.d. of each data point.  f  A schematic representation of KP O1 and O2 LPS. The gray region represents the membrane proximal LPS core region, the black region represents the  d -galactan I ( d -gal I) repeating O antigen sugars, the hatched gray filled region represents the O1 specific  d -galactan II ( d -gal II) repeating O antigen sugars encoded by the  wbbYZ  locus. Deletion of this locus converted the O1 strain (Kp1131115 WT) to an O2 expressing strain (Kp1131115ΔwbbYZ).  g  Silver stain of a SDS-PAGE gel showing the relative molecular weight of  K. pneumoniae  O1 LPS (lane 2) vs.  K. pneumoniae  O2 LPS (lane 3)
    Figure Legend Snippet: K. pneumoniae O2 LPS is less immunogenic than K. pneumoniae O1 LPS. Purified O1 and O2 LPS were used for immunization of mice ( a ) or rabbits ( b ) with 0.5 mg LPS per animal. Immune sera were collected from O1 and O2 immunized animals and used to assess antibody titer against KP O1 or O2 LPS by ELISA. Sera from mock immunized animals with adjuvant only (black open circle) were used as a negative control. c Mice were immunized subcutaneously with either heat killed Kp1131115 (WT, an O1 strain) or the isogenic matched Kp1131115Δ wbbYZ (ΔwbbYZ, O2 serotype). Sera were collected 7 days after the final injection and used to assess antibody titer against K. pneumoniae O1 or O2 LPS by ELISA. d Sera collected in c were used to assess antibody binding to a protein target (OmpA) and to proteinase K bacterial lysate by ELISA. e Immune activation of cells in vitro was compared for purified O1 and O2 LPS. RAW264.7 cells stably transfected with a NF-κB driven luciferase promoter were stimulated with various doses of K. pneumoniae O1 or K. pneumoniae O2 LPS for 2 h. Percent activation was calculated as the amount of luminescence in stimulated cells vs. non-stimulated. Error bars indicate s.d. of each data point. f A schematic representation of KP O1 and O2 LPS. The gray region represents the membrane proximal LPS core region, the black region represents the d -galactan I ( d -gal I) repeating O antigen sugars, the hatched gray filled region represents the O1 specific d -galactan II ( d -gal II) repeating O antigen sugars encoded by the wbbYZ locus. Deletion of this locus converted the O1 strain (Kp1131115 WT) to an O2 expressing strain (Kp1131115ΔwbbYZ). g Silver stain of a SDS-PAGE gel showing the relative molecular weight of K. pneumoniae O1 LPS (lane 2) vs. K. pneumoniae O2 LPS (lane 3)

    Techniques Used: Purification, Mouse Assay, Enzyme-linked Immunosorbent Assay, Negative Control, Injection, Binding Assay, Activation Assay, In Vitro, Stable Transfection, Transfection, Luciferase, Expressing, Silver Staining, SDS Page, Molecular Weight

    6) Product Images from "Prion Pathogenesis is Independent of Caspase-12"

    Article Title: Prion Pathogenesis is Independent of Caspase-12

    Journal:

    doi:

    ER stress is activated in prion disease. Upregulation of ER stress markers was determined in prion infected CD1 mice (n = 2 per timepoint) after inoculation with 6.5logLD50 RML prions. Western blot analysis was performed to analyze the levels of C12, Grp58, JNK phosphorylation, ERK phosphorylation, total PrP and proteinase K-resistant PrP. The total level of JNK, ERK, and actin were measured as loading controls. Faint processing of C12 is visible at 4 months post inoculation (mpi) but more clearly at 4.5 and 5 mpi (active fragments of C12 are indicated by an arrow head). Phosphorylation of JNK (P-JNK) as well as induction of Grp58 was observed at 4.5 and 5 mpi. Phosphorylation of ERK was observed at 4.5 and 5 mpi. Higher order SDS-resistant PrP species were first visible at 3 mpi and thereafter (an arrow head marks the migration of monomeric PrP) along with proteinase K resistant PrP.
    Figure Legend Snippet: ER stress is activated in prion disease. Upregulation of ER stress markers was determined in prion infected CD1 mice (n = 2 per timepoint) after inoculation with 6.5logLD50 RML prions. Western blot analysis was performed to analyze the levels of C12, Grp58, JNK phosphorylation, ERK phosphorylation, total PrP and proteinase K-resistant PrP. The total level of JNK, ERK, and actin were measured as loading controls. Faint processing of C12 is visible at 4 months post inoculation (mpi) but more clearly at 4.5 and 5 mpi (active fragments of C12 are indicated by an arrow head). Phosphorylation of JNK (P-JNK) as well as induction of Grp58 was observed at 4.5 and 5 mpi. Phosphorylation of ERK was observed at 4.5 and 5 mpi. Higher order SDS-resistant PrP species were first visible at 3 mpi and thereafter (an arrow head marks the migration of monomeric PrP) along with proteinase K resistant PrP.

    Techniques Used: Infection, Mouse Assay, Western Blot, Migration

    7) Product Images from "SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics"

    Article Title: SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    Journal: Scientific Reports

    doi: 10.1038/srep33351

    Experimental design and reproducibility. ( a ) Allocation of columns of the microfluidic chip to simulate 16 parallel measurements. The chip was divided in half for each of the TFs Pho4 and AtERF2. The 12-mer random libraries flowed through the microfluidic chip such that each library was directed to both halves of chip. Non-specifically bound DNA was degraded by endonuclease. Specifically bound DNA was released by TF degradation with proteinase K. DNA from just a single column of each quarter (a single measurement from each) was collected and amplified. The procedure was repeated before HTS. ( b ) 6-mer scores of round 2 frequencies. The frequency scores of two parallel experiments on the same protein demonstrate the high reproducibility of our experimental design.
    Figure Legend Snippet: Experimental design and reproducibility. ( a ) Allocation of columns of the microfluidic chip to simulate 16 parallel measurements. The chip was divided in half for each of the TFs Pho4 and AtERF2. The 12-mer random libraries flowed through the microfluidic chip such that each library was directed to both halves of chip. Non-specifically bound DNA was degraded by endonuclease. Specifically bound DNA was released by TF degradation with proteinase K. DNA from just a single column of each quarter (a single measurement from each) was collected and amplified. The procedure was repeated before HTS. ( b ) 6-mer scores of round 2 frequencies. The frequency scores of two parallel experiments on the same protein demonstrate the high reproducibility of our experimental design.

    Techniques Used: Chromatin Immunoprecipitation, Amplification

    8) Product Images from "Japanese Encephalitis Virus Enters Rat Neuroblastoma Cells via a pH-Dependent, Dynamin and Caveola-Mediated Endocytosis Pathway"

    Article Title: Japanese Encephalitis Virus Enters Rat Neuroblastoma Cells via a pH-Dependent, Dynamin and Caveola-Mediated Endocytosis Pathway

    Journal:

    doi: 10.1128/JVI.00903-12

    Filipin and MβCD inhibit JEV entry into B104 cells. (A and C) B104 cells were pretreated with filipin (A) or MβCD (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell
    Figure Legend Snippet: Filipin and MβCD inhibit JEV entry into B104 cells. (A and C) B104 cells were pretreated with filipin (A) or MβCD (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell

    Techniques Used: Infection

    Clathrin is not required for JEV entry. (A) B104 cells were pretreated with chlorpromazine and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets were plated onto B104 cells to determine
    Figure Legend Snippet: Clathrin is not required for JEV entry. (A) B104 cells were pretreated with chlorpromazine and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets were plated onto B104 cells to determine

    Techniques Used: Infection

    JEV entry is independent of macropinocytosis/phagocytosis. (A and C) B104 cells were pretreated with EIPA (A) or wortmannin (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets
    Figure Legend Snippet: JEV entry is independent of macropinocytosis/phagocytosis. (A and C) B104 cells were pretreated with EIPA (A) or wortmannin (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets

    Techniques Used: Infection

    Kinetics and rate of JEV internalization into B104 cells. (A) B104 cells were infected with JEV at 37°C. At the indicated time points after infection, extracellular virus was inactivated with proteinase K. Results are shown as a percentage of
    Figure Legend Snippet: Kinetics and rate of JEV internalization into B104 cells. (A) B104 cells were infected with JEV at 37°C. At the indicated time points after infection, extracellular virus was inactivated with proteinase K. Results are shown as a percentage of

    Techniques Used: Infection

    JEV entry depends on dynamin II. (A) B104 cells were pretreated with dynasore and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets were plated onto B104 cells to determine internalized
    Figure Legend Snippet: JEV entry depends on dynamin II. (A) B104 cells were pretreated with dynasore and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets were plated onto B104 cells to determine internalized

    Techniques Used: Infection

    Effects of genistein and okadaic acid on JEV entry. (A and C) B104 cells were pretreated with genistein (A) or okadaic acid (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets
    Figure Legend Snippet: Effects of genistein and okadaic acid on JEV entry. (A and C) B104 cells were pretreated with genistein (A) or okadaic acid (C) and infected with JEV. After 1 h of internalization, extracellular virus was inactivated with proteinase K and the cell pellets

    Techniques Used: Infection

    9) Product Images from "Early synaptic dysfunction induced by α-synuclein in a rat model of Parkinson’s disease"

    Article Title: Early synaptic dysfunction induced by α-synuclein in a rat model of Parkinson’s disease

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-06724-9

    Pathological α-synuclein is present in axonal swellings. ( A ) The effect of proteinase K treatment on the hippocampus and striatum from ASYN animals at 4 and 12 weeks post-surgery. Sections were incubated with KPBS (NT; top row) or Proteinase-K in KBPS for 2 hours (2 hrs; bottom row), and then immunostained with an antibody recognizing both human and rat ASYN; inserts display higher magnifications of details framed in the photos. The hippocampus showed abundant endogenous ASYN + signal in the CA3 that disappeared after 2 hours of proteinase K treatment. However, proteinase-K-resistant ASYN + aggregates (arrows) were found in striatum from animals at 4 and 12 weeks. At 4 weeks, the proteinase-K resistant formations appeared as round scattered formations in ASYN animals (arrow in inset). After 12 weeks, we observed thick fibers and rosary-like ASYN + formations, which were resistant to proteinase K digestion (arrows in inset). Scale bar = 60 µm applies to all. ( B ) P-Ser129-ASYN immunostained frontal and caudal striatal sections from ASYN animals 4 weeks (left), and 12 weeks (right) post-surgery. For each section showed in low power (top row) a high power image is presented in the bottom row to reveal details of the immunostaining in the striatum and medial forebrain bundle (MFB). In addition, each inset shows details of the P-Ser129-ASYN + structures shown in the high power photos. While at 4 weeks, single round P-Ser129-ASYN + inclusions were found in thin fibers (arrows and inset) in striatum, at 12 weeks we could find several of those round inclusions per fiber, which appeared as a rosary-like structures (arrows and inset). We also observed immunostaining in the MFB, with some single round inclusions at 4 weeks, that were smaller but more numerous at 12 weeks. Scale bar = 20 µm.
    Figure Legend Snippet: Pathological α-synuclein is present in axonal swellings. ( A ) The effect of proteinase K treatment on the hippocampus and striatum from ASYN animals at 4 and 12 weeks post-surgery. Sections were incubated with KPBS (NT; top row) or Proteinase-K in KBPS for 2 hours (2 hrs; bottom row), and then immunostained with an antibody recognizing both human and rat ASYN; inserts display higher magnifications of details framed in the photos. The hippocampus showed abundant endogenous ASYN + signal in the CA3 that disappeared after 2 hours of proteinase K treatment. However, proteinase-K-resistant ASYN + aggregates (arrows) were found in striatum from animals at 4 and 12 weeks. At 4 weeks, the proteinase-K resistant formations appeared as round scattered formations in ASYN animals (arrow in inset). After 12 weeks, we observed thick fibers and rosary-like ASYN + formations, which were resistant to proteinase K digestion (arrows in inset). Scale bar = 60 µm applies to all. ( B ) P-Ser129-ASYN immunostained frontal and caudal striatal sections from ASYN animals 4 weeks (left), and 12 weeks (right) post-surgery. For each section showed in low power (top row) a high power image is presented in the bottom row to reveal details of the immunostaining in the striatum and medial forebrain bundle (MFB). In addition, each inset shows details of the P-Ser129-ASYN + structures shown in the high power photos. While at 4 weeks, single round P-Ser129-ASYN + inclusions were found in thin fibers (arrows and inset) in striatum, at 12 weeks we could find several of those round inclusions per fiber, which appeared as a rosary-like structures (arrows and inset). We also observed immunostaining in the MFB, with some single round inclusions at 4 weeks, that were smaller but more numerous at 12 weeks. Scale bar = 20 µm.

    Techniques Used: Incubation, Immunostaining

    10) Product Images from "Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2"

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-08743-y

    The ELISA assay of the interaction between TLR2 protein and LipL32 variants. ( A ) The interaction of TLR2 protein and LipL32 truncated variants. The protein concentration of LipL32 and TLR2 protein were 1 µM. BSA and Pam 3 CSK 4  were served as negative and positive controls. WT + PK indicated the LipL32WT pretreated with proteinase K for ELISA assay. ( B ) The interaction of TLR2 protein and LipL32 point mutation variants. ( C ) The dose dependent ELISA of the interaction between LipL32ΔCenα3 variant and TLR2 protein. ○, LipL32WT in the presence of 1 µM Ca 2+ ; ●, LipL32WT in the presence of 1 µM EGTA; ▼, LipL32ΔCenα3 in the presence of 1 µM Ca 2+ ; △, LipL32ΔCenα3 in the presence of 1 µM EGTA. ( D ) The dose dependent ELISA of the interaction between LipL32 point mutation variants and TLR2. ○, D195A variant in the presence of 1 µM Ca 2+ ; ●, D195A variant in the presence of 1 µM EGTA; ▼, D196A variant in the presence of 1 µM Ca 2+ ; Δ, D196A in the presence of 1 µM EGTA. *p 
    Figure Legend Snippet: The ELISA assay of the interaction between TLR2 protein and LipL32 variants. ( A ) The interaction of TLR2 protein and LipL32 truncated variants. The protein concentration of LipL32 and TLR2 protein were 1 µM. BSA and Pam 3 CSK 4 were served as negative and positive controls. WT + PK indicated the LipL32WT pretreated with proteinase K for ELISA assay. ( B ) The interaction of TLR2 protein and LipL32 point mutation variants. ( C ) The dose dependent ELISA of the interaction between LipL32ΔCenα3 variant and TLR2 protein. ○, LipL32WT in the presence of 1 µM Ca 2+ ; ●, LipL32WT in the presence of 1 µM EGTA; ▼, LipL32ΔCenα3 in the presence of 1 µM Ca 2+ ; △, LipL32ΔCenα3 in the presence of 1 µM EGTA. ( D ) The dose dependent ELISA of the interaction between LipL32 point mutation variants and TLR2. ○, D195A variant in the presence of 1 µM Ca 2+ ; ●, D195A variant in the presence of 1 µM EGTA; ▼, D196A variant in the presence of 1 µM Ca 2+ ; Δ, D196A in the presence of 1 µM EGTA. *p 

    Techniques Used: Enzyme-linked Immunosorbent Assay, Protein Concentration, Mutagenesis, Variant Assay

    Co-localization of LipL32 and TLR2. The confocal microscopy was used to observe the co-localization of LipL32 and TLR2 on HEK293-TLR2 cell. The purified LipL32 variants were incubated with HEK293-TLR2 cell as described in Materials and Methods and observed by confocal microscopy. TLR2 was stained by Alexa488 (green) and LipL32 was stained by Alexa594 (red). The yellow color indicated that the two proteins were co-localized on HEK293-TLR2 cell. ( A ) HEK293 cell incubated with LipL32WT. ( B ) HEK293-TLR2 cell incubated with LipL32WT. ( C ) HEK293-TLR2 cell incubated with LipL32WT treated with proteinase K (PK). ( D ) HEK293-TLR2 cell incubated with LipL32ΔCenα3. ( E ) HEK293-TLR2 cell incubated with LipL32ΔCα4. ( F ) HEK293-TLR2 cell incubated with LipL32ΔNβ1β2. ( G ) Statistic analysis of the co-localization of the LipL32 and TLR2 on HEK293-TLR2 cell. Pearson’s correlation was used to calculate the overlap between image pairs. All conditions are repeated at least three independent experiments. Scale bar, 7.5 μm; **p 
    Figure Legend Snippet: Co-localization of LipL32 and TLR2. The confocal microscopy was used to observe the co-localization of LipL32 and TLR2 on HEK293-TLR2 cell. The purified LipL32 variants were incubated with HEK293-TLR2 cell as described in Materials and Methods and observed by confocal microscopy. TLR2 was stained by Alexa488 (green) and LipL32 was stained by Alexa594 (red). The yellow color indicated that the two proteins were co-localized on HEK293-TLR2 cell. ( A ) HEK293 cell incubated with LipL32WT. ( B ) HEK293-TLR2 cell incubated with LipL32WT. ( C ) HEK293-TLR2 cell incubated with LipL32WT treated with proteinase K (PK). ( D ) HEK293-TLR2 cell incubated with LipL32ΔCenα3. ( E ) HEK293-TLR2 cell incubated with LipL32ΔCα4. ( F ) HEK293-TLR2 cell incubated with LipL32ΔNβ1β2. ( G ) Statistic analysis of the co-localization of the LipL32 and TLR2 on HEK293-TLR2 cell. Pearson’s correlation was used to calculate the overlap between image pairs. All conditions are repeated at least three independent experiments. Scale bar, 7.5 μm; **p 

    Techniques Used: Confocal Microscopy, Purification, Incubation, Staining

    11) Product Images from "Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi"

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-10-277

    FACS plots of OspA:mRFP1 mutant populations . Both pOSK4 (pRJS1009-based) and pOSK3 (pRJS1016-based)  B. burgdorferi  libraries were assayed. The two panels to the left indicate the gating used. Forward scatter (FSC) is plotted against side scatter (SSC). The percentage of events, i.e. cells inside the gated population (shaded rectangles) is indicated. The four panels to the right show the distribution of presorted, i.e. OspA:mRFP1-expressing fluorescent cells upon treatment with proteinase K. Mock treated cells were incubated in buffer only. Fluorescence measured via a Texas Red filter is plotted against number of events, i.e. cells. The vertical line indicates the cut-off fluorescence for sorting. The percentage of events within the fluorescent population is indicated.
    Figure Legend Snippet: FACS plots of OspA:mRFP1 mutant populations . Both pOSK4 (pRJS1009-based) and pOSK3 (pRJS1016-based) B. burgdorferi libraries were assayed. The two panels to the left indicate the gating used. Forward scatter (FSC) is plotted against side scatter (SSC). The percentage of events, i.e. cells inside the gated population (shaded rectangles) is indicated. The four panels to the right show the distribution of presorted, i.e. OspA:mRFP1-expressing fluorescent cells upon treatment with proteinase K. Mock treated cells were incubated in buffer only. Fluorescence measured via a Texas Red filter is plotted against number of events, i.e. cells. The vertical line indicates the cut-off fluorescence for sorting. The percentage of events within the fluorescent population is indicated.

    Techniques Used: FACS, Mutagenesis, Expressing, Incubation, Fluorescence

    Screening strategy for subsurface OspA:mRFP1 fusions . A random mutagenesis oligo was synthesized to change mRFP1 codons E4 and D5 in OspA20:mRFP1 to any amino acid, with a bias against stop codons (except for amber UAG, see text). The oligo was converted to a double-stranded linker and ligated with a shuttle vector carrying the 5' and 3' portions of the OspA20:mRFP1 fusion gene. The resulting library was amplified in  E. coli  and used to transform  B. burgdorferi . A presorted population of red fluorescent spirochetes was incubated with proteinase K, washed, and sorted again for red fluorescence. Clones grown from individual colonies were grown in 96-well plates and subjected to a confirmatory  in situ  proteolysis assay. PCR and DNA sequence analysis revealed the mutant genotypes. Numbered arrows indicate specific oligonucleotides used (Table 1). For details, see the Materials and Methods section.
    Figure Legend Snippet: Screening strategy for subsurface OspA:mRFP1 fusions . A random mutagenesis oligo was synthesized to change mRFP1 codons E4 and D5 in OspA20:mRFP1 to any amino acid, with a bias against stop codons (except for amber UAG, see text). The oligo was converted to a double-stranded linker and ligated with a shuttle vector carrying the 5' and 3' portions of the OspA20:mRFP1 fusion gene. The resulting library was amplified in E. coli and used to transform B. burgdorferi . A presorted population of red fluorescent spirochetes was incubated with proteinase K, washed, and sorted again for red fluorescence. Clones grown from individual colonies were grown in 96-well plates and subjected to a confirmatory in situ proteolysis assay. PCR and DNA sequence analysis revealed the mutant genotypes. Numbered arrows indicate specific oligonucleotides used (Table 1). For details, see the Materials and Methods section.

    Techniques Used: Mutagenesis, Synthesized, Plasmid Preparation, Amplification, Incubation, Fluorescence, Clone Assay, In Situ, Proteolysis Assay, Polymerase Chain Reaction, Sequencing

    Phenotypical analysis of select OspA:mRFP1 fusion mutants . Representative Western blots of select mutants are shown (see Additional File   2 -Figures S1 and S2 for full data set). Mutant-specific amino acid sequences are listed in single letter code above the blots. OspA28:mRFP1 and OspA20:mRFP1 (ED) were included as controls. (A) Protein expression and protease accessibility. Whole cell lysates of  B. burgdorferi  expressing mutant OspA:mRFP1 fusions from an identical P flaB  promoter (Figure 1) were obtained before (-) or after (+)  in situ  treatment with proteinase K (pK). A polyclonal antiserum against mRFP1 was used to detect the OspA:mRFP1 fusions. Constitutively expressed periplasmic FlaB was used as a control for loading (to normalize signals within samples) as well as for subsurface localization (negative control). OspA served as a surface control. Untreated (-pK) samples were used to assess protein expression/ in vivo  stability of OspA:mRFP1 fusions. (B) Distribution of proteins to inner or outer membranes. Protoplasmic cylinder (PC) and outer membrane vesicle (OM) fractions from  B. burgdorferi  expressing mutant OspA:mRFP1 fusions were probed with a polyclonal antiserum against mRFP1 to detect the OspA:mRFP1 fusions. IM-localized lipoprotein OppAIV was used as a PC-specific control. Surface lipoprotein OspA was used as an outer membrane control. Note that the PC fraction also contains intact cells, i.e. also contains OM proteins.
    Figure Legend Snippet: Phenotypical analysis of select OspA:mRFP1 fusion mutants . Representative Western blots of select mutants are shown (see Additional File 2 -Figures S1 and S2 for full data set). Mutant-specific amino acid sequences are listed in single letter code above the blots. OspA28:mRFP1 and OspA20:mRFP1 (ED) were included as controls. (A) Protein expression and protease accessibility. Whole cell lysates of B. burgdorferi expressing mutant OspA:mRFP1 fusions from an identical P flaB promoter (Figure 1) were obtained before (-) or after (+) in situ treatment with proteinase K (pK). A polyclonal antiserum against mRFP1 was used to detect the OspA:mRFP1 fusions. Constitutively expressed periplasmic FlaB was used as a control for loading (to normalize signals within samples) as well as for subsurface localization (negative control). OspA served as a surface control. Untreated (-pK) samples were used to assess protein expression/ in vivo stability of OspA:mRFP1 fusions. (B) Distribution of proteins to inner or outer membranes. Protoplasmic cylinder (PC) and outer membrane vesicle (OM) fractions from B. burgdorferi expressing mutant OspA:mRFP1 fusions were probed with a polyclonal antiserum against mRFP1 to detect the OspA:mRFP1 fusions. IM-localized lipoprotein OppAIV was used as a PC-specific control. Surface lipoprotein OspA was used as an outer membrane control. Note that the PC fraction also contains intact cells, i.e. also contains OM proteins.

    Techniques Used: Western Blot, Mutagenesis, Expressing, In Situ, Negative Control, In Vivo

    12) Product Images from "Ubiquitination of serine, threonine, or lysine residues on the cytoplasmic tail can induce ERAD of MHC-I by viral E3 ligase mK3"

    Article Title: Ubiquitination of serine, threonine, or lysine residues on the cytoplasmic tail can induce ERAD of MHC-I by viral E3 ligase mK3

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200611063

    Ubiquitination and degradation of Ub/L d  fusion proteins in the presence of mK3.  (A) After incubation for 24 h with 125 U/ml IFN-γ, WT3 cells expressing Ub wt/L d  K-less or Ub K-less/L d  K-less (±mK3) were pulse labeled with [ 35 S]Cys/Met for 15 min and chased for the indicated times. Ub/L d  fusion molecules were precipitated by anti-L d  mAbs. Precipitates then were resolved by SDS-PAGE and visualized by autoradiography (left). Relative band intensities from these gels were plotted as a percentage of the intensity at time zero for each line (right). (B) Cells used in A were Dounce homogenized. The homogenate was then subjected to serial centrifugations from 1,000 to 100,000  g . After digestion (or mock digestion) with 10 μg/ml proteinase K for 20 min on ice, Ub/L d  molecules were precipitated from NP-40 lysates of 100,000  g  pellet (P) or supernatant (S) and analyzed by immunoblotting using anti-Ub mAb or rabbit anti-L d  cytoplasmic tail (cyt tail) antibodies. Polyubiquitinated forms are indicated by asterisks.
    Figure Legend Snippet: Ubiquitination and degradation of Ub/L d fusion proteins in the presence of mK3. (A) After incubation for 24 h with 125 U/ml IFN-γ, WT3 cells expressing Ub wt/L d K-less or Ub K-less/L d K-less (±mK3) were pulse labeled with [ 35 S]Cys/Met for 15 min and chased for the indicated times. Ub/L d fusion molecules were precipitated by anti-L d mAbs. Precipitates then were resolved by SDS-PAGE and visualized by autoradiography (left). Relative band intensities from these gels were plotted as a percentage of the intensity at time zero for each line (right). (B) Cells used in A were Dounce homogenized. The homogenate was then subjected to serial centrifugations from 1,000 to 100,000 g . After digestion (or mock digestion) with 10 μg/ml proteinase K for 20 min on ice, Ub/L d molecules were precipitated from NP-40 lysates of 100,000 g pellet (P) or supernatant (S) and analyzed by immunoblotting using anti-Ub mAb or rabbit anti-L d cytoplasmic tail (cyt tail) antibodies. Polyubiquitinated forms are indicated by asterisks.

    Techniques Used: Incubation, Expressing, Labeling, SDS Page, Autoradiography

    13) Product Images from "Upregulated LINE-1 Activity in the Fanconi Anemia Cancer Susceptibility Syndrome Leads to Spontaneous Pro-inflammatory Cytokine Production"

    Article Title: Upregulated LINE-1 Activity in the Fanconi Anemia Cancer Susceptibility Syndrome Leads to Spontaneous Pro-inflammatory Cytokine Production

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2016.05.005

    Cytoplasmic accumulation of ssDNA is responsible for pro-inflammatory signals in SLX4 deficiency. (A) Immunofluorescence analysis was performed on RA3331, RA3331 SLX4  and RA3331 SLX4ΔSAP  using ssDNA-specific antibody and DAPI nuclear staining. Images are representative of at least 4 independent experiments. (B) Quantification of staining observed in A. (C) Left panel: experimental scheme. Briefly, cytoplasmic extraction was performed on RA3331, RA3331 SLX4  and RA3331 SLX4ΔSAP  followed by RNase cocktail (RNase A and RNase T1) and proteinase K treatments prior to DNA extraction and radiolabeling. DNA extracted from RA3331 cells was subjected or not to a subsequent S1 Nuclease treatment prior to separation on acrylamide gel and autoradiography. Right panel: autoradiography of a representative experiment. (D) WCE from RA3331 expressing  Luciferase- ,  MYD88- , or  STING -targeting inducible shRNAs were analyzed by WB using indicated antibodies. (E) Graphs present RT-qPCR quantification of knock-down efficiency, measured using specific primers, as mean (± SD) mRNA expression relative to cells expressing  Luciferase -targeting shRNA from 3 independent experiments. (F) MxA, RIG-I, TLR4 and TLR2 mRNA levels were measured in cells described in D. Graphs present means (± SD) of 3 independent experiments as fold increase mRNA expression relative to cells expressing a  Luciferase  targeting shRNA. (G) WCE from RA3331 expressing  Luciferase ,  STING ,  cGAS  or  IFI16 -targeting inducible shRNAs were analyzed by WB using indicated antibodies. (H) MxA, STING, cGAS and IFI16 mRNA levels were measured in cells described in G. Graphs present means (± SD) of 3 independent experiments expressed as fold change in mRNA expression relative to cells expressing a  Luciferase  targeting shRNA. ****:  p
    Figure Legend Snippet: Cytoplasmic accumulation of ssDNA is responsible for pro-inflammatory signals in SLX4 deficiency. (A) Immunofluorescence analysis was performed on RA3331, RA3331 SLX4 and RA3331 SLX4ΔSAP using ssDNA-specific antibody and DAPI nuclear staining. Images are representative of at least 4 independent experiments. (B) Quantification of staining observed in A. (C) Left panel: experimental scheme. Briefly, cytoplasmic extraction was performed on RA3331, RA3331 SLX4 and RA3331 SLX4ΔSAP followed by RNase cocktail (RNase A and RNase T1) and proteinase K treatments prior to DNA extraction and radiolabeling. DNA extracted from RA3331 cells was subjected or not to a subsequent S1 Nuclease treatment prior to separation on acrylamide gel and autoradiography. Right panel: autoradiography of a representative experiment. (D) WCE from RA3331 expressing Luciferase- , MYD88- , or STING -targeting inducible shRNAs were analyzed by WB using indicated antibodies. (E) Graphs present RT-qPCR quantification of knock-down efficiency, measured using specific primers, as mean (± SD) mRNA expression relative to cells expressing Luciferase -targeting shRNA from 3 independent experiments. (F) MxA, RIG-I, TLR4 and TLR2 mRNA levels were measured in cells described in D. Graphs present means (± SD) of 3 independent experiments as fold increase mRNA expression relative to cells expressing a Luciferase targeting shRNA. (G) WCE from RA3331 expressing Luciferase , STING , cGAS or IFI16 -targeting inducible shRNAs were analyzed by WB using indicated antibodies. (H) MxA, STING, cGAS and IFI16 mRNA levels were measured in cells described in G. Graphs present means (± SD) of 3 independent experiments expressed as fold change in mRNA expression relative to cells expressing a Luciferase targeting shRNA. ****: p

    Techniques Used: Immunofluorescence, Staining, DNA Extraction, Radioactivity, Acrylamide Gel Assay, Autoradiography, Expressing, Luciferase, Western Blot, Quantitative RT-PCR, shRNA

    14) Product Images from "Guiding the morphogenesis of dissociated newborn mouse retinal cells and hES cell-derived retinal cells by soft lithography-patterned microchannel PLGA scaffolds"

    Article Title: Guiding the morphogenesis of dissociated newborn mouse retinal cells and hES cell-derived retinal cells by soft lithography-patterned microchannel PLGA scaffolds

    Journal:

    doi: 10.1016/j.biomaterials.2011.10.083

    Dissociated neonatal Nrl-GFP mouse retinal neurons cultured in scaffolds layered on retinal pigment epithelium (RPE) explants. (A) Following treatment with proteinase K, the sclera is removed from the RPE/choroid and the RPE/choroid sheet is flat-mounted
    Figure Legend Snippet: Dissociated neonatal Nrl-GFP mouse retinal neurons cultured in scaffolds layered on retinal pigment epithelium (RPE) explants. (A) Following treatment with proteinase K, the sclera is removed from the RPE/choroid and the RPE/choroid sheet is flat-mounted

    Techniques Used: Cell Culture

    15) Product Images from "Allosteric Interactions by p53 mRNA Govern HDM2 E3 Ubiquitin Ligase Specificity under Different Conditions"

    Article Title: Allosteric Interactions by p53 mRNA Govern HDM2 E3 Ubiquitin Ligase Specificity under Different Conditions

    Journal:

    doi: 10.1128/MCB.00113-16

    HDM2 conformational rearrangement promoted by phosphomimetic mutant HDM2(S395D). (a) Cartoon illustrating major domains of HDM2. p53 BD, the p53 binding domain; NLS, nuclear localization signal; NES, nuclear export signal; Ac, acidic domain; Zn, zinc finger; RING, really interesting new gene domain. The predicted intrinsically disordered regions of HDM2 are shown in the lower panel. Serine 395 is indicated in red and is located at the end of a disordered region. (b) Recombinant purified HDM2 and HDM2(S395D). MW, molecular weights in thousands. (c) Far-UV CD spectra of the HDM2 and phosphomimetic mutant HDM2(S395D). (d) Near-UV CD spectra of the HDM2 and phosphomimetic mutant HDM2(S395D). (e) The intrinsic fluorescence emission spectra of HDM2 and phosphomimetic mutant HDM2(S395D). The spectral center of mass (SCM) at excitation (Ex) wavelengths of 280 and 295 nm were calculated. All spectra shown were obtained after subtracting the blank (no enzyme) from the experimental values. (f) Limited proteolysis of HDM2 and the phosphomimetic mutant S395D by proteinase K. Asterisks represent the main differences between the wild type and the mutant, showing that HDM2(S395D) is less susceptible to proteinase K. One representative experiment of 3 is shown.
    Figure Legend Snippet: HDM2 conformational rearrangement promoted by phosphomimetic mutant HDM2(S395D). (a) Cartoon illustrating major domains of HDM2. p53 BD, the p53 binding domain; NLS, nuclear localization signal; NES, nuclear export signal; Ac, acidic domain; Zn, zinc finger; RING, really interesting new gene domain. The predicted intrinsically disordered regions of HDM2 are shown in the lower panel. Serine 395 is indicated in red and is located at the end of a disordered region. (b) Recombinant purified HDM2 and HDM2(S395D). MW, molecular weights in thousands. (c) Far-UV CD spectra of the HDM2 and phosphomimetic mutant HDM2(S395D). (d) Near-UV CD spectra of the HDM2 and phosphomimetic mutant HDM2(S395D). (e) The intrinsic fluorescence emission spectra of HDM2 and phosphomimetic mutant HDM2(S395D). The spectral center of mass (SCM) at excitation (Ex) wavelengths of 280 and 295 nm were calculated. All spectra shown were obtained after subtracting the blank (no enzyme) from the experimental values. (f) Limited proteolysis of HDM2 and the phosphomimetic mutant S395D by proteinase K. Asterisks represent the main differences between the wild type and the mutant, showing that HDM2(S395D) is less susceptible to proteinase K. One representative experiment of 3 is shown.

    Techniques Used: Mutagenesis, Binding Assay, Recombinant, Purification, Fluorescence

    16) Product Images from "Chikungunya virus infectivity, RNA replication and non-structural polyprotein processing depend on the nsP2 protease’s active site cysteine residue"

    Article Title: Chikungunya virus infectivity, RNA replication and non-structural polyprotein processing depend on the nsP2 protease’s active site cysteine residue

    Journal: Scientific Reports

    doi: 10.1038/srep37124

    Processing of different substrates by CHIKV nsP2. ( a ) Processing of recombinant protein substrates. Reaction mixtures were incubated for 60 min and reaction products were resolved using 12% SDS-PAGE. Substrates contained either short (10:5) peptides originating from 1/2, 2/3 and 3/4 sites (left side of the panel) or a longer (10:170) region representing 2/3 site and macro domain of nsP3 (right side of the panel). Enzymes used to perform cleavage are shown above the panel. ( b ) Processing of Short peptide substrate. The concentration of nsP2 was kept constant (78 nM) while concentration of the substrate ranged from 1 to 50 μM (shown above graphs); in the control reaction 15 μM of substrate was incubated without the enzyme. The fluorescence resulting from cleavage is shown as the function of time. ( c ) Processing of Long peptide substrate. The experiment was performed as in panel b. ( d ) Enzyme kinetic constant K m  was derived by plotting the initial reaction velocity on vertical axis against increasing Long peptide substrate concentration (0.5, 1, 2, 5, 10, 15, 30, 50 μM) on horizontal axis. Inset: representative plot of EDANS fluorescence generated by treating increasing concentrations of Long peptide substrate with proteinase K (50 μg per reaction). ( e ) Processing kinetics of wt nsP2 revealed using recombinant protein based substrates. Wt nsP2 was mixed with substrates corresponding to 1/2 (left panel) and 3/4 (right panel) sites using molar ratio 1:100. Reactions were carried out at 30 °C; aliquots were collected at 0 (before adding enzyme), 1, 3, 6, 15, 30, 60 and 90 min, and analysed using 10% SDS-PAGE. ImageJ program (NIH, USA) was used to quantify substrate band intensities. The values were further analysed using MS Excel software and expressed as pmol of processed substrate per pmol of nsP2 as indicated at the bottom of the figure. All experiments were repeated at least twice; data from one of reproducible experiment is shown.
    Figure Legend Snippet: Processing of different substrates by CHIKV nsP2. ( a ) Processing of recombinant protein substrates. Reaction mixtures were incubated for 60 min and reaction products were resolved using 12% SDS-PAGE. Substrates contained either short (10:5) peptides originating from 1/2, 2/3 and 3/4 sites (left side of the panel) or a longer (10:170) region representing 2/3 site and macro domain of nsP3 (right side of the panel). Enzymes used to perform cleavage are shown above the panel. ( b ) Processing of Short peptide substrate. The concentration of nsP2 was kept constant (78 nM) while concentration of the substrate ranged from 1 to 50 μM (shown above graphs); in the control reaction 15 μM of substrate was incubated without the enzyme. The fluorescence resulting from cleavage is shown as the function of time. ( c ) Processing of Long peptide substrate. The experiment was performed as in panel b. ( d ) Enzyme kinetic constant K m was derived by plotting the initial reaction velocity on vertical axis against increasing Long peptide substrate concentration (0.5, 1, 2, 5, 10, 15, 30, 50 μM) on horizontal axis. Inset: representative plot of EDANS fluorescence generated by treating increasing concentrations of Long peptide substrate with proteinase K (50 μg per reaction). ( e ) Processing kinetics of wt nsP2 revealed using recombinant protein based substrates. Wt nsP2 was mixed with substrates corresponding to 1/2 (left panel) and 3/4 (right panel) sites using molar ratio 1:100. Reactions were carried out at 30 °C; aliquots were collected at 0 (before adding enzyme), 1, 3, 6, 15, 30, 60 and 90 min, and analysed using 10% SDS-PAGE. ImageJ program (NIH, USA) was used to quantify substrate band intensities. The values were further analysed using MS Excel software and expressed as pmol of processed substrate per pmol of nsP2 as indicated at the bottom of the figure. All experiments were repeated at least twice; data from one of reproducible experiment is shown.

    Techniques Used: Recombinant, Incubation, SDS Page, Concentration Assay, Fluorescence, Derivative Assay, Generated, Mass Spectrometry, Software

    17) Product Images from "Membrane-anchoring stabilizes and favors secretion of New Delhi Metallo-β-lactamase"

    Article Title: Membrane-anchoring stabilizes and favors secretion of New Delhi Metallo-β-lactamase

    Journal: Nature chemical biology

    doi: 10.1038/nchembio.2083

    Membrane-anchoring protects NDM-1 from degradation upon Zn(II) deprivation ( a ) Relative MICs of cefotaxime for  E. coli  cells expressing wild type or mutant variants of NDM-1 in growth medium supplemented with different concentrations of the metal chelator DPA. Data correspond to three independent experiments, with standard errors ≤16% of each data point. ( b ) MBL levels in periplasmic (solid lines) or membrane (dashed lines) fractions as a function of time after addition of 1000 μM DPA, relative to levels in untreated control samples grown in the same conditions. Data correspond to three independent experiments and are shown as mean ± s.e.m. ( c ) Comparison between whole cell imipenem hydrolysis rates and periplasmic MBL levels after 90-minute incubation with 1000 μM DPA. Values are relative to untreated control samples grown in the same conditions, and protein levels correspond to those of Fig. 3b. The same data was determined for membrane bound variants after 960 minutes. Data correspond to three independent experiments are shown as mean ± s.e.m. Equal amounts of total protein were loaded on gels for each sample. ( d ) Limited proteolysis of purified recombinant NDM-1 (a soluble variant lacking the lipobox sequence), in its Zn(II)-bound or apo form. Aliquots were taken at various time intervals after addition of 2.5 μg proteinase K to solutions of 200 μg protein, and analyzed by SDS-PAGE. Original gel is displayed in  Supplementary Figure 11 .
    Figure Legend Snippet: Membrane-anchoring protects NDM-1 from degradation upon Zn(II) deprivation ( a ) Relative MICs of cefotaxime for E. coli cells expressing wild type or mutant variants of NDM-1 in growth medium supplemented with different concentrations of the metal chelator DPA. Data correspond to three independent experiments, with standard errors ≤16% of each data point. ( b ) MBL levels in periplasmic (solid lines) or membrane (dashed lines) fractions as a function of time after addition of 1000 μM DPA, relative to levels in untreated control samples grown in the same conditions. Data correspond to three independent experiments and are shown as mean ± s.e.m. ( c ) Comparison between whole cell imipenem hydrolysis rates and periplasmic MBL levels after 90-minute incubation with 1000 μM DPA. Values are relative to untreated control samples grown in the same conditions, and protein levels correspond to those of Fig. 3b. The same data was determined for membrane bound variants after 960 minutes. Data correspond to three independent experiments are shown as mean ± s.e.m. Equal amounts of total protein were loaded on gels for each sample. ( d ) Limited proteolysis of purified recombinant NDM-1 (a soluble variant lacking the lipobox sequence), in its Zn(II)-bound or apo form. Aliquots were taken at various time intervals after addition of 2.5 μg proteinase K to solutions of 200 μg protein, and analyzed by SDS-PAGE. Original gel is displayed in Supplementary Figure 11 .

    Techniques Used: Expressing, Mutagenesis, Incubation, Purification, Recombinant, Variant Assay, Sequencing, SDS Page

    Membrane-anchoring favors secretion of NDM-1 into outer membrane vesicles (OMVs) ( a ) Negative stain TEM of OMVs from  E. coli  cells expressing NDM- 1. ( b ) MBL levels in whole cells expressing NDM-1, NDM-1 C26A or N-VIM and OMVs purified from their cell culture supernatants. Gel lanes were loaded with equal amounts of total protein. ( c ) Western blot of intact (–) and lysed OMVs (+, treated with 0.1 % Triton X-100) upon treatment with 100 μg/mL proteinase K. ( d ) Imipenem hydrolysis by OMVs purified from  E. coli  cells expressing NDM-1, NDM-1 C26A and N-VIM. Data correspond to three independent experiments and are shown as mean ± s.e.m. ( e ) Effect of calprotectin on the imipenemase activity of OMVs (0.8 μg) containing NDM-1 or NDM-1 C26A, compared to recombinant NDM-1 (6 nM). Data correspond to mean values from two independent experiments. ( f ) Effect of calprotectin on NDM-1 levels in OMVs. NDM-1 OMVs were incubated for 20 minutes at 37ºC in 10 mM HEPES, 200 mM NaCl at pH 7.4 with or without addition of calprotectin 500 μg/mL. Top, relative imipenem hydrolysis rates of OMVs; bottom, Western blot showing NDM-1 levels in OMVs. Data correspond to mean values from two independent experiments. Original Western Blots for panels ( b ), ( c ) and ( f ) are displayed in  Supplementary Figure 11 .
    Figure Legend Snippet: Membrane-anchoring favors secretion of NDM-1 into outer membrane vesicles (OMVs) ( a ) Negative stain TEM of OMVs from E. coli cells expressing NDM- 1. ( b ) MBL levels in whole cells expressing NDM-1, NDM-1 C26A or N-VIM and OMVs purified from their cell culture supernatants. Gel lanes were loaded with equal amounts of total protein. ( c ) Western blot of intact (–) and lysed OMVs (+, treated with 0.1 % Triton X-100) upon treatment with 100 μg/mL proteinase K. ( d ) Imipenem hydrolysis by OMVs purified from E. coli cells expressing NDM-1, NDM-1 C26A and N-VIM. Data correspond to three independent experiments and are shown as mean ± s.e.m. ( e ) Effect of calprotectin on the imipenemase activity of OMVs (0.8 μg) containing NDM-1 or NDM-1 C26A, compared to recombinant NDM-1 (6 nM). Data correspond to mean values from two independent experiments. ( f ) Effect of calprotectin on NDM-1 levels in OMVs. NDM-1 OMVs were incubated for 20 minutes at 37ºC in 10 mM HEPES, 200 mM NaCl at pH 7.4 with or without addition of calprotectin 500 μg/mL. Top, relative imipenem hydrolysis rates of OMVs; bottom, Western blot showing NDM-1 levels in OMVs. Data correspond to mean values from two independent experiments. Original Western Blots for panels ( b ), ( c ) and ( f ) are displayed in Supplementary Figure 11 .

    Techniques Used: Staining, Transmission Electron Microscopy, Expressing, Purification, Cell Culture, Western Blot, Activity Assay, Recombinant, Incubation

    18) Product Images from "Deconjugated Bile Salts Produced by Extracellular Bile-Salt Hydrolase-Like Activities from the Probiotic Lactobacillus johnsonii La1 Inhibit Giardia duodenalis In vitro Growth"

    Article Title: Deconjugated Bile Salts Produced by Extracellular Bile-Salt Hydrolase-Like Activities from the Probiotic Lactobacillus johnsonii La1 Inhibit Giardia duodenalis In vitro Growth

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2016.01453

    G. duodenalis  growth inhibition by  L. johnsonii  La1 supernatant is affected by supernatant incubation with proteases, heat-treatment and pH. (A)  Supernatant of  L. johnsonii  La1 was incubated for 6 h with 1 mg of immobilized proteases ( L. johnsonii  La1 supernatant: no protease treatment;  L. johnsonii  La1 supernatant + PK: treatment with proteinase K;  L. johnsonii  La1 supernatant + Pronase: treatment with pronase;  L. johnsonii  La1 supernatant + Catalase: treatment with catalase) or heated at 90°C for 10 min before  G. duodenalis  growth inhibition assay. Growth inhibition (%) was normalized according to matched control: lactic acid-adjusted MTYI medium incubated with protease-coupled beads or treated for 10 min at 90°C.  (B)  Supernatant from  L. johnsonii  La1 in MTYI medium was adjusted to pH 6.2, 6.7, 6.9, or 7.2 before  Giardia  growth inhibition assays. Growth inhibition (%) was normalized according to control, i.e., lactic acid-adjusted MTYI subsequently raised to pH 6.2, 6.7, 6.9, or 7.2. Values are the mean ± SD of three independent experiments.  (C)  Molecular weight determination of inhibitory compounds from  L. johnsonii  La1 supernatant. Supernatant from a culture of  L. johnsonii  La1 in KM-FCS was filtrated through 10, 30, or 50 kDa MW cut-off membranes. Acidified KM-FCS alone was processed similarly. Fractions above and under respective thresholds were assayed for  Giardia  growth inhibition in the presence of bile (0.5 g/L). Inhibition values (%) were normalized according to KM-FCS controls. Data are the mean ± SD of three independent experiments performed in triplicate. Letters indicate significant differences between treatments (Kruskal-Wallis,  p
    Figure Legend Snippet: G. duodenalis growth inhibition by L. johnsonii La1 supernatant is affected by supernatant incubation with proteases, heat-treatment and pH. (A) Supernatant of L. johnsonii La1 was incubated for 6 h with 1 mg of immobilized proteases ( L. johnsonii La1 supernatant: no protease treatment; L. johnsonii La1 supernatant + PK: treatment with proteinase K; L. johnsonii La1 supernatant + Pronase: treatment with pronase; L. johnsonii La1 supernatant + Catalase: treatment with catalase) or heated at 90°C for 10 min before G. duodenalis growth inhibition assay. Growth inhibition (%) was normalized according to matched control: lactic acid-adjusted MTYI medium incubated with protease-coupled beads or treated for 10 min at 90°C. (B) Supernatant from L. johnsonii La1 in MTYI medium was adjusted to pH 6.2, 6.7, 6.9, or 7.2 before Giardia growth inhibition assays. Growth inhibition (%) was normalized according to control, i.e., lactic acid-adjusted MTYI subsequently raised to pH 6.2, 6.7, 6.9, or 7.2. Values are the mean ± SD of three independent experiments. (C) Molecular weight determination of inhibitory compounds from L. johnsonii La1 supernatant. Supernatant from a culture of L. johnsonii La1 in KM-FCS was filtrated through 10, 30, or 50 kDa MW cut-off membranes. Acidified KM-FCS alone was processed similarly. Fractions above and under respective thresholds were assayed for Giardia growth inhibition in the presence of bile (0.5 g/L). Inhibition values (%) were normalized according to KM-FCS controls. Data are the mean ± SD of three independent experiments performed in triplicate. Letters indicate significant differences between treatments (Kruskal-Wallis, p

    Techniques Used: Inhibition, Incubation, Growth Inhibition Assay, Molecular Weight

    19) Product Images from "Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models"

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.00262

    Staphylococcus aureus  MVs promote bacterial survival in human whole blood and in the presence of neutrophils  ex vivo  and  in vivo .  (A)  Survival of  S. aureus  MSSA476 in blood is increased in the presence of 20 μg MV (0.1 μg/μl) isolated from MSSA476 grown in LB and BHI [marked as LB (MVs) or BHI (MVs) in the figure] compared to absence of MVs (marked as control in the figure). The number of inoculated bacteria at time point 0 was set to 100% and the number of surviving bacteria after 3 h is represented as the percentage of inoculation.  (B) S. aureus  MSSA476 survival in blood is increased in the presence of MVs, in a dose-dependent manner (5–20 μg of total MVs, i.e., 0.025–0.1 μg/μl). The number of surviving bacteria after 3 h in the absence of MVs was arbitrary set as 1, and the number of surviving bacteria in the presence of MVs is represented as the fold change compared to bacteria in the absence of MV.  (C)  Survival of USA300 MRSA in human blood is increased in the presence of MVs isolated from USA300 (MV-Hla) and USA300ΔHla (MV-ΔHla) grown in BHI. The percentage of survival was calculated as described in  (A) .  (D)  Sonication of purified MVs followed by proteinase K (PK) treatment abolished the effect of MVs on bacterial survival in human whole blood. The fold change of survival was calculated as described in  (B) .  (E)  Survival of opsonized  S. aureus  MSSA476 in the presence of neutrophils is enhanced by supplementation of MVs isolated from bacteria growing in LB and BHI. Percentage of survival was calculated as described in  (A) .  (F) S. aureus  MSSA476 were labeled with FITC and incubated with human whole blood in the absence or presence of MVs isolated from MSSA476 grown in LB and BHI. Data represents geometric mean of the fluorescence intensity (GMFI).  (G)  Bacterial loads in the blood (CFU/ml) of 8-week-old C57BL/6 mice were counted 24 h after the mice were intravenously infected with  S. aureus  MSSA476 supplemented with PBS or an exogenous source of MVs isolated from MSSA476 grown in BHI.  (H)  HaCaT (100 μg of total MVs, i.e., 0.1 μg/μl) and freshly purified neutrophils were treated with MVs (5–20 μg of total MVs, i.e., 0.025–0.1 μg/μl) isolated from  S. aureus  MSSA476 grown in LB or BHI at the time points indicated. Percentage of cytotoxicity was calculated by measuring the amount of LDH released from the cytosol of damaged cells into the supernatant after exposure to MVs.  (I)  Viability staining of neutrophils in the presence (20 μg of total MVs, i.e., 0.1 μg/μl) or absence of MVs were performed using propidium iodide (PI). Live imaging was performed after 0 and 0.45 or 1.5 h using fluorescence microscopy. Scale bar is shown. The data represent as the mean ± SEM of at least three independent experiments except for  (D) , which the data are expressed as the mean ± SEM of two independent experiments performed in triplicate. Mice study corresponds to one experiment performed with 10 mice/group. The significance is indicated by asterisks ( ∗ ):  ∗ P
    Figure Legend Snippet: Staphylococcus aureus MVs promote bacterial survival in human whole blood and in the presence of neutrophils ex vivo and in vivo . (A) Survival of S. aureus MSSA476 in blood is increased in the presence of 20 μg MV (0.1 μg/μl) isolated from MSSA476 grown in LB and BHI [marked as LB (MVs) or BHI (MVs) in the figure] compared to absence of MVs (marked as control in the figure). The number of inoculated bacteria at time point 0 was set to 100% and the number of surviving bacteria after 3 h is represented as the percentage of inoculation. (B) S. aureus MSSA476 survival in blood is increased in the presence of MVs, in a dose-dependent manner (5–20 μg of total MVs, i.e., 0.025–0.1 μg/μl). The number of surviving bacteria after 3 h in the absence of MVs was arbitrary set as 1, and the number of surviving bacteria in the presence of MVs is represented as the fold change compared to bacteria in the absence of MV. (C) Survival of USA300 MRSA in human blood is increased in the presence of MVs isolated from USA300 (MV-Hla) and USA300ΔHla (MV-ΔHla) grown in BHI. The percentage of survival was calculated as described in (A) . (D) Sonication of purified MVs followed by proteinase K (PK) treatment abolished the effect of MVs on bacterial survival in human whole blood. The fold change of survival was calculated as described in (B) . (E) Survival of opsonized S. aureus MSSA476 in the presence of neutrophils is enhanced by supplementation of MVs isolated from bacteria growing in LB and BHI. Percentage of survival was calculated as described in (A) . (F) S. aureus MSSA476 were labeled with FITC and incubated with human whole blood in the absence or presence of MVs isolated from MSSA476 grown in LB and BHI. Data represents geometric mean of the fluorescence intensity (GMFI). (G) Bacterial loads in the blood (CFU/ml) of 8-week-old C57BL/6 mice were counted 24 h after the mice were intravenously infected with S. aureus MSSA476 supplemented with PBS or an exogenous source of MVs isolated from MSSA476 grown in BHI. (H) HaCaT (100 μg of total MVs, i.e., 0.1 μg/μl) and freshly purified neutrophils were treated with MVs (5–20 μg of total MVs, i.e., 0.025–0.1 μg/μl) isolated from S. aureus MSSA476 grown in LB or BHI at the time points indicated. Percentage of cytotoxicity was calculated by measuring the amount of LDH released from the cytosol of damaged cells into the supernatant after exposure to MVs. (I) Viability staining of neutrophils in the presence (20 μg of total MVs, i.e., 0.1 μg/μl) or absence of MVs were performed using propidium iodide (PI). Live imaging was performed after 0 and 0.45 or 1.5 h using fluorescence microscopy. Scale bar is shown. The data represent as the mean ± SEM of at least three independent experiments except for (D) , which the data are expressed as the mean ± SEM of two independent experiments performed in triplicate. Mice study corresponds to one experiment performed with 10 mice/group. The significance is indicated by asterisks ( ∗ ): ∗ P

    Techniques Used: Ex Vivo, In Vivo, Isolation, Sonication, Purification, Labeling, Incubation, Fluorescence, Mouse Assay, Infection, Staining, Imaging, Microscopy

    20) Product Images from "Uncoupling FoxO3A mitochondrial and nuclear functions in cancer cells undergoing metabolic stress and chemotherapy"

    Article Title: Uncoupling FoxO3A mitochondrial and nuclear functions in cancer cells undergoing metabolic stress and chemotherapy

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0336-0

    FoxO3A accumulates into the mitochondria in metabolically stressed cell lines and normal tissues. a  Immunogold labeling of HeLa cells cultured in high glucose (HG) or switched to low glucose (LG, 0.75 mM glucose) for 24 h. Black dots represent gold particles recognizing FoxO3A immunocomplexes.  b ,  c  Immunoblot analysis of mitochondria isolated from HCT116 cells upon  b  LG (24 h) and  c  2-deoxy-glucose (2-DG) treatment (1 mM, 6 h). Mitochondrial fractions were treated with proteinase K (PK) to degrade outer mitochondrial membrane proteins. PDH: loading control.  d ,  e  Immunoblot analysis of mitochondrial fractions isolated from Caco2, HT29, SW-480 and HEK293 ( d ) and from NIH3T3 and MEF murine fibroblasts ( e ) cultured in LG (24 h). Mitochondrial fractions were treated with PK alone or with PK and Triton X-100 to permeabilize mitochondria and degrade all mitochondrial proteins. BCL2: outer membrane control; PDH: mitochondrial matrix control.  f  Immunoblot analysis of mitochondria-enriched fractions isolated from murine kidney and liver and subjected to PK or combined PK and Triton X-100 treatment. PDH: mitochondrial matrix control. The presented results are representative of at least three independent experiments
    Figure Legend Snippet: FoxO3A accumulates into the mitochondria in metabolically stressed cell lines and normal tissues. a Immunogold labeling of HeLa cells cultured in high glucose (HG) or switched to low glucose (LG, 0.75 mM glucose) for 24 h. Black dots represent gold particles recognizing FoxO3A immunocomplexes. b , c Immunoblot analysis of mitochondria isolated from HCT116 cells upon b LG (24 h) and c 2-deoxy-glucose (2-DG) treatment (1 mM, 6 h). Mitochondrial fractions were treated with proteinase K (PK) to degrade outer mitochondrial membrane proteins. PDH: loading control. d , e Immunoblot analysis of mitochondrial fractions isolated from Caco2, HT29, SW-480 and HEK293 ( d ) and from NIH3T3 and MEF murine fibroblasts ( e ) cultured in LG (24 h). Mitochondrial fractions were treated with PK alone or with PK and Triton X-100 to permeabilize mitochondria and degrade all mitochondrial proteins. BCL2: outer membrane control; PDH: mitochondrial matrix control. f Immunoblot analysis of mitochondria-enriched fractions isolated from murine kidney and liver and subjected to PK or combined PK and Triton X-100 treatment. PDH: mitochondrial matrix control. The presented results are representative of at least three independent experiments

    Techniques Used: Metabolic Labelling, Labeling, Cell Culture, Isolation

    Related Articles

    Centrifugation:

    Article Title: Comprehensive Spatial Analysis of the Borrelia burgdorferi Lipoproteome Reveals a Compartmentalization Bias toward the Bacterial Surface
    Article Snippet: Briefly, cells were grown at 34°C to late-logarithmic phase in BSK-II medium and harvested by centrifugation at room temperature using a centrifugal force not exceeding 3,000 × g using a Sorvall Legend RT centrifuge. .. Cells were then resuspended in dPBS + Mg with either distilled water (dH2 O) (mock), proteinase K (Invitrogen, 200 μg/ml final concentration), or pronase (1 mg/ml final concentration; Roche Life Sciences).

    Article Title:
    Article Snippet: After 2 h bacteria were harvested by centrifugation at 3500 × g for 10 min at 4 °C and washed three times in PBS. .. Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml.

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice. .. For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: The cell debris was discarded after centrifugation at 14,000 xg for 30 min and the supernatant absorbed to Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (GE Healthcare Life Sciences, Chalfont) for affinity chromatography purification , , . rLipL32 protein and its variants were eluted in PBS buffer containing 250 mM imidazole and the elution fractions were dialysis against the PBS buffer to remove the imidazole and applied to mono Q column ion exchanged column (GE Healthcare Life Sciences, Chalfont) for further removal the contaminated protein and endotoxins. .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Luciferase:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: Growth factor ligands EGF (MilliporeSigma, E9644) and TGF-β (Sigma-Aldrich, T7039) were used for luciferase assays in CAGA12-HaCaT cells ( ). .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    Neutralization:

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , . .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Blocking Assay:

    Article Title: Physical Routes to Primitive Cells: An Experimental Model Based on the Spontaneous Entrapment of Enzymes inside Micrometer-Sized Liposomes
    Article Snippet: 29 kDa), 6-carboxyfluorescein diacetate (CFDA, #C5041, 460 Da), 6-carboxyfluorescein (6-CF, #C0662, 376 Da), calceina disodium salt (#21030, 666 Da), oleic acid (#O1008), sodium oleate (#O7501), and all solvents and buffers; (b ) from Invitrogen: proteinase K (MW ca. .. 29 kDa), 6-carboxyfluorescein diacetate (CFDA, #C5041, 460 Da), 6-carboxyfluorescein (6-CF, #C0662, 376 Da), calceina disodium salt (#21030, 666 Da), oleic acid (#O1008), sodium oleate (#O7501), and all solvents and buffers; (b ) from Invitrogen: proteinase K (MW ca.

    Incubation:

    Article Title: Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection
    Article Snippet: Then, cells were infected at an m.o.i. of 1 PFU/cell in the presence of the drug, except for nystatin and methyl-β-cyclodextrin where drug-pretreated cultures were extensively washed before infection to eliminate compound and were further incubated in the absence of compound. .. Briefly, cell monolayers were treated with proteinase K (1 mg/ml, Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Article Title: Japanese Encephalitis Virus Enters Rat Neuroblastoma Cells via a pH-Dependent, Dynamin and Caveola-Mediated Endocytosis Pathway
    Article Snippet: B104 cells grown in 24-well plates (4.5 × 105 cells/well) were infected with JEV at a multiplicity of infection (MOI) of 0.1 in 500 μl DMEM and incubated at 37°C. .. At different times, cells were washed with phosphate-buffered saline (PBS) and treated with proteinase K (1 mg/ml) (Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Article Title: Comprehensive Spatial Analysis of the Borrelia burgdorferi Lipoproteome Reveals a Compartmentalization Bias toward the Bacterial Surface
    Article Snippet: Cells were then resuspended in dPBS + Mg with either distilled water (dH2 O) (mock), proteinase K (Invitrogen, 200 μg/ml final concentration), or pronase (1 mg/ml final concentration; Roche Life Sciences). .. Proteinase K-containing samples and respective controls were incubated for 1 h at room temperature, and reactions were stopped after 1 h by adding phenylmethylsulfonyl fluoride (PMSF) to a final concentration of 5 mM ( , ).

    Article Title: Insights into the mechanism of a G-quadruplex-unwinding DEAH-box helicase
    Article Snippet: DHX36 (110 pM) was incubated for the indicated amounts of time at 37°C with 4 nM annealed G4 (0.08% radiolabeled) in the K-Res buffer (50 mM Tris acetate pH 7.8, 100 mM KCl, 10 mM NaCl, 70 mM glycine, 10% glycerol, 3.3 mM MgCl2 , 0.12% bovine α-lactalbumin (Sigma), 10 ng·μl−1 poly(dI:dC) (Sigma)) supplemented with 1 mM ATP in a volume of 20 μl. .. Reactions were stopped with proteinase K (20 mg·ml−1 , 5 μl, Applied Biosystems) followed by incubation at 37°C for 10 min. .. Reactions were directly loaded onto a 20% poly acrylamide gel (19:1) and run at 350 V for 2.5 h. Gels were handled as described above.

    Article Title:
    Article Snippet: MBP protein was used as a control of the integrity of the bacterial cells after protease treatment. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described. .. MBP protein was used as a control of the integrity of the OMVs after protease treatment.

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi
    Article Snippet: Borrelia cells were transformed by electroporation with 2 μg of plasmid DNA using established protocols [ , ] and grown in liquid BSK-II media at 34°C and 5% CO2 . .. 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature. .. Mock-treated cells were incubated in PBS+Mg only.

    Article Title:
    Article Snippet: The cross-linked peptide was then digested with proteinase K (Invitrogen) for 1 h at 37 °C at a 1:1 (w/w) enzyme:substrate ratio. .. The cross-linked peptide was then digested with proteinase K (Invitrogen) for 1 h at 37 °C at a 1:1 (w/w) enzyme:substrate ratio.

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: Mitochondria and cytosolic fractions were freshly prepared from cells plated at 60–70% confluent using a Mitochondria Isolation Kit for Cultured Cells (Thermo Fisher) according to the manufacturer’s instructions. .. For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice. .. Digestion was terminated with 10% trichloroacetic acid (w/v).

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use. .. When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: Furthermore, to detach His6 -tag, the rLipL32 protein and its variants were incubated with 0.2 mg/ml enterokinase (EC 3.4.21.9; Invitrogen) at 37 °C for 16 h , . .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Article Title: Soluble biglycan: a potential mediator of cartilage degradation in osteoarthritis
    Article Snippet: BGN endotoxin (LPS) contamination was not detected using the limulus amebocyte lysate test. .. As additional endotoxin controls, 5 μg/ml sBGN was incubated in fresh Gibco DMEM/F-12 containing 50 μg/ml proteinase K (Thermo Scientific, Waltham, MA, USA) or 25 μg/ml polymyxin B (InvivoGen) at 37 °C for 1 h, after which the mixtures were added to the primary chondrocyte cultures. .. Protein homogeneity was confirmed by sodium dodecyl sulphate–polyacrylamide gel electrophoresis and Coomassie staining (performed by the manufacturer).

    Activity Assay:

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use. .. When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use.

    Cell Culture:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: The BioT transfection reagent (Bioland Scientific) was used for overexpression and siRNA knockdown in cultured cells. .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: Mitochondria and cytosolic fractions were freshly prepared from cells plated at 60–70% confluent using a Mitochondria Isolation Kit for Cultured Cells (Thermo Fisher) according to the manufacturer’s instructions. .. For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice.

    Expressing:

    Article Title: Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection
    Article Snippet: Briefly, cell monolayers were treated with proteinase K (1 mg/ml, Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus. .. Then, proteinase K was inactivated with 2 mM phenyl-methyl-sulfonyl fluoride in PBS with 3% bovine seroalbumin (BSA), cells were washed with PBS 0.2% BSA by low speed centrifugation, and cell pellets were resuspended in MM.

    Article Title:
    Article Snippet: When the cultures had reached an OD600 value of 0.5, protein expression was induced by addition of 1 mm IPTG. .. Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml.

    Article Title:
    Article Snippet: MBP protein was used as a control of the integrity of the bacterial cells after protease treatment. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described. .. MBP protein was used as a control of the integrity of the OMVs after protease treatment.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: Paragraph title: Protein expression and purification ... To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    BIA-KA:

    Article Title: Early Increase and Late Decrease of Purkinje Cell Dendritic Spine Density in Prion-Infected Organotypic Mouse Cerebellar Cultures
    Article Snippet: Total protein concentration was determined by BCA assay. .. 30 µg total protein (in 20 µL) was treated with 20 µg/mL Proteinase K (Invitrogen) at 37°C for 1 hr, diluted to 33.3 µL with PefaBloc (1 mM) and 3X loading buffer (187.5 mM Tris HCl pH 6.8, 15% glycerol, 15% SDS, 9 mM EDTA, 8 M urea, 12% βME), boiled for 10 min, and stored at −80°C.

    Western Blot:

    Article Title:
    Article Snippet: Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml. .. The suspension was centrifuged at 9000 × g for 5 min and pellets were resuspended in SDS-PAGE loading buffer and boiled for 5 min.

    Article Title:
    Article Snippet: MBP protein was used as a control of the integrity of the bacterial cells after protease treatment. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described. .. MBP protein was used as a control of the integrity of the OMVs after protease treatment.

    Article Title: Early Increase and Late Decrease of Purkinje Cell Dendritic Spine Density in Prion-Infected Organotypic Mouse Cerebellar Cultures
    Article Snippet: Paragraph title: 3) Western blotting ... 30 µg total protein (in 20 µL) was treated with 20 µg/mL Proteinase K (Invitrogen) at 37°C for 1 hr, diluted to 33.3 µL with PefaBloc (1 mM) and 3X loading buffer (187.5 mM Tris HCl pH 6.8, 15% glycerol, 15% SDS, 9 mM EDTA, 8 M urea, 12% βME), boiled for 10 min, and stored at −80°C.

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice. .. For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice.

    Over Expression:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: The BioT transfection reagent (Bioland Scientific) was used for overexpression and siRNA knockdown in cultured cells. .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    Transfection:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: The BioT transfection reagent (Bioland Scientific) was used for overexpression and siRNA knockdown in cultured cells. .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    Serial Dilution:

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use. .. When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use.

    Infection:

    Article Title: Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection
    Article Snippet: Then, cells were infected at an m.o.i. of 1 PFU/cell in the presence of the drug, except for nystatin and methyl-β-cyclodextrin where drug-pretreated cultures were extensively washed before infection to eliminate compound and were further incubated in the absence of compound. .. Briefly, cell monolayers were treated with proteinase K (1 mg/ml, Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Article Title: Japanese Encephalitis Virus Enters Rat Neuroblastoma Cells via a pH-Dependent, Dynamin and Caveola-Mediated Endocytosis Pathway
    Article Snippet: B104 cells grown in 24-well plates (4.5 × 105 cells/well) were infected with JEV at a multiplicity of infection (MOI) of 0.1 in 500 μl DMEM and incubated at 37°C. .. At different times, cells were washed with phosphate-buffered saline (PBS) and treated with proteinase K (1 mg/ml) (Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Clonogenic Cell Survival Assay:

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: Paragraph title: Blood Survival Assay ... When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use.

    Generated:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: A custom pSmad4GSK3 antibody (1:5,000) was generated previously in our laboratory ( ) using the synthetic peptide ([H]-CKK-Acp-NSTTTWT(PO3)GSRT(PO3)APY-[NH2]) to immunize rabbits (Covance). .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    other:

    Article Title: Effects of Carbon Dioxide Aerosols on the Viability of Escherichia coli during Biofilm Dispersal
    Article Snippet: The bacteria collected in 25 mM HEPES buffer (pH 7.2) (Sigma-Aldrich, USA) were subjected to enzymatic treatment with Proteinase K (100 ng/ml, Invitrogen, USA) and DNase I (100 ng/ml, Sigma-Aldrich, USA) for 2 h at 37 °C to disrupt any cell clumps that may be present.

    Protein Concentration:

    Article Title: Deer Prion Proteins Modulate the Emergence and Adaptation of Chronic Wasting Disease Strains
    Article Snippet: The brain homogenate protein content was determined using a micro-bicinchoninic acid assay kit (Life Technologies). .. For the proteinase digestion reactions, 50 to 70 μg total protein (final sample protein concentration, 1 to 1.4 mg/ml) was treated with 150 μg/ml of proteinase K (Life Technologies) for 45 min at 37°C. .. Reactions were terminated by boiling the samples in 2.5× Laemmli buffer (150 mM Tris-HCl, pH 6.8, 0.5% bromophenol blue, 25% glycerol, 5% [wt/vol] SDS, 12.5% β-mercaptoethanol) at 95°C for 10 min.

    Article Title: Early Increase and Late Decrease of Purkinje Cell Dendritic Spine Density in Prion-Infected Organotypic Mouse Cerebellar Cultures
    Article Snippet: Total protein concentration was determined by BCA assay. .. 30 µg total protein (in 20 µL) was treated with 20 µg/mL Proteinase K (Invitrogen) at 37°C for 1 hr, diluted to 33.3 µL with PefaBloc (1 mM) and 3X loading buffer (187.5 mM Tris HCl pH 6.8, 15% glycerol, 15% SDS, 9 mM EDTA, 8 M urea, 12% βME), boiled for 10 min, and stored at −80°C.

    Polymerase Chain Reaction:

    Article Title: Structural Prediction and Mutational Analysis of the Gifsy-1 Xis Protein
    Article Snippet: Proteinase K was obtained from Invitrogen. .. Platinum Pfx DNA polymerase (Invitrogen) was used to amplify DNA fragments for cloning into expression vectors.

    Sonication:

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: Thereafter, 20 μl of buffer (RPMI/HSA) or 5–20 μg MVs (0.025–0.1 μg/μl) in buffer was added to the blood with bacteria-samples. .. When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use. .. When indicated, the blood assay was performed in the absence of MVs, presence of intact, sonicated or sonicated-PK treated MVs for 3 h at 37°C on a rotator.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: E. coli cells were harvested by centrifugation at 4,000 x g for 15 min and then sonicated in phosphate buffered saline (PBS buffer). .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Injection:

    Article Title: Physical Routes to Primitive Cells: An Experimental Model Based on the Spontaneous Entrapment of Enzymes inside Micrometer-Sized Liposomes
    Article Snippet: 29 kDa), 6-carboxyfluorescein diacetate (CFDA, #C5041, 460 Da), 6-carboxyfluorescein (6-CF, #C0662, 376 Da), calceina disodium salt (#21030, 666 Da), oleic acid (#O1008), sodium oleate (#O7501), and all solvents and buffers; (b ) from Invitrogen: proteinase K (MW ca. .. 29 kDa), 6-carboxyfluorescein diacetate (CFDA, #C5041, 460 Da), 6-carboxyfluorescein (6-CF, #C0662, 376 Da), calceina disodium salt (#21030, 666 Da), oleic acid (#O1008), sodium oleate (#O7501), and all solvents and buffers; (b ) from Invitrogen: proteinase K (MW ca.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: The purified rLipL32 and its variants (100–150 μg) were injected into the column and the flow rate was set at 1 ml/min at 4 °C. .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    MTT Assay:

    Article Title: Dengue-3 Virus Entry into Vero Cells: Role of Clathrin-Mediated Endocytosis in the Outcome of Infection
    Article Snippet: Cells were treated with different compound concentrations during 3 h and thereafter cell viability was measured by MTT assay, as described previously [ ]. .. Briefly, cell monolayers were treated with proteinase K (1 mg/ml, Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Fluorescence:

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi
    Article Snippet: Paragraph title: Fluorescence activated cell sorting (FACS) ... 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature.

    Mutagenesis:

    Article Title: Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking
    Article Snippet: Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma). .. Reagents for protease protection assays were digitonin (Abcam), proteinase K (Invitrogen), and Triton X-100 (MilliporeSigma).

    Article Title: Structural Prediction and Mutational Analysis of the Gifsy-1 Xis Protein
    Article Snippet: Proteinase K was obtained from Invitrogen. .. Platinum Pfx DNA polymerase (Invitrogen) was used to amplify DNA fragments for cloning into expression vectors.

    Isolation:

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: Paragraph title: Isolation of mitochondria, proteinase K treatment, and alkaline carbonate extraction ... For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice.

    Flow Cytometry:

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi
    Article Snippet: 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature. .. 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: The purified rLipL32 and its variants (100–150 μg) were injected into the column and the flow rate was set at 1 ml/min at 4 °C. .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Purification:

    Article Title:
    Article Snippet: MBP protein was used as a control of the integrity of the bacterial cells after protease treatment. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described. .. MBP protein was used as a control of the integrity of the OMVs after protease treatment.

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: Paragraph title: Protein expression and purification ... To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Sequencing:

    Article Title: Structural Prediction and Mutational Analysis of the Gifsy-1 Xis Protein
    Article Snippet: Proteinase K was obtained from Invitrogen. .. PCR mutagenesis was accomplished using a Genemorph II PCR kit (Stratagene).

    Article Title: Soluble biglycan: a potential mediator of cartilage degradation in osteoarthritis
    Article Snippet: Primary chondrocytes cultures from passage 1 were stimulated for 24 or 48 h with 5 μg/ml bovine BGN (high sequence homology and structural conservation with human BGN) obtained from articular cartilage and solubilised according to the manufacturer’s instructions (Sigma-Aldrich) [ ]. .. As additional endotoxin controls, 5 μg/ml sBGN was incubated in fresh Gibco DMEM/F-12 containing 50 μg/ml proteinase K (Thermo Scientific, Waltham, MA, USA) or 25 μg/ml polymyxin B (InvivoGen) at 37 °C for 1 h, after which the mixtures were added to the primary chondrocyte cultures.

    Coagulation:

    Article Title: Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models
    Article Snippet: When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use. .. When indicated, the MVs were sonicated, left untreated or treated with 0.1 μg/ml proteinase K (PK; Life Technologies, United Kingdom) for 3 h at 56°C prior to use.

    FACS:

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi
    Article Snippet: Paragraph title: Fluorescence activated cell sorting (FACS) ... 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature.

    Mouse Assay:

    Article Title: Deer Prion Proteins Modulate the Emergence and Adaptation of Chronic Wasting Disease Strains
    Article Snippet: Brain tissues from tg mice were homogenized to 10% (wt/vol) in sterile water using disposable syringes and needles of decreasing diameters (18 gauge to 21 gauge), aliquoted, and stored at −80°C. .. For the proteinase digestion reactions, 50 to 70 μg total protein (final sample protein concentration, 1 to 1.4 mg/ml) was treated with 150 μg/ml of proteinase K (Life Technologies) for 45 min at 37°C.

    SDS Page:

    Article Title: Comprehensive Spatial Analysis of the Borrelia burgdorferi Lipoproteome Reveals a Compartmentalization Bias toward the Bacterial Surface
    Article Snippet: Cells were then resuspended in dPBS + Mg with either distilled water (dH2 O) (mock), proteinase K (Invitrogen, 200 μg/ml final concentration), or pronase (1 mg/ml final concentration; Roche Life Sciences). .. Pronase-containing samples and respective controls were incubated for 2 h at 37°C, and reactions were stopped by addition of EDTA, PMSF, and Pefabloc SC to 1 mM, 0.2 mM, and 0.8 mM final concentrations, respectively.

    Article Title:
    Article Snippet: Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml. .. After incubation for 30 min at 37 °C the reaction was stopped by addition of 5 μl of the peptidase inhibitor, phenylmethhylsulfonyl fluoride (PMSF; Sigma-Aldrich).

    Article Title:
    Article Snippet: The suspension was centrifuged at 9000 × g for 5 min and pellets were resuspended in SDS-PAGE loading buffer and boiled for 5 min. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described.

    Article Title: Membrane-anchoring stabilizes and favors secretion of New Delhi Metallo-β-lactamase
    Article Snippet: Inner and outer membrane vesicles were identified by NADH oxidase activity as previously described , and mass spectrometry characterization of protein from excised gel bands (trypsin digestion followed by MS/MS, performed at Mass Spectrometry Laboratory for Protein Sequencing, The Cleveland Clinic Foundation, USA). .. Spheroplasts and whole cell suspensions were treated with Proteinase K (Fungal, Invitrogen, > 20 U/mg) as previously described , and analyzed by SDS-PAGE and immunoblotting. .. Liquid cultures of E. coli pMBLe-bla NDM-1 or pMBLe-bla NDM-1 C26A were grown at 37ºC until OD600 0.8.

    Article Title: Identification of the N-terminal transmembrane domain of StarD7 and its importance for mitochondrial outer membrane localization and phosphatidylcholine transfer
    Article Snippet: For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice. .. For proteinase K digestion, mitochondria were resuspended in isotonic mitochondrial buffer (10 mM Hepes buffer, pH 8.0, 250 mM sucrose, 0.5 mM EGTA) and incubated with different concentrations of proteinase K (Thermo Fisher) for 30 min on ice.

    Plasmid Preparation:

    Article Title: Structural Prediction and Mutational Analysis of the Gifsy-1 Xis Protein
    Article Snippet: Proteinase K was obtained from Invitrogen. .. Automated fluorescent sequencing was carried out at the W. M. Keck Center at the University of Illinois at Urbana Champaign.

    Affinity Chromatography:

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: The cell debris was discarded after centrifugation at 14,000 xg for 30 min and the supernatant absorbed to Ni2+ -nitrilotriacetic acid (Ni2+ -NTA) agarose resin (GE Healthcare Life Sciences, Chalfont) for affinity chromatography purification , , . rLipL32 protein and its variants were eluted in PBS buffer containing 250 mM imidazole and the elution fractions were dialysis against the PBS buffer to remove the imidazole and applied to mono Q column ion exchanged column (GE Healthcare Life Sciences, Chalfont) for further removal the contaminated protein and endotoxins. .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Size-exclusion Chromatography:

    Article Title: Active Components of Leptospira Outer Membrane Protein LipL32 to Toll-Like Receptor 2
    Article Snippet: The tag peptide was further removed by size exclusion chromatography using Superdex 200 pg 16/600 column (GE Healthcare Life Sciences, Chalfont). .. To validate the inflammatory effects of rLipL32, the protein were subjected to polymyxin B (Invitrogen), heat, and proteinase K (Invitrogen) treatments, respectively, as described previously , .

    Acid Assay:

    Article Title: Deer Prion Proteins Modulate the Emergence and Adaptation of Chronic Wasting Disease Strains
    Article Snippet: The brain homogenate protein content was determined using a micro-bicinchoninic acid assay kit (Life Technologies). .. For the proteinase digestion reactions, 50 to 70 μg total protein (final sample protein concentration, 1 to 1.4 mg/ml) was treated with 150 μg/ml of proteinase K (Life Technologies) for 45 min at 37°C.

    Concentration Assay:

    Article Title: Comprehensive Spatial Analysis of the Borrelia burgdorferi Lipoproteome Reveals a Compartmentalization Bias toward the Bacterial Surface
    Article Snippet: Cells were then washed once by resuspension in sterile room-temperature Dulbecco's phosphate-buffered saline (dPBS) containing 5 mM MgCl2 (dPBS + Mg) and repelleted. .. Cells were then resuspended in dPBS + Mg with either distilled water (dH2 O) (mock), proteinase K (Invitrogen, 200 μg/ml final concentration), or pronase (1 mg/ml final concentration; Roche Life Sciences). .. Proteinase K-containing samples and respective controls were incubated for 1 h at room temperature, and reactions were stopped after 1 h by adding phenylmethylsulfonyl fluoride (PMSF) to a final concentration of 5 mM ( , ).

    Article Title:
    Article Snippet: Cells were resuspended in PBS to a final density of 2 × 109 cells/ml. .. Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml. .. After incubation for 30 min at 37 °C the reaction was stopped by addition of 5 μl of the peptidase inhibitor, phenylmethhylsulfonyl fluoride (PMSF; Sigma-Aldrich).

    Article Title:
    Article Snippet: Proteinase K (Fermentas) was added to a final concentration of 100 μg/ml. .. To investigate protein localization in OMVs 10 μg of proteinase K (Fermentas, Waltham, MA) were added to 15 μg of intact or solubilized (in 1% SDS) OMVs purified from strains expressing Nm-fHbp, Aa-fHbp or NHBA proteins, and the mixtures were then incubated at 37 °C for 60 min. After proteinase K inactivation with 10 mm phenylmethylsulfonyl fluoride (PMSF; Sigma Aldrich) samples were loaded on a 4–12% or 10% polyacrylamide gel and Western blotting analysis was performed as previously described.

    Article Title: Development and validation of a FACS-based lipoprotein localization screen in the Lyme disease spirochete Borrelia burgdorferi
    Article Snippet: Borrelia cells were transformed by electroporation with 2 μg of plasmid DNA using established protocols [ , ] and grown in liquid BSK-II media at 34°C and 5% CO2 . .. 2 × 106 spirochetes were harvested as described [ ], washed twice with phosphate buffered saline containing 5 mM MgCl2 (PBS+Mg), and incubated with a final concentration of 50 μg ml-1 proteinase K (Invitrogen) for one hour at room temperature. .. Mock-treated cells were incubated in PBS+Mg only.

    Article Title: Structural Prediction and Mutational Analysis of the Gifsy-1 Xis Protein
    Article Snippet: L-arabinose (Sigma) was added to media at a concentration of 1%. .. Proteinase K was obtained from Invitrogen.

    Article Title: Early Increase and Late Decrease of Purkinje Cell Dendritic Spine Density in Prion-Infected Organotypic Mouse Cerebellar Cultures
    Article Snippet: 30 µg total protein (in 20 µL) was treated with 20 µg/mL Proteinase K (Invitrogen) at 37°C for 1 hr, diluted to 33.3 µL with PefaBloc (1 mM) and 3X loading buffer (187.5 mM Tris HCl pH 6.8, 15% glycerol, 15% SDS, 9 mM EDTA, 8 M urea, 12% βME), boiled for 10 min, and stored at −80°C. .. 30 µg total protein (in 20 µL) was treated with 20 µg/mL Proteinase K (Invitrogen) at 37°C for 1 hr, diluted to 33.3 µL with PefaBloc (1 mM) and 3X loading buffer (187.5 mM Tris HCl pH 6.8, 15% glycerol, 15% SDS, 9 mM EDTA, 8 M urea, 12% βME), boiled for 10 min, and stored at −80°C.

    Article Title: A nanobody:GFP bacterial platform that enables functional enzyme display and easy quantification of display capacity
    Article Snippet: The GFP fluorophore was excited and signal detected using an excitation filter with band-pass 470/40 and a suppression filter with band-pass 525/50. .. Cells were harvested and resuspended in 50 µl PBS buffer before adding 1.5 µl Proteinase K (final concentration 0.58 mg/ml) (ThermoScientific). .. Samples were incubated for 30 min at 37 °C, after which the accessibility was assessed by carrying out the NB:GFP assay and analysing samples on SDS-PAGE as described above, starting with a centrifugation and washing step to remove all cleaved off protein.

    Staining:

    Article Title: Japanese Encephalitis Virus Enters Rat Neuroblastoma Cells via a pH-Dependent, Dynamin and Caveola-Mediated Endocytosis Pathway
    Article Snippet: At different times, cells were washed with phosphate-buffered saline (PBS) and treated with proteinase K (1 mg/ml) (Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus. .. At different times, cells were washed with phosphate-buffered saline (PBS) and treated with proteinase K (1 mg/ml) (Invitrogen) for 45 min at 4°C to remove adsorbed but not internalized virus.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gene exp gzmb hs01554355 m1
    T-bet and Eomesodermin are differentially expressed in blood and rectal CD8 + T-cells. (a) Representative flow cytometry plot of data from a seronegative participant showing high and low fluorescence intensities of T-bet and Eomesodermin (Eomes) in blood and rectal CD8 + T-cells, highlighting the reduction in frequency of T-bet High Eomes High CD8 + T-cells in rectal mucosa compared to blood. (b) Differences in the frequencies of total T-bet + and Eomes + CD8 + T-cells between blood and rectal mucosa and between HIV + and seronegative participants. (c) Differences in the frequencies of CD8 + T-cells with T-bet and Eomes high and low expression intensities in blood and rectal mucosa. (d) Difference in T-bet and Eomes co-expression patterns in blood and rectal CD8 + T-cells. (e) Frequency of Eomes High CD8 + T-cells in rectal mucosa across HIV disease status. Similar results were observed in blood (data not shown). (f) Representative flow cytometry plot showing co-expression of Eomes High and <t>GrzB</t> in rectal mucosal CD8 + T-cells. (g) Spearman correlation analysis relating the frequency of Eomes High CD8 + T-cells with the frequency of CD8 + T-cells expressing perforin or GrzB in rectal mucosa. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks indicate level of significance as follows: * P
    Gene Exp Gzmb Hs01554355 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gzmb hs01554355 m1/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gene exp gzmb hs01554355 m1 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher gene exp gzmb hs00188051 m1
    Quantification of regulatory (FOXP3), effector (T-bet), and cytotoxic <t>(GrzB)</t> mRNA in the peripheral blood mononuclear cells of healthy volunteers and renal transplant patients. (i) Quantification of mRNA for FOXP3 (A), T-bet (B), and GrzB (C) in the peripheral
    Gene Exp Gzmb Hs00188051 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gzmb hs00188051 m1/product/Thermo Fisher
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp gzmb hs00188051 m1 - by Bioz Stars, 2019-10
    93/100 stars
      Buy from Supplier

    85
    Thermo Fisher gene exp gzma hs00989184 m1
    Favorable prognosis in cases with enriched TCRβ clonotypes and high PD-L1 mRNA expression. (A and B) All 32 cases were classified into two groups by the median number of TCRβ clones with > 0.1% frequency (Materials and methods), and compared by mRNA expression of (A) CD8 and (B) <t>GZMA</t> . (C-E) Kaplan-Meier curves of progression-free survival for two groups classified by T cell clonal expansion in our 32 cases (C) and PD-L1 expression in our 32 cases (D) and PD-L1 expression in 540 TCGA cases (E) were evaluated by a log-rank test. Cases were classified by the median of each value. (F) All cases were classified into two groups according to high or low TCRβ clonality by the median value of numbers of TCRβ clones with the frequency of > 0.1% (Materials and methods), and then individual cases in each group were ordered in the relative PD-L1 expression levels (median, 5.3). (G-I) Comparison of mRNA expression of (G) CD8 , (H) GZMA and (I) HLA-A between ‘CL_High/PD-L1_High’ [cases shown in red in (F)] cases and ‘The others’. P-values were calculated by Mann-Whitney test. (J) Kaplan-Meier curves (progression-free survival) of patients by classification of tumors with T cell clonal expansion along with high PD-L1 expression (CL_High/PD-L1_High) and the other cases (The others). P-value was calculated using log-rank test.
    Gene Exp Gzma Hs00989184 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gzma hs00989184 m1/product/Thermo Fisher
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp gzma hs00989184 m1 - by Bioz Stars, 2019-10
    85/100 stars
      Buy from Supplier

    Image Search Results


    T-bet and Eomesodermin are differentially expressed in blood and rectal CD8 + T-cells. (a) Representative flow cytometry plot of data from a seronegative participant showing high and low fluorescence intensities of T-bet and Eomesodermin (Eomes) in blood and rectal CD8 + T-cells, highlighting the reduction in frequency of T-bet High Eomes High CD8 + T-cells in rectal mucosa compared to blood. (b) Differences in the frequencies of total T-bet + and Eomes + CD8 + T-cells between blood and rectal mucosa and between HIV + and seronegative participants. (c) Differences in the frequencies of CD8 + T-cells with T-bet and Eomes high and low expression intensities in blood and rectal mucosa. (d) Difference in T-bet and Eomes co-expression patterns in blood and rectal CD8 + T-cells. (e) Frequency of Eomes High CD8 + T-cells in rectal mucosa across HIV disease status. Similar results were observed in blood (data not shown). (f) Representative flow cytometry plot showing co-expression of Eomes High and GrzB in rectal mucosal CD8 + T-cells. (g) Spearman correlation analysis relating the frequency of Eomes High CD8 + T-cells with the frequency of CD8 + T-cells expressing perforin or GrzB in rectal mucosa. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks indicate level of significance as follows: * P

    Journal: Mucosal immunology

    Article Title: Predominance of Weakly Cytotoxic, T-betLowEomesNeg CD8+ T-cells in Human Gastrointestinal Mucosa: Implications for HIV Infection

    doi: 10.1038/mi.2016.100

    Figure Lengend Snippet: T-bet and Eomesodermin are differentially expressed in blood and rectal CD8 + T-cells. (a) Representative flow cytometry plot of data from a seronegative participant showing high and low fluorescence intensities of T-bet and Eomesodermin (Eomes) in blood and rectal CD8 + T-cells, highlighting the reduction in frequency of T-bet High Eomes High CD8 + T-cells in rectal mucosa compared to blood. (b) Differences in the frequencies of total T-bet + and Eomes + CD8 + T-cells between blood and rectal mucosa and between HIV + and seronegative participants. (c) Differences in the frequencies of CD8 + T-cells with T-bet and Eomes high and low expression intensities in blood and rectal mucosa. (d) Difference in T-bet and Eomes co-expression patterns in blood and rectal CD8 + T-cells. (e) Frequency of Eomes High CD8 + T-cells in rectal mucosa across HIV disease status. Similar results were observed in blood (data not shown). (f) Representative flow cytometry plot showing co-expression of Eomes High and GrzB in rectal mucosal CD8 + T-cells. (g) Spearman correlation analysis relating the frequency of Eomes High CD8 + T-cells with the frequency of CD8 + T-cells expressing perforin or GrzB in rectal mucosa. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks indicate level of significance as follows: * P

    Article Snippet: Cell lysates were submitted to the UC Davis Real-Time PCR Research and Diagnostics Core Facility for RNA extraction and real-time qPCR using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) for perforin (Hs00169473_m1), Granzyme B (Hs01554355_m1), T-bet (Hs00203436_m1), Eomesodermin (Hs00172872_m1), and 18S rRNA (Hs99999901_s1).

    Techniques: Flow Cytometry, Cytometry, Fluorescence, Expressing

    Varying perforin and GrzB expression between blood and rectal CD8 + T-cells and across HIV-infection. (a) Representative flow cytometry plot of intracellular perforin and GrzB expression in unstimulated ex vivo blood and rectal mucosal CD8 + T-cells from representative participants: viremic untreated (top) and seronegative (bottom). (b) Difference in intracellular perforin and GrzB expression between blood and rectal CD8 + T-cells in a consolidated group of all HIV+ participants compared to seronegative (SN) participants. (c) Difference in intracellular perforin and GrzB expression in rectal and blood CD8 + T-cells across HIV-disease status. (d) Spearman correlation analysis relating the frequency of GrzB + CD8 + T-cells with the frequency of perforin + CD8 + T-cells in rectal mucosa and blood. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks show level of significance as follows: * P

    Journal: Mucosal immunology

    Article Title: Predominance of Weakly Cytotoxic, T-betLowEomesNeg CD8+ T-cells in Human Gastrointestinal Mucosa: Implications for HIV Infection

    doi: 10.1038/mi.2016.100

    Figure Lengend Snippet: Varying perforin and GrzB expression between blood and rectal CD8 + T-cells and across HIV-infection. (a) Representative flow cytometry plot of intracellular perforin and GrzB expression in unstimulated ex vivo blood and rectal mucosal CD8 + T-cells from representative participants: viremic untreated (top) and seronegative (bottom). (b) Difference in intracellular perforin and GrzB expression between blood and rectal CD8 + T-cells in a consolidated group of all HIV+ participants compared to seronegative (SN) participants. (c) Difference in intracellular perforin and GrzB expression in rectal and blood CD8 + T-cells across HIV-disease status. (d) Spearman correlation analysis relating the frequency of GrzB + CD8 + T-cells with the frequency of perforin + CD8 + T-cells in rectal mucosa and blood. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks show level of significance as follows: * P

    Article Snippet: Cell lysates were submitted to the UC Davis Real-Time PCR Research and Diagnostics Core Facility for RNA extraction and real-time qPCR using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) for perforin (Hs00169473_m1), Granzyme B (Hs01554355_m1), T-bet (Hs00203436_m1), Eomesodermin (Hs00172872_m1), and 18S rRNA (Hs99999901_s1).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Ex Vivo

    Reduced expression of perforin and GrzB in rectal mucosal CD8 + T-cell memory/effector populations compared to blood. (a) Representative flow cytometry plot displaying surface staining for the memory differentiation markers CD45RO, CD27, and CCR7 in blood and rectal CD8 + T-cells. (b) Frequency of memory/effector subsets within blood and rectal CD8 + T-cell populations in a consolidated group of HIV+ and seronegative participants. (c) Distribution of perforin and GrzB expression in blood and rectal CD8 + T-cell memory/effector subsets. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks indicate level of significance as follows: * P

    Journal: Mucosal immunology

    Article Title: Predominance of Weakly Cytotoxic, T-betLowEomesNeg CD8+ T-cells in Human Gastrointestinal Mucosa: Implications for HIV Infection

    doi: 10.1038/mi.2016.100

    Figure Lengend Snippet: Reduced expression of perforin and GrzB in rectal mucosal CD8 + T-cell memory/effector populations compared to blood. (a) Representative flow cytometry plot displaying surface staining for the memory differentiation markers CD45RO, CD27, and CCR7 in blood and rectal CD8 + T-cells. (b) Frequency of memory/effector subsets within blood and rectal CD8 + T-cell populations in a consolidated group of HIV+ and seronegative participants. (c) Distribution of perforin and GrzB expression in blood and rectal CD8 + T-cell memory/effector subsets. Wide horizontal bars represent medians; narrow whiskers indicate interquartile ranges; asterisks indicate level of significance as follows: * P

    Article Snippet: Cell lysates were submitted to the UC Davis Real-Time PCR Research and Diagnostics Core Facility for RNA extraction and real-time qPCR using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) for perforin (Hs00169473_m1), Granzyme B (Hs01554355_m1), T-bet (Hs00203436_m1), Eomesodermin (Hs00172872_m1), and 18S rRNA (Hs99999901_s1).

    Techniques: Expressing, Flow Cytometry, Cytometry, Staining

    Length of the shortest HO-1 (GT)n allele correlates positively with CNS expression of markers of type I interferon responses and T-lymphocyte activation in HIV-infected individuals. Correlations were determined between the length of an HIV-infected (without HIVE) individuals shortest HO-1 (GT)n allele and the prefrontal cortex expression of the RNA markers a MX1, b ISG15, c IRF1, d CD38, e GZMB, f CD8A, g CD68, h CD163, i CD19, j PECAM1, and k VWF. Significant associations were determined by Spearman rank correlation. Solid lines represent best-fit linear regression models with dashed lines showing 95% confidence bands. Red regression lines denote significant differences. r , Spearman rank coefficient; n.s., not significant

    Journal: Journal of Neuroinflammation

    Article Title: Heme oxygenase-1 promoter region (GT)n polymorphism associates with increased neuroimmune activation and risk for encephalitis in HIV infection

    doi: 10.1186/s12974-018-1102-z

    Figure Lengend Snippet: Length of the shortest HO-1 (GT)n allele correlates positively with CNS expression of markers of type I interferon responses and T-lymphocyte activation in HIV-infected individuals. Correlations were determined between the length of an HIV-infected (without HIVE) individuals shortest HO-1 (GT)n allele and the prefrontal cortex expression of the RNA markers a MX1, b ISG15, c IRF1, d CD38, e GZMB, f CD8A, g CD68, h CD163, i CD19, j PECAM1, and k VWF. Significant associations were determined by Spearman rank correlation. Solid lines represent best-fit linear regression models with dashed lines showing 95% confidence bands. Red regression lines denote significant differences. r , Spearman rank coefficient; n.s., not significant

    Article Snippet: Duplicate qPCR reactions were run and relative mRNA expression was calculated using the ΔΔCt method (compared to GAPDH mRNA expression) using commercially available primer and probe sets from Applied Biosystems: CD19, Hs99999192_m1; CD38, Hs01120071_m1; CD163, Hs01016661_m1; CD68, Hs00154355_m1; CD8A, Hs01555600_m1; GAPDH, Hs99999905_m1; GZMB, Hs01554355_m1; IRF1, Hs00971959_m1; ISG15, Hs00192713_m1: MX1, Hs00182073_m1; PECAM1, Hs00169777_m1; VWF, Hs00169795_m1.

    Techniques: Expressing, Activation Assay, Infection

    Prefrontal cortex type I interferon responses and T-lymphocyte activation marker expression trends lower in HIV-infected Caucasian and African American individuals with short ‘S’ HO-1 (GT)n alleles. Prefrotanal cortex RNA expression of neuroimmune markers was compared between HIV-infected subjects (without HIVE) with a short ‘S’ HO-1 (GT)n allele (SS, SM, SL) and those without a short ‘S’ allele (MM, ML, LL) in self-identifying Caucasian and African American subgroups. Neuroimmune markers analyzed were a MX1, b ISG15, c IRF1, d CD38, and e GZMB, those that significantly associated with the HO-1 (GT)n polymorphism in the full HIV+ cohort. Lines and error bars indicate median ± 95% confidence interval of log 10 transformed RNA expression data. Red median lines and errors bars denote significant differences. Differences in expression between subjects with short ‘S’ alleles and those without ‘S’ alleles in Caucasian and African American subgroups were analyzed by Mann-Whitney test

    Journal: Journal of Neuroinflammation

    Article Title: Heme oxygenase-1 promoter region (GT)n polymorphism associates with increased neuroimmune activation and risk for encephalitis in HIV infection

    doi: 10.1186/s12974-018-1102-z

    Figure Lengend Snippet: Prefrontal cortex type I interferon responses and T-lymphocyte activation marker expression trends lower in HIV-infected Caucasian and African American individuals with short ‘S’ HO-1 (GT)n alleles. Prefrotanal cortex RNA expression of neuroimmune markers was compared between HIV-infected subjects (without HIVE) with a short ‘S’ HO-1 (GT)n allele (SS, SM, SL) and those without a short ‘S’ allele (MM, ML, LL) in self-identifying Caucasian and African American subgroups. Neuroimmune markers analyzed were a MX1, b ISG15, c IRF1, d CD38, and e GZMB, those that significantly associated with the HO-1 (GT)n polymorphism in the full HIV+ cohort. Lines and error bars indicate median ± 95% confidence interval of log 10 transformed RNA expression data. Red median lines and errors bars denote significant differences. Differences in expression between subjects with short ‘S’ alleles and those without ‘S’ alleles in Caucasian and African American subgroups were analyzed by Mann-Whitney test

    Article Snippet: Duplicate qPCR reactions were run and relative mRNA expression was calculated using the ΔΔCt method (compared to GAPDH mRNA expression) using commercially available primer and probe sets from Applied Biosystems: CD19, Hs99999192_m1; CD38, Hs01120071_m1; CD163, Hs01016661_m1; CD68, Hs00154355_m1; CD8A, Hs01555600_m1; GAPDH, Hs99999905_m1; GZMB, Hs01554355_m1; IRF1, Hs00971959_m1; ISG15, Hs00192713_m1: MX1, Hs00182073_m1; PECAM1, Hs00169777_m1; VWF, Hs00169795_m1.

    Techniques: Activation Assay, Marker, Expressing, Infection, RNA Expression, Transformation Assay, MANN-WHITNEY

    HIV-infected individuals with short ‘S’ HO-1 (GT)n alleles have significantly lower CNS expression of markers of type I interferon responses and T-lymphocyte activation. Prefrotanal cortex RNA expression of neuroimmune markers was compared between HIV-infected subjects (without HIVE) with a short ‘S’ HO-1 (GT)n allele (SS, SM, SL) and those without a short ‘S’ allele (MM, ML, LL). Neuroimmune markers analyzed were a MX1, b ISG15, c IRF1, d CD38, e GZMB, f CD8A, g CD68, h CD163, i CD19, j PECAM1, and k VWF. Lines and error bars indicate median ± 95% confidence interval of log 10 transformed RNA expression data. Red median lines and errors bars denote significant differences. Differences between groups were analyzed by Mann-Whitney test. n.s., not significant

    Journal: Journal of Neuroinflammation

    Article Title: Heme oxygenase-1 promoter region (GT)n polymorphism associates with increased neuroimmune activation and risk for encephalitis in HIV infection

    doi: 10.1186/s12974-018-1102-z

    Figure Lengend Snippet: HIV-infected individuals with short ‘S’ HO-1 (GT)n alleles have significantly lower CNS expression of markers of type I interferon responses and T-lymphocyte activation. Prefrotanal cortex RNA expression of neuroimmune markers was compared between HIV-infected subjects (without HIVE) with a short ‘S’ HO-1 (GT)n allele (SS, SM, SL) and those without a short ‘S’ allele (MM, ML, LL). Neuroimmune markers analyzed were a MX1, b ISG15, c IRF1, d CD38, e GZMB, f CD8A, g CD68, h CD163, i CD19, j PECAM1, and k VWF. Lines and error bars indicate median ± 95% confidence interval of log 10 transformed RNA expression data. Red median lines and errors bars denote significant differences. Differences between groups were analyzed by Mann-Whitney test. n.s., not significant

    Article Snippet: Duplicate qPCR reactions were run and relative mRNA expression was calculated using the ΔΔCt method (compared to GAPDH mRNA expression) using commercially available primer and probe sets from Applied Biosystems: CD19, Hs99999192_m1; CD38, Hs01120071_m1; CD163, Hs01016661_m1; CD68, Hs00154355_m1; CD8A, Hs01555600_m1; GAPDH, Hs99999905_m1; GZMB, Hs01554355_m1; IRF1, Hs00971959_m1; ISG15, Hs00192713_m1: MX1, Hs00182073_m1; PECAM1, Hs00169777_m1; VWF, Hs00169795_m1.

    Techniques: Infection, Expressing, Activation Assay, RNA Expression, Transformation Assay, MANN-WHITNEY

    Quantification of regulatory (FOXP3), effector (T-bet), and cytotoxic (GrzB) mRNA in the peripheral blood mononuclear cells of healthy volunteers and renal transplant patients. (i) Quantification of mRNA for FOXP3 (A), T-bet (B), and GrzB (C) in the peripheral

    Journal:

    Article Title: Regulatory, Effector, and Cytotoxic T Cell Profiles in Long-Term Kidney Transplant Patients

    doi: 10.1681/ASN.2008050450

    Figure Lengend Snippet: Quantification of regulatory (FOXP3), effector (T-bet), and cytotoxic (GrzB) mRNA in the peripheral blood mononuclear cells of healthy volunteers and renal transplant patients. (i) Quantification of mRNA for FOXP3 (A), T-bet (B), and GrzB (C) in the peripheral

    Article Snippet: Real-time quantitative PCR (qPCR) was performed in an Applied Biosystems GenAmp 7700 or 7900 sequence detection system (Applied Biosystems, Foster City, CA) using commercially available primer and probe sets (Applied Biosystems: FOXP3, Hs00203958_m1; GrzB, Hs00188051_m1; T-bet, Hs00203436_m1; IL-17a, Hs00174383).

    Techniques:

    Quantification of intragraft GrzB mRNA and GrzB+ cells in chronic injury of kidney allografts. (A) Quantitative PCR measurement of GrzB mRNA accumulation in kidney graft biopsies displaying signs of chronic injury (chronic calcineurin inhibitor

    Journal:

    Article Title: Regulatory, Effector, and Cytotoxic T Cell Profiles in Long-Term Kidney Transplant Patients

    doi: 10.1681/ASN.2008050450

    Figure Lengend Snippet: Quantification of intragraft GrzB mRNA and GrzB+ cells in chronic injury of kidney allografts. (A) Quantitative PCR measurement of GrzB mRNA accumulation in kidney graft biopsies displaying signs of chronic injury (chronic calcineurin inhibitor

    Article Snippet: Real-time quantitative PCR (qPCR) was performed in an Applied Biosystems GenAmp 7700 or 7900 sequence detection system (Applied Biosystems, Foster City, CA) using commercially available primer and probe sets (Applied Biosystems: FOXP3, Hs00203958_m1; GrzB, Hs00188051_m1; T-bet, Hs00203436_m1; IL-17a, Hs00174383).

    Techniques: Real-time Polymerase Chain Reaction

    Receiver operating characteristic curve analysis of GrzB mRNA in the STA and CAMR PBMC samples. The ROC curve measures the ability of GrzB mRNA quantity to correctly classify patients with and without CAMR. The ROC is represented as a graphical plot of

    Journal:

    Article Title: Regulatory, Effector, and Cytotoxic T Cell Profiles in Long-Term Kidney Transplant Patients

    doi: 10.1681/ASN.2008050450

    Figure Lengend Snippet: Receiver operating characteristic curve analysis of GrzB mRNA in the STA and CAMR PBMC samples. The ROC curve measures the ability of GrzB mRNA quantity to correctly classify patients with and without CAMR. The ROC is represented as a graphical plot of

    Article Snippet: Real-time quantitative PCR (qPCR) was performed in an Applied Biosystems GenAmp 7700 or 7900 sequence detection system (Applied Biosystems, Foster City, CA) using commercially available primer and probe sets (Applied Biosystems: FOXP3, Hs00203958_m1; GrzB, Hs00188051_m1; T-bet, Hs00203436_m1; IL-17a, Hs00174383).

    Techniques:

    Favorable prognosis in cases with enriched TCRβ clonotypes and high PD-L1 mRNA expression. (A and B) All 32 cases were classified into two groups by the median number of TCRβ clones with > 0.1% frequency (Materials and methods), and compared by mRNA expression of (A) CD8 and (B) GZMA . (C-E) Kaplan-Meier curves of progression-free survival for two groups classified by T cell clonal expansion in our 32 cases (C) and PD-L1 expression in our 32 cases (D) and PD-L1 expression in 540 TCGA cases (E) were evaluated by a log-rank test. Cases were classified by the median of each value. (F) All cases were classified into two groups according to high or low TCRβ clonality by the median value of numbers of TCRβ clones with the frequency of > 0.1% (Materials and methods), and then individual cases in each group were ordered in the relative PD-L1 expression levels (median, 5.3). (G-I) Comparison of mRNA expression of (G) CD8 , (H) GZMA and (I) HLA-A between ‘CL_High/PD-L1_High’ [cases shown in red in (F)] cases and ‘The others’. P-values were calculated by Mann-Whitney test. (J) Kaplan-Meier curves (progression-free survival) of patients by classification of tumors with T cell clonal expansion along with high PD-L1 expression (CL_High/PD-L1_High) and the other cases (The others). P-value was calculated using log-rank test.

    Journal: Oncology Reports

    Article Title: Clinical significance of T cell clonality and expression levels of immune-related genes in endometrial cancer

    doi: 10.3892/or.2017.5536

    Figure Lengend Snippet: Favorable prognosis in cases with enriched TCRβ clonotypes and high PD-L1 mRNA expression. (A and B) All 32 cases were classified into two groups by the median number of TCRβ clones with > 0.1% frequency (Materials and methods), and compared by mRNA expression of (A) CD8 and (B) GZMA . (C-E) Kaplan-Meier curves of progression-free survival for two groups classified by T cell clonal expansion in our 32 cases (C) and PD-L1 expression in our 32 cases (D) and PD-L1 expression in 540 TCGA cases (E) were evaluated by a log-rank test. Cases were classified by the median of each value. (F) All cases were classified into two groups according to high or low TCRβ clonality by the median value of numbers of TCRβ clones with the frequency of > 0.1% (Materials and methods), and then individual cases in each group were ordered in the relative PD-L1 expression levels (median, 5.3). (G-I) Comparison of mRNA expression of (G) CD8 , (H) GZMA and (I) HLA-A between ‘CL_High/PD-L1_High’ [cases shown in red in (F)] cases and ‘The others’. P-values were calculated by Mann-Whitney test. (J) Kaplan-Meier curves (progression-free survival) of patients by classification of tumors with T cell clonal expansion along with high PD-L1 expression (CL_High/PD-L1_High) and the other cases (The others). P-value was calculated using log-rank test.

    Article Snippet: The following TaqMan gene expression assays were used; TCRβ (TRB) (forward, GAGCCATCAGAAGCAGAGATCTC and reverse; GGCCAGGCACACCAGTGT, MGB probe; ACACC AAAAGGC), CD8A (Hs00233520_m1), granzyme A (GZMA ) (Hs00989184_m1), HLA-A (Hs01058806_g1), CD11c (ITGAX ) (Hs00174217_m1) and PD-L1 (Hs01125301_m1). mRNA expression levels were normalized to GAPDH expression (Hs02758991_g1).

    Techniques: Expressing, Clone Assay, MANN-WHITNEY

    Prognostic significance of cancer immune-related genes in endometrial cancer. (A and B) Kaplan-Meier curves for progression-free survival according to classification of 32 patients by the median expression level of CD8 , GZMA , HLA-A and CD11c gene (A) and to that of 540 cases from the TCGA database (B). (C) Kaplan-Meier curves for progression-free survival by the median expression level of HLA-B , HLA-C and CD163 in 540 cases from the TCGA database. P-values were calculated by a log-rank test.

    Journal: Oncology Reports

    Article Title: Clinical significance of T cell clonality and expression levels of immune-related genes in endometrial cancer

    doi: 10.3892/or.2017.5536

    Figure Lengend Snippet: Prognostic significance of cancer immune-related genes in endometrial cancer. (A and B) Kaplan-Meier curves for progression-free survival according to classification of 32 patients by the median expression level of CD8 , GZMA , HLA-A and CD11c gene (A) and to that of 540 cases from the TCGA database (B). (C) Kaplan-Meier curves for progression-free survival by the median expression level of HLA-B , HLA-C and CD163 in 540 cases from the TCGA database. P-values were calculated by a log-rank test.

    Article Snippet: The following TaqMan gene expression assays were used; TCRβ (TRB) (forward, GAGCCATCAGAAGCAGAGATCTC and reverse; GGCCAGGCACACCAGTGT, MGB probe; ACACC AAAAGGC), CD8A (Hs00233520_m1), granzyme A (GZMA ) (Hs00989184_m1), HLA-A (Hs01058806_g1), CD11c (ITGAX ) (Hs00174217_m1) and PD-L1 (Hs01125301_m1). mRNA expression levels were normalized to GAPDH expression (Hs02758991_g1).

    Techniques: Expressing

    Immune-active status was significantly high in early-stage endometrial cancer. (A-C) Comparison of mRNA expression levels of CD8 , GZMA and HLA-A in early- (stage I/II) and advanced- (stage III/IV) stages (A), in grade 1/2 and grade 3 tumors (B) and in young (≤61 years) and elderly ( > 61 years) patients (C) by Mann-Whitney test.

    Journal: Oncology Reports

    Article Title: Clinical significance of T cell clonality and expression levels of immune-related genes in endometrial cancer

    doi: 10.3892/or.2017.5536

    Figure Lengend Snippet: Immune-active status was significantly high in early-stage endometrial cancer. (A-C) Comparison of mRNA expression levels of CD8 , GZMA and HLA-A in early- (stage I/II) and advanced- (stage III/IV) stages (A), in grade 1/2 and grade 3 tumors (B) and in young (≤61 years) and elderly ( > 61 years) patients (C) by Mann-Whitney test.

    Article Snippet: The following TaqMan gene expression assays were used; TCRβ (TRB) (forward, GAGCCATCAGAAGCAGAGATCTC and reverse; GGCCAGGCACACCAGTGT, MGB probe; ACACC AAAAGGC), CD8A (Hs00233520_m1), granzyme A (GZMA ) (Hs00989184_m1), HLA-A (Hs01058806_g1), CD11c (ITGAX ) (Hs00174217_m1) and PD-L1 (Hs01125301_m1). mRNA expression levels were normalized to GAPDH expression (Hs02758991_g1).

    Techniques: Expressing, MANN-WHITNEY