proteinase k  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Millipore proteinase k
    Distinct autoantibodies against the SRP54N and SRP54G domains can both inhibit secretory protein translocation into the ER. (a) The secretory protein preprolactin (PPL) was synthesized as a 35 S-radiolabelled precursor in vitro in the presence of salt-washed rough microsomes (RM) and signal recognition particle(SRP) that was preincubated with affinity-purified autoantibodies from sera 19-1 or 25-1 on SRP54 amino acids 1–166 (Aff), with the flow-through fractions (Sup) or with buffer alone. SRP without preincubation (lanes 11 and 12) and translations without added SRP (lanes 13 and 14) or RM (lanes 15 and 16) were used as positive and negative controls, respectively. Samples were treated with <t>proteinase</t> K or not (+ or - PK) and were analysed by SDS-PAGE on 10–15% gels and by fluorography. (b) Serum 25-1 contains two distinct anti-SRP54 activities. SRP54 was synthesized as a 35 S-radiolabelled protein in vitro and either digested with V8 protease (+ V8) or incubated in the absence of protease (- V8) as described previously [17]. An aliquot of both digested and undigested material was loaded onto the gel directly (Tot). Both digested and undigested material were immunoprecipitated using 1 μl serum 25-1 (Ser), using 1 μl affinity-column flow-through (Sup) or using 1 μg affinity-purified autoantibodies from serum 25-1 (Aff). Samples were analysed by SDS-PAGE on 10–15% gels and by fluorography.
    Proteinase K, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 610 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k/product/Millipore
    Average 99 stars, based on 610 article reviews
    Price from $9.99 to $1999.99
    proteinase k - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    edta
    sds
    rnase a
    pbs
    nacl
    tris-hcl
    tris
    rna
    antigen retrieval
    triton x-100
    genomic dna
    dna extraction
    mgcl2
    digestion buffer
    pfa

    Images

    1) Product Images from "Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages"

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages

    Journal: Arthritis Research & Therapy

    doi: 10.1186/ar1895

    Distinct autoantibodies against the SRP54N and SRP54G domains can both inhibit secretory protein translocation into the ER. (a) The secretory protein preprolactin (PPL) was synthesized as a 35 S-radiolabelled precursor in vitro in the presence of salt-washed rough microsomes (RM) and signal recognition particle(SRP) that was preincubated with affinity-purified autoantibodies from sera 19-1 or 25-1 on SRP54 amino acids 1–166 (Aff), with the flow-through fractions (Sup) or with buffer alone. SRP without preincubation (lanes 11 and 12) and translations without added SRP (lanes 13 and 14) or RM (lanes 15 and 16) were used as positive and negative controls, respectively. Samples were treated with proteinase K or not (+ or - PK) and were analysed by SDS-PAGE on 10–15% gels and by fluorography. (b) Serum 25-1 contains two distinct anti-SRP54 activities. SRP54 was synthesized as a 35 S-radiolabelled protein in vitro and either digested with V8 protease (+ V8) or incubated in the absence of protease (- V8) as described previously [17]. An aliquot of both digested and undigested material was loaded onto the gel directly (Tot). Both digested and undigested material were immunoprecipitated using 1 μl serum 25-1 (Ser), using 1 μl affinity-column flow-through (Sup) or using 1 μg affinity-purified autoantibodies from serum 25-1 (Aff). Samples were analysed by SDS-PAGE on 10–15% gels and by fluorography.
    Figure Legend Snippet: Distinct autoantibodies against the SRP54N and SRP54G domains can both inhibit secretory protein translocation into the ER. (a) The secretory protein preprolactin (PPL) was synthesized as a 35 S-radiolabelled precursor in vitro in the presence of salt-washed rough microsomes (RM) and signal recognition particle(SRP) that was preincubated with affinity-purified autoantibodies from sera 19-1 or 25-1 on SRP54 amino acids 1–166 (Aff), with the flow-through fractions (Sup) or with buffer alone. SRP without preincubation (lanes 11 and 12) and translations without added SRP (lanes 13 and 14) or RM (lanes 15 and 16) were used as positive and negative controls, respectively. Samples were treated with proteinase K or not (+ or - PK) and were analysed by SDS-PAGE on 10–15% gels and by fluorography. (b) Serum 25-1 contains two distinct anti-SRP54 activities. SRP54 was synthesized as a 35 S-radiolabelled protein in vitro and either digested with V8 protease (+ V8) or incubated in the absence of protease (- V8) as described previously [17]. An aliquot of both digested and undigested material was loaded onto the gel directly (Tot). Both digested and undigested material were immunoprecipitated using 1 μl serum 25-1 (Ser), using 1 μl affinity-column flow-through (Sup) or using 1 μg affinity-purified autoantibodies from serum 25-1 (Aff). Samples were analysed by SDS-PAGE on 10–15% gels and by fluorography.

    Techniques Used: Translocation Assay, Synthesized, In Vitro, Affinity Purification, Flow Cytometry, SDS Page, Incubation, Immunoprecipitation, Affinity Column

    Human sera containing autoantibodies directed against SRP inhibit protein translocation into the ER in vitro . The secretory precursor preprolactin (PPL) was synthesized as a 35 S-radiolabelled protein using a cell-free system supplemented with signal recognition particle (SRP)-depleted endoplasmic reticulum (ER) membranes and purified SRP that had been preincubated with either buffer (lanes 1 and 2) or with no additions (lanes 3 and 4) to establish normal levels of prolactin (PL) translocation into ER-derived microsomes. The specificity of protein translocation was controlled for by performing experiments lacking exogenous SRP (lanes 5 and 6) or lacking salt-washed rough microsomal membranes (RM) (lanes 7 and 8). The complete translocation of signal-sequence-processed PL into the lumen of the ER microsomes was confirmed by showing resistance to digestion by proteinase K (cf. - and + PK). To investigate the ability of distinct autoantibodies to block function, SRP was preincubated with various anti-SRP-positive sera (S), IgG (I) or Fab (F) fractions prior to protein synthesis. TL, human control serum from a healthy individual, while 19-1, 17-1, 4-2 and 25-1 are human sera containing anti-SRP autoantibodies from polymyositis patients. Serum 5–15 is from a polymyositis patient without detectable myositis autoantibodies, and serum 1–24 is from a polymyositis patient with autoantibodies directed against histidyl-tRNA synthetase. PPL, unprocessed (signal-sequence containing) preprolactin that has not been translocated into the ER microsomes. PL, fully translocated, signal-cleaved prolactin located inside ER microsomes. Samples were analysed by SDS-PAGE on 10–15% gels and by fluorography.
    Figure Legend Snippet: Human sera containing autoantibodies directed against SRP inhibit protein translocation into the ER in vitro . The secretory precursor preprolactin (PPL) was synthesized as a 35 S-radiolabelled protein using a cell-free system supplemented with signal recognition particle (SRP)-depleted endoplasmic reticulum (ER) membranes and purified SRP that had been preincubated with either buffer (lanes 1 and 2) or with no additions (lanes 3 and 4) to establish normal levels of prolactin (PL) translocation into ER-derived microsomes. The specificity of protein translocation was controlled for by performing experiments lacking exogenous SRP (lanes 5 and 6) or lacking salt-washed rough microsomal membranes (RM) (lanes 7 and 8). The complete translocation of signal-sequence-processed PL into the lumen of the ER microsomes was confirmed by showing resistance to digestion by proteinase K (cf. - and + PK). To investigate the ability of distinct autoantibodies to block function, SRP was preincubated with various anti-SRP-positive sera (S), IgG (I) or Fab (F) fractions prior to protein synthesis. TL, human control serum from a healthy individual, while 19-1, 17-1, 4-2 and 25-1 are human sera containing anti-SRP autoantibodies from polymyositis patients. Serum 5–15 is from a polymyositis patient without detectable myositis autoantibodies, and serum 1–24 is from a polymyositis patient with autoantibodies directed against histidyl-tRNA synthetase. PPL, unprocessed (signal-sequence containing) preprolactin that has not been translocated into the ER microsomes. PL, fully translocated, signal-cleaved prolactin located inside ER microsomes. Samples were analysed by SDS-PAGE on 10–15% gels and by fluorography.

    Techniques Used: Translocation Assay, In Vitro, Synthesized, Purification, Derivative Assay, Sequencing, Blocking Assay, SDS Page

    2) Product Images from "Potent and rapid activation of tropomyosin-receptor kinase A in endometrial stromal fibroblasts by seminal plasma"

    Article Title: Potent and rapid activation of tropomyosin-receptor kinase A in endometrial stromal fibroblasts by seminal plasma

    Journal: Biology of Reproduction

    doi: 10.1093/biolre/ioy056

    The factor(s) in SP responsible for TrkA activation is degraded by proteinase K and has a molecular weight of 30–100 kDa. (A) Seminal plasma was incubated in the presence or absence of 200 μg/ml proteinase K for 18 h at 37°C, and then spiked with PMSF to inhibit further proteolytic activity. A final concentration of 1% or 10% SP (control, mock-treated, or proteinase-K treated) was exposed for 5 min to eSF from a woman without uterine pathologies, and then probed for pTrkA pY785 levels. (B) Seminal plasma was centrifuged using filter units with nominal molecular weight limits of 3, 10, 30, and 100 kDa to generate size fractions
    Figure Legend Snippet: The factor(s) in SP responsible for TrkA activation is degraded by proteinase K and has a molecular weight of 30–100 kDa. (A) Seminal plasma was incubated in the presence or absence of 200 μg/ml proteinase K for 18 h at 37°C, and then spiked with PMSF to inhibit further proteolytic activity. A final concentration of 1% or 10% SP (control, mock-treated, or proteinase-K treated) was exposed for 5 min to eSF from a woman without uterine pathologies, and then probed for pTrkA pY785 levels. (B) Seminal plasma was centrifuged using filter units with nominal molecular weight limits of 3, 10, 30, and 100 kDa to generate size fractions

    Techniques Used: Activation Assay, Molecular Weight, Incubation, Activity Assay, Concentration Assay

    3) Product Images from "SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation"

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation

    Journal: Nature structural & molecular biology

    doi: 10.1038/s41594-018-0143-4

    SAMMSON expression increases rRNA processing thus promoting protein synthesis. ( a ) Heatmap representation of pre-rRNA analysis in Mel-ST cells overexpressing SAMMSON ( SAM O/E) relative to cells transfected with an empty (Ctrl). Each pre-RNA intermediates detected was quantified with a PhosphorImager; n=3. ( b ) Quantification of relative protein synthesis (%) after a 10-minute pulse with puromycin and subsequent cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation in Mel-ST cells described in a . Error bars represent mean ± s.e.m. Total and Cyto, n=4; Mito and Mitopl, n=3. ( c ) Quantification of relative protein synthesis (%) after a 10-minute pulse with puromycin and subsequent cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation in LCL cells as described in Figure 1a ; n=5. ( d ) p32 relative expression measured by RT-qPCR in LCL cells as described in c ; n=6. ( e ) Quantification of p32 protein levels relative to the control fraction in LCL cells described in c after cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation; n=6. ( f ) Quantification of p32 protein levels relative to the control fraction after cytosol(Cyto)-mitochondria(Mito)-proteinase K-treated mitochondria(Mito+PK) fractionation in LCL cells as described in Figure 1a ; n=4. ( g ) Puromycin quantification (each point represents the average of the quantification of three different fields) of tumors as described in Figure 1e-g ; n=8. Box boundaries represent 25th and 75th percentiles; center line represents the median; whiskers, last data point within ±1.5 interquartile range. P values were calculated by paired two-tailed Student’s t-test. * P
    Figure Legend Snippet: SAMMSON expression increases rRNA processing thus promoting protein synthesis. ( a ) Heatmap representation of pre-rRNA analysis in Mel-ST cells overexpressing SAMMSON ( SAM O/E) relative to cells transfected with an empty (Ctrl). Each pre-RNA intermediates detected was quantified with a PhosphorImager; n=3. ( b ) Quantification of relative protein synthesis (%) after a 10-minute pulse with puromycin and subsequent cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation in Mel-ST cells described in a . Error bars represent mean ± s.e.m. Total and Cyto, n=4; Mito and Mitopl, n=3. ( c ) Quantification of relative protein synthesis (%) after a 10-minute pulse with puromycin and subsequent cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation in LCL cells as described in Figure 1a ; n=5. ( d ) p32 relative expression measured by RT-qPCR in LCL cells as described in c ; n=6. ( e ) Quantification of p32 protein levels relative to the control fraction in LCL cells described in c after cytosol(Cyto)-mitochondria(Mito)-mitoplast(Mitopl) fractionation; n=6. ( f ) Quantification of p32 protein levels relative to the control fraction after cytosol(Cyto)-mitochondria(Mito)-proteinase K-treated mitochondria(Mito+PK) fractionation in LCL cells as described in Figure 1a ; n=4. ( g ) Puromycin quantification (each point represents the average of the quantification of three different fields) of tumors as described in Figure 1e-g ; n=8. Box boundaries represent 25th and 75th percentiles; center line represents the median; whiskers, last data point within ±1.5 interquartile range. P values were calculated by paired two-tailed Student’s t-test. * P

    Techniques Used: Expressing, Transfection, Fractionation, Quantitative RT-PCR, Two Tailed Test

    4) Product Images from "σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus"

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00098-19

    Analysis of PNAG accumulation in σ B mutants. (a) Dot-blot analysis of PNAG accumulation in S. aureus wild-type and Δσ B mutant strains. Cell surface extracts of biofilm cultures were treated with proteinase K and spotted onto nitrocellulose filters at different dilutions (1:10 to 1:5,000). PNAG production was detected with anti- S. aureus PNAG antiserum. (b) PNAG levels of the S. aureus 15981 Δ ica mutant and the Δσ B Δ ica double mutant complemented with pSC18 plasmid, which carries the ica locus. For dot blot analysis, samples diluted 1:100, 1:1,000, and 1:5,000 were spotted onto nitrocellulose membranes, and PNAG production was detected with an anti-PNAG antiserum.
    Figure Legend Snippet: Analysis of PNAG accumulation in σ B mutants. (a) Dot-blot analysis of PNAG accumulation in S. aureus wild-type and Δσ B mutant strains. Cell surface extracts of biofilm cultures were treated with proteinase K and spotted onto nitrocellulose filters at different dilutions (1:10 to 1:5,000). PNAG production was detected with anti- S. aureus PNAG antiserum. (b) PNAG levels of the S. aureus 15981 Δ ica mutant and the Δσ B Δ ica double mutant complemented with pSC18 plasmid, which carries the ica locus. For dot blot analysis, samples diluted 1:100, 1:1,000, and 1:5,000 were spotted onto nitrocellulose membranes, and PNAG production was detected with an anti-PNAG antiserum.

    Techniques Used: Dot Blot, Mutagenesis, Plasmid Preparation

    5) Product Images from "Recombinant production of ESAT-6 antigen in thermoinducible Escherichia coli: the role of culture scale and temperature on metabolic response, expression of chaperones, and architecture of inclusion bodies"

    Article Title: Recombinant production of ESAT-6 antigen in thermoinducible Escherichia coli: the role of culture scale and temperature on metabolic response, expression of chaperones, and architecture of inclusion bodies

    Journal: Cell Stress & Chaperones

    doi: 10.1007/s12192-019-01006-x

    Kinetic comparison of proteolytic degradation of rESAT-6 IBs (50 μg/mL) harvested at the end of culture in shake flasks ( a ) and bioreactors ( b ). Proteinase-K was used for degradation at final concentration of 12 μg/mL. The progressive degradation was followed by absorbance at 350 nm for 100 min, and data were normalized. Average and standard deviation of at least two IBs obtained from independent cultures are shown. IBs were purified from thermo-induced cultures at 39 °C (closed dots) and 42 °C (open triangles)
    Figure Legend Snippet: Kinetic comparison of proteolytic degradation of rESAT-6 IBs (50 μg/mL) harvested at the end of culture in shake flasks ( a ) and bioreactors ( b ). Proteinase-K was used for degradation at final concentration of 12 μg/mL. The progressive degradation was followed by absorbance at 350 nm for 100 min, and data were normalized. Average and standard deviation of at least two IBs obtained from independent cultures are shown. IBs were purified from thermo-induced cultures at 39 °C (closed dots) and 42 °C (open triangles)

    Techniques Used: Concentration Assay, Standard Deviation, Purification

    6) Product Images from "Atomic Force Microscopy of Asymmetric Membranes from Turtle Erythrocytes"

    Article Title: Atomic Force Microscopy of Asymmetric Membranes from Turtle Erythrocytes

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2014.0115

    Digestion of the inner leaflet of the turtle erythrocyte membranes by proteinase K. (A) AFM topographic image of the digested membrane. (B) (Top) High-resolution image of the edge of the digested membrane. Arrows point to the exposed lipid bilayer after digestion (2.5 ± 0.5 nm, thickness). The bottom is the cross-sectional analysis along the black line with single arrow pointing to the lipid bilayer and double arrows pointing to the remaining proteins or peptides. (C) The height distribution of proteins in the membrane after digestion is from 1.5 to 12.5 nm with the peak at 4–6 nm. Scale bars; 2 μm in (A); 200 nm in (B).
    Figure Legend Snippet: Digestion of the inner leaflet of the turtle erythrocyte membranes by proteinase K. (A) AFM topographic image of the digested membrane. (B) (Top) High-resolution image of the edge of the digested membrane. Arrows point to the exposed lipid bilayer after digestion (2.5 ± 0.5 nm, thickness). The bottom is the cross-sectional analysis along the black line with single arrow pointing to the lipid bilayer and double arrows pointing to the remaining proteins or peptides. (C) The height distribution of proteins in the membrane after digestion is from 1.5 to 12.5 nm with the peak at 4–6 nm. Scale bars; 2 μm in (A); 200 nm in (B).

    Techniques Used:

    7) Product Images from "Type III Secretion Needle Proteins Induce Cell Signaling and Cytokine Secretion via Toll-Like Receptors"

    Article Title: Type III Secretion Needle Proteins Induce Cell Signaling and Cytokine Secretion via Toll-Like Receptors

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01705-14

    Treatment of needle proteins with proteinase K, lipoprotein lipase, and polymyxin B retains NF-κB/AP-1 activation. Needle proteins (1 μg/ml) (A, B, and C) and LcrG (1 μg/ml) (B and C), PBS, flagellin (1 μg/ml) (A), Pam3
    Figure Legend Snippet: Treatment of needle proteins with proteinase K, lipoprotein lipase, and polymyxin B retains NF-κB/AP-1 activation. Needle proteins (1 μg/ml) (A, B, and C) and LcrG (1 μg/ml) (B and C), PBS, flagellin (1 μg/ml) (A), Pam3

    Techniques Used: Activation Assay

    Related Articles

    Synthesized:

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: For translocation assays, full-length PPL was synthesized as a 35 S-methionine-labelled precursor using a wheatgerm cell-free translation system supplemented with 0.06 OD280 units of salt-washed dog pancreas rough microsomes [ ] and 20 nM canine SRP [ ] for 1 hour at 25°C. .. One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma).

    Quantitative RT-PCR:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating. .. Mitochondria and mitoplast enrichment was validated by RT-qPCR for the 16S mt-rRNA and by western blot using antibodies directed against multiple mitochondrial proteins and calreticulin or calnexin (in order to exclude the possibility of ER contaminants).

    Incubation:

    Article Title: Candesartan augments ischemia-induced proangiogenic state and results in sustained improvement after stroke
    Article Snippet: .. Slides were deparaffinized, rehydrated in solution of 0.1% Triton-X-100 (Fisher Scientific), flooded with a solution of Proteinase K (20 µg/mL) and 0.05% Trypsin for antigen retrieval, and incubated for 30 minutes at 30° C. For EBA analysis, slides were rinsed 3 times with PBS and blocked with 2% normal calf serum solution (Sigma). .. A solution of primary mouse anti-EBA antibody (Sternberger Monoclonals SMI-71, Baltimore, MD) was flooded onto each slide and incubated at room temperature for 1 hour in a humidified chamber.

    Article Title: The eIF2A knockout mouse
    Article Snippet: Mice were screened prior to weaning at the age of 12–17 d. For genotyping, tail snip DNA was extracted using tail lysis procedure with Proteinase K. The lysis (L) buffer contained 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM EDTA, 1% Sarkosyl, 5 mM DTT, 0.05 mM Spermidine and 2 μl proteinase K (Sigma) per 100 μl of the buffer. .. Mice tails in buffer L + proteinase K (300–400 μl/tail) were incubated overnight at 65°C, diluted 1:40, heated at 95°C for 5 min and used for PCR reactions.

    Article Title: σB Inhibits Poly-N-Acetylglucosamine Exopolysaccharide Synthesis and Biofilm Formation in Staphylococcus aureus
    Article Snippet: .. The cells were incubated for 5 min at 100°C, and 40 μl of the supernatant was incubated with 10 μl of proteinase K (20 mg/ml; Sigma) for 30 min at 37°C. .. After addition of 10 μl of Tris-buffered saline (20 mM Tris-HCl, 150 mM NaCl [pH 7.4]) containing 0.01% bromophenol blue, 5 μl of sample dilutions was spotted on a nitrocellulose filter using a Bio-Dot microfiltration apparatus (Bio-Rad), blocked overnight, and incubated for 2 h with an anti- S. aureus PNAG antibody diluted 1:20,000 ( ).

    Article Title: Potent and rapid activation of tropomyosin-receptor kinase A in endometrial stromal fibroblasts by seminal plasma
    Article Snippet: To confirm the degradation of seminal proteins by proteinase K, 200 μg/ml of proteinase K (Sigma-Aldrich) was added to 100% SP for 18 h at 37°C. .. After this incubation, 5 mM PMSF (Sigma-Aldrich) was added to the tube to inactivate proteinase K. 6X Laemmli buffer was added to the sample, which was then boiled for 5 min at 95°C.

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: Mitoplasts were obtained by incubating purified mitochondria in RNase A-containing hypotonic buffer (HEPES pH 7.2 supplemented with 1× Halt Protease and Phosphatase Inhibitor Single-Use Cocktail (Life Technologies) and 10 µg mL-1 RNase A (Roche)) for 20 min on ice and subsequently incubated for 10 additional min at room temperature in order to remove all possible RNA contaminants. .. For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating.

    Article Title: Type III Secretion Needle Proteins Induce Cell Signaling and Cytokine Secretion via Toll-Like Receptors
    Article Snippet: .. Needle proteins and flagellin (standard flagellin from Salmonella Typhimurium; Invivogen) were incubated with 40 μg/ml proteinase K (Thermo-Fisher) at 37°C for 16 h. Proteinase K was then inactivated with 1.6 mg/ml phenylmethylsulfonyl fluoride (PMSF; Sigma-Aldrich, St. Louis, MO). .. Needle proteins and Pam3 CSK4 (Invivogen) were incubated with 50 μg/ml of bacterial lipoprotein lipase (LPL) (lipoprotein lipase from Pseudomonas sp. ; Sigma-Aldrich) in 1× PBS at 37°C for 12 h. THP-1 cells were stimulated with 20 μg/ml of polymyxin B (Invivogen) and needle proteins or lipopolysaccharide (LPS) as a control for 24 h. PBS treated with proteinase K, lipoprotein lipase, or polymyxin B was used as a negative control.

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma). .. To assay the effect of autoantibodies on SRP function, 3 μl of 250 nM SRP were incubated with 1 μl patient serum or 1 μg IgG or Fab in 20 mM Hepes-KOH, pH 7.9, 250 mM potassium acetate at 25°C for 30 minutes.

    Article Title: Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses
    Article Snippet: The OsTPR1 extracellular domain/region was identified by protease protection assays using trypsin (Amresco) or protease K (Sigma). .. The rice protoplast or N. benthamiana that expressed OsTPR1-GFP or GFP proteins were incubated with proteases at 28°C.

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C. .. To study aggrecan distribution, sections were preincubated with 10 µg/ml proteinase K for 10 min at 50°C, and to localize the laminin γ1 chain, sections were incubated with 0.005% Trypsin for 10 min at 37°C.

    Cell Fractionation:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: Paragraph title: Cellular fractionation and mitoplast isolation ... For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating.

    Western Blot:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating. .. Mitochondria and mitoplast enrichment was validated by RT-qPCR for the 16S mt-rRNA and by western blot using antibodies directed against multiple mitochondrial proteins and calreticulin or calnexin (in order to exclude the possibility of ER contaminants).

    Transformation Assay:

    Article Title: Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses
    Article Snippet: Rice protoplast preparation and plasmid transformation were performed according to the methods of . .. The OsTPR1 extracellular domain/region was identified by protease protection assays using trypsin (Amresco) or protease K (Sigma).

    Translocation Assay:

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: .. One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma). .. The proteinase K was quenched by precipitation with 10% trichloroacetic acid (final concentration) at 4°C for 30 minutes.

    Immunohistochemistry:

    Article Title: Candesartan augments ischemia-induced proangiogenic state and results in sustained improvement after stroke
    Article Snippet: The immunohistochemical analyses were performed on additional slide-mounted, paraffin-embedded 5µm thick sections collected at 7 days as described above. .. Slides were deparaffinized, rehydrated in solution of 0.1% Triton-X-100 (Fisher Scientific), flooded with a solution of Proteinase K (20 µg/mL) and 0.05% Trypsin for antigen retrieval, and incubated for 30 minutes at 30° C. For EBA analysis, slides were rinsed 3 times with PBS and blocked with 2% normal calf serum solution (Sigma).

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: Paragraph title: Histology and immunohistochemistry ... To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C.

    Cell Culture:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: Cellular fractionation and mitoplast isolation Briefly, mitochondria were purified from 4-6 × 107 cells using mitochondria isolation kit for cultured cells (Thermo Fisher Scientific) according to manufacturer instructions, all buffers were supplemented with 60 U mL−1 Superase-In (Ambion) and 1× Halt Protease and Phosphatase Inhibitor Single-Use Cocktail (Life Technologies)). .. For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating.

    other:

    Article Title: Atomic Force Microscopy of Asymmetric Membranes from Turtle Erythrocytes
    Article Snippet: Digestion of the inner leaflet of erythrocyte membranes with proteinase K The inner leaflet of erythrocyte membranes was prepared as described above and then digested with 1.0 mg/ml proteinase K (Sigma) for 30 min at 37°C.

    Polymerase Chain Reaction:

    Article Title: The eIF2A knockout mouse
    Article Snippet: Mice were screened prior to weaning at the age of 12–17 d. For genotyping, tail snip DNA was extracted using tail lysis procedure with Proteinase K. The lysis (L) buffer contained 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM EDTA, 1% Sarkosyl, 5 mM DTT, 0.05 mM Spermidine and 2 μl proteinase K (Sigma) per 100 μl of the buffer. .. Mice tails in buffer L + proteinase K (300–400 μl/tail) were incubated overnight at 65°C, diluted 1:40, heated at 95°C for 5 min and used for PCR reactions.

    Immunofluorescence:

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: The organization of the growth plate was assessed by hematoxylin/eosin/alcian blue staining and the distribution of ECM proteins was determined by immunofluorescence microscopy. .. To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C.

    Isolation:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: Paragraph title: Cellular fractionation and mitoplast isolation ... For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating.

    Microscopy:

    Article Title: Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses
    Article Snippet: Forty-eight hours later, the expressed proteins were observed using a confocal laser microscope (Leica Model TCS SP8). .. The OsTPR1 extracellular domain/region was identified by protease protection assays using trypsin (Amresco) or protease K (Sigma).

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: The organization of the growth plate was assessed by hematoxylin/eosin/alcian blue staining and the distribution of ECM proteins was determined by immunofluorescence microscopy. .. To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C.

    Mouse Assay:

    Article Title: The eIF2A knockout mouse
    Article Snippet: .. Mice were screened prior to weaning at the age of 12–17 d. For genotyping, tail snip DNA was extracted using tail lysis procedure with Proteinase K. The lysis (L) buffer contained 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM EDTA, 1% Sarkosyl, 5 mM DTT, 0.05 mM Spermidine and 2 μl proteinase K (Sigma) per 100 μl of the buffer. .. Mice tails in buffer L + proteinase K (300–400 μl/tail) were incubated overnight at 65°C, diluted 1:40, heated at 95°C for 5 min and used for PCR reactions.

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: Microtome sections (5 µm) of decalcified right femora from mice were used for morphological and immunohistological analyses. .. To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C.

    Lysis:

    Article Title: The eIF2A knockout mouse
    Article Snippet: .. Mice were screened prior to weaning at the age of 12–17 d. For genotyping, tail snip DNA was extracted using tail lysis procedure with Proteinase K. The lysis (L) buffer contained 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM EDTA, 1% Sarkosyl, 5 mM DTT, 0.05 mM Spermidine and 2 μl proteinase K (Sigma) per 100 μl of the buffer. .. Mice tails in buffer L + proteinase K (300–400 μl/tail) were incubated overnight at 65°C, diluted 1:40, heated at 95°C for 5 min and used for PCR reactions.

    Purification:

    Article Title: SAMMSON fosters cancer cell fitness by enhancing concertedly mitochondrial and cytosolic translation
    Article Snippet: .. For proteinase K experiments, purified mitochondria were resuspended in 1× sucrose buffer (SB: HEPES 10 mM, sucrose 280 mM, EGTA 1 mM pH 7,4) supplemented with 100 µg mL-1 proteinase K (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) for 30 min at 4 °C rotating. .. Afterwards, mitochondria were resuspended in 1× SB supplemented with 20 nM PMSF (Sigma-Aldrich) and with 60 U mL−1 Superase-In (Ambion) and pelleted at 9,000 x g for 10 min. An additional washing step was performed with 1× SB supplemented with 20 nM PMSF (Sigma-Aldrich) and 1× Halt Protease and Phosphatase Inhibitor Single-Use Cocktail (Life Technologies) and with 60 U mL−1 Superase-In (Ambion).

    Article Title: Type III Secretion Needle Proteins Induce Cell Signaling and Cytokine Secretion via Toll-Like Receptors
    Article Snippet: Paragraph title: Enzyme digestion and lipoprotein treatment of needle proteins or purified needles and polymyxin B treatment of THP-1 cells. ... Needle proteins and flagellin (standard flagellin from Salmonella Typhimurium; Invivogen) were incubated with 40 μg/ml proteinase K (Thermo-Fisher) at 37°C for 16 h. Proteinase K was then inactivated with 1.6 mg/ml phenylmethylsulfonyl fluoride (PMSF; Sigma-Aldrich, St. Louis, MO).

    Article Title: Recombinant production of ESAT-6 antigen in thermoinducible Escherichia coli: the role of culture scale and temperature on metabolic response, expression of chaperones, and architecture of inclusion bodies
    Article Snippet: IBs obtained were subject to proteolytic digestion as previously reported by Castellanos-Mendoza et al. ( ) using proteinase-K (Merck-Sigma-Aldrich, St. Louis, MI, USA) at 12 μg/mL (final concentration). .. Digestion was performed with 50 μg/mL of purified IBs diluted in buffer (50 mM Tris–HCl and 150 mM NaCl at pH 8.0) to a final volume of 1.0 mL.

    SDS Page:

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: .. One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma). .. The proteinase K was quenched by precipitation with 10% trichloroacetic acid (final concentration) at 4°C for 30 minutes.

    Plasmid Preparation:

    Article Title: Candesartan augments ischemia-induced proangiogenic state and results in sustained improvement after stroke
    Article Snippet: Slides were deparaffinized, rehydrated in solution of 0.1% Triton-X-100 (Fisher Scientific), flooded with a solution of Proteinase K (20 µg/mL) and 0.05% Trypsin for antigen retrieval, and incubated for 30 minutes at 30° C. For EBA analysis, slides were rinsed 3 times with PBS and blocked with 2% normal calf serum solution (Sigma). .. Slides were washed 3 times in PBS and a solution of secondary antibody, biotinylated horse anti-mouse (Vector BA-2001 #C0804, Burlingame, CA) was applied and incubated at room temperature for 30 minutes in a humidified chamber.

    Article Title: Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses
    Article Snippet: Rice protoplast preparation and plasmid transformation were performed according to the methods of . .. The OsTPR1 extracellular domain/region was identified by protease protection assays using trypsin (Amresco) or protease K (Sigma).

    Software:

    Article Title: Binding of the Magnaporthe oryzae Chitinase MoChia1 by a Rice Tetratricopeptide Repeat Protein Allows Free Chitin to Trigger Immune Responses
    Article Snippet: Confocal images were analyzed using Leica LAS AF software. .. The OsTPR1 extracellular domain/region was identified by protease protection assays using trypsin (Amresco) or protease K (Sigma).

    Negative Control:

    Article Title: Type III Secretion Needle Proteins Induce Cell Signaling and Cytokine Secretion via Toll-Like Receptors
    Article Snippet: Needle proteins and flagellin (standard flagellin from Salmonella Typhimurium; Invivogen) were incubated with 40 μg/ml proteinase K (Thermo-Fisher) at 37°C for 16 h. Proteinase K was then inactivated with 1.6 mg/ml phenylmethylsulfonyl fluoride (PMSF; Sigma-Aldrich, St. Louis, MO). .. Needle proteins and Pam3 CSK4 (Invivogen) were incubated with 50 μg/ml of bacterial lipoprotein lipase (LPL) (lipoprotein lipase from Pseudomonas sp. ; Sigma-Aldrich) in 1× PBS at 37°C for 12 h. THP-1 cells were stimulated with 20 μg/ml of polymyxin B (Invivogen) and needle proteins or lipopolysaccharide (LPS) as a control for 24 h. PBS treated with proteinase K, lipoprotein lipase, or polymyxin B was used as a negative control.

    In Vitro:

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: Paragraph title: In vitro translation and translocation of preprolactin ... One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma).

    Spectrophotometry:

    Article Title: Recombinant production of ESAT-6 antigen in thermoinducible Escherichia coli: the role of culture scale and temperature on metabolic response, expression of chaperones, and architecture of inclusion bodies
    Article Snippet: IBs obtained were subject to proteolytic digestion as previously reported by Castellanos-Mendoza et al. ( ) using proteinase-K (Merck-Sigma-Aldrich, St. Louis, MI, USA) at 12 μg/mL (final concentration). .. Absorbance was monitored at 350 nm for 100 min (DU®730 UV/Vis Spectrophotometer, Beckman Coulter, Brea, CA, USA).

    Concentration Assay:

    Article Title: Human autoantibodies against the 54 kDa protein of the signal recognition particle block function at multiple stages
    Article Snippet: One aliquot of the translocation reaction was analysed directly by SDS-PAGE, a further aliquot was digested with 0.3 mg/ml proteinase K (Boehringer Mannheim, Mannheim, Germany) for 10 minutes at 25°C and a third aliquot was treated with proteinase K in the presence of 0.5% Nonidet-P40 (Sigma). .. The proteinase K was quenched by precipitation with 10% trichloroacetic acid (final concentration) at 4°C for 30 minutes.

    Article Title: Recombinant production of ESAT-6 antigen in thermoinducible Escherichia coli: the role of culture scale and temperature on metabolic response, expression of chaperones, and architecture of inclusion bodies
    Article Snippet: .. IBs obtained were subject to proteolytic digestion as previously reported by Castellanos-Mendoza et al. ( ) using proteinase-K (Merck-Sigma-Aldrich, St. Louis, MI, USA) at 12 μg/mL (final concentration). .. Digestion was performed with 50 μg/mL of purified IBs diluted in buffer (50 mM Tris–HCl and 150 mM NaCl at pH 8.0) to a final volume of 1.0 mL.

    Staining:

    Article Title: Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
    Article Snippet: The organization of the growth plate was assessed by hematoxylin/eosin/alcian blue staining and the distribution of ECM proteins was determined by immunofluorescence microscopy. .. To detect collagen II and X, sections were pretreated with 0.025% pepsin for 15 min at 37°C, 5 mg/ml hyaluronidase (Sigma-Aldrich) for 30 min at 37°C, and 10 µg/ml proteinase K (Sigma-Aldrich) for 10 min at 50°C.

    Variant Assay:

    Article Title: The eIF2A knockout mouse
    Article Snippet: Mice were screened prior to weaning at the age of 12–17 d. For genotyping, tail snip DNA was extracted using tail lysis procedure with Proteinase K. The lysis (L) buffer contained 25 mM Tris-HCl pH 7.5, 100 mM NaCl, 50 mM EDTA, 1% Sarkosyl, 5 mM DTT, 0.05 mM Spermidine and 2 μl proteinase K (Sigma) per 100 μl of the buffer. .. The following pairs of primers were used to detect either the wild-type eIF2A gene Ffwd : 5′-GCCTTTCTTGAACTCTCACC-3′ and Rrev : 5′-GCAGACCACAGGTCACACAT-3′, giving raise to 357 bp product and/or its disrupted variant Ffwd : 5′-GCCTTTCTTGAACTCTCACC-3′ and RVrev : 5′- CCAATAAACCCTCTTGCAGTTGC −3′ (216 product).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • proteinase k  (Millipore)
    99
    Millipore proteinase k
    Tim23p lacking the fourth TM segment is not efficiently imported into mitochondria. (A) Tim23p lacking the fourth TM segment is incompletely imported into mitochondria. Constructs of Tim23p lacking the fourth TM segment (Δ4) or lacking loop L3 and the fourth TM segment (ΔL3Δ4) were generated. Schematic representations of the constructs are shown to the left of the gel. The three proteins were synthesized and incubated with mitochondria. After the import reaction, samples were either analyzed directly (mitos) or after treatment with 200 μg/ml trypsin (mitos + trypsin) or 200 μg/ml <t>proteinase</t> K (mitos + proK). Mitochondrial pellets were analyzed by SDS-PAGE and fluorography. (B) The fourth TM segment and loop L3 are not required for Tim23p function. tim23::URA3 trp1 leu2 cyh2 strain KRR146 carrying TIM23-TRP1-CYH2 plasmid pKR1 was transformed with six different plasmids: LEU2 -containing plasmid pJE50, which expresses wt Tim23p; pAD75, which expresses Tim23p lacking the fourth TM segment (TM4); pKR2, which lacks loop L3 and TM4; pKR34, which lacks the TM3 and TM4; pKR40, which lacks TM2, TM3, and TM4; and the empty vector pRS315. Leu+ colonies were patched out onto synthetic complete medium lacking leucine (SD−Leu). Patches were grown at 30°C for 2 d, and then replica-plated onto YEPD medium containing 10 mg/L cycloheximide (YEPD + CYH). Yeast cells that contain a functional Tim23 protein are able to lose the TIM23-TRP1-CYH2 plasmid and grow in the presence of cycloheximide.
    Proteinase K, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 610 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k/product/Millipore
    Average 99 stars, based on 610 article reviews
    Price from $9.99 to $1999.99
    proteinase k - by Bioz Stars, 2020-04
    99/100 stars
    		  Buy from Supplier
    proteinase k inhibitor  (Millipore)
    94
    Millipore proteinase k inhibitor
    Detection of CDK2 in HBV capsids purified from HepG2 cells by Western blotting. HBV capsids (0.5 μg) were digested with <t>proteinase</t> K (PK) agarose beads as described in Materials and Methods. Proteinase K was then inactivated by the addition of the proteinase K inhibitor, and the sample was resolved by SDS-PAGE (lanes 8 and 10), along with the same amount of undigested capsids from the same fractions (lanes 7 and 9). Purified GST-CDK2 standards (lanes 1 to 3) and total lysate from HepG2 cells (lane 4) were loaded as controls for CDK2 detection. A sucrose fraction that did not contain HBV capsids was also treated with the proteinase K agarose beads to ensure that contaminating proteins were removed by the digestion (lane 6) or mock treated (lane 5). The capsids loaded in lanes 9 and 10 were from a capsid-positive sucrose fraction of higher purity than those loaded in lanes 7 and 8. CDK2 was detected by Western blotting using the anti-CDK2 antibody (top panel). HBc was visualized by Sypro ruby staining (bottom panel). C, core protein.
    Proteinase K Inhibitor, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k inhibitor/product/Millipore
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    proteinase k inhibitor - by Bioz Stars, 2020-04
    94/100 stars
    		  Buy from Supplier

    Image Search Results


    Tim23p lacking the fourth TM segment is not efficiently imported into mitochondria. (A) Tim23p lacking the fourth TM segment is incompletely imported into mitochondria. Constructs of Tim23p lacking the fourth TM segment (Δ4) or lacking loop L3 and the fourth TM segment (ΔL3Δ4) were generated. Schematic representations of the constructs are shown to the left of the gel. The three proteins were synthesized and incubated with mitochondria. After the import reaction, samples were either analyzed directly (mitos) or after treatment with 200 μg/ml trypsin (mitos + trypsin) or 200 μg/ml proteinase K (mitos + proK). Mitochondrial pellets were analyzed by SDS-PAGE and fluorography. (B) The fourth TM segment and loop L3 are not required for Tim23p function. tim23::URA3 trp1 leu2 cyh2 strain KRR146 carrying TIM23-TRP1-CYH2 plasmid pKR1 was transformed with six different plasmids: LEU2 -containing plasmid pJE50, which expresses wt Tim23p; pAD75, which expresses Tim23p lacking the fourth TM segment (TM4); pKR2, which lacks loop L3 and TM4; pKR34, which lacks the TM3 and TM4; pKR40, which lacks TM2, TM3, and TM4; and the empty vector pRS315. Leu+ colonies were patched out onto synthetic complete medium lacking leucine (SD−Leu). Patches were grown at 30°C for 2 d, and then replica-plated onto YEPD medium containing 10 mg/L cycloheximide (YEPD + CYH). Yeast cells that contain a functional Tim23 protein are able to lose the TIM23-TRP1-CYH2 plasmid and grow in the presence of cycloheximide.

    Journal: Molecular Biology of the Cell

    Article Title: Tim23p Contains Separate and Distinct Signals for Targeting to Mitochondria and Insertion into the Inner Membrane

    doi:

    Figure Lengend Snippet: Tim23p lacking the fourth TM segment is not efficiently imported into mitochondria. (A) Tim23p lacking the fourth TM segment is incompletely imported into mitochondria. Constructs of Tim23p lacking the fourth TM segment (Δ4) or lacking loop L3 and the fourth TM segment (ΔL3Δ4) were generated. Schematic representations of the constructs are shown to the left of the gel. The three proteins were synthesized and incubated with mitochondria. After the import reaction, samples were either analyzed directly (mitos) or after treatment with 200 μg/ml trypsin (mitos + trypsin) or 200 μg/ml proteinase K (mitos + proK). Mitochondrial pellets were analyzed by SDS-PAGE and fluorography. (B) The fourth TM segment and loop L3 are not required for Tim23p function. tim23::URA3 trp1 leu2 cyh2 strain KRR146 carrying TIM23-TRP1-CYH2 plasmid pKR1 was transformed with six different plasmids: LEU2 -containing plasmid pJE50, which expresses wt Tim23p; pAD75, which expresses Tim23p lacking the fourth TM segment (TM4); pKR2, which lacks loop L3 and TM4; pKR34, which lacks the TM3 and TM4; pKR40, which lacks TM2, TM3, and TM4; and the empty vector pRS315. Leu+ colonies were patched out onto synthetic complete medium lacking leucine (SD−Leu). Patches were grown at 30°C for 2 d, and then replica-plated onto YEPD medium containing 10 mg/L cycloheximide (YEPD + CYH). Yeast cells that contain a functional Tim23 protein are able to lose the TIM23-TRP1-CYH2 plasmid and grow in the presence of cycloheximide.

    Article Snippet: Samples were treated with the indicated amounts of trypsin (Sigma) or proteinase K (Calbiochem, San Diego, CA) for 20 min on ice, followed by the addition of either 1 mg/ml soybean trypsin inhibitor (Sigma) or 1 mM phenylmethylsulfonyl fluoride (Sigma).

    Techniques: Construct, Generated, Synthesized, Incubation, SDS Page, Plasmid Preparation, Transformation Assay, Functional Assay

    Internal positively charged segments mediate the insertion of Tim23p into the IM but are not required for import into mitochondria. (A) The Tim23, L1Neut, L3Neut, and L1L3Neut proteins were synthesized in the presence of 35 S-methionine and imported into isolated mitochondria as described in MATERIALS AND METHODS. To dissipate the IM potential (−Δψ), mitochondria were preincubated with 250 mM KCl and 40 μM valinomycin. After import, mitochondria were treated with 200 μg/ml trypsin, split into aliquots, and reisolated by centrifugation. Two sets of samples were resuspended in SDS-sample buffer (mitos + protease; −Δψ mitos + protease). In the other samples, the OM was disrupted by OS, and the resulting mitoplasts were treated with 50 μg/ml proteinase K. Mitoplasts were isolated by centrifugation and resuspended in SDS-sample buffer (mitoplasts + protease). Proteins were separated by SDS-PAGE, and radiolabeled proteins were visualized by fluorography; 20% of the translation product used in the import reactions is also shown. The arrow indicates the 14-kDa fragment of Tim23p protected from protease digestion in mitoplasts, indicative of the proper insertion of Tim23p into the IM. (B) Radiolabeled Tim23, L1Neut, L3Neut, L1L3Neut, and F1β proteins were imported into mitochondria and treated with 200 μg/ml proteinase K. Mitochondria were isolated by centrifugation, and the pellets were resuspended in 0.1 M sodium carbonate, pH 11.4. After incubation on ice for 30 min, samples were spun at 100,000 × g for 30 min at 4°C. Pellets and supernatants were subjected to SDS-PAGE, fluorography, and densitometry. The amount of the Tim23, L1Neut, L3Neut, L1L3Neut, and F1β proteins found in the pellet fraction is indicated.

    Journal: Molecular Biology of the Cell

    Article Title: Tim23p Contains Separate and Distinct Signals for Targeting to Mitochondria and Insertion into the Inner Membrane

    doi:

    Figure Lengend Snippet: Internal positively charged segments mediate the insertion of Tim23p into the IM but are not required for import into mitochondria. (A) The Tim23, L1Neut, L3Neut, and L1L3Neut proteins were synthesized in the presence of 35 S-methionine and imported into isolated mitochondria as described in MATERIALS AND METHODS. To dissipate the IM potential (−Δψ), mitochondria were preincubated with 250 mM KCl and 40 μM valinomycin. After import, mitochondria were treated with 200 μg/ml trypsin, split into aliquots, and reisolated by centrifugation. Two sets of samples were resuspended in SDS-sample buffer (mitos + protease; −Δψ mitos + protease). In the other samples, the OM was disrupted by OS, and the resulting mitoplasts were treated with 50 μg/ml proteinase K. Mitoplasts were isolated by centrifugation and resuspended in SDS-sample buffer (mitoplasts + protease). Proteins were separated by SDS-PAGE, and radiolabeled proteins were visualized by fluorography; 20% of the translation product used in the import reactions is also shown. The arrow indicates the 14-kDa fragment of Tim23p protected from protease digestion in mitoplasts, indicative of the proper insertion of Tim23p into the IM. (B) Radiolabeled Tim23, L1Neut, L3Neut, L1L3Neut, and F1β proteins were imported into mitochondria and treated with 200 μg/ml proteinase K. Mitochondria were isolated by centrifugation, and the pellets were resuspended in 0.1 M sodium carbonate, pH 11.4. After incubation on ice for 30 min, samples were spun at 100,000 × g for 30 min at 4°C. Pellets and supernatants were subjected to SDS-PAGE, fluorography, and densitometry. The amount of the Tim23, L1Neut, L3Neut, L1L3Neut, and F1β proteins found in the pellet fraction is indicated.

    Article Snippet: Samples were treated with the indicated amounts of trypsin (Sigma) or proteinase K (Calbiochem, San Diego, CA) for 20 min on ice, followed by the addition of either 1 mg/ml soybean trypsin inhibitor (Sigma) or 1 mM phenylmethylsulfonyl fluoride (Sigma).

    Techniques: Synthesized, Isolation, Centrifugation, SDS Page, Incubation

    The hydrophobic carboxyl terminus of Tim23p carries targeting information. Tim23Np, which consists of amino acids 1–96 of Tim23p, Tim23Cp, which contains residues 95–222, and wt Tim23p were synthesized in the presence of 35 S-methionine and imported into isolated mitochondria in the presence or absence (−Δψ) of membrane potential. After import, mitochondria were treated with 200 μg/ml trypsin, split into aliquots, and reisolated by centrifugation. Two sets of samples were resuspended in SDS-sample buffer (mitos + protease; −Δψ mitos + protease). In the other samples, the OM was disrupted by OS, and the resulting mitoplasts were treated with 50 μg/ml proteinase K. Mitoplasts were isolated by centrifugation and resuspended in SDS-sample buffe r (mitoplasts + protease). Proteins were separated by SDS-PAGE, and radiolabeled proteins were visualized by fluorography. Twenty percent of the translation product used in the import reactions is also shown. The arrow indicates the 14-kDa fragment of Tim23p protected from protease digestion in mitoplasts, indicative of the proper insertion of Tim23p into the IM.

    Journal: Molecular Biology of the Cell

    Article Title: Tim23p Contains Separate and Distinct Signals for Targeting to Mitochondria and Insertion into the Inner Membrane

    doi:

    Figure Lengend Snippet: The hydrophobic carboxyl terminus of Tim23p carries targeting information. Tim23Np, which consists of amino acids 1–96 of Tim23p, Tim23Cp, which contains residues 95–222, and wt Tim23p were synthesized in the presence of 35 S-methionine and imported into isolated mitochondria in the presence or absence (−Δψ) of membrane potential. After import, mitochondria were treated with 200 μg/ml trypsin, split into aliquots, and reisolated by centrifugation. Two sets of samples were resuspended in SDS-sample buffer (mitos + protease; −Δψ mitos + protease). In the other samples, the OM was disrupted by OS, and the resulting mitoplasts were treated with 50 μg/ml proteinase K. Mitoplasts were isolated by centrifugation and resuspended in SDS-sample buffe r (mitoplasts + protease). Proteins were separated by SDS-PAGE, and radiolabeled proteins were visualized by fluorography. Twenty percent of the translation product used in the import reactions is also shown. The arrow indicates the 14-kDa fragment of Tim23p protected from protease digestion in mitoplasts, indicative of the proper insertion of Tim23p into the IM.

    Article Snippet: Samples were treated with the indicated amounts of trypsin (Sigma) or proteinase K (Calbiochem, San Diego, CA) for 20 min on ice, followed by the addition of either 1 mg/ml soybean trypsin inhibitor (Sigma) or 1 mM phenylmethylsulfonyl fluoride (Sigma).

    Techniques: Synthesized, Isolation, Centrifugation, SDS Page

    A working model for the topology of the Tim23 protein in the mitochondrial inner membrane (IM). (A) The Tim23p contains four predicted TM segments and its amino and carboxyl termini have been shown to face the intermembrane space (IMS). TM segments are indicated by the numbered rectangles, and loops L1 and L3 are proposed to face the matrix as indicated. (B) An HA epitope inserted into loop L2 of Tim23p faces the IMS. Mitochondria were isolated yeast cells expressing Tim23p with the HA epitope in loop L2 from plasmid pAD91 (called I-HA). As controls mitochondria were isolated from wt cells (WT), and cells expressing Tim23p with the HA epitope inserted at its C terminus from plasmid pJE8 (called C-HA). Intact mitochondria were digested with 100 μg/ml proteinase K for 30 min at 0°C, and mitochondria whose OM was disrupted by OS were digested with 50 μg/ml proteinase K. Mitochondrial proteins were immune blotted with antibodies to the amino-terminal domain of Tim23p, the HA epitope, the matrix protein α-MPP, or the OM protein, Tom70p.

    Journal: Molecular Biology of the Cell

    Article Title: Tim23p Contains Separate and Distinct Signals for Targeting to Mitochondria and Insertion into the Inner Membrane

    doi:

    Figure Lengend Snippet: A working model for the topology of the Tim23 protein in the mitochondrial inner membrane (IM). (A) The Tim23p contains four predicted TM segments and its amino and carboxyl termini have been shown to face the intermembrane space (IMS). TM segments are indicated by the numbered rectangles, and loops L1 and L3 are proposed to face the matrix as indicated. (B) An HA epitope inserted into loop L2 of Tim23p faces the IMS. Mitochondria were isolated yeast cells expressing Tim23p with the HA epitope in loop L2 from plasmid pAD91 (called I-HA). As controls mitochondria were isolated from wt cells (WT), and cells expressing Tim23p with the HA epitope inserted at its C terminus from plasmid pJE8 (called C-HA). Intact mitochondria were digested with 100 μg/ml proteinase K for 30 min at 0°C, and mitochondria whose OM was disrupted by OS were digested with 50 μg/ml proteinase K. Mitochondrial proteins were immune blotted with antibodies to the amino-terminal domain of Tim23p, the HA epitope, the matrix protein α-MPP, or the OM protein, Tom70p.

    Article Snippet: Samples were treated with the indicated amounts of trypsin (Sigma) or proteinase K (Calbiochem, San Diego, CA) for 20 min on ice, followed by the addition of either 1 mg/ml soybean trypsin inhibitor (Sigma) or 1 mM phenylmethylsulfonyl fluoride (Sigma).

    Techniques: Isolation, Expressing, Plasmid Preparation

    Size modulation of PrP Sc oligomers by anle138b and inhibition of various human and non-human prion strains in PMCA. ( a , b ) Size distribution of PrP Sc aggregates was analyzed by sucrose-gradient centrifugation. Mice treated with anle138b show a strong reduction of high molecular weight species (fractions 7–12). Also small molecular weight oligomers (fractions 3–4) are reduced and show a shift towards smaller size (fraction 2) indicating that anle138b blocks aggregation at the level of small oligomers. DMSO-treated mice are indistinguishable from terminally ill untreated mice. ( c , d ) For PMCA assay, infected brain homogenates were diluted 100-fold by appropriate normal brain homogenates containing compounds (1 μl of 10 mM solutions in DMSO) or 1 μl of DMSO as control. c Mouse-adapted scrapie strains (RML, ME7) and Mouse-adapted BSE (301C) were used as seed in C57/BL6 mouse normal brain homogenates. d sCJD and vCJD samples were propagated in non-CJD human brain homogenates. In all gels, 0.5 % (w/v) normal brain homogenates from C57/BL6 and human brain, respectively, were loaded directly in the last lane without proteolysis as a reference (indicated as PrP C on the top). All other samples were treated with 50 μg/ml PK. “Start” (lane 1 of each gel) indicates samples containing infected brain homogenate before PMCA. Molecular weight markers are indicated on the right . PrP migrates in three different bands due to the presence of non-glycosylated, mono-glycosylated, and di-glycosylated forms, and digestion with Proteinase K results in a shift to lower molecular weights with the non-glycosylated band migrating at ~20 kD. Anle138b shows a strong inhibitory activity in all prion strains tested. As an additional control, the inactive isomer anle234b (see Table 1 , Suppl. Fig. 4) was used. Quantitative PMCA results are provided in Table 1 and Suppl. Fig. 8

    Journal: Acta Neuropathologica

    Article Title: Anle138b: a novel oligomer modulator for disease-modifying therapy of neurodegenerative diseases such as prion and Parkinson's disease

    doi: 10.1007/s00401-013-1114-9

    Figure Lengend Snippet: Size modulation of PrP Sc oligomers by anle138b and inhibition of various human and non-human prion strains in PMCA. ( a , b ) Size distribution of PrP Sc aggregates was analyzed by sucrose-gradient centrifugation. Mice treated with anle138b show a strong reduction of high molecular weight species (fractions 7–12). Also small molecular weight oligomers (fractions 3–4) are reduced and show a shift towards smaller size (fraction 2) indicating that anle138b blocks aggregation at the level of small oligomers. DMSO-treated mice are indistinguishable from terminally ill untreated mice. ( c , d ) For PMCA assay, infected brain homogenates were diluted 100-fold by appropriate normal brain homogenates containing compounds (1 μl of 10 mM solutions in DMSO) or 1 μl of DMSO as control. c Mouse-adapted scrapie strains (RML, ME7) and Mouse-adapted BSE (301C) were used as seed in C57/BL6 mouse normal brain homogenates. d sCJD and vCJD samples were propagated in non-CJD human brain homogenates. In all gels, 0.5 % (w/v) normal brain homogenates from C57/BL6 and human brain, respectively, were loaded directly in the last lane without proteolysis as a reference (indicated as PrP C on the top). All other samples were treated with 50 μg/ml PK. “Start” (lane 1 of each gel) indicates samples containing infected brain homogenate before PMCA. Molecular weight markers are indicated on the right . PrP migrates in three different bands due to the presence of non-glycosylated, mono-glycosylated, and di-glycosylated forms, and digestion with Proteinase K results in a shift to lower molecular weights with the non-glycosylated band migrating at ~20 kD. Anle138b shows a strong inhibitory activity in all prion strains tested. As an additional control, the inactive isomer anle234b (see Table 1 , Suppl. Fig. 4) was used. Quantitative PMCA results are provided in Table 1 and Suppl. Fig. 8

    Article Snippet: Each cycle consisted of sonication at 60 % potency (~209 W) for 20 s followed by incubation at 37 °C for 59 min 40 s. PMCA product was digested with 50 μg/ml proteinase K at 37 °C for 1 h. After adding an equal volume of SDS loading buffer and boiling for 10 min, samples were separated by SDS-PAGE and transferred to PVDF membranes (Immobilon-P, Millipore, MA, USA) at 12 V for 2 h. For immunoblotting, the membrane was blocked with 5 % non-fat milk in PBST and incubated with 1:5,000 diluted PrP monoclonal antibody 3F4 (Dako, Glostrup, Denmark) in PBST at room temperature for 2 h. After three washes in PBST, the membrane was immerged in a 1:5,000 diluted alkaline phosphatase conjugated anti-mouse IgG (Dako) in PBST and incubated at room temperature for 2 h. Detection was performed with CDP-Star solution (Roche, Mannheim, Germany).

    Techniques: Inhibition, Gradient Centrifugation, Mouse Assay, Molecular Weight, Infection, Activity Assay

    STYM1 cellular extracts have inhibitory protein. Extract was spotted onto plates, allowed to dry under aerobic conditions, and overlaid with a soft top agar inoculated with P. gingivalis . Plates were imaged 2 days after anaerobic growth. (A) Agar overlay assay with equal protein amounts of soluble cell extracts from STYM1, SYB13, SYB7, and 11842. (B to D) Agar overlay assays with STYM1 cellular extract either treated with proteinase K (Prot K) or heat-killed proteinase K (Heat-killed Prot K) (B), passage through a 10-kDa-MWCO filter (Flow and Conc.) (C), or heat treatment (95°C for 20 min) (D).

    Journal: Applied and Environmental Microbiology

    Article Title: Interspecies Inhibition of Porphyromonas gingivalis by Yogurt-Derived Lactobacillus delbrueckii Requires Active Pyruvate Oxidase

    doi: 10.1128/AEM.01271-19

    Figure Lengend Snippet: STYM1 cellular extracts have inhibitory protein. Extract was spotted onto plates, allowed to dry under aerobic conditions, and overlaid with a soft top agar inoculated with P. gingivalis . Plates were imaged 2 days after anaerobic growth. (A) Agar overlay assay with equal protein amounts of soluble cell extracts from STYM1, SYB13, SYB7, and 11842. (B to D) Agar overlay assays with STYM1 cellular extract either treated with proteinase K (Prot K) or heat-killed proteinase K (Heat-killed Prot K) (B), passage through a 10-kDa-MWCO filter (Flow and Conc.) (C), or heat treatment (95°C for 20 min) (D).

    Article Snippet: Prior to testing in an agar overlay assay, STYM1 extracts were treated with either heat, proteinase K, or passage through a 10-kDa-MWCO filter (Millipore, Burlington, MA).

    Techniques: Overlay Assay

    Detection of CDK2 in HBV capsids purified from HepG2 cells by Western blotting. HBV capsids (0.5 μg) were digested with proteinase K (PK) agarose beads as described in Materials and Methods. Proteinase K was then inactivated by the addition of the proteinase K inhibitor, and the sample was resolved by SDS-PAGE (lanes 8 and 10), along with the same amount of undigested capsids from the same fractions (lanes 7 and 9). Purified GST-CDK2 standards (lanes 1 to 3) and total lysate from HepG2 cells (lane 4) were loaded as controls for CDK2 detection. A sucrose fraction that did not contain HBV capsids was also treated with the proteinase K agarose beads to ensure that contaminating proteins were removed by the digestion (lane 6) or mock treated (lane 5). The capsids loaded in lanes 9 and 10 were from a capsid-positive sucrose fraction of higher purity than those loaded in lanes 7 and 8. CDK2 was detected by Western blotting using the anti-CDK2 antibody (top panel). HBc was visualized by Sypro ruby staining (bottom panel). C, core protein.

    Journal: Journal of Virology

    Article Title: Cyclin-Dependent Kinase 2 Phosphorylates S/T-P Sites in the Hepadnavirus Core Protein C-Terminal Domain and Is Incorporated into Viral Capsids

    doi: 10.1128/JVI.01218-12

    Figure Lengend Snippet: Detection of CDK2 in HBV capsids purified from HepG2 cells by Western blotting. HBV capsids (0.5 μg) were digested with proteinase K (PK) agarose beads as described in Materials and Methods. Proteinase K was then inactivated by the addition of the proteinase K inhibitor, and the sample was resolved by SDS-PAGE (lanes 8 and 10), along with the same amount of undigested capsids from the same fractions (lanes 7 and 9). Purified GST-CDK2 standards (lanes 1 to 3) and total lysate from HepG2 cells (lane 4) were loaded as controls for CDK2 detection. A sucrose fraction that did not contain HBV capsids was also treated with the proteinase K agarose beads to ensure that contaminating proteins were removed by the digestion (lane 6) or mock treated (lane 5). The capsids loaded in lanes 9 and 10 were from a capsid-positive sucrose fraction of higher purity than those loaded in lanes 7 and 8. CDK2 was detected by Western blotting using the anti-CDK2 antibody (top panel). HBc was visualized by Sypro ruby staining (bottom panel). C, core protein.

    Article Snippet: When proteinase K-treated capsids were resolved by SDS-PAGE, the proteinase K digestion was stopped by adding proteinase K inhibitor (Calbiochem) to 1 mM (final concentration) and incubating the sample at room temperature for 10 min ( ).

    Techniques: Purification, Western Blot, SDS Page, Staining

    Endogenous kinase reactions with virion-derived HBV capsids. HBV capsids were released from virions purified from the medium of HBV-transfected HepG2 cells by NP-40 treatment. One control aliquot was removed, and the remaining virion-derived capsids were digested by proteinase K. The untreated (lane 1) or proteinase K-treated (lanes 2 to 5), virion-derived capsids (ca. 6 ng per reaction) were phosphorylated by the encapsidated kinase in endogenous kinase reactions in the presence of the indicated kinase inhibitors (lanes 3 to 5) or DMSO control (lane 2). Kinase inhibitors used included CDK2 inhibitor III (lane 3, 250 μM, 500× IC 50 for CDK2), roscovitine (lane 4, 250 μM, 350× IC 50 for CDK2), and Bisindo (lane 3, 5 μM, 500× IC 50 for PKC). An equal amount of proteinase K alone was also loaded as an additional control (lane 6). In parallel, 6 ng (lane 7) or 12 ng (lane 8) of cytoplasmic HBV capsids from HepG2 cells (also treated with proteinase K; see Materials and Methods) were subjected to the endogenous kinase reaction. Half of each reaction product was resolved by agarose gel electrophoresis to visualize capsid particles (top), and proteinase K inhibitor was added to the other half to terminate the digestion before boiling in SDS sample buffer and resolving by SDS-PAGE to visualize the total core protein (bottom). The gels were dried, and labeled capsids or core proteins were detected by autoradiography. *, unknown labeled species. CA, capsids; C, core protein; PK, proteinase K; IC, intracellular.

    Journal: Journal of Virology

    Article Title: Cyclin-Dependent Kinase 2 Phosphorylates S/T-P Sites in the Hepadnavirus Core Protein C-Terminal Domain and Is Incorporated into Viral Capsids

    doi: 10.1128/JVI.01218-12

    Figure Lengend Snippet: Endogenous kinase reactions with virion-derived HBV capsids. HBV capsids were released from virions purified from the medium of HBV-transfected HepG2 cells by NP-40 treatment. One control aliquot was removed, and the remaining virion-derived capsids were digested by proteinase K. The untreated (lane 1) or proteinase K-treated (lanes 2 to 5), virion-derived capsids (ca. 6 ng per reaction) were phosphorylated by the encapsidated kinase in endogenous kinase reactions in the presence of the indicated kinase inhibitors (lanes 3 to 5) or DMSO control (lane 2). Kinase inhibitors used included CDK2 inhibitor III (lane 3, 250 μM, 500× IC 50 for CDK2), roscovitine (lane 4, 250 μM, 350× IC 50 for CDK2), and Bisindo (lane 3, 5 μM, 500× IC 50 for PKC). An equal amount of proteinase K alone was also loaded as an additional control (lane 6). In parallel, 6 ng (lane 7) or 12 ng (lane 8) of cytoplasmic HBV capsids from HepG2 cells (also treated with proteinase K; see Materials and Methods) were subjected to the endogenous kinase reaction. Half of each reaction product was resolved by agarose gel electrophoresis to visualize capsid particles (top), and proteinase K inhibitor was added to the other half to terminate the digestion before boiling in SDS sample buffer and resolving by SDS-PAGE to visualize the total core protein (bottom). The gels were dried, and labeled capsids or core proteins were detected by autoradiography. *, unknown labeled species. CA, capsids; C, core protein; PK, proteinase K; IC, intracellular.

    Article Snippet: When proteinase K-treated capsids were resolved by SDS-PAGE, the proteinase K digestion was stopped by adding proteinase K inhibitor (Calbiochem) to 1 mM (final concentration) and incubating the sample at room temperature for 10 min ( ).

    Techniques: Derivative Assay, Purification, Transfection, Agarose Gel Electrophoresis, SDS Page, Labeling, Autoradiography