proteinase k  (Amresco)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Amresco proteinase k
    TAP-mRNP association and splicing-dependent 9G8 hypophosphorylation in vitro . ( A ) TAP binds spliced mRNP after splicing in vitro . 32 ) (Input) was incubated with HeLa nuclear extract under splicing conditions. Glutathione beads precoated with GST-TAP231 or GST alone were added to the total reaction (lanes 3–6) or to a proteinase K-treated reaction (lanes 9–12). Radioactive RNAs selected by the bead-bound proteins (P, lanes 4, 6, 10, and 12) or from 5% (S, lanes 3 and 5) or 20% of the corresponding supernatants (lanes 9 and 11) were resolved on 8% denaturing polyacrylamide gels and visualized by PhosphorImager. Total, 5% of the splicing reaction before the binding assays. The bands marked * in this panel and in the following panels were nonspecific degradation products. ( B ) Adenovirus splicing substrate (lane 1) was incubated under splicing conditions in HeLa nuclear extract deficient in splicing activity (lane 2). Splicing was stimulated in a dose-dependent manner by addition of 9G8 made by in vitro translation (lanes 3 and 4). ( C ) In vitro splicing was performed with in vitro translated 35 S-labeled 9G8 and unlabeled splicing substrate. Quantitations ( Upper ) were the average of two independent experiments, where the observed ratios differed by no more than 15%. Splicing reactions were in the absence (lane 1) or presence (lanes 3–5) of the splicing substrate and with the addition of the U6-5′SS oligonucleotide (CUCUGUAUCGUUCCAAUUUU, lane 3), a control (Contr) oligonucleotide (UUUCCAGUAGCUGAA, lane 4), or no oligonucleotide (lane 5). Three microliters of rabbit reticulocyte lysate containing the 35 S-labeled 9G8 used were loaded in lane 2. ( D ) A splicing reaction comparable to C contained an equivalent amount of in vitro translated but unlabeled 9G8 whereas the splicing substrate was 32 P-labeled. The identities of the spliced products are marked on the right in A , B , and D .
    Proteinase K, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k/product/Amresco
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    proteinase k - by Bioz Stars, 2021-03
    86/100 stars

    Images

    1) Product Images from "A molecular link between SR protein dephosphorylation and mRNA export"

    Article Title: A molecular link between SR protein dephosphorylation and mRNA export

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0403533101

    TAP-mRNP association and splicing-dependent 9G8 hypophosphorylation in vitro . ( A ) TAP binds spliced mRNP after splicing in vitro . 32 ) (Input) was incubated with HeLa nuclear extract under splicing conditions. Glutathione beads precoated with GST-TAP231 or GST alone were added to the total reaction (lanes 3–6) or to a proteinase K-treated reaction (lanes 9–12). Radioactive RNAs selected by the bead-bound proteins (P, lanes 4, 6, 10, and 12) or from 5% (S, lanes 3 and 5) or 20% of the corresponding supernatants (lanes 9 and 11) were resolved on 8% denaturing polyacrylamide gels and visualized by PhosphorImager. Total, 5% of the splicing reaction before the binding assays. The bands marked * in this panel and in the following panels were nonspecific degradation products. ( B ) Adenovirus splicing substrate (lane 1) was incubated under splicing conditions in HeLa nuclear extract deficient in splicing activity (lane 2). Splicing was stimulated in a dose-dependent manner by addition of 9G8 made by in vitro translation (lanes 3 and 4). ( C ) In vitro splicing was performed with in vitro translated 35 S-labeled 9G8 and unlabeled splicing substrate. Quantitations ( Upper ) were the average of two independent experiments, where the observed ratios differed by no more than 15%. Splicing reactions were in the absence (lane 1) or presence (lanes 3–5) of the splicing substrate and with the addition of the U6-5′SS oligonucleotide (CUCUGUAUCGUUCCAAUUUU, lane 3), a control (Contr) oligonucleotide (UUUCCAGUAGCUGAA, lane 4), or no oligonucleotide (lane 5). Three microliters of rabbit reticulocyte lysate containing the 35 S-labeled 9G8 used were loaded in lane 2. ( D ) A splicing reaction comparable to C contained an equivalent amount of in vitro translated but unlabeled 9G8 whereas the splicing substrate was 32 P-labeled. The identities of the spliced products are marked on the right in A , B , and D .
    Figure Legend Snippet: TAP-mRNP association and splicing-dependent 9G8 hypophosphorylation in vitro . ( A ) TAP binds spliced mRNP after splicing in vitro . 32 ) (Input) was incubated with HeLa nuclear extract under splicing conditions. Glutathione beads precoated with GST-TAP231 or GST alone were added to the total reaction (lanes 3–6) or to a proteinase K-treated reaction (lanes 9–12). Radioactive RNAs selected by the bead-bound proteins (P, lanes 4, 6, 10, and 12) or from 5% (S, lanes 3 and 5) or 20% of the corresponding supernatants (lanes 9 and 11) were resolved on 8% denaturing polyacrylamide gels and visualized by PhosphorImager. Total, 5% of the splicing reaction before the binding assays. The bands marked * in this panel and in the following panels were nonspecific degradation products. ( B ) Adenovirus splicing substrate (lane 1) was incubated under splicing conditions in HeLa nuclear extract deficient in splicing activity (lane 2). Splicing was stimulated in a dose-dependent manner by addition of 9G8 made by in vitro translation (lanes 3 and 4). ( C ) In vitro splicing was performed with in vitro translated 35 S-labeled 9G8 and unlabeled splicing substrate. Quantitations ( Upper ) were the average of two independent experiments, where the observed ratios differed by no more than 15%. Splicing reactions were in the absence (lane 1) or presence (lanes 3–5) of the splicing substrate and with the addition of the U6-5′SS oligonucleotide (CUCUGUAUCGUUCCAAUUUU, lane 3), a control (Contr) oligonucleotide (UUUCCAGUAGCUGAA, lane 4), or no oligonucleotide (lane 5). Three microliters of rabbit reticulocyte lysate containing the 35 S-labeled 9G8 used were loaded in lane 2. ( D ) A splicing reaction comparable to C contained an equivalent amount of in vitro translated but unlabeled 9G8 whereas the splicing substrate was 32 P-labeled. The identities of the spliced products are marked on the right in A , B , and D .

    Techniques Used: In Vitro, Incubation, Binding Assay, Activity Assay, Labeling

    2) Product Images from "A Comparative Evaluation of Factors Influencing Osteoinductivity Among Scaffolds Designed for Bone Regeneration"

    Article Title: A Comparative Evaluation of Factors Influencing Osteoinductivity Among Scaffolds Designed for Bone Regeneration

    Journal: Tissue Engineering. Part A

    doi: 10.1089/ten.tea.2012.0711

    Adhesion rates among scaffolds. Cells were inoculated onto scaffolds and allowed to adhere for 2 h at 37°C /5% CO 2 , after which time the scaffolds were washed twice with PBS and digested with proteinase K. The lysates were stained with
    Figure Legend Snippet: Adhesion rates among scaffolds. Cells were inoculated onto scaffolds and allowed to adhere for 2 h at 37°C /5% CO 2 , after which time the scaffolds were washed twice with PBS and digested with proteinase K. The lysates were stained with

    Techniques Used: Staining

    3) Product Images from "Co-existence of Distinct Prion Types Enables Conformational Evolution of Human PrPSc by Competitive Selection *"

    Article Title: Co-existence of Distinct Prion Types Enables Conformational Evolution of Human PrPSc by Competitive Selection *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.500108

    Concentration and dichotomous impact of PK treatment on the conformational stability of PrP Sc isoforms in the cortex of sCJD with mixed type 1 + 2 PrP Sc in the same location. A, concentration of total and type 1 rPrP Sc in the cortex of 36 cases of sCJD homozygous for different codon 129 polymorphisms and with WB classification of MM type 1 ( n = 10), MM type 2 ( n = 10), VV type 2 ( n = 10), and MM type 1 + 2 ( n = 6) rPrP Sc in the same location. B, relative proportion of type 1 rPrP Sc in each codon 129 polymorphism and WB classification group; the sCJD cases MM type 1 + 2 ( n = 6) studied in detail in this paper are depicted as brown circles. C, concentrations of total PrP Sc ( purple circles ), rPrP Sc ( black circles ), sPrP Sc ( green diamonds ). D, relative proportion of sPrP Sc ( green diamonds ), type 1 ( red triangles ), and type 2 ( blue triangles ) in each sCJD case ( n = 6). E, distinct conformational stability of total rPrP Sc , type 1 rPrP Sc , and incongruent impact of proteinase K treatment (−/+). The same color symbols and links indicate data obtained in the same mixed case of sCJD. F, differential stability curves of type 2 rPrP Sc obtained after subtracting stability curves of type 1 rPrP Sc obtained with mAb 12B2 from stability curves of total rPrP Sc obtained with mAb 3F4 after PK treatment. The CDI with europium-labeled mAb 3F4 was used to determine the concentration and stability of total PrP Sc and mAb 12B2 to measure the concentration and stability of type 1 rPrP Sc . Each data point represents a unique patient measured in triplicate, and the concentration of PrP Sc in 10% brain homogenate was calculated; the percentage of rPrP Sc or type 1 is expressed over total rPrP Sc . The horizontal line represents mean for each parameter.
    Figure Legend Snippet: Concentration and dichotomous impact of PK treatment on the conformational stability of PrP Sc isoforms in the cortex of sCJD with mixed type 1 + 2 PrP Sc in the same location. A, concentration of total and type 1 rPrP Sc in the cortex of 36 cases of sCJD homozygous for different codon 129 polymorphisms and with WB classification of MM type 1 ( n = 10), MM type 2 ( n = 10), VV type 2 ( n = 10), and MM type 1 + 2 ( n = 6) rPrP Sc in the same location. B, relative proportion of type 1 rPrP Sc in each codon 129 polymorphism and WB classification group; the sCJD cases MM type 1 + 2 ( n = 6) studied in detail in this paper are depicted as brown circles. C, concentrations of total PrP Sc ( purple circles ), rPrP Sc ( black circles ), sPrP Sc ( green diamonds ). D, relative proportion of sPrP Sc ( green diamonds ), type 1 ( red triangles ), and type 2 ( blue triangles ) in each sCJD case ( n = 6). E, distinct conformational stability of total rPrP Sc , type 1 rPrP Sc , and incongruent impact of proteinase K treatment (−/+). The same color symbols and links indicate data obtained in the same mixed case of sCJD. F, differential stability curves of type 2 rPrP Sc obtained after subtracting stability curves of type 1 rPrP Sc obtained with mAb 12B2 from stability curves of total rPrP Sc obtained with mAb 3F4 after PK treatment. The CDI with europium-labeled mAb 3F4 was used to determine the concentration and stability of total PrP Sc and mAb 12B2 to measure the concentration and stability of type 1 rPrP Sc . Each data point represents a unique patient measured in triplicate, and the concentration of PrP Sc in 10% brain homogenate was calculated; the percentage of rPrP Sc or type 1 is expressed over total rPrP Sc . The horizontal line represents mean for each parameter.

    Techniques Used: Concentration Assay, Western Blot, Labeling

    4) Product Images from "USP33 deubiquitinates PRKN/parkin and antagonizes its role in mitophagy"

    Article Title: USP33 deubiquitinates PRKN/parkin and antagonizes its role in mitophagy

    Journal: Autophagy

    doi: 10.1080/15548627.2019.1656957

    ). a.u., arbitrary units. Scale bar: 25 μm. (B) USP33 level in different fractions (Nu: nucleus; Cyto: cytoplasm; Mito: mitochondria) of HEK293 cells by western blotting. LMNB1 (lamin B1): nuclear marker; TUBB/β-tubulin: cytoplasmic marker; CANX (calnexin): ER marker; VDAC1: mitochondrial marker. (C) Protease K assay showing localization of USP33 at OMM. VDAC1: mitochondrial outer membrane marker, DIABLO/SMAC: intermembrane space marker. (D) Colocalization of GFP-USP33, but not GFP-USP33ΔTM (residues 549-569 deletion), with mitochondrial protein TOMM20 by immunostaining analysis. Scale bar: 2.5 μm. (E) GFP-USP33 is present in both mitochondrial and cytosolic fractions, whereas GFP-USP33ΔTM only in cytosolic fraction of HEK293 cells transiently transfected with WT or mutant USP33.
    Figure Legend Snippet: ). a.u., arbitrary units. Scale bar: 25 μm. (B) USP33 level in different fractions (Nu: nucleus; Cyto: cytoplasm; Mito: mitochondria) of HEK293 cells by western blotting. LMNB1 (lamin B1): nuclear marker; TUBB/β-tubulin: cytoplasmic marker; CANX (calnexin): ER marker; VDAC1: mitochondrial marker. (C) Protease K assay showing localization of USP33 at OMM. VDAC1: mitochondrial outer membrane marker, DIABLO/SMAC: intermembrane space marker. (D) Colocalization of GFP-USP33, but not GFP-USP33ΔTM (residues 549-569 deletion), with mitochondrial protein TOMM20 by immunostaining analysis. Scale bar: 2.5 μm. (E) GFP-USP33 is present in both mitochondrial and cytosolic fractions, whereas GFP-USP33ΔTM only in cytosolic fraction of HEK293 cells transiently transfected with WT or mutant USP33.

    Techniques Used: Western Blot, Marker, Immunostaining, Transfection, Mutagenesis

    Related Articles

    Infection:

    Article Title: Isolation, identification, and complete genome sequence of a bovine adenovirus type 3 from cattle in China
    Article Snippet: The primers E2Afwd (5'-GAG ATG GAT GTG AAC AGC GA-3') and E2Aseq1 (5'-ACA TTC TGA TGC TGG TAC TG-3') amplified an approximately 644 bp product from the BAV-3 DNA. .. Viral genomic DNA was extracted from 500 μl of infected culture supernatant containing 0.2 mg/ml proteinase K (AMRESCO, USA) and 0.5% sodium dodecyl sulfate, which was incubated at 37°C for two hours. ..

    Incubation:

    Article Title: Isolation, identification, and complete genome sequence of a bovine adenovirus type 3 from cattle in China
    Article Snippet: The primers E2Afwd (5'-GAG ATG GAT GTG AAC AGC GA-3') and E2Aseq1 (5'-ACA TTC TGA TGC TGG TAC TG-3') amplified an approximately 644 bp product from the BAV-3 DNA. .. Viral genomic DNA was extracted from 500 μl of infected culture supernatant containing 0.2 mg/ml proteinase K (AMRESCO, USA) and 0.5% sodium dodecyl sulfate, which was incubated at 37°C for two hours. ..

    Article Title: Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw
    Article Snippet: The rumen fluid samples were then centrifuged at 4000 rpm for 5 min and the supernatant obtained was used further for the DNA extraction. .. In brief, the rumen fluid was centrifuged at 14,000 rpm for 10 min and the pelleted cells were resuspended in a mix of 800 µl of CTAB lysis buffer (2% CTAB, 1.4 M NaCl, 20 mM EDTA and 100 mM Tris–HCl), (Amresco, Solon, USA) and 0.2 g of glass beads (0.1 mm), (Biospec products Inc, Bartlesville, USA) and kept in a Mini bead beater (Biospec products Inc, Bartlesville, USA) for 3 min. 10 µl of 20 mg/ml proteinase K (Amresco, Solon, USA) and 10 mg/ml lysozyme (Amresco, Solon, USA) were added to the above mixture and incubated at 37 °C for 1 h. The tubes were then incubated at 70 °C for 30 min with intermittent mixing. .. An equal volume of Phenol:Chloroform:Isoamyl alcohol (25:24:1) (Amresco, Solon, USA) was added to the above lysate and mixed by inverting until a thick milky white emulsion was formed.

    Article Title: Clinical and Veterinary Isolates of Salmonella enterica Serovar Enteritidis Defective in Lipopolysaccharide O-Chain Polymerization
    Article Snippet: After centrifugation (10,000 × g , for 30 min at 4°C), the precipitate was dried, dissolved in 1.0 ml of nuclease buffer (0.01 M Tris [pH 7.8], 10 mM MgCl2 ), and incubated for 16 h at 37°C with DNase (2 μg/ml) and RNase I (10 μg/ml) (Boehringer Mannheim) ( ). .. The sample was adjusted to include 0.5% sodium dodecyl sulfate (SDS) for incubation with proteinase K (50 μg/ml) (Amresco, Solon, Ohio) for 16 h at 42°C ( ). .. An equal volume of phenol-chloroform (P:C) was used to remove hydrolytic enzymes, and LPS in the aqueous phase collected after centrifugation was precipitated with 2.5 volumes of ethanol for 16 h at −20°C.

    Article Title: Like a pig out of water: seaborne spread of domestic pigs in Southern Italy and Sardinia during the Bronze and Iron Ages
    Article Snippet: .. Specifically, ~50 mg of bone powder was incubated with 0.44 M EDTA pH 8 (AMRESCO, Solon, OH, USA), 0.1 M urea and 20 mg ml−1 proteinase K (AMRESCO) overnight at 56 °C. .. After decalcification and digestion, the supernatant was concentrated to about 100 μl using Vivaspin filter 3000 MWCO (Sartorius Stedim Biotech, Aubagne, France) and then directly purified using silica-based spin columns (Minelute PCR Purification kit, Qiagen, Inc.) with a final elution volume of 70 μl.

    Lysis:

    Article Title: Metagenomic insights into the rumen microbial fibrolytic enzymes in Indian crossbred cattle fed finger millet straw
    Article Snippet: The rumen fluid samples were then centrifuged at 4000 rpm for 5 min and the supernatant obtained was used further for the DNA extraction. .. In brief, the rumen fluid was centrifuged at 14,000 rpm for 10 min and the pelleted cells were resuspended in a mix of 800 µl of CTAB lysis buffer (2% CTAB, 1.4 M NaCl, 20 mM EDTA and 100 mM Tris–HCl), (Amresco, Solon, USA) and 0.2 g of glass beads (0.1 mm), (Biospec products Inc, Bartlesville, USA) and kept in a Mini bead beater (Biospec products Inc, Bartlesville, USA) for 3 min. 10 µl of 20 mg/ml proteinase K (Amresco, Solon, USA) and 10 mg/ml lysozyme (Amresco, Solon, USA) were added to the above mixture and incubated at 37 °C for 1 h. The tubes were then incubated at 70 °C for 30 min with intermittent mixing. .. An equal volume of Phenol:Chloroform:Isoamyl alcohol (25:24:1) (Amresco, Solon, USA) was added to the above lysate and mixed by inverting until a thick milky white emulsion was formed.

    Article Title: Helicobacter pylori in dental plaque and stomach of patients from Northern Brazil
    Article Snippet: For comparison, a similar reading of each biopsy was also performed after 3 and 24 h. Results of the rapid urease test were compared with polymerase chain reaction (PCR) results and histological examination. .. Total DNA was extracted from frozen gastric biopsy and dental plaque specimens using the following procedure[ ]: 10 μL proteinase K (Amresco, Cleveland, OH, USA) and 300 μL lysis buffer (200 mmol/L Tris-HCl, 25 mmol/L EDTA, 300 mmol/L NaCl, 1.2% SDS) were added to the biopsy or dental plaque pellets specimens. .. The mixture was incubated at 55°C for 12 h. The lysate was extracted with an equal volume of phenol-chloroform, precipitated with isopropanol, and washed with 70% ethanol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • proteinase k  (Amresco)
    86
    Amresco proteinase k
    Ethidium bromide-stained polyacrylamide gel of PCR products obtained from enzymes used for pretreatment of samples for fungal PCR and controls by using primers S1 and CUF1. Lanes: L, 100-bp ladder; 1, 100 pg of C. albicans DNA; 2, 100 pg of A. fumigatus DNA; 3, Zymolyase (Seikagaku); 4, Zymolyase (ICN); 5, lysing enzymes (Sigma); 6, lyticase (Sigma); 7, <t>proteinase</t> K (Amresco); 8, proteinase K (Boehringer); 9, negative control.
    Proteinase K, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k/product/Amresco
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    proteinase k - by Bioz Stars, 2021-03
    86/100 stars
    		  Buy from Supplier
    proteinase k amresco inc  (Amresco)
    86
    Amresco proteinase k amresco inc
    Mtb WhiB4 exhibits non-specific DNA binding activities. (A) 150 ng of either linear (L) or supercoiled (SC) plasmid DNA was incubated with oxidized apo-WhiB4 (250 ng [lanes 2, 6]; 300 ng [lanes 3, 7]; 350 ng [4, 8]). Lanes 1 and 5 represent DNA without WhiB4. (B) Binding of apo-WhiB4 (100, 150, 200, 250, 300 and 350 ng) with 1 kb λ-DNA ladder (λ) (150 ng). (C) WhiB4 represses transcription . In vitro transcribed pGEM plasmid in the absence of apo-WhiB4 (lane 1), oxidized apo-WhiB4 in complex with pGEM (lane 2), in vitro transcription of pGEM in the presence of oxidized (lane 3) or reduced (lane 4) apo-WhiB4. The reactions in lane 3 and 4 were treated with 6% SDS and 4 mg ml -1 protease K to remove WhiB4 from the mixture before separation. C: pGEM plasmid DNA alone. Cysteine residues regulate DNA binding of WhiB4 (D) DTT-treatment abolished DNA binding of WhiB4. Oxidized apo-WhiB4 (350 ng) was treated with DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. C: represents DNA without WhiB4. (E) Purified wt apo-WhiB4 and Cys mutant variants were treated with thiol oxidant, diamide, and the gel-shift assay was performed as described earlier. DNA binding assays using Mtb HU (50–350 ng) and Mtb TcrX (150–350 ng) with (F) supercoiled DNA and (G) 1 kb λ-DNA ladder. (H) 350 ng of Mtb HU or (I) Mtb TcrX were treated with increasing concentrations of DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. The samples were analyzed on 1% agarose gel.
    Proteinase K Amresco Inc, supplied by Amresco, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/proteinase k amresco inc/product/Amresco
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    proteinase k amresco inc - by Bioz Stars, 2021-03
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Ethidium bromide-stained polyacrylamide gel of PCR products obtained from enzymes used for pretreatment of samples for fungal PCR and controls by using primers S1 and CUF1. Lanes: L, 100-bp ladder; 1, 100 pg of C. albicans DNA; 2, 100 pg of A. fumigatus DNA; 3, Zymolyase (Seikagaku); 4, Zymolyase (ICN); 5, lysing enzymes (Sigma); 6, lyticase (Sigma); 7, proteinase K (Amresco); 8, proteinase K (Boehringer); 9, negative control.

    Journal: Journal of Clinical Microbiology

    Article Title: Identification of Contaminating Fungal DNA Sequences in Zymolyase

    doi:

    Figure Lengend Snippet: Ethidium bromide-stained polyacrylamide gel of PCR products obtained from enzymes used for pretreatment of samples for fungal PCR and controls by using primers S1 and CUF1. Lanes: L, 100-bp ladder; 1, 100 pg of C. albicans DNA; 2, 100 pg of A. fumigatus DNA; 3, Zymolyase (Seikagaku); 4, Zymolyase (ICN); 5, lysing enzymes (Sigma); 6, lyticase (Sigma); 7, proteinase K (Amresco); 8, proteinase K (Boehringer); 9, negative control.

    Article Snippet: This contamination is still present after partial purification of the Zymolyase by affinity chromatography, which was done by ICN Biomedicals, Inc. Other enzymes, which are also widely used for pretreatment of samples for fungal PCR assays, including lysing enzymes from T. harzianum and lyticase (both from Sigma, Munich, Germany) and proteinase K (Amresco, Solon, Ohio, and Boehringer, Mannheim, Germany), did not yield amplification products when the panfungal primer pairs S1-CUF1 (Fig. ) and F5-F6 (Table ) were used; thus, they appeared to be largely free from fungal DNA.

    Techniques: Staining, Polymerase Chain Reaction, Negative Control

    In vivo cross-linking of telomeres. Mycelium from liquid cultures was treated with DSS or DSG. Total DNA was isolated, digested with BclI (Bc) or BglII (Bg), fractionated by gel electrophoresis and hybridized to labeled plasmid DNA. ( A ) pLUS891L. The physical map of the plasmid DNA is shown above. The sizes of the restriction fragments are indicated (in kb). tsr , thiostrepton resistance gene; ARS, autonomously replicating sequence of pSLA2; filled arrows, SCP1 telomeres; filled circles, Tpc proteins. The DNA linked by the cross-linker is indicated by an asterisk. ‘M’, DNA size markers. The size of the DNA fragments is depicted on the left (in kb). A set of samples was treated with proteinase K (‘+’) before electrophoresis (right panel). ( B ) pLUS892L. The symbols and analyses are as in (A).

    Journal: Nucleic Acids Research

    Article Title: Linear Streptomyces plasmids form superhelical circles through interactions between their terminal proteins

    doi: 10.1093/nar/gkq1204

    Figure Lengend Snippet: In vivo cross-linking of telomeres. Mycelium from liquid cultures was treated with DSS or DSG. Total DNA was isolated, digested with BclI (Bc) or BglII (Bg), fractionated by gel electrophoresis and hybridized to labeled plasmid DNA. ( A ) pLUS891L. The physical map of the plasmid DNA is shown above. The sizes of the restriction fragments are indicated (in kb). tsr , thiostrepton resistance gene; ARS, autonomously replicating sequence of pSLA2; filled arrows, SCP1 telomeres; filled circles, Tpc proteins. The DNA linked by the cross-linker is indicated by an asterisk. ‘M’, DNA size markers. The size of the DNA fragments is depicted on the left (in kb). A set of samples was treated with proteinase K (‘+’) before electrophoresis (right panel). ( B ) pLUS892L. The symbols and analyses are as in (A).

    Article Snippet: To remove TP, proteinase K (AMRESCO) was added to the loading buffer containing the DNA sample to a final concentration of 20 U/ml before electrophoresis.

    Techniques: In Vivo, Isolation, Nucleic Acid Electrophoresis, Labeling, Plasmid Preparation, Sequencing, Electrophoresis

    In vitro cross-linking of telomeres. ( A ) Without GnHCl treatment. Total DNA of S. lividans 3200/pLUS891L was treated with DSS or DSG, digested with BclI (Bc) or BglII (Bg), fractionated by gel electrophoresis and hybridized with pLUS891L DNA probe. ( B ) With GnHCl treatment. Genomic DNA of S. lividans 3200/pLUS892L was isolated by GnHCl–CsCl gradient centrifugation and treated with DSS or DSG. The treated DNA was digested with BclI or MluI, fractionated by gel electrophoresis and hybridized to the SCP1 terminal DNA probe. The physical map of pLUS892L is shown above with the BclI and MluI (Ml) sites and fragments sizes indicated. In the control experiment (right panel), the samples were treated with proteinase K before electrophoresis. The cross-linked DNA is indicated by an asterisk.

    Journal: Nucleic Acids Research

    Article Title: Linear Streptomyces plasmids form superhelical circles through interactions between their terminal proteins

    doi: 10.1093/nar/gkq1204

    Figure Lengend Snippet: In vitro cross-linking of telomeres. ( A ) Without GnHCl treatment. Total DNA of S. lividans 3200/pLUS891L was treated with DSS or DSG, digested with BclI (Bc) or BglII (Bg), fractionated by gel electrophoresis and hybridized with pLUS891L DNA probe. ( B ) With GnHCl treatment. Genomic DNA of S. lividans 3200/pLUS892L was isolated by GnHCl–CsCl gradient centrifugation and treated with DSS or DSG. The treated DNA was digested with BclI or MluI, fractionated by gel electrophoresis and hybridized to the SCP1 terminal DNA probe. The physical map of pLUS892L is shown above with the BclI and MluI (Ml) sites and fragments sizes indicated. In the control experiment (right panel), the samples were treated with proteinase K before electrophoresis. The cross-linked DNA is indicated by an asterisk.

    Article Snippet: To remove TP, proteinase K (AMRESCO) was added to the loading buffer containing the DNA sample to a final concentration of 20 U/ml before electrophoresis.

    Techniques: In Vitro, Nucleic Acid Electrophoresis, Isolation, Gradient Centrifugation, Electrophoresis

    Superhelical structures formed by linear plasmid DNA. ( A ) S. lividans 3200/pLUS892L mycelium was osmotically lysed. The cell lysate was treated with E. coli Topoisomerase I (‘Topo I’), fractionated by gel electrophoresis and hybridized to the pLUS892L DNA probe. In the control experiments, samples were treated with proteinase K (‘PK’) before electrophoresis, or the topoisomerase treatment was omitted, or both. The sizes of the (proteinase K-treated) linear pLUS892L DNA and the marker DNAs (‘M’) are indicated (in kb). ( B ) AFM examination of isolated DSS-cross-linked linear plasmid DNA (pLUS891L) without proteinase K-treatment (‘−PK’) shows supercoiled DNA structures that are held together by telomere–telomere interactions (left and center images). The center image shows a zoomed-in surface plot of the coiled DNA molecule boxed in the left image. Proteolytic digestion of the DSS-cross-linked DNA by proteinase K (‘+PK’) transformed it into relaxed, linear structures (right). The scale bar is 1 µm.

    Journal: Nucleic Acids Research

    Article Title: Linear Streptomyces plasmids form superhelical circles through interactions between their terminal proteins

    doi: 10.1093/nar/gkq1204

    Figure Lengend Snippet: Superhelical structures formed by linear plasmid DNA. ( A ) S. lividans 3200/pLUS892L mycelium was osmotically lysed. The cell lysate was treated with E. coli Topoisomerase I (‘Topo I’), fractionated by gel electrophoresis and hybridized to the pLUS892L DNA probe. In the control experiments, samples were treated with proteinase K (‘PK’) before electrophoresis, or the topoisomerase treatment was omitted, or both. The sizes of the (proteinase K-treated) linear pLUS892L DNA and the marker DNAs (‘M’) are indicated (in kb). ( B ) AFM examination of isolated DSS-cross-linked linear plasmid DNA (pLUS891L) without proteinase K-treatment (‘−PK’) shows supercoiled DNA structures that are held together by telomere–telomere interactions (left and center images). The center image shows a zoomed-in surface plot of the coiled DNA molecule boxed in the left image. Proteolytic digestion of the DSS-cross-linked DNA by proteinase K (‘+PK’) transformed it into relaxed, linear structures (right). The scale bar is 1 µm.

    Article Snippet: To remove TP, proteinase K (AMRESCO) was added to the loading buffer containing the DNA sample to a final concentration of 20 U/ml before electrophoresis.

    Techniques: Plasmid Preparation, Nucleic Acid Electrophoresis, Electrophoresis, Marker, Isolation, Transformation Assay

    Secondary structural changes of human PrP isoforms monitored by far-UV CD ( A and B ) and proteinase K digestion assays of human PrP fibrils ( C and D ) formed in the absence of a crowding agent ( A and C ) and in the presence of 150 g/liter Ficoll 70 ( B and

    Journal: The Journal of Biological Chemistry

    Article Title: Crowded Cell-like Environment Accelerates the Nucleation Step of Amyloidogenic Protein Misfolding *

    doi: 10.1074/jbc.M109.002832

    Figure Lengend Snippet: Secondary structural changes of human PrP isoforms monitored by far-UV CD ( A and B ) and proteinase K digestion assays of human PrP fibrils ( C and D ) formed in the absence of a crowding agent ( A and C ) and in the presence of 150 g/liter Ficoll 70 ( B and

    Article Snippet: Dithiothreitol (DTT), proteinase K, and Triton X-100 were purchased from Amresco Chemical Co. (Solon, OH).

    Techniques:

    Mtb WhiB4 exhibits non-specific DNA binding activities. (A) 150 ng of either linear (L) or supercoiled (SC) plasmid DNA was incubated with oxidized apo-WhiB4 (250 ng [lanes 2, 6]; 300 ng [lanes 3, 7]; 350 ng [4, 8]). Lanes 1 and 5 represent DNA without WhiB4. (B) Binding of apo-WhiB4 (100, 150, 200, 250, 300 and 350 ng) with 1 kb λ-DNA ladder (λ) (150 ng). (C) WhiB4 represses transcription . In vitro transcribed pGEM plasmid in the absence of apo-WhiB4 (lane 1), oxidized apo-WhiB4 in complex with pGEM (lane 2), in vitro transcription of pGEM in the presence of oxidized (lane 3) or reduced (lane 4) apo-WhiB4. The reactions in lane 3 and 4 were treated with 6% SDS and 4 mg ml -1 protease K to remove WhiB4 from the mixture before separation. C: pGEM plasmid DNA alone. Cysteine residues regulate DNA binding of WhiB4 (D) DTT-treatment abolished DNA binding of WhiB4. Oxidized apo-WhiB4 (350 ng) was treated with DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. C: represents DNA without WhiB4. (E) Purified wt apo-WhiB4 and Cys mutant variants were treated with thiol oxidant, diamide, and the gel-shift assay was performed as described earlier. DNA binding assays using Mtb HU (50–350 ng) and Mtb TcrX (150–350 ng) with (F) supercoiled DNA and (G) 1 kb λ-DNA ladder. (H) 350 ng of Mtb HU or (I) Mtb TcrX were treated with increasing concentrations of DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. The samples were analyzed on 1% agarose gel.

    Journal: Redox Biology

    Article Title: Redox-dependent condensation of the mycobacterial nucleoid by WhiB4

    doi: 10.1016/j.redox.2018.08.006

    Figure Lengend Snippet: Mtb WhiB4 exhibits non-specific DNA binding activities. (A) 150 ng of either linear (L) or supercoiled (SC) plasmid DNA was incubated with oxidized apo-WhiB4 (250 ng [lanes 2, 6]; 300 ng [lanes 3, 7]; 350 ng [4, 8]). Lanes 1 and 5 represent DNA without WhiB4. (B) Binding of apo-WhiB4 (100, 150, 200, 250, 300 and 350 ng) with 1 kb λ-DNA ladder (λ) (150 ng). (C) WhiB4 represses transcription . In vitro transcribed pGEM plasmid in the absence of apo-WhiB4 (lane 1), oxidized apo-WhiB4 in complex with pGEM (lane 2), in vitro transcription of pGEM in the presence of oxidized (lane 3) or reduced (lane 4) apo-WhiB4. The reactions in lane 3 and 4 were treated with 6% SDS and 4 mg ml -1 protease K to remove WhiB4 from the mixture before separation. C: pGEM plasmid DNA alone. Cysteine residues regulate DNA binding of WhiB4 (D) DTT-treatment abolished DNA binding of WhiB4. Oxidized apo-WhiB4 (350 ng) was treated with DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. C: represents DNA without WhiB4. (E) Purified wt apo-WhiB4 and Cys mutant variants were treated with thiol oxidant, diamide, and the gel-shift assay was performed as described earlier. DNA binding assays using Mtb HU (50–350 ng) and Mtb TcrX (150–350 ng) with (F) supercoiled DNA and (G) 1 kb λ-DNA ladder. (H) 350 ng of Mtb HU or (I) Mtb TcrX were treated with increasing concentrations of DTT (0, 200, 400, 800 mM) for 2 h followed by binding to the supercoiled plasmid DNA. The samples were analyzed on 1% agarose gel.

    Article Snippet: Samples were treated with 6% SDS (Amresco Inc.) and 4 mg ml-1 proteinase K (Amresco Inc.) for 30 min at 37o C and the reaction products were analyzed on a 1% agarose gel.

    Techniques: Binding Assay, Plasmid Preparation, Incubation, In Vitro, Purification, Mutagenesis, Electrophoretic Mobility Shift Assay, Agarose Gel Electrophoresis