primescript rt reagent kit  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PrimeScript RT Reagent Kit
    Description:
    When synthesizing cDNA for real time PCR the PrimeScript RT Reagent Kit Perfect Real Time allows maximal flexibility during reaction assembly This reverse transcription reagent kit facilitates cDNA synthesis prior to analysis by real time PCR Designed for two step real time RT PCR also called qRT PCR or RT qPCR the PrimeScript RT Reagent Kit Perfect Real Time contains all of the components needed for reverse transcription including PrimeScript RTase RNase inhibitor random 6 mers oligo dT primer dNTPs and reaction buffer Because the kit s primers and RTase are provided as separate components there is greater flexibility in reaction assembly
    Catalog Number:
    rr037b
    Price:
    None
    Size:
    800 Rxns
    Category:
    PrimeScript RT reagent kit Reverse transcription prior to qPCR Real time PCR
    Buy from Supplier


    Structured Review

    TaKaRa primescript rt reagent kit
    QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with <t>PrimeScript™</t> RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.
    When synthesizing cDNA for real time PCR the PrimeScript RT Reagent Kit Perfect Real Time allows maximal flexibility during reaction assembly This reverse transcription reagent kit facilitates cDNA synthesis prior to analysis by real time PCR Designed for two step real time RT PCR also called qRT PCR or RT qPCR the PrimeScript RT Reagent Kit Perfect Real Time contains all of the components needed for reverse transcription including PrimeScript RTase RNase inhibitor random 6 mers oligo dT primer dNTPs and reaction buffer Because the kit s primers and RTase are provided as separate components there is greater flexibility in reaction assembly
    https://www.bioz.com/result/primescript rt reagent kit/product/TaKaRa
    Average 99 stars, based on 5118 article reviews
    Price from $9.99 to $1999.99
    primescript rt reagent kit - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells"

    Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0031708

    QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.
    Figure Legend Snippet: QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

    Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

    2) Product Images from "Growth and adherence of Staphylococcus aureus were enhanced through the PGE2 produced by the activated COX-2/PGE2 pathway of infected oral epithelial cells"

    Article Title: Growth and adherence of Staphylococcus aureus were enhanced through the PGE2 produced by the activated COX-2/PGE2 pathway of infected oral epithelial cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0177166

    PGE 2 up-regulates the expression of fnbpB but not fnbpA mRNA. S . aureus were treated with PGE 2 (500 pg/mL) or with PBS and bacterial cells were harvested at both the early and the middle exponential phase. Total RNA of S . aureus was isolated from ~5×10 8 bacterial cells using TRIzol reagent following the manufacturer’s instruction. cDNA was synthesized using the PrimeScript RT reagent Kit and qPCR was performed with the SYBR reagent. A . The transcriptional level of fnbpA and fnbpB mRNA in the early exponential phase. The level of fnbpB mRNA of PGE 2 -treated S . aureus is 73% higher than that of un-treated S . aureus and the level of fnbpA mRNA had no differences between the two groups. B . The transcriptional level of fnbpA and fnbpB mRNA in the middle exponential phase. The level of fnbpB mRNA of PGE 2 -treated S . aureus is 67% higher than that of un-treated S . aureus and the level of fnbpA mRNA had no differences between the two groups. All values were normalized against S . aureus 16S rRNA expression. Results are representative of three independent experiments and represent the means ± standard errors for three separate cultures. The asterisk represents significant differences ( P
    Figure Legend Snippet: PGE 2 up-regulates the expression of fnbpB but not fnbpA mRNA. S . aureus were treated with PGE 2 (500 pg/mL) or with PBS and bacterial cells were harvested at both the early and the middle exponential phase. Total RNA of S . aureus was isolated from ~5×10 8 bacterial cells using TRIzol reagent following the manufacturer’s instruction. cDNA was synthesized using the PrimeScript RT reagent Kit and qPCR was performed with the SYBR reagent. A . The transcriptional level of fnbpA and fnbpB mRNA in the early exponential phase. The level of fnbpB mRNA of PGE 2 -treated S . aureus is 73% higher than that of un-treated S . aureus and the level of fnbpA mRNA had no differences between the two groups. B . The transcriptional level of fnbpA and fnbpB mRNA in the middle exponential phase. The level of fnbpB mRNA of PGE 2 -treated S . aureus is 67% higher than that of un-treated S . aureus and the level of fnbpA mRNA had no differences between the two groups. All values were normalized against S . aureus 16S rRNA expression. Results are representative of three independent experiments and represent the means ± standard errors for three separate cultures. The asterisk represents significant differences ( P

    Techniques Used: Expressing, Isolation, Synthesized, Real-time Polymerase Chain Reaction

    Related Articles

    Synthesized:

    Article Title: STE20/SPS1-Related Proline/Alanine-Rich Kinase Is Involved in Plasticity of GABA Signaling Function in a Mouse Model of Acquired Epilepsy
    Article Snippet: .. An initial strand of cDNA was synthesized from 1 mg of total cellular RNA with random 6mers with the ExScript™\RT reagent kit (Takara Biotechnology, Dalian, China). .. RT-PCR cycles were carried out for amplification of SPAK and GAPDH with a DNA Engine Opticon Continuous Fluorescence Detection System (DFC-3200, MJ Research Company, USA).

    Article Title: Growth and adherence of Staphylococcus aureus were enhanced through the PGE2 produced by the activated COX-2/PGE2 pathway of infected oral epithelial cells
    Article Snippet: .. Total RNA yield and purity were determined by absorbance at 260 nm and 280 nm using a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). cDNA was then synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Clontech, Japan) according to the manufacturer’s instructions. .. Real-time PCR was performed on a C1000 Touch™ Thermal Cycler instrument (Bio-Rad, Philadelphia, PA, USA) with the SYBR reagent (Takara, Dalian, China) following the manufacturer’s instructions.

    Isolation:

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    Quantitative RT-PCR:

    Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
    Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

    Article Title: Comparative Transcriptome Profiling of mRNA and lncRNA Related to Tail Adipose Tissues of Sheep
    Article Snippet: .. Total RNA samples were reverse transcribed to cDNA using the PrimeSriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) according to the manufacturer’s recommendations. qRT-PCR was performed using the SYBR® Premix Ex TaqTM kit (TaKaRa, Dalian, China) on the Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, United States). ..

    Article Title: Altered staining patterns and expression level of Engrailed-2 in benign prostatic hyperplasia and prostate Cancer predict prostatic disease progression
    Article Snippet: .. RT-qPCR The EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). .. The reverse transcription reaction was performed according to the manufacturer’s instructions by PrimeScript™ RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 °C for 5 min, 94 °C for 20 s, 55 °C for 20 s and 72 °C 15 s for 30 cycles, followed by 72 °C for 5 min using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA).

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    Real-time Polymerase Chain Reaction:

    Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
    Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

    Article Title: Comparative Transcriptome Profiling of mRNA and lncRNA Related to Tail Adipose Tissues of Sheep
    Article Snippet: .. Total RNA samples were reverse transcribed to cDNA using the PrimeSriptTM RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China) according to the manufacturer’s recommendations. qRT-PCR was performed using the SYBR® Premix Ex TaqTM kit (TaKaRa, Dalian, China) on the Bio-Rad CFX96 Real-Time PCR system (Hercules, CA, United States). ..

    Article Title: Altered staining patterns and expression level of Engrailed-2 in benign prostatic hyperplasia and prostate Cancer predict prostatic disease progression
    Article Snippet: .. RT-qPCR The EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). .. The reverse transcription reaction was performed according to the manufacturer’s instructions by PrimeScript™ RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 °C for 5 min, 94 °C for 20 s, 55 °C for 20 s and 72 °C 15 s for 30 cycles, followed by 72 °C for 5 min using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA).

    Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
    Article Snippet: .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The reverse-transcribed RNA was primed with oligonucleotides specific for VEGFR1 (Flt-1) (forward: 5′–GGGCAGACTCTTGTCCTCAACT–3′ and reverse: 5′–CAGCTCATTTGCACCCTCGT–3′ ), VEGFR2 (Flk-1) (forward: 5′–GACTGTGGCGAAGTGTTTTTGA–3′ and reverse: 5′–GTGCAGGGGAGGGTTGGCGTAG–3′ ), and β-actin (forward: 5′–GTGCGGGACATCAAGGAGAA–3′ and reverse: 5′–AGGAAGGAGGGCTGGAAGAG–3′ ) (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    Spectrophotometry:

    Article Title: Growth and adherence of Staphylococcus aureus were enhanced through the PGE2 produced by the activated COX-2/PGE2 pathway of infected oral epithelial cells
    Article Snippet: .. Total RNA yield and purity were determined by absorbance at 260 nm and 280 nm using a NanoDrop-2000 spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA). cDNA was then synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Clontech, Japan) according to the manufacturer’s instructions. .. Real-time PCR was performed on a C1000 Touch™ Thermal Cycler instrument (Bio-Rad, Philadelphia, PA, USA) with the SYBR reagent (Takara, Dalian, China) following the manufacturer’s instructions.

    Expressing:

    Article Title: Altered staining patterns and expression level of Engrailed-2 in benign prostatic hyperplasia and prostate Cancer predict prostatic disease progression
    Article Snippet: .. RT-qPCR The EN2 gene expression was measured by reverse transcription quantitative polymerase chain reaction (RT-qPCR). .. The reverse transcription reaction was performed according to the manufacturer’s instructions by PrimeScript™ RT reagent Kit (#RR047A, TAKARA, Japan) and the qPCR reactions were performed at 94 °C for 5 min, 94 °C for 20 s, 55 °C for 20 s and 72 °C 15 s for 30 cycles, followed by 72 °C for 5 min using 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher Inc., USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa qrt pcr analysis
    SETD8 repressed STRA8 expression by directly binding to the proximal STRA8 promoter. STRA8 increased the transcriptional activity of SETD8 promoter in a dose‐dependent manner. A, Transcriptional activity analysis of STRA8 promoter by DLR assay. pGL3 was a negative control group. pGL4 was a positive control group. B, Effects of SETD8 protein (pCMV‐HA‐SETD8, μg) with different doses on transcriptional activity of STRA8 promoter. C, Validation of SETD8 protein expression by Western blot. D, Transcriptional activity analysis of SETD8 promoter. E, Effects of STRA8 protein (pCMV‐MYC‐STRA8) with different doses on transcriptional activity of SETD8 promoter. F, Validation of STRA8 protein expression by Western blot. G, Schematic representation of primers structure of STRA8 promoter for ChIP assay. H, ChIP assay using anti‐HA antibody and control IgG. <t>qRT‐PCR</t> with specific primers was used to calculate the IP efficiency. The data were presented as mean ± standard deviation, * represented a significant statistical difference versus the control group, P
    Qrt Pcr Analysis, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5576 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr analysis/product/TaKaRa
    Average 99 stars, based on 5576 article reviews
    Price from $9.99 to $1999.99
    qrt pcr analysis - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    TaKaRa gdna eraser
    The SHH pathway is upregulated in an additional CNS HGNET-BCOR case (A) The sequence of exon 15 of BCOR was analyzed by PCR in the genomic DNA extracted from the blood of P1 (lane 1), the primary tumor of P2 (lane 2) or from the primary tumor of P1 (lane 3). The sizes of the wt BCOR and of the BCOR ITDs are indicated. (B) Protein sequence of the BCOR allele of P2 carrying the ITD compared to the wild type BCOR and to the BCOR ITD detected in P1. (C) qRT-PCR analysis was performed using primers recognizing BCOR , GLI2, PTCH1 or GLI1 . After normalization to the housekeeping gene HPRT1 , the fold change of the expression of P2 with respect to P1 was calculated. Expression analysis was done in triplicates. Expression analysis was done on <t>RNA</t> extracted from FFPE material.
    Gdna Eraser, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1792 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna eraser/product/TaKaRa
    Average 99 stars, based on 1792 article reviews
    Price from $9.99 to $1999.99
    gdna eraser - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    SETD8 repressed STRA8 expression by directly binding to the proximal STRA8 promoter. STRA8 increased the transcriptional activity of SETD8 promoter in a dose‐dependent manner. A, Transcriptional activity analysis of STRA8 promoter by DLR assay. pGL3 was a negative control group. pGL4 was a positive control group. B, Effects of SETD8 protein (pCMV‐HA‐SETD8, μg) with different doses on transcriptional activity of STRA8 promoter. C, Validation of SETD8 protein expression by Western blot. D, Transcriptional activity analysis of SETD8 promoter. E, Effects of STRA8 protein (pCMV‐MYC‐STRA8) with different doses on transcriptional activity of SETD8 promoter. F, Validation of STRA8 protein expression by Western blot. G, Schematic representation of primers structure of STRA8 promoter for ChIP assay. H, ChIP assay using anti‐HA antibody and control IgG. qRT‐PCR with specific primers was used to calculate the IP efficiency. The data were presented as mean ± standard deviation, * represented a significant statistical difference versus the control group, P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis

    doi: 10.1111/jcmm.15080

    Figure Lengend Snippet: SETD8 repressed STRA8 expression by directly binding to the proximal STRA8 promoter. STRA8 increased the transcriptional activity of SETD8 promoter in a dose‐dependent manner. A, Transcriptional activity analysis of STRA8 promoter by DLR assay. pGL3 was a negative control group. pGL4 was a positive control group. B, Effects of SETD8 protein (pCMV‐HA‐SETD8, μg) with different doses on transcriptional activity of STRA8 promoter. C, Validation of SETD8 protein expression by Western blot. D, Transcriptional activity analysis of SETD8 promoter. E, Effects of STRA8 protein (pCMV‐MYC‐STRA8) with different doses on transcriptional activity of SETD8 promoter. F, Validation of STRA8 protein expression by Western blot. G, Schematic representation of primers structure of STRA8 promoter for ChIP assay. H, ChIP assay using anti‐HA antibody and control IgG. qRT‐PCR with specific primers was used to calculate the IP efficiency. The data were presented as mean ± standard deviation, * represented a significant statistical difference versus the control group, P

    Article Snippet: Reverse transcription was performed according to the instructions of PrimeScript™ RT reagent Kit (Takara). qRT‐PCR analysis was performed following the method outlined by the GoTaq® qPCR Master Mix kit (TaKaRa).

    Techniques: Expressing, Binding Assay, Activity Assay, Negative Control, Positive Control, Western Blot, Chromatin Immunoprecipitation, Quantitative RT-PCR, Standard Deviation

    LOXL4 expression is upregulated in HCC tissues and predicts a poor clinical outcome. a The mRNA expression level of LOXL4 in HCC tissues compared with the normal liver tissues (N) revealed using the GSE6764 dataset. b-c The mRNA expression level of LOXL4 in the non-tumorous liver (NT) and HCC tissues revealed using the GSE36376 ( b ) and GSE84402 ( c ) datasets. d The mRNA expression level of LOXL4 in 42 matched NT and HCC tissues derived from Ren Ji cohort detected by qRT-PCR. e IHC staining performed using an antibody against LOXL4 and representative photographs of the LOXL4 staining in NT and HCC tissues. (Scale bar: 100 μm). f LOXL4 expression was upregulated in 175 HCC tissues compared with NT tissues (T > N). g Comparison of overall survival of HCC patients with different LOXL4 protein expression. h Comparison of disease-free survival of HCC patients with different LOXL4 protein expression. i Overall survival analysis of HCC patients in TCGA cohort. j-k Forest plot showing the association between LOXL4 expression and HCC survival using univariate ( j ) and multivariate ( k ) analyses. (HR, hazard ratio; CI, confidence interval)

    Journal: Molecular Cancer

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis

    doi: 10.1186/s12943-019-0948-8

    Figure Lengend Snippet: LOXL4 expression is upregulated in HCC tissues and predicts a poor clinical outcome. a The mRNA expression level of LOXL4 in HCC tissues compared with the normal liver tissues (N) revealed using the GSE6764 dataset. b-c The mRNA expression level of LOXL4 in the non-tumorous liver (NT) and HCC tissues revealed using the GSE36376 ( b ) and GSE84402 ( c ) datasets. d The mRNA expression level of LOXL4 in 42 matched NT and HCC tissues derived from Ren Ji cohort detected by qRT-PCR. e IHC staining performed using an antibody against LOXL4 and representative photographs of the LOXL4 staining in NT and HCC tissues. (Scale bar: 100 μm). f LOXL4 expression was upregulated in 175 HCC tissues compared with NT tissues (T > N). g Comparison of overall survival of HCC patients with different LOXL4 protein expression. h Comparison of disease-free survival of HCC patients with different LOXL4 protein expression. i Overall survival analysis of HCC patients in TCGA cohort. j-k Forest plot showing the association between LOXL4 expression and HCC survival using univariate ( j ) and multivariate ( k ) analyses. (HR, hazard ratio; CI, confidence interval)

    Article Snippet: Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions.

    Techniques: Expressing, Derivative Assay, Quantitative RT-PCR, Immunohistochemistry, Staining

    QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

    Journal: PLoS ONE

    Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells

    doi: 10.1371/journal.pone.0031708

    Figure Lengend Snippet: QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

    Article Snippet: RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR

    The SHH pathway is upregulated in an additional CNS HGNET-BCOR case (A) The sequence of exon 15 of BCOR was analyzed by PCR in the genomic DNA extracted from the blood of P1 (lane 1), the primary tumor of P2 (lane 2) or from the primary tumor of P1 (lane 3). The sizes of the wt BCOR and of the BCOR ITDs are indicated. (B) Protein sequence of the BCOR allele of P2 carrying the ITD compared to the wild type BCOR and to the BCOR ITD detected in P1. (C) qRT-PCR analysis was performed using primers recognizing BCOR , GLI2, PTCH1 or GLI1 . After normalization to the housekeeping gene HPRT1 , the fold change of the expression of P2 with respect to P1 was calculated. Expression analysis was done in triplicates. Expression analysis was done on RNA extracted from FFPE material.

    Journal: Oncotarget

    Article Title: Personalized therapy: CNS HGNET-BCOR responsiveness to arsenic trioxide combined with radiotherapy

    doi: 10.18632/oncotarget.23174

    Figure Lengend Snippet: The SHH pathway is upregulated in an additional CNS HGNET-BCOR case (A) The sequence of exon 15 of BCOR was analyzed by PCR in the genomic DNA extracted from the blood of P1 (lane 1), the primary tumor of P2 (lane 2) or from the primary tumor of P1 (lane 3). The sizes of the wt BCOR and of the BCOR ITDs are indicated. (B) Protein sequence of the BCOR allele of P2 carrying the ITD compared to the wild type BCOR and to the BCOR ITD detected in P1. (C) qRT-PCR analysis was performed using primers recognizing BCOR , GLI2, PTCH1 or GLI1 . After normalization to the housekeeping gene HPRT1 , the fold change of the expression of P2 with respect to P1 was calculated. Expression analysis was done in triplicates. Expression analysis was done on RNA extracted from FFPE material.

    Article Snippet: RT-PCR and qRT-PCR RNA was converted to cDNA by using PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio Europe, Saint-Germain-en-Laye, France). qRT-PCR was performed using the LightCycler 480 II Detection System and Software (Applied Biosystems, Darmstadt, Germany) with KAPA SYBR FAST LightCycler 480 Kit (PeqLab, Erlangen, Germany).

    Techniques: Sequencing, Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Formalin-fixed Paraffin-Embedded

    The BCOR ITD is maintained in the systemic metastases of P1 (A) BCOR ITD specific primers were used for PCR analysis of the genomic DNA extracted from the primary tumor (lane 1), a metastasis (lane 2) and the blood (lane 3) of P1. The expected product of BCOR ITD is 117 bps. (B) The genomic DNA extracted from the primary tumor was diluted at different concentrations. The –log of the concentration in ng/μl is shown on the x-axis. The threshold cycle (ct) is shown on the y axis. The slope of the standard curve was used to calculate the efficiency of the primers. (C) The size of the isolated ctDNA was analyzed using a Bioanalyzer. The y axis shows the signal intensity (FU) and the x axis the size distribution in bps. The circle indicates the purified ctDNA. (D) The concentration of the ctDNA was calculated based on the standard curve in B and reported as ng of ctDNA per μl of purified ctDNA (ng/μl) on the y axis. The x axis report the days of the plasma collection with respect to the time of the complete remission as assessed by MRI (x=0). To facilitate the comparison with the sketch in Figure 3 , the datum of the plasma collection is also reported.

    Journal: Oncotarget

    Article Title: Personalized therapy: CNS HGNET-BCOR responsiveness to arsenic trioxide combined with radiotherapy

    doi: 10.18632/oncotarget.23174

    Figure Lengend Snippet: The BCOR ITD is maintained in the systemic metastases of P1 (A) BCOR ITD specific primers were used for PCR analysis of the genomic DNA extracted from the primary tumor (lane 1), a metastasis (lane 2) and the blood (lane 3) of P1. The expected product of BCOR ITD is 117 bps. (B) The genomic DNA extracted from the primary tumor was diluted at different concentrations. The –log of the concentration in ng/μl is shown on the x-axis. The threshold cycle (ct) is shown on the y axis. The slope of the standard curve was used to calculate the efficiency of the primers. (C) The size of the isolated ctDNA was analyzed using a Bioanalyzer. The y axis shows the signal intensity (FU) and the x axis the size distribution in bps. The circle indicates the purified ctDNA. (D) The concentration of the ctDNA was calculated based on the standard curve in B and reported as ng of ctDNA per μl of purified ctDNA (ng/μl) on the y axis. The x axis report the days of the plasma collection with respect to the time of the complete remission as assessed by MRI (x=0). To facilitate the comparison with the sketch in Figure 3 , the datum of the plasma collection is also reported.

    Article Snippet: RT-PCR and qRT-PCR RNA was converted to cDNA by using PrimeScript RT Reagent Kit with gDNA Eraser (Takara Bio Europe, Saint-Germain-en-Laye, France). qRT-PCR was performed using the LightCycler 480 II Detection System and Software (Applied Biosystems, Darmstadt, Germany) with KAPA SYBR FAST LightCycler 480 Kit (PeqLab, Erlangen, Germany).

    Techniques: Polymerase Chain Reaction, Concentration Assay, Isolation, Purification, Magnetic Resonance Imaging