Structured Review

Illumina Inc primers spanning rs1876453
The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding <t>rs1876453.</t> (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40
Primers Spanning Rs1876453, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers spanning rs1876453/product/Illumina Inc
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
primers spanning rs1876453 - by Bioz Stars, 2020-09
86/100 stars

Images

1) Product Images from "Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA"

Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

Journal: Annals of the Rheumatic Diseases

doi: 10.1136/annrheumdis-2014-205584

The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40
Figure Legend Snippet: The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40

Techniques Used: Derivative Assay, Transformation Assay, Chromatin Immunoprecipitation, Blocking Assay, Binding Assay, Next-Generation Sequencing, RNA Sequencing Assay

CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.
Figure Legend Snippet: CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.

Techniques Used: Binding Assay, In Vivo, Chromatin Immunoprecipitation, Transformation Assay, Real-time Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Amplification, Generated

Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of
Figure Legend Snippet: Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of

Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Binding Assay, Two Tailed Test

Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.
Figure Legend Snippet: Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.

Techniques Used: Binding Assay

Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.
Figure Legend Snippet: Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.

Techniques Used: Variant Assay, Generated

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA
Article Snippet: .. Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System. .. A standard curve was constructed using a chromatin input control. qPCR of EBV-transformed cell transcripts was performed using cDNA transcribed using the Superscript VILO cDNA synthesis kit (Life Technologies), primers specific for β-actin (5′-GATGACCCAGATCATGTTTGAG-3′, 5′-GACTCCATGCCCAGGAAGGAA-3′), CTCF (5′-CAACCAGCCCAAACAGAACCAG-3′, 5′-TCCTCTTCCTCTCCCTCTGC-3′), CR2 (5′-TGCCTGTAAAACCAACTTCTC-3′, 5′-AGCAAGTAACCAGATTCACAG-3′) and CR1 (5′-TGCTAAGGACAGGTGCAGAC-3′, 5′-GGCAGACGAGGAACCAATGA-3′), SYBR Green-based detection, and the Eco Real-Time PCR System (Illumina).

Incubation:

Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA
Article Snippet: .. Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System. .. A standard curve was constructed using a chromatin input control. qPCR of EBV-transformed cell transcripts was performed using cDNA transcribed using the Superscript VILO cDNA synthesis kit (Life Technologies), primers specific for β-actin (5′-GATGACCCAGATCATGTTTGAG-3′, 5′-GACTCCATGCCCAGGAAGGAA-3′), CTCF (5′-CAACCAGCCCAAACAGAACCAG-3′, 5′-TCCTCTTCCTCTCCCTCTGC-3′), CR2 (5′-TGCCTGTAAAACCAACTTCTC-3′, 5′-AGCAAGTAACCAGATTCACAG-3′) and CR1 (5′-TGCTAAGGACAGGTGCAGAC-3′, 5′-GGCAGACGAGGAACCAATGA-3′), SYBR Green-based detection, and the Eco Real-Time PCR System (Illumina).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Illumina Inc primers spanning rs1876453
    The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding <t>rs1876453.</t> (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40
    Primers Spanning Rs1876453, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primers spanning rs1876453/product/Illumina Inc
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primers spanning rs1876453 - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    Image Search Results


    The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: The ENCyclopedia Of DNA Elements (ENCODE) Project data surrounding rs1876453. (A) The first exon and 5′ end of the first intron of the CR2 gene. The 5’ untranslated region (5′ UTR) is shown before the methionine start codon, in green. These data are derived from the University of California Santa Cruz (UCSC) Genes Track. (B) The location of rs1876453 (highlighted in yellow) and previously reported systemic lupus erythematosus-associated rs3813946 (in blue font). These data are derived from the Common Single-Nucleotide Polymorphisms (SNP) (138) Track (ft.ncbi.nih.gov/snp). 39 (C) DNaseI hypersensitive sites in the GM12878 Epstein–Barr virus (EBV)-transformed B cell line and in primary CD20+ B cells derived by DNase-seq. These data are derived from the UCSC Uniform DNaseI HS Track. Signal values are shown as grayscale-coloured items where higher signal values correspond to darker-coloured blocks. Primary B cells contain an additional hypersensitivity site that overlies rs1876453. (D) Histone marks surrounding rs1876453, as determined by chromatin immunoprecipitation (ChIP)-seq. These data were derived from the Layered H3K4Me3, H3K4Me1 and H3K27Ac Tracks. The H3K4Me3 histone mark is associated with poised or active promoters, the H3K4me1 histone mark is associated with enhancers and with DNA regions downstream of transcription sites and the H3K27Ac histone mark may enhance transcription by blocking the spread of the repressive histone mark H3K27Me3. Data shown are for the GM12878 EBV-transformed B cell line. (E) Transcription factor binding sites determined by ChIP-seq are shown as grey boxes that encompass the peaks of transcription factor occupancy, with the darkness of the box proportional to the maximal signal strength observed in any cell line. The name to the left of the box is the transcription factor, and includes in parentheses the antibody used for ChIP. The letters to the right of the box indicate the cell lines in which a signal is detected, with the darkness of the letter proportional to the signal strength in the cell line. Data are derived from the Transcription Factor ChIP Track. CCCTC-binding factor (CTCF) binding was seen in multiple EBV-transformed B cell lines (G, g) as well as a variety of other cell lines. (F) CTCF binding to primary CD20+ B cells by ChIP-seq. Peak occupancy lies over exon 1 and the 5′ UTR. Data are derived from the Broad Histone Track. (G) Transcription levels for several cell types assayed by high-throughput sequencing of polyadenylated RNA (RNA-seq). Each cell line is associated with a particular colour; the GM12878 cell line is shown in pink. This figure was obtained from the UCSC Genome Browser (Human Feb 2009 (GRCh37/hg19) Assembly; http://genome.ucsc.edu ). 40

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Derivative Assay, Transformation Assay, Chromatin Immunoprecipitation, Blocking Assay, Binding Assay, Next-Generation Sequencing, RNA Sequencing Assay

    CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: CCCTC-binding factor (CTCF) interacts with CR2 intron 1 in vivo and demonstrates differential affinity for rs1876453 alleles. (A) Chromatin immunoprecipitation performed using an antibody specific for CTCF yielded allele-specific enrichment of the region surrounding rs1876453 from Epstein–Barr virus (EBV)-transformed B cells homozygous for the major or minor allele at rs1876453. The qPCR products were visualised by ethidium bromide staining of a 1.8% agarose gel and sized using a PCR marker (New England Biolabs). A non-specific IgG control (IgG) and a control without antibody (No Ab) were included to measure background enrichment. Decreasing amounts of enrichment were observed with serially diluted input samples (Lanes 5–8; 13–16). NTC, no template control. (B) A representative qPCR amplification plot. (C) The percentage enrichment at the CR2 promoter was determined by quantification against the standard curve. CTCF enrichment was normalised to the background enrichment generated by a non-specific IgG. (D) CTCF enrichment normalised to the minor allele at rs1876453. (E) CTCF transcript abundance for each homozygous cell line after normalisation to β-actin. (F) Transcript abundance of CR1 relative to CR2 in each homozygous cell line, with each transcript normalised to β-actin. Data shown are the mean±SEM for three independent experiments.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Binding Assay, In Vivo, Chromatin Immunoprecipitation, Transformation Assay, Real-time Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Amplification, Generated

    Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Allele-specific effects of rs1876453 on CR1 and CR2 expression. Relative amounts of CR2 (A) or CR1 (C) RNA transcripts in primary B cells from 35 or 40 healthy donors respectively were measured by qPCR using the comparative Ct method. 17 Levels of surface CR2 (B) and CR1 (D) on primary B cells from 131 healthy donors were determined by quantitative flow cytometry (ABC, antibody binding capacity). Each point represents a unique subject, and the line and error bars represent the mean SD for each group; p values were determined using a two-tailed Student t test, and a p value of

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Binding Assay, Two Tailed Test

    Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Allelic differences in complex formation at rs1876453. (A) Protein-DNA complexes (indicated by arrows; A–D) were formed with oligonucleotides including either the minor A or major G allele in the absence or presence of K562 (Lanes 1–10), Reh (Lanes 11–20) and Ramos (Lanes 21–30) nuclear extracts. Specificity and binding affinity of the protein-DNA complexes were demonstrated by the addition of 15-molar to 60-molar excess of unlabelled oligonucleotides. UB represents unbound control. (B) Anti-CTCF (CCCTC-binding factor) antibody was included during the formation of protein-DNA complexes to determine whether CTCF was involved in forming these complexes. Data shown are representative of at least three independent experiments.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Binding Assay

    Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.

    Journal: Annals of the Rheumatic Diseases

    Article Title: Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA

    doi: 10.1136/annrheumdis-2014-205584

    Figure Lengend Snippet: Association of single-nucleotide polymorphisms (SNPs) in the CR2 region with dsDNA autoantibodies. (A) The genomic structure of the CR2 region and positions of genetic variants are indicated. (B) The allelic p value (-log 10 p value) of each genetic variant with dsDNA autoantibodies is plotted against its position as a circle (genotyped) or a triangle (imputed) for European American (EA), African American (AA) and Hispanic (HS), respectively. Genetic variants are highlighted using different colours according to their strength of linkage disequilibrium (LD) (r 2 ) with rs1876453. An arrow is used to indicate the position of rs1876453. (C) Transancestral meta-analysis p value generated using fixed and random model are highlighted as red and blue, respectively. The dashed line represents the significance level after Bonferroni correction. (D) Frequencies, ORs and p values of haplotypes formed by lupus-associated CR2 SNPs in various ancestral groups. Haplotype H1 corresponds to the previously reported systemic lupus erythematosus (SLE)-associated haplotype and is highlighted in green.

    Article Snippet: Precleared soluble chromatin was incubated with anti-CTCF, an isotype control, or no antibody followed by Protein G agarose/salmon sperm DNA. qPCR was performed on immune complex-associated DNA using primers spanning rs1876453 (5′–GGAAAGTTTCTGTGCCGCGA–3′, 5′-GACAATCAGGACCAGGCGGT–3′), SYBR Green-based detection, and the Illumina Eco Real-Time PCR System.

    Techniques: Variant Assay, Generated