primer sequences  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher primer sequences
    Primer Sequences, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 439 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer sequences/product/Thermo Fisher
    Average 92 stars, based on 439 article reviews
    Price from $9.99 to $1999.99
    primer sequences - by Bioz Stars, 2020-07
    92/100 stars

    Images

    Related Articles

    Countercurrent Chromatography:

    Article Title: Targeted suppression of heme oxygenase-1 by small interference RNAs inhibits the production of bilirubin in neonatal rat with hyperbilirubinemia
    Article Snippet: .. The primer sequences used for RT-PCR analysis (synthesized by Invitrogen) are as follows: HO-1 Forward: 5'-CGG CCC TGG AAG AGG AGA TAG-3', Reverse: 5'-CGA TGC TCG GGA AGG TGA AAA-3'. .. GAPDH Forward: 5'-GTC GTG GAG TCT ACT GGC GTC TT-3', Reverse 5'-CAG TCT TCT GAG TGG CAG TGA TGG-3'.

    Clone Assay:

    Article Title: Substantial Differences in Specificity of HIV-Specific Cytotoxic T Cells in Acute and Chronic HIV Infection
    Article Snippet: .. Inserted Gag sequences were determined from both directions on an ABI 377 sequencer using primer sequences located in the plasmid sequence on both sides of the insert (Topo2 cloning kit; Invitrogen). .. Sequence analysis was performed using the sequencer software version 3.1.1.

    Amplification:

    Article Title: Extracellular matrix-associated gene expression in adult sensory neuron populations cultured on a laminin substrate
    Article Snippet: .. Primer sequences are not provided, but context sequences and amplicon size for each assay are available at Applied BioSystems (Taqman® search: a http://bioinfo.appliedbiosystems.com ). .. Data were expressed relative to IB4- at t=0 using a standard PCR protocol on a Fast Real-Time PCR platform (Applied Biosystems).

    Synthesized:

    Article Title: Targeted suppression of heme oxygenase-1 by small interference RNAs inhibits the production of bilirubin in neonatal rat with hyperbilirubinemia
    Article Snippet: .. The primer sequences used for RT-PCR analysis (synthesized by Invitrogen) are as follows: HO-1 Forward: 5'-CGG CCC TGG AAG AGG AGA TAG-3', Reverse: 5'-CGA TGC TCG GGA AGG TGA AAA-3'. .. GAPDH Forward: 5'-GTC GTG GAG TCT ACT GGC GTC TT-3', Reverse 5'-CAG TCT TCT GAG TGG CAG TGA TGG-3'.

    SYBR Green Assay:

    Article Title: T-Bet Enhances Regulatory T Cell Fitness and Directs Control of Th1 Responses in Crescentic GN
    Article Snippet: .. For detection of IL-10, TGF- β 1, and 18S, the sybr green method was used (primer sequences are available on request), whereas detection for EBI-3 was performed using Taqman probes (Applied Biosystems Assay ID: Mm00469294_m1). ..

    Sequencing:

    Article Title: Substantial Differences in Specificity of HIV-Specific Cytotoxic T Cells in Acute and Chronic HIV Infection
    Article Snippet: .. Inserted Gag sequences were determined from both directions on an ABI 377 sequencer using primer sequences located in the plasmid sequence on both sides of the insert (Topo2 cloning kit; Invitrogen). .. Sequence analysis was performed using the sequencer software version 3.1.1.

    Polymerase Chain Reaction:

    Article Title: The Protective Effects of Beta-Casomorphin-7 against Glucose -Induced Renal Oxidative Stress In Vivo and Vitro
    Article Snippet: .. The specific primers for the polymerase chain reaction (PCR) were as follows: The specific primer sequences for ACE, ACE2 and β-actin were designed with the software program Primer Express (PE, Applied Biosystems Inc., Foster City, USA) and given in . .. The SYBR Green quantitative real-time PCR Master Mix (Roche, Mannheim, Germany) was used to quantify the relative abundance of target mRNA.

    Expressing:

    Article Title: Characterization of Distinct Populations of Carcinoma-Associated Fibroblasts from Non–Small Cell Lung Carcinoma Reveals a Role for ST8SIA2 in Cancer Cell Invasion
    Article Snippet: .. Primer sequences for ST8SIA2 gene expression were designed based on Affymetrix-specific probe set: (forward) 5′-CCAGTACAGGAGTATGCCCG and (reverse) 5′-TGGCATTGACCAAGTCCTCA. ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Targeted suppression of heme oxygenase-1 by small interference RNAs inhibits the production of bilirubin in neonatal rat with hyperbilirubinemia
    Article Snippet: .. The primer sequences used for RT-PCR analysis (synthesized by Invitrogen) are as follows: HO-1 Forward: 5'-CGG CCC TGG AAG AGG AGA TAG-3', Reverse: 5'-CGA TGC TCG GGA AGG TGA AAA-3'. .. GAPDH Forward: 5'-GTC GTG GAG TCT ACT GGC GTC TT-3', Reverse 5'-CAG TCT TCT GAG TGG CAG TGA TGG-3'.

    Plasmid Preparation:

    Article Title: Structural Insight into the Clostridium difficile Ethanolamine Utilisation Microcompartment
    Article Snippet: .. The primer sequences were designed for insertion between NcoI and XhoI restriction sites in the pET28b vector (Invitrogen). .. N-terminal truncations of CD1925 were designed using sequence analysis to identify the putative start residue of the core fold and primers were made to produce a number of different internal start sites.

    Article Title: Substantial Differences in Specificity of HIV-Specific Cytotoxic T Cells in Acute and Chronic HIV Infection
    Article Snippet: .. Inserted Gag sequences were determined from both directions on an ABI 377 sequencer using primer sequences located in the plasmid sequence on both sides of the insert (Topo2 cloning kit; Invitrogen). .. Sequence analysis was performed using the sequencer software version 3.1.1.

    Software:

    Article Title: The Protective Effects of Beta-Casomorphin-7 against Glucose -Induced Renal Oxidative Stress In Vivo and Vitro
    Article Snippet: .. The specific primers for the polymerase chain reaction (PCR) were as follows: The specific primer sequences for ACE, ACE2 and β-actin were designed with the software program Primer Express (PE, Applied Biosystems Inc., Foster City, USA) and given in . .. The SYBR Green quantitative real-time PCR Master Mix (Roche, Mannheim, Germany) was used to quantify the relative abundance of target mRNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher gene specific primers ul43 fw
    Convergent transcriptional overlap of <t>UL43-44-AT</t> and UL26.5. The arrow a. points to the overlapping region delimited by the vertical red lines. The blue box represents the already known UL26.5 transcript, while the red box represents the novel UL43-44-AT transcript. Reads of the PacBio IsoSeq (A) and MinION Direct RNA (B) sequencing were visualized in compact mode using IGV.
    Gene Specific Primers Ul43 Fw, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene specific primers ul43 fw/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gene specific primers ul43 fw - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher mab 4384 full primers
    Binding activity of <t>MAB_4384</t> to a palindromic region within IR S5/L5 . (A) DNA sequence of IR S5/L5 and representation of the operator composed of a 27 bp region containing two degenerated inverted sequences of 13 nucleotides each (black arrows) and separated by a one nucleotide spacer. The probe used to perform the EMSA is delimited by dotted lines (Probe 1). (B) DNA sequences of all the various 5′ fluorescein-labeled probes used in this study. (C) EMSA and competition assay using probe 1. Protein and DNA concentrations are expressed in μM. In competition assays, the concentration of Probe 1 was fixed at 280 nM. Gel shifts were revealed by fluorescence emission. (D–H) EMSA using Probes 2 to 8, each time compared to the shift profile obtained with Probe 1. Experiments were reproduced three times with similar results.
    Mab 4384 Full Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mab 4384 full primers/product/Thermo Fisher
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mab 4384 full primers - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    93
    Thermo Fisher muc5ac
    IL13 increases <t>MUC5AC</t> expression and secretion. (A) In vitro protocol for IL13 treatment of human tracheal/bronchial epithelial cells (hTEC) differentiated using air-liquid interface conditions (ALI). Cells were assayed at the indicated times. (B) Representative
    Muc5ac, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/muc5ac/product/Thermo Fisher
    Average 93 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    muc5ac - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    89
    Thermo Fisher sirna dsirna
    Nucleotide and amino acid sequences of RNAi-resistant cells. The localisation of each mutation observed in <t>siRNA/DsiRNA</t> resistant viral clones. SGR-Feo-JFH-1 cells were repeatedly transfected (5-day intervals) with 5 nM of siD1/siD5 or DsiRNA1/DsiRNA5 and treated with 1 mg/mL of G418. Twenty-one days after the first transfection, the total RNA of surviving colonies was extracted, amplified by RT-PCR and submitted for sequencing. A) Nucleotide substitutions for NS5B target site. B) Amino acid substitutions for NS5B target site. C) Nucleotide substitutions for NS4B target site. B) Amino acid substitutions for NS4B target site. SIN—Synonymous mutations; WT—JFH-1 wild type; Numbers after the RNAi molecule name on first column represents the clone in which sequences were obtained.
    Sirna Dsirna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna dsirna/product/Thermo Fisher
    Average 89 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    sirna dsirna - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    Image Search Results


    Convergent transcriptional overlap of UL43-44-AT and UL26.5. The arrow a. points to the overlapping region delimited by the vertical red lines. The blue box represents the already known UL26.5 transcript, while the red box represents the novel UL43-44-AT transcript. Reads of the PacBio IsoSeq (A) and MinION Direct RNA (B) sequencing were visualized in compact mode using IGV.

    Journal: Frontiers in Microbiology

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus

    doi: 10.3389/fmicb.2017.02708

    Figure Lengend Snippet: Convergent transcriptional overlap of UL43-44-AT and UL26.5. The arrow a. points to the overlapping region delimited by the vertical red lines. The blue box represents the already known UL26.5 transcript, while the red box represents the novel UL43-44-AT transcript. Reads of the PacBio IsoSeq (A) and MinION Direct RNA (B) sequencing were visualized in compact mode using IGV.

    Article Snippet: RT-qPCR reaction was carried out in a total volume of 20 μl containing cDNA or RT control, both of the gene-specific primers UL43_fw, UL43_rev (GGATTTAATGCTAGTGGCGCA), and ABsolute QPCR SYBR Green Mix (Thermo Fisher Scientific) according to the manufacturer’s recommendation.

    Techniques: Sequencing

    Divergent transcriptional overlap of multiple transcripts in the ul41-ul43 gene cluster. The arrow a. points to the overlapping region delimited by the vertical red lines. The blue box represent already known UL42 transcript, while the red boxes represent novel transcripts. Reads of the PacBio IsoSeq (A) and MinION cDNA (B) sequencing were visualized in compact mode using IGV.

    Journal: Frontiers in Microbiology

    Article Title: Multi-Platform Sequencing Approach Reveals a Novel Transcriptome Profile in Pseudorabies Virus

    doi: 10.3389/fmicb.2017.02708

    Figure Lengend Snippet: Divergent transcriptional overlap of multiple transcripts in the ul41-ul43 gene cluster. The arrow a. points to the overlapping region delimited by the vertical red lines. The blue box represent already known UL42 transcript, while the red boxes represent novel transcripts. Reads of the PacBio IsoSeq (A) and MinION cDNA (B) sequencing were visualized in compact mode using IGV.

    Article Snippet: RT-qPCR reaction was carried out in a total volume of 20 μl containing cDNA or RT control, both of the gene-specific primers UL43_fw, UL43_rev (GGATTTAATGCTAGTGGCGCA), and ABsolute QPCR SYBR Green Mix (Thermo Fisher Scientific) according to the manufacturer’s recommendation.

    Techniques: Sequencing

    Binding activity of MAB_4384 to a palindromic region within IR S5/L5 . (A) DNA sequence of IR S5/L5 and representation of the operator composed of a 27 bp region containing two degenerated inverted sequences of 13 nucleotides each (black arrows) and separated by a one nucleotide spacer. The probe used to perform the EMSA is delimited by dotted lines (Probe 1). (B) DNA sequences of all the various 5′ fluorescein-labeled probes used in this study. (C) EMSA and competition assay using probe 1. Protein and DNA concentrations are expressed in μM. In competition assays, the concentration of Probe 1 was fixed at 280 nM. Gel shifts were revealed by fluorescence emission. (D–H) EMSA using Probes 2 to 8, each time compared to the shift profile obtained with Probe 1. Experiments were reproduced three times with similar results.

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: Binding activity of MAB_4384 to a palindromic region within IR S5/L5 . (A) DNA sequence of IR S5/L5 and representation of the operator composed of a 27 bp region containing two degenerated inverted sequences of 13 nucleotides each (black arrows) and separated by a one nucleotide spacer. The probe used to perform the EMSA is delimited by dotted lines (Probe 1). (B) DNA sequences of all the various 5′ fluorescein-labeled probes used in this study. (C) EMSA and competition assay using probe 1. Protein and DNA concentrations are expressed in μM. In competition assays, the concentration of Probe 1 was fixed at 280 nM. Gel shifts were revealed by fluorescence emission. (D–H) EMSA using Probes 2 to 8, each time compared to the shift profile obtained with Probe 1. Experiments were reproduced three times with similar results.

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Binding Assay, Activity Assay, Sequencing, Labeling, Competitive Binding Assay, Concentration Assay, Fluorescence

    Model of the binding of MAB_4384 to its operator and regulation of the MmpS5/MmpL5 efflux pump machinery. In the absence of drug, two MAB_4384 dimers bind to their DNA operator located in the intergenic region (IR S5/L5 ) between the divergently transcribed MAB_4384 (encoding the TetR regulator) and MAB_4383c / MAB_4382c (encoding the MmpS5/MmpL5 efflux pump) (1). This action represses the transcription of MAB_4384 (2), MAB_4383c (3) and MAB_4382c (4), predisposing the bacteria to drug susceptibility. When the TAC derivatives bind to MAB_4384 (5) or if MAB_4384 harbors the D14N or F57L mutations (6), the regulator loses affinity for the operator, leading to derepression of MAB_4384 itself (7), MAB_4383c (8) and MAB_4382c (9). This triggers high levels of expression of the MmpS5/MmpL5 complex in the plasma membrane and the subsequent export of the TAC analogs outside the bacteria (10), reducing susceptibility to the compounds.

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: Model of the binding of MAB_4384 to its operator and regulation of the MmpS5/MmpL5 efflux pump machinery. In the absence of drug, two MAB_4384 dimers bind to their DNA operator located in the intergenic region (IR S5/L5 ) between the divergently transcribed MAB_4384 (encoding the TetR regulator) and MAB_4383c / MAB_4382c (encoding the MmpS5/MmpL5 efflux pump) (1). This action represses the transcription of MAB_4384 (2), MAB_4383c (3) and MAB_4382c (4), predisposing the bacteria to drug susceptibility. When the TAC derivatives bind to MAB_4384 (5) or if MAB_4384 harbors the D14N or F57L mutations (6), the regulator loses affinity for the operator, leading to derepression of MAB_4384 itself (7), MAB_4383c (8) and MAB_4382c (9). This triggers high levels of expression of the MmpS5/MmpL5 complex in the plasma membrane and the subsequent export of the TAC analogs outside the bacteria (10), reducing susceptibility to the compounds.

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Binding Assay, Expressing

    Identification of a MAB_4384-dependent regulatory promoter region in M. abscessus . (A) Schematic representation of the genome organization of MAB_4384 and the mmpS5/mmpL5 gene cluster in M. abscessus with the purple rectangle indicating the IR S5/L5 intergenic region cloned upstream of the lacZ reporter construct. (B) The effect of MAB_4384 on mmpS5/mmpL5 expression was assayed by constructing a plasmid with the lacZ reporter under control of IR S5/L5 . A positive control plasmid consisting of the constitutive expression of lacZ under the control of the hsp60 promoter and a negative control consisting of a promoter-less lacZ were also generated. All constructs were introduced into wild-type smooth (S) and rough (R) variants as well as into three different strains harboring single point mutations in MAB_4384 (M1A, D14N and F57L replacements). Exponentially growing M. abscessus cultures were streaked onto 7H10 plates containing 100 μg/mL kanamycin and 50 μg/mL X-gal. The plates were subsequently incubated for 3–4 days at 37°C and visualized for their appearance with respect to white-to-blue coloration. The β-galactosidase specific activity (SA β-Gal ) was quantified in liquid cultures using ONPG as a substrate. Results were obtained from three independent experiments and the error bars represent standard deviation. The capped lines indicate the groups compared. For statistical analysis, the Student’s t -test was applied with ns, ∗∗ , ∗∗∗ , ∗∗∗∗ indicating non-significant, p

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: Identification of a MAB_4384-dependent regulatory promoter region in M. abscessus . (A) Schematic representation of the genome organization of MAB_4384 and the mmpS5/mmpL5 gene cluster in M. abscessus with the purple rectangle indicating the IR S5/L5 intergenic region cloned upstream of the lacZ reporter construct. (B) The effect of MAB_4384 on mmpS5/mmpL5 expression was assayed by constructing a plasmid with the lacZ reporter under control of IR S5/L5 . A positive control plasmid consisting of the constitutive expression of lacZ under the control of the hsp60 promoter and a negative control consisting of a promoter-less lacZ were also generated. All constructs were introduced into wild-type smooth (S) and rough (R) variants as well as into three different strains harboring single point mutations in MAB_4384 (M1A, D14N and F57L replacements). Exponentially growing M. abscessus cultures were streaked onto 7H10 plates containing 100 μg/mL kanamycin and 50 μg/mL X-gal. The plates were subsequently incubated for 3–4 days at 37°C and visualized for their appearance with respect to white-to-blue coloration. The β-galactosidase specific activity (SA β-Gal ) was quantified in liquid cultures using ONPG as a substrate. Results were obtained from three independent experiments and the error bars represent standard deviation. The capped lines indicate the groups compared. For statistical analysis, the Student’s t -test was applied with ns, ∗∗ , ∗∗∗ , ∗∗∗∗ indicating non-significant, p

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Clone Assay, Construct, Expressing, Plasmid Preparation, Positive Control, Negative Control, Generated, Incubation, Activity Assay, Standard Deviation

    Oligomerization of MAB_4384 and the MAB_4384:DNA complex in solution. The oligomeric states of MAB_4384 alone or complexed to its DNA target were determined by size exclusion chromatography. The elution profile of the proteins, used for the calibration is displayed as a dashed black line. Calibration was established using β-amylase (200 kDa) (1), bovine serum albumin (66 kDa) (2), carbonic anhydrase (29 kDa) (3), and cytochrome C (12.4 kDa) (4), eluting with estimated volumes of 11.7, 13.2, 14.9, 15.9 mL, respectively. The void volume was determined with the elution volume (8.8 mL) of dextran blue. MAB_4384 (dimer) was at a concentration of 3.9 mg/mL. The elution profiles of MAB_4384 dimer, DNA target and MAB_4384 bound to the DNA target are shown in orange, blue, and pink and their respective elution peaks were at 13.9, 14.7, and 12.6 mL. K av indicates the partition coefficient.

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: Oligomerization of MAB_4384 and the MAB_4384:DNA complex in solution. The oligomeric states of MAB_4384 alone or complexed to its DNA target were determined by size exclusion chromatography. The elution profile of the proteins, used for the calibration is displayed as a dashed black line. Calibration was established using β-amylase (200 kDa) (1), bovine serum albumin (66 kDa) (2), carbonic anhydrase (29 kDa) (3), and cytochrome C (12.4 kDa) (4), eluting with estimated volumes of 11.7, 13.2, 14.9, 15.9 mL, respectively. The void volume was determined with the elution volume (8.8 mL) of dextran blue. MAB_4384 (dimer) was at a concentration of 3.9 mg/mL. The elution profiles of MAB_4384 dimer, DNA target and MAB_4384 bound to the DNA target are shown in orange, blue, and pink and their respective elution peaks were at 13.9, 14.7, and 12.6 mL. K av indicates the partition coefficient.

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Size-exclusion Chromatography, Concentration Assay

    D14N and F57L mutations abrogate binding of MAB_4384 to its palindromic DNA target. (A) Multiple primary sequence alignments of MAB_4384 N-terminus with other TetR family members whose crystal structures are known (PDB code indicated) from different microorganisms showing the conservation of the Asp14 and Phe57 residues (indicated with black arrows). (B) Mapping of the mutations on the crystal structure of MAB_4384, the degree of residue conservation (obtained from the sequence alignment in A ) is represented by the coloration, from white (low conservation) to red (high conservation). (A,B) Were prepared using the ENDscript server ( http://endscript.ibcp.fr/ESPript/ENDscript/ ). EMSA were performed using increasing concentrations (in μM) of the purified MAB_4384 (D14N) (C) , MAB_4384 (F57L) (D) or MAB_4384 (D14N/F57L) (E) in the presence of Probe 1. Wild-type MAB_4384 was included as a positive control in each assay. The concentration of Probe 1 was fixed at 280 nM. Gel shifts were revealed by fluorescence emission. Three independent experiments were performed with similar results.

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: D14N and F57L mutations abrogate binding of MAB_4384 to its palindromic DNA target. (A) Multiple primary sequence alignments of MAB_4384 N-terminus with other TetR family members whose crystal structures are known (PDB code indicated) from different microorganisms showing the conservation of the Asp14 and Phe57 residues (indicated with black arrows). (B) Mapping of the mutations on the crystal structure of MAB_4384, the degree of residue conservation (obtained from the sequence alignment in A ) is represented by the coloration, from white (low conservation) to red (high conservation). (A,B) Were prepared using the ENDscript server ( http://endscript.ibcp.fr/ESPript/ENDscript/ ). EMSA were performed using increasing concentrations (in μM) of the purified MAB_4384 (D14N) (C) , MAB_4384 (F57L) (D) or MAB_4384 (D14N/F57L) (E) in the presence of Probe 1. Wild-type MAB_4384 was included as a positive control in each assay. The concentration of Probe 1 was fixed at 280 nM. Gel shifts were revealed by fluorescence emission. Three independent experiments were performed with similar results.

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Binding Assay, Sequencing, Purification, Positive Control, Concentration Assay, Fluorescence

    The homodimeric crystal structure of MAB_4384. (A) Overall structure of the MAB_4384 dimer displayed as cartoon representation. The LBDs of each subunit are colored in slate and pink while the DNA binding domains are colored in blue and magenta. Helices are indicated by the α signs followed by numbers, Nt and Ct stands for N-terminus and C-terminus and ’ is for chain B. (B) Putative ligand binding pocket in the LBD of MAB_4384. The Fo-Fc simulated annealed omit map contoured at 3 σ level is shown in blue. Residues that are 4 Å around the electron density blob and that are potential amino acids of the ligand binding site are shown as sticks. (C) Structural comparison of MAB_4384 with the crystal structure of the M. smegmatis LfrR repressor (PDB id: 2V57). The left panel represents the superposition of one monomer of MAB_4384 (in blue) on one monomer of LfrR (in orange). The superposition of the two homodimers is shown on the right panel, the two subunits of MAB_4384 are in blue and magenta and the two monomers of LfrR are in orange and wheat. (D,E) The figures compare the distance between the two DNA binding domains in MAB_4384 (D) and in the crystal structure of the M. smegmatis TetR Ms6564 protein bound to its DNA target (PDB id: 4JL3).

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: The homodimeric crystal structure of MAB_4384. (A) Overall structure of the MAB_4384 dimer displayed as cartoon representation. The LBDs of each subunit are colored in slate and pink while the DNA binding domains are colored in blue and magenta. Helices are indicated by the α signs followed by numbers, Nt and Ct stands for N-terminus and C-terminus and ’ is for chain B. (B) Putative ligand binding pocket in the LBD of MAB_4384. The Fo-Fc simulated annealed omit map contoured at 3 σ level is shown in blue. Residues that are 4 Å around the electron density blob and that are potential amino acids of the ligand binding site are shown as sticks. (C) Structural comparison of MAB_4384 with the crystal structure of the M. smegmatis LfrR repressor (PDB id: 2V57). The left panel represents the superposition of one monomer of MAB_4384 (in blue) on one monomer of LfrR (in orange). The superposition of the two homodimers is shown on the right panel, the two subunits of MAB_4384 are in blue and magenta and the two monomers of LfrR are in orange and wheat. (D,E) The figures compare the distance between the two DNA binding domains in MAB_4384 (D) and in the crystal structure of the M. smegmatis TetR Ms6564 protein bound to its DNA target (PDB id: 4JL3).

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Binding Assay, Ligand Binding Assay

    MAB_4384 is a specific repressor of the mmpS5/mmpL5 locus in M. abscessus . Transcriptional profile of 19 mmpL in M. abscessus expressed in fold induction relative to expression in the wild-type strain (CIP104536 T ) in (A) the D15_S4 spontaneous mutant resistant to TAC analogs containing a stop codon in MAB_4384 and in (B) MAB_4384 ::pUX1 in which MAB_4384 has been disrupted by homologous recombination. tgs1 was included as a non-relevant control gene. Error bars indicate standard deviation. (C) Expression of MAB_ 4384 in M. abscessus. Fold induction levels of MAB_4384 were calculated in MAB_4384 ::pUX1 relative to the parental strain. Error bars indicate standard deviation. Relative gene expression was calculated using the ΔΔCt method with correction for PCR efficiency. Data is representative of three independent experiments.

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: MAB_4384 is a specific repressor of the mmpS5/mmpL5 locus in M. abscessus . Transcriptional profile of 19 mmpL in M. abscessus expressed in fold induction relative to expression in the wild-type strain (CIP104536 T ) in (A) the D15_S4 spontaneous mutant resistant to TAC analogs containing a stop codon in MAB_4384 and in (B) MAB_4384 ::pUX1 in which MAB_4384 has been disrupted by homologous recombination. tgs1 was included as a non-relevant control gene. Error bars indicate standard deviation. (C) Expression of MAB_ 4384 in M. abscessus. Fold induction levels of MAB_4384 were calculated in MAB_4384 ::pUX1 relative to the parental strain. Error bars indicate standard deviation. Relative gene expression was calculated using the ΔΔCt method with correction for PCR efficiency. Data is representative of three independent experiments.

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Expressing, Mutagenesis, Homologous Recombination, Standard Deviation, Polymerase Chain Reaction

    IR S5/L5 can be induced by structural analogs of thiacetazone. (A) Docking of TAC derivatives in the ligand binding site of MAB_4384. All the residues involved in van der Waals, hydrophobic bonds or hydrogen bonds (in black dashes) are displayed as sticks. D15 in salmon has a binding energy of ΔG = –6.6 kcal/mol, D6 in magenta has a ΔG = –7.3 kcal/mol, and D17 seems to bind slightly stronger with a ΔG = –8.3kcal/mol. (B) Conditional induction of lacZ by structural analogs of TAC in M. abscessus . Induction of β-Gal activity in wild-type M. abscessus S carrying pMV261_P S5/L5 _ lacZ was assayed using mid-log phase cultures incubated with increasing drug concentrations varying from 1X to 5X the MIC for D15 and varying from 0.5X to 2.5X the MIC for D6 and D17. Inductions were performed for 96 h at 37°C. The β-galactosidase specific activity (SA β-Gal ) was quantified in liquid cultures using ONPG as a substrate. Amikacin (AMK) and ethionamide (ETH) were included as unrelated drug controls. (C) Transcriptional profile of lacZ in the M. abscessus pMV261_P S5/L5 _ lacZ reporter strain exposed to 2.5X the MIC of D17 for 8 h (left). tgs1 was included as a non-relevant control. Replacing D17 by an equal volume of DMSO had no effect on lacZ transcription. Transcriptional induction of mmpS5 Mabs and mmpL5 Mabs following exposure to 2.5X the MIC of D17 for 8 h (right). Results were obtained from three independent experiments and the error bars represent standard deviation. For statistical analysis the Student’s t -test was applied with ns, ∗ , ∗∗ , ∗∗∗ , ∗∗∗∗ indicating non-significant, p

    Journal: Frontiers in Microbiology

    Article Title: Mechanistic and Structural Insights Into the Unique TetR-Dependent Regulation of a Drug Efflux Pump in Mycobacterium abscessus

    doi: 10.3389/fmicb.2018.00649

    Figure Lengend Snippet: IR S5/L5 can be induced by structural analogs of thiacetazone. (A) Docking of TAC derivatives in the ligand binding site of MAB_4384. All the residues involved in van der Waals, hydrophobic bonds or hydrogen bonds (in black dashes) are displayed as sticks. D15 in salmon has a binding energy of ΔG = –6.6 kcal/mol, D6 in magenta has a ΔG = –7.3 kcal/mol, and D17 seems to bind slightly stronger with a ΔG = –8.3kcal/mol. (B) Conditional induction of lacZ by structural analogs of TAC in M. abscessus . Induction of β-Gal activity in wild-type M. abscessus S carrying pMV261_P S5/L5 _ lacZ was assayed using mid-log phase cultures incubated with increasing drug concentrations varying from 1X to 5X the MIC for D15 and varying from 0.5X to 2.5X the MIC for D6 and D17. Inductions were performed for 96 h at 37°C. The β-galactosidase specific activity (SA β-Gal ) was quantified in liquid cultures using ONPG as a substrate. Amikacin (AMK) and ethionamide (ETH) were included as unrelated drug controls. (C) Transcriptional profile of lacZ in the M. abscessus pMV261_P S5/L5 _ lacZ reporter strain exposed to 2.5X the MIC of D17 for 8 h (left). tgs1 was included as a non-relevant control. Replacing D17 by an equal volume of DMSO had no effect on lacZ transcription. Transcriptional induction of mmpS5 Mabs and mmpL5 Mabs following exposure to 2.5X the MIC of D17 for 8 h (right). Results were obtained from three independent experiments and the error bars represent standard deviation. For statistical analysis the Student’s t -test was applied with ns, ∗ , ∗∗ , ∗∗∗ , ∗∗∗∗ indicating non-significant, p

    Article Snippet: Cloning of Wild-Type and Mutated MAB_4384 and Site-Directed Mutagenesis MAB_4384 was PCR-amplified from M. abscessus CIP104536T purified genomic DNA using the MAB_4384_full primers (Supplementary Table ) and Phusion polymerase (Thermo Fisher Scientific).

    Techniques: Ligand Binding Assay, Binding Assay, Activity Assay, Incubation, Standard Deviation

    IL13 increases MUC5AC expression and secretion. (A) In vitro protocol for IL13 treatment of human tracheal/bronchial epithelial cells (hTEC) differentiated using air-liquid interface conditions (ALI). Cells were assayed at the indicated times. (B) Representative

    Journal: Autophagy

    Article Title: IL13 activates autophagy to regulate secretion in airway epithelial cells

    doi: 10.1080/15548627.2015.1056967

    Figure Lengend Snippet: IL13 increases MUC5AC expression and secretion. (A) In vitro protocol for IL13 treatment of human tracheal/bronchial epithelial cells (hTEC) differentiated using air-liquid interface conditions (ALI). Cells were assayed at the indicated times. (B) Representative

    Article Snippet: Sequence-specific primers for MUC5AC and ATG5 were used as previously published.

    Techniques: Expressing, In Vitro

    Depletion of ATG5 and ATG14 reduces IL13-mediated MUC5AC secretion. (A) Scheme of in vitro IL13-mediated MUC5AC secretion protocol in hTEC. Secreted MUC5AC was measured 1 h following the application of fresh IL13 on cells transduced with NT or

    Journal: Autophagy

    Article Title: IL13 activates autophagy to regulate secretion in airway epithelial cells

    doi: 10.1080/15548627.2015.1056967

    Figure Lengend Snippet: Depletion of ATG5 and ATG14 reduces IL13-mediated MUC5AC secretion. (A) Scheme of in vitro IL13-mediated MUC5AC secretion protocol in hTEC. Secreted MUC5AC was measured 1 h following the application of fresh IL13 on cells transduced with NT or

    Article Snippet: Sequence-specific primers for MUC5AC and ATG5 were used as previously published.

    Techniques: In Vitro, Transduction

    Nucleotide and amino acid sequences of RNAi-resistant cells. The localisation of each mutation observed in siRNA/DsiRNA resistant viral clones. SGR-Feo-JFH-1 cells were repeatedly transfected (5-day intervals) with 5 nM of siD1/siD5 or DsiRNA1/DsiRNA5 and treated with 1 mg/mL of G418. Twenty-one days after the first transfection, the total RNA of surviving colonies was extracted, amplified by RT-PCR and submitted for sequencing. A) Nucleotide substitutions for NS5B target site. B) Amino acid substitutions for NS5B target site. C) Nucleotide substitutions for NS4B target site. B) Amino acid substitutions for NS4B target site. SIN—Synonymous mutations; WT—JFH-1 wild type; Numbers after the RNAi molecule name on first column represents the clone in which sequences were obtained.

    Journal: PLoS ONE

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study

    doi: 10.1371/journal.pone.0117742

    Figure Lengend Snippet: Nucleotide and amino acid sequences of RNAi-resistant cells. The localisation of each mutation observed in siRNA/DsiRNA resistant viral clones. SGR-Feo-JFH-1 cells were repeatedly transfected (5-day intervals) with 5 nM of siD1/siD5 or DsiRNA1/DsiRNA5 and treated with 1 mg/mL of G418. Twenty-one days after the first transfection, the total RNA of surviving colonies was extracted, amplified by RT-PCR and submitted for sequencing. A) Nucleotide substitutions for NS5B target site. B) Amino acid substitutions for NS5B target site. C) Nucleotide substitutions for NS4B target site. B) Amino acid substitutions for NS4B target site. SIN—Synonymous mutations; WT—JFH-1 wild type; Numbers after the RNAi molecule name on first column represents the clone in which sequences were obtained.

    Article Snippet: Complementary DNA was amplified using primers flanking the target region of siRNA/DsiRNA and Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific).

    Techniques: Mutagenesis, Clone Assay, Transfection, Amplification, Reverse Transcription Polymerase Chain Reaction, Sequencing

    Potency comparison between DsiRNAs and 21 nt siRNAs. SGR-Feo-JFH-1 cells were transfected with the indicated concentrations of DsiRNA or canonical siRNA for two distinct targets. At 48 h post-infection, the cells were lysed in PLB and the luminescence levels were read on a BMG plate reader. The values are a percentage of the luminescence of the treated sample compared to the negative control (NC1). The data (A and B) are averages of three technical replicates and at least three biological replicates, error bars represents SD.

    Journal: PLoS ONE

    Article Title: Evaluation of Canonical siRNA and Dicer Substrate RNA for Inhibition of Hepatitis C Virus Genome Replication – A Comparative Study

    doi: 10.1371/journal.pone.0117742

    Figure Lengend Snippet: Potency comparison between DsiRNAs and 21 nt siRNAs. SGR-Feo-JFH-1 cells were transfected with the indicated concentrations of DsiRNA or canonical siRNA for two distinct targets. At 48 h post-infection, the cells were lysed in PLB and the luminescence levels were read on a BMG plate reader. The values are a percentage of the luminescence of the treated sample compared to the negative control (NC1). The data (A and B) are averages of three technical replicates and at least three biological replicates, error bars represents SD.

    Article Snippet: Complementary DNA was amplified using primers flanking the target region of siRNA/DsiRNA and Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Scientific).

    Techniques: Transfection, Infection, Negative Control