Structured Review

TaKaRa primer sequences
Primer Sequences, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/TaKaRa
Average 93 stars, based on 79 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
93/100 stars

Images

Related Articles

Amplification:

Article Title: MyD88-dependent Toll-like receptor 4 signal pathway in intervertebral disc degeneration
Article Snippet: .. Forward and reverse primer sequences are listed in and were synthesized by Takara Bio, Inc. To normalize each sample, a control gene (GAPDH) was used, and the arbitrary intensity threshold of amplification was computed. .. The 2-ΔΔCq method was used to calculate the relative expression of each target gene, as described previously ( ).

Article Title: A novel seizure-induced synaptotagmin gene identified by differential display
Article Snippet: .. Primer sequences derived from the differential display cDNA fragment were used to obtain additional cDNA sequence information via 5′-rapid amplification of cDNA ends using the Marathon cDNA Amplification Kit (CLONTECH). .. The syt X cDNA probe used for Northern blot analysis corresponding to nucleotides 810–1553 was agarose gel purified using the Qiaex purification resin (Qiagen) and 32 P-labeled using Ready-To-Go DNA Labeling Beads (Pharmacia) (−dCTP).

Synthesized:

Article Title: MyD88-dependent Toll-like receptor 4 signal pathway in intervertebral disc degeneration
Article Snippet: .. Forward and reverse primer sequences are listed in and were synthesized by Takara Bio, Inc. To normalize each sample, a control gene (GAPDH) was used, and the arbitrary intensity threshold of amplification was computed. .. The 2-ΔΔCq method was used to calculate the relative expression of each target gene, as described previously ( ).

Article Title: RANKL-mediated harmonious dialogue between fetus and mother guarantees smooth gestation by inducing decidual M2 macrophage polarization
Article Snippet: .. The primer sequences were designed and synthesized by TaKaRa Biotechnology Co., Ltd (Tokyo, Japan) as described in . .. Co-culture of dMφ and decidual naive T cells After 48 h of culture with trophoblasts/JEG-3 cells and DSCs, CD14+ dMφ were collected and washed three times with phosphate-buffered saline to remove excess cytokines.

Article Title: In vivo assessment of mitochondrial toxicity of metacavir in Rhesus monkeys after three months of intravenous administration
Article Snippet: .. According to the related literature , the following primer sequences were designed and synthesized by Takara Biotechnology (Dalian) Co Ltd. ..

Quantitative RT-PCR:

Article Title: Digital Gene-Expression Profiling Analysis of the Cholesterol-Lowering Effects of Alfalfa Saponin Extract on Laying Hens
Article Snippet: .. Primer sequences were designed using Primer 5 (ref. ). qRT-PCR with the SYBR Real-time PCR Premix Ex TaqTM (Tli RNaseH Plus) (TaKaRa, Code No.:RR420A) was carried out on a Mastercycler ep realplex Real-Time PCR System (Eppendorf, Germany). .. The results were normalized to the expression level of the constitutive Lbr .

Real-time Polymerase Chain Reaction:

Article Title: Digital Gene-Expression Profiling Analysis of the Cholesterol-Lowering Effects of Alfalfa Saponin Extract on Laying Hens
Article Snippet: .. Primer sequences were designed using Primer 5 (ref. ). qRT-PCR with the SYBR Real-time PCR Premix Ex TaqTM (Tli RNaseH Plus) (TaKaRa, Code No.:RR420A) was carried out on a Mastercycler ep realplex Real-Time PCR System (Eppendorf, Germany). .. The results were normalized to the expression level of the constitutive Lbr .

Article Title: Presence–Absence Polymorphisms of Highly Expressed FP Sequences Contribute to Fluorescent Polymorphisms in Acropora digitifera
Article Snippet: .. Primer sequences are shown in , online. qPCR was performed using the Thermal Cycler Dice TP800 (Takara). ..

Sequencing:

Article Title: A novel seizure-induced synaptotagmin gene identified by differential display
Article Snippet: .. Primer sequences derived from the differential display cDNA fragment were used to obtain additional cDNA sequence information via 5′-rapid amplification of cDNA ends using the Marathon cDNA Amplification Kit (CLONTECH). .. The syt X cDNA probe used for Northern blot analysis corresponding to nucleotides 810–1553 was agarose gel purified using the Qiaex purification resin (Qiagen) and 32 P-labeled using Ready-To-Go DNA Labeling Beads (Pharmacia) (−dCTP).

Derivative Assay:

Article Title: A novel seizure-induced synaptotagmin gene identified by differential display
Article Snippet: .. Primer sequences derived from the differential display cDNA fragment were used to obtain additional cDNA sequence information via 5′-rapid amplification of cDNA ends using the Marathon cDNA Amplification Kit (CLONTECH). .. The syt X cDNA probe used for Northern blot analysis corresponding to nucleotides 810–1553 was agarose gel purified using the Qiaex purification resin (Qiagen) and 32 P-labeled using Ready-To-Go DNA Labeling Beads (Pharmacia) (−dCTP).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    TaKaRa actin isoforms
    Expression of actin <t>isoforms</t> during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.
    Actin Isoforms, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/actin isoforms/product/TaKaRa
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    actin isoforms - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    91
    TaKaRa hiv primer specific ngs platform
    Reverse transcription temperature optimization. The trimmed <t>NGS</t> reads from <t>HIV-SMART</t> libraries prepared at the indicated reverse transcription temperature (42°C, 47°C, or 50°C) were mapped to the HXB2 reference genome. (A, B) The genome coverage (A) and percentage of HIV reads (B) for this alignment were calculated by use of the CLC Bio software. (C) The viral load for each sample tested is plotted on a log scale. (D) The genome coverage plots for each position of the genome are shown for NGSID 12, which showed a trend representative of the trends seen in all other samples tested. y axis, number of reads; x axis, nucleotide position in the genome sequence.
    Hiv Primer Specific Ngs Platform, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv primer specific ngs platform/product/TaKaRa
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiv primer specific ngs platform - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    91
    TaKaRa y4rna r4
    Quantitative RT-PCR. (A) Primer pairs. The sequences of the primers SL-forward_Y4_3 and <t>Y4RNA_R4</t> for amplification of the 31/32-nt Y4-RNA fragment and the sequences of the primers SL-forward_Y4_3 and Y4RNA_R5 for amplification of the full-length Y4-RNA are presented together with the sequence of Y4-RNA, a middle part of which is omitted. Three nucleotides are added to the 5′ terminus of each primer to stabilize the primer/template hybrid. (B) A representative RT-PCR data for the synthetic 31-nt Y4-RNA fragment (0.001, 0.01, 0.05, and 0.1 fmol) and saliva RNA (1 ng) from the examinees E1, E3, and E4. The right and left halves represent the data for the full-length Y4-RNA and the 31/32-nt fragment, respectively. (C) A standard curve was drawn using the RT-PCR data for the synthetic 31-nt Y4-RNA fragment. (D) Quantitation of the 31/32-nt Y4-RNA fragment in saliva RNA from the examinees E1, E3, and E4. Error bars denote standard deviations (n = 3).
    Y4rna R4, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/y4rna r4/product/TaKaRa
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    y4rna r4 - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    94
    TaKaRa pcr amplified
    MSK2 is required for <t>p65</t> transactivation and cell survival following UV-C radiation. A , quantitative real-time <t>PCR</t> analysis of endogenous A20, Bcl-xL, and X-IAP gene expression (normalized to TATA-box binding protein) in MDA-MB-231 cells 6 h following
    Pcr Amplified, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 695 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplified/product/TaKaRa
    Average 94 stars, based on 695 article reviews
    Price from $9.99 to $1999.99
    pcr amplified - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Expression of actin isoforms during maturation in the presence of Lat B as determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM cultures were monitored during 10-days maturation on control media or media with the addition of 100 nM Lat B. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. The four columns of bands in each treatment represent samples taken after 3, 5, 7 and 10 days of maturation.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

    Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Multiple alignments of latrunculin-binding region of a rabbit actin and four spruce actin isoforms . Threonin T186 and arginin R210 directly binding latrunculin are framed with rectangles; aspartic acid D187 and arginin R206 forming a salt bridge (indicated by arrows) are highlighted in dark gray; a loop moving under Lat B binding is in light gray, amino acid exchanges between the rabbit actin sequence and spruce isoforms are in bold. The amino-acid exchange D187→A187 in isoform 3, hypothetically responsible for altered latrunculin binding, is underlined.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Binding Assay, Sequencing

    Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.

    Journal: BMC Plant Biology

    Article Title: The role of actin isoforms in somatic embryogenesis in Norway spruce

    doi: 10.1186/1471-2229-10-89

    Figure Lengend Snippet: Expression of actin isoforms in control ESM and isolated embryos determined by semiquantitative RT-PCR . Transcript levels in non-fractionated ESM culture (ESM) and in isolated embryos (E) after two weeks of maturation on control media. EF , gene for elongation factor ef1α (internal standard); Pa1-4 , Picea abies actin isoforms 1-4. For details see Material and Methods and Results.

    Article Snippet: Missing 5' ends of isolated segments of actin genes were amplified using isoform-specific reverse primers (see bellow) and forward primers designed according to sequences of related actin isoforms from Pinus taeda (Act1,2ATG : GAAGATGGCTGACGCWGAGG and Act4ATG : ATGGGTGATGCAGAAGAAATCC); missing 3' ends were obtained using isoform-specific forward primers (see bellow) and oligoT23 primer or using SMART™ RACE cDNA Amplification Kit and PowerScript™ ReverseTranscriptase (Clontech laboratories, Palo Alto, CA, USA).

    Techniques: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction

    Reverse transcription temperature optimization. The trimmed NGS reads from HIV-SMART libraries prepared at the indicated reverse transcription temperature (42°C, 47°C, or 50°C) were mapped to the HXB2 reference genome. (A, B) The genome coverage (A) and percentage of HIV reads (B) for this alignment were calculated by use of the CLC Bio software. (C) The viral load for each sample tested is plotted on a log scale. (D) The genome coverage plots for each position of the genome are shown for NGSID 12, which showed a trend representative of the trends seen in all other samples tested. y axis, number of reads; x axis, nucleotide position in the genome sequence.

    Journal: Journal of Virology

    Article Title: Sensitive Next-Generation Sequencing Method Reveals Deep Genetic Diversity of HIV-1 in the Democratic Republic of the Congo

    doi: 10.1128/JVI.01841-16

    Figure Lengend Snippet: Reverse transcription temperature optimization. The trimmed NGS reads from HIV-SMART libraries prepared at the indicated reverse transcription temperature (42°C, 47°C, or 50°C) were mapped to the HXB2 reference genome. (A, B) The genome coverage (A) and percentage of HIV reads (B) for this alignment were calculated by use of the CLC Bio software. (C) The viral load for each sample tested is plotted on a log scale. (D) The genome coverage plots for each position of the genome are shown for NGSID 12, which showed a trend representative of the trends seen in all other samples tested. y axis, number of reads; x axis, nucleotide position in the genome sequence.

    Article Snippet: Recently, we developed a new HIV primer-specific NGS platform, called HIV-switching mechanism at the 5′ end of the RNA template (SMART; Clontech) ( ) to obtain complete genomes from HIV-1 groups M, N, O, and P as well as HIV-2 isolates.

    Techniques: Next-Generation Sequencing, Software, Sequencing

    Library preparation optimization. The trimmed NGS reads from HIV-SMART libraries were prepared by protocols A to E (A, the standard protocol; B, a protocol with the Pico SMART cDNA kit; C, a protocol with a nucleic acid concentrator; D, a protocol with a sizing column; E, a protocol that followed the nucleic concentration protocol [Conc.] in protocol C with reverse transcription at 47°C) and mapped to the HXB2 reference genome. (A, B) The genome coverage (A) and percentage of HIV reads (B) were calculated for this alignment by the use of CLC Bio software. (C) The viral load for each sample tested is plotted on a log scale. (D) The genome coverage plots for each position of the genome are shown for isolate NGSID 4, which showed a trend representative of the trends seen for all other isolates tested. y axis, number of reads; x axis, nucleotide position in the genome sequence.

    Journal: Journal of Virology

    Article Title: Sensitive Next-Generation Sequencing Method Reveals Deep Genetic Diversity of HIV-1 in the Democratic Republic of the Congo

    doi: 10.1128/JVI.01841-16

    Figure Lengend Snippet: Library preparation optimization. The trimmed NGS reads from HIV-SMART libraries were prepared by protocols A to E (A, the standard protocol; B, a protocol with the Pico SMART cDNA kit; C, a protocol with a nucleic acid concentrator; D, a protocol with a sizing column; E, a protocol that followed the nucleic concentration protocol [Conc.] in protocol C with reverse transcription at 47°C) and mapped to the HXB2 reference genome. (A, B) The genome coverage (A) and percentage of HIV reads (B) were calculated for this alignment by the use of CLC Bio software. (C) The viral load for each sample tested is plotted on a log scale. (D) The genome coverage plots for each position of the genome are shown for isolate NGSID 4, which showed a trend representative of the trends seen for all other isolates tested. y axis, number of reads; x axis, nucleotide position in the genome sequence.

    Article Snippet: Recently, we developed a new HIV primer-specific NGS platform, called HIV-switching mechanism at the 5′ end of the RNA template (SMART; Clontech) ( ) to obtain complete genomes from HIV-1 groups M, N, O, and P as well as HIV-2 isolates.

    Techniques: Next-Generation Sequencing, Concentration Assay, Software, Sequencing

    Quantitative RT-PCR. (A) Primer pairs. The sequences of the primers SL-forward_Y4_3 and Y4RNA_R4 for amplification of the 31/32-nt Y4-RNA fragment and the sequences of the primers SL-forward_Y4_3 and Y4RNA_R5 for amplification of the full-length Y4-RNA are presented together with the sequence of Y4-RNA, a middle part of which is omitted. Three nucleotides are added to the 5′ terminus of each primer to stabilize the primer/template hybrid. (B) A representative RT-PCR data for the synthetic 31-nt Y4-RNA fragment (0.001, 0.01, 0.05, and 0.1 fmol) and saliva RNA (1 ng) from the examinees E1, E3, and E4. The right and left halves represent the data for the full-length Y4-RNA and the 31/32-nt fragment, respectively. (C) A standard curve was drawn using the RT-PCR data for the synthetic 31-nt Y4-RNA fragment. (D) Quantitation of the 31/32-nt Y4-RNA fragment in saliva RNA from the examinees E1, E3, and E4. Error bars denote standard deviations (n = 3).

    Journal: Non-coding RNA Research

    Article Title: The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

    doi: 10.1016/j.ncrna.2017.07.002

    Figure Lengend Snippet: Quantitative RT-PCR. (A) Primer pairs. The sequences of the primers SL-forward_Y4_3 and Y4RNA_R4 for amplification of the 31/32-nt Y4-RNA fragment and the sequences of the primers SL-forward_Y4_3 and Y4RNA_R5 for amplification of the full-length Y4-RNA are presented together with the sequence of Y4-RNA, a middle part of which is omitted. Three nucleotides are added to the 5′ terminus of each primer to stabilize the primer/template hybrid. (B) A representative RT-PCR data for the synthetic 31-nt Y4-RNA fragment (0.001, 0.01, 0.05, and 0.1 fmol) and saliva RNA (1 ng) from the examinees E1, E3, and E4. The right and left halves represent the data for the full-length Y4-RNA and the 31/32-nt fragment, respectively. (C) A standard curve was drawn using the RT-PCR data for the synthetic 31-nt Y4-RNA fragment. (D) Quantitation of the 31/32-nt Y4-RNA fragment in saliva RNA from the examinees E1, E3, and E4. Error bars denote standard deviations (n = 3).

    Article Snippet: 2.4 Reverse transcription (RT) PCR An RNA test sample was reverse transcribed using a reverse primer, Y4RNA_R4 or Y4RNA_R5, with a PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio, Otsu, Japan) according to manufacturer's protocol.

    Techniques: Quantitative RT-PCR, Amplification, Sequencing, Reverse Transcription Polymerase Chain Reaction, Quantitation Assay

    MSK2 is required for p65 transactivation and cell survival following UV-C radiation. A , quantitative real-time PCR analysis of endogenous A20, Bcl-xL, and X-IAP gene expression (normalized to TATA-box binding protein) in MDA-MB-231 cells 6 h following

    Journal:

    Article Title: Differential Regulation of Mitogen- and Stress-activated Protein Kinase-1 and -2 (MSK1 and MSK2) by CK2 following UV Radiation *

    doi: 10.1074/jbc.M109.083808

    Figure Lengend Snippet: MSK2 is required for p65 transactivation and cell survival following UV-C radiation. A , quantitative real-time PCR analysis of endogenous A20, Bcl-xL, and X-IAP gene expression (normalized to TATA-box binding protein) in MDA-MB-231 cells 6 h following

    Article Snippet: For p65 cloning, RNA was harvested from cycling MDA-MB-231 cells using the RNeasy minikit from Qiagen and reverse transcribed to make cDNA using qScript cDNA Supermix (Quanta) from which p65 was PCR-amplified (primers: forward, 5′-ATGGACGAACTGTTCCCCCTCATC-3′; reverse, 5′-GGA GCT GAT CTG ACT CAG CAG GGC-3′) and subcloned into the pM vector (Clontech) in frame with the Gal4-DNA binding domain sequence (pGal4-p65).

    Techniques: Real-time Polymerase Chain Reaction, Expressing, Binding Assay, Multiple Displacement Amplification