Structured Review

TIB MOLBIOL primer sequences
Primer Sequences, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 92/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/TIB MOLBIOL
Average 92 stars, based on 24 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

CTG Assay:

Article Title: Characterization of the postjunctional α2C-adrenoceptor mediating vasoconstriction to UK14304 in porcine pulmonary veins
Article Snippet: .. The following primer sequences were used (TiBMolBiol, Berlin, Germany): 5′-CGC TTG TCA TCC CTT TCT CG and 5′-CTC TAT GGC CTG GGT GAT GG for the pig α 2A -adrenoceptor (NM 214400, nucleotides 251–420); 5′-AAC TGG CCA CTG CTG GAG AG and 5′-TTC AGC CTC CTC CTC TGG TG for the pig α 2B -adrenoceptor (NM 001037148, nucleotides 681–859); and 5′-CCA ACG AGC TCA TGG CCT AC and 5′-GAG ATG ACG GCC GAG ATG AG for the bovine α 2C -adrenoceptor (AJ 488281, nucleotides 85–304). .. Nucleotide sequences were retrieved and respective primer pairs constructed as mentioned above.

Concentration Assay:

Article Title: Immunomodulatory Effects of the Neuropeptide Pituitary Adenylate Cyclase-Activating Polypeptide in Acute Toxoplasmosis
Article Snippet: .. The primer sequences are listed in and were synthetized by Tib MolBiol and used at 100 nM final concentration. .. Expression of Hprt was chosen as reference gene and relative mRNA levels were determined by the ratio gene of interest / reference gene and subsequently normalized to mean values of control group.

Produced:

Article Title: Comparative Analysis of Different Platelet Lysates and Platelet Rich Preparations to Stimulate Tendon Cell Biology: An In Vitro Study
Article Snippet: .. All primer sequences were designed using Primer 3 software (Freeware; Available online: http://frodo.wi.mit.edu/primer3 ), and were produced by Tib Molbiol, Berlin, Germany (Primer sequences see ). .. All primers were tested for amplification efficiency and the ΔC t method with efficiency correction was used to calculate the relative gene expression to the reference gene 18S rRNA.

Synthesized:

Article Title: Differentiation impairs Bach1 dependent HO-1 activation and increases sensitivity to oxidative stress in SH-SY5Y neuroblastoma cells
Article Snippet: .. All the primer sequences used have been synthesized at Tib Mol Biol, Italy and listed in supplementary table 1. .. After separation on 2% agarose gel, a densitometric analysis of PCR products, stained with ethidium bromide and visualized under UV light, has been performed using a GelDoc apparatus (Bio-Rad, Italy).

Software:

Article Title: Comparative Analysis of Different Platelet Lysates and Platelet Rich Preparations to Stimulate Tendon Cell Biology: An In Vitro Study
Article Snippet: .. All primer sequences were designed using Primer 3 software (Freeware; Available online: http://frodo.wi.mit.edu/primer3 ), and were produced by Tib Molbiol, Berlin, Germany (Primer sequences see ). .. All primers were tested for amplification efficiency and the ΔC t method with efficiency correction was used to calculate the relative gene expression to the reference gene 18S rRNA.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TIB MOLBIOL cpn60 gene
    Detection limits for the SMG-specific real-time PCR assays showing the relationship between CFU and CP for each assay. (A) <t>SMG_cpn60;</t> (B) 16s_SA; and (C) 16s_SCI. In each graph, S. anginosus ( S. ang ) is represented by a circle, S. constellatus ( S. const ) by a square, and S. intermedius ( S. inter ) by a triangle. The gray vertical line represents the current detection limit for SMG using McKay agar (10 4 CFU/ml) to isolate SMG from sputum samples.
    Cpn60 Gene, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cpn60 gene/product/TIB MOLBIOL
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cpn60 gene - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    TIB MOLBIOL andv s segment specific primers
    Construction of recombinant Ad vectors expressing <t>ANDV</t> proteins. (A) The ANDV S, M, and L RNA segments encoding the N protein, the GPC protein that gives rise to G N and G C , and polymerase, respectively. (B) N-, GPC-, G N -, and G C -coding regions were amplified by PCR from plasmids and inserted into a shuttle plasmid, pDC316(io), for rescue into E1 − E3 − Ad vectors. This placed hantavirus coding sequences downstream of an MCMV immediate-early promoter sequence that was separated from the hantavirus genes by a LacZ repressor binding site and an intron, all inserted with Ad5 E1 sequences. These pDC316(io) plasmids were cotransfected with plasmid pBHGloxDE1,3Cre, which contains other Ad sequences and lacks E3 sequences, into 293 IQ cells. Recombination between loxP sites in pDC316(io) and pBHGloxDE1,3Cre produced Ad vectors. 293 IQ cells express a LacZ repressor protein that reduces expression of hantavirus proteins during Ad vector propagation.
    Andv S Segment Specific Primers, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/andv s segment specific primers/product/TIB MOLBIOL
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    andv s segment specific primers - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    90
    TIB MOLBIOL conditions rpa primers
    The results layout of one <t>LSDV</t> <t>RPA</t> assay run. Fluorescence development over time using a dilution range of 10 7 –10 1 molecules/μl of the DNA molecular standard (Graph generated by ESEquant tubescanner software). 10 7 represented by black line; 10 6 , gray; 10 5 , red; 10 4 , blue; 10 3 , green; 10 2 , cyan; 10 1 , dark khaki; negative control, orange. The LSDV RPA assay detected down to 10 DNA molecules/reaction. After 230 s, the strip was taken out of the tubescanner for mixing, therefore, no fluorescence signals were recorded
    Conditions Rpa Primers, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/conditions rpa primers/product/TIB MOLBIOL
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    conditions rpa primers - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    92
    TIB MOLBIOL 16s rrna genes
    Intestinal microbiota composition of NOD2 deficient mice following ileitis induction. Main bacterial groups of the commensal intestinal microbiota were quantified by molecular analysis of fecal samples derived from C57BL/6 wildtype (WT; black circles) and NOD2 deficient (NOD2-/-; white circles) mice before (N, naïve) and seven days after ileitis induction by peroral T. gondii infection (ILE). Quantitative Real-Time-PCR analyses amplified bacterial <t>16S</t> <t>rRNA</t> variable regions and 16S rRNA gene numbers/ng DNA from the following bacterial groups: ( A ) Total eubacterial load, ( B ) Enterobacteria , ( C ) Enterococci , ( D ) Lactobacilli , ( E ) Bifidobacteria , ( F ) Bacteroides/Prevotella spp., ( G ) Clostridium leptum group, ( H ) Clostridium coccoides group, and ( I ) Mouse intestinal Bacteroidetes . Numbers of mice harboring the respective bacterial 16S rRNA out of the total number of analyzed animals are given in parentheses. Medians and significance levels ( p -values) determined by Mann-Whitney-U test are indicated. Data shown are representative for three independent experiments.
    16s Rrna Genes, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/16s rrna genes/product/TIB MOLBIOL
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    16s rrna genes - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    Detection limits for the SMG-specific real-time PCR assays showing the relationship between CFU and CP for each assay. (A) SMG_cpn60; (B) 16s_SA; and (C) 16s_SCI. In each graph, S. anginosus ( S. ang ) is represented by a circle, S. constellatus ( S. const ) by a square, and S. intermedius ( S. inter ) by a triangle. The gray vertical line represents the current detection limit for SMG using McKay agar (10 4 CFU/ml) to isolate SMG from sputum samples.

    Journal: Journal of Clinical Microbiology

    Article Title: Development of Real-Time PCR Assays for Detection of the Streptococcus milleri Group from Cystic Fibrosis Clinical Specimens by Targeting the cpn60 and 16S rRNA Genes ▿ and 16S rRNA Genes ▿ †

    doi: 10.1128/JCM.02082-09

    Figure Lengend Snippet: Detection limits for the SMG-specific real-time PCR assays showing the relationship between CFU and CP for each assay. (A) SMG_cpn60; (B) 16s_SA; and (C) 16s_SCI. In each graph, S. anginosus ( S. ang ) is represented by a circle, S. constellatus ( S. const ) by a square, and S. intermedius ( S. inter ) by a triangle. The gray vertical line represents the current detection limit for SMG using McKay agar (10 4 CFU/ml) to isolate SMG from sputum samples.

    Article Snippet: Primers and probes were designed based on multiple sequence alignments of the cpn60 gene and the 16S rRNA gene and synthesized by Tib-Molbiol (Berlin, Germany).

    Techniques: Real-time Polymerase Chain Reaction

    Construction of recombinant Ad vectors expressing ANDV proteins. (A) The ANDV S, M, and L RNA segments encoding the N protein, the GPC protein that gives rise to G N and G C , and polymerase, respectively. (B) N-, GPC-, G N -, and G C -coding regions were amplified by PCR from plasmids and inserted into a shuttle plasmid, pDC316(io), for rescue into E1 − E3 − Ad vectors. This placed hantavirus coding sequences downstream of an MCMV immediate-early promoter sequence that was separated from the hantavirus genes by a LacZ repressor binding site and an intron, all inserted with Ad5 E1 sequences. These pDC316(io) plasmids were cotransfected with plasmid pBHGloxDE1,3Cre, which contains other Ad sequences and lacks E3 sequences, into 293 IQ cells. Recombination between loxP sites in pDC316(io) and pBHGloxDE1,3Cre produced Ad vectors. 293 IQ cells express a LacZ repressor protein that reduces expression of hantavirus proteins during Ad vector propagation.

    Journal: Journal of Virology

    Article Title: Adenovirus Vectors Expressing Hantavirus Proteins Protect Hamsters against Lethal Challenge with Andes Virus ▿

    doi: 10.1128/JVI.00373-09

    Figure Lengend Snippet: Construction of recombinant Ad vectors expressing ANDV proteins. (A) The ANDV S, M, and L RNA segments encoding the N protein, the GPC protein that gives rise to G N and G C , and polymerase, respectively. (B) N-, GPC-, G N -, and G C -coding regions were amplified by PCR from plasmids and inserted into a shuttle plasmid, pDC316(io), for rescue into E1 − E3 − Ad vectors. This placed hantavirus coding sequences downstream of an MCMV immediate-early promoter sequence that was separated from the hantavirus genes by a LacZ repressor binding site and an intron, all inserted with Ad5 E1 sequences. These pDC316(io) plasmids were cotransfected with plasmid pBHGloxDE1,3Cre, which contains other Ad sequences and lacks E3 sequences, into 293 IQ cells. Recombination between loxP sites in pDC316(io) and pBHGloxDE1,3Cre produced Ad vectors. 293 IQ cells express a LacZ repressor protein that reduces expression of hantavirus proteins during Ad vector propagation.

    Article Snippet: Quantitative real-time one-step reverse transcription-PCR (RT-PCR) was conducted on RNA extracts using a Rotor-Gene RG-3000 instrument (Corbett Life Science, Sydney, Australia) with ANDV S segment-specific primers (ANDV S129f [5′ AAGGCAGTGGAGGTGGAC] and ANDV S291r [5′ CCCTGTTGGATCAACTGGTT]) and a dual-labeled fluorescent probe (ANDV TM [5′ FAM-ACGGGCAGCTGTGTCTACATTGGA-TAMRA]) (all from TIB Molbiol, Adelphia, NJ).

    Techniques: Recombinant, Expressing, Gel Permeation Chromatography, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Sequencing, Binding Assay, Produced

    The results layout of one LSDV RPA assay run. Fluorescence development over time using a dilution range of 10 7 –10 1 molecules/μl of the DNA molecular standard (Graph generated by ESEquant tubescanner software). 10 7 represented by black line; 10 6 , gray; 10 5 , red; 10 4 , blue; 10 3 , green; 10 2 , cyan; 10 1 , dark khaki; negative control, orange. The LSDV RPA assay detected down to 10 DNA molecules/reaction. After 230 s, the strip was taken out of the tubescanner for mixing, therefore, no fluorescence signals were recorded

    Journal: BMC Veterinary Research

    Article Title: Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus

    doi: 10.1186/s12917-016-0875-5

    Figure Lengend Snippet: The results layout of one LSDV RPA assay run. Fluorescence development over time using a dilution range of 10 7 –10 1 molecules/μl of the DNA molecular standard (Graph generated by ESEquant tubescanner software). 10 7 represented by black line; 10 6 , gray; 10 5 , red; 10 4 , blue; 10 3 , green; 10 2 , cyan; 10 1 , dark khaki; negative control, orange. The LSDV RPA assay detected down to 10 DNA molecules/reaction. After 230 s, the strip was taken out of the tubescanner for mixing, therefore, no fluorescence signals were recorded

    Article Snippet: LSDV RPA oligonucleotides and conditions RPA primers and exo probe (Fig. ) were synthesized by TIB MOLBIOL (Berlin, Germany).

    Techniques: Recombinase Polymerase Amplification, Fluorescence, Generated, Software, Negative Control, Stripping Membranes

    Performance of the LSDV RPA assay using data set of eight RPA assay runs. a Semi-logarithmic regression ( b ) Probit regression analysis. The LSDV RPA assay yielded results between 2–12 min. The results of the 10 7 –10 3 were consistence, therefore no error bars was included ( a ). The limit of detection (179 DNA molecules) at 95 % probability was is depicted by a triangle ( b )

    Journal: BMC Veterinary Research

    Article Title: Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus

    doi: 10.1186/s12917-016-0875-5

    Figure Lengend Snippet: Performance of the LSDV RPA assay using data set of eight RPA assay runs. a Semi-logarithmic regression ( b ) Probit regression analysis. The LSDV RPA assay yielded results between 2–12 min. The results of the 10 7 –10 3 were consistence, therefore no error bars was included ( a ). The limit of detection (179 DNA molecules) at 95 % probability was is depicted by a triangle ( b )

    Article Snippet: LSDV RPA oligonucleotides and conditions RPA primers and exo probe (Fig. ) were synthesized by TIB MOLBIOL (Berlin, Germany).

    Techniques: Recombinase Polymerase Amplification

    Alignment of the LSDV RPA primers and exo-probe sequences with the consensus sequence of 132 capripoxviruses GPCR genes downloaded from Genbank (Geneious® 6.1.5, Biomatters Limited, New Zealand). Mismatches are indicated in bold and underlined. NNN are sites of the quencher and fluropohore in following order (BHQ1-dT) (Tetrahydrofuran) (FAM-dT). R is A or G; Y, C or T; M, A or C; D, A or G or T; H, A or C or T

    Journal: BMC Veterinary Research

    Article Title: Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus

    doi: 10.1186/s12917-016-0875-5

    Figure Lengend Snippet: Alignment of the LSDV RPA primers and exo-probe sequences with the consensus sequence of 132 capripoxviruses GPCR genes downloaded from Genbank (Geneious® 6.1.5, Biomatters Limited, New Zealand). Mismatches are indicated in bold and underlined. NNN are sites of the quencher and fluropohore in following order (BHQ1-dT) (Tetrahydrofuran) (FAM-dT). R is A or G; Y, C or T; M, A or C; D, A or G or T; H, A or C or T

    Article Snippet: LSDV RPA oligonucleotides and conditions RPA primers and exo probe (Fig. ) were synthesized by TIB MOLBIOL (Berlin, Germany).

    Techniques: Recombinase Polymerase Amplification, Sequencing

    Intestinal microbiota composition of NOD2 deficient mice following ileitis induction. Main bacterial groups of the commensal intestinal microbiota were quantified by molecular analysis of fecal samples derived from C57BL/6 wildtype (WT; black circles) and NOD2 deficient (NOD2-/-; white circles) mice before (N, naïve) and seven days after ileitis induction by peroral T. gondii infection (ILE). Quantitative Real-Time-PCR analyses amplified bacterial 16S rRNA variable regions and 16S rRNA gene numbers/ng DNA from the following bacterial groups: ( A ) Total eubacterial load, ( B ) Enterobacteria , ( C ) Enterococci , ( D ) Lactobacilli , ( E ) Bifidobacteria , ( F ) Bacteroides/Prevotella spp., ( G ) Clostridium leptum group, ( H ) Clostridium coccoides group, and ( I ) Mouse intestinal Bacteroidetes . Numbers of mice harboring the respective bacterial 16S rRNA out of the total number of analyzed animals are given in parentheses. Medians and significance levels ( p -values) determined by Mann-Whitney-U test are indicated. Data shown are representative for three independent experiments.

    Journal: PLoS ONE

    Article Title: Nucleotide-Oligomerization-Domain-2 Affects Commensal Gut Microbiota Composition and Intracerebral Immunopathology in Acute Toxoplasma gondii Induced Murine Ileitis

    doi: 10.1371/journal.pone.0105120

    Figure Lengend Snippet: Intestinal microbiota composition of NOD2 deficient mice following ileitis induction. Main bacterial groups of the commensal intestinal microbiota were quantified by molecular analysis of fecal samples derived from C57BL/6 wildtype (WT; black circles) and NOD2 deficient (NOD2-/-; white circles) mice before (N, naïve) and seven days after ileitis induction by peroral T. gondii infection (ILE). Quantitative Real-Time-PCR analyses amplified bacterial 16S rRNA variable regions and 16S rRNA gene numbers/ng DNA from the following bacterial groups: ( A ) Total eubacterial load, ( B ) Enterobacteria , ( C ) Enterococci , ( D ) Lactobacilli , ( E ) Bifidobacteria , ( F ) Bacteroides/Prevotella spp., ( G ) Clostridium leptum group, ( H ) Clostridium coccoides group, and ( I ) Mouse intestinal Bacteroidetes . Numbers of mice harboring the respective bacterial 16S rRNA out of the total number of analyzed animals are given in parentheses. Medians and significance levels ( p -values) determined by Mann-Whitney-U test are indicated. Data shown are representative for three independent experiments.

    Article Snippet: Then, main bacterial groups abundant in the murine conventional intestinal microbiota were detected by quantitative real-time (RT) -PCR with primers specific for sequences in the 16S rRNA genes of individual bacterial species, genera or groups (Tib MolBiol, Germany) as described previously , , .

    Techniques: Mouse Assay, Derivative Assay, Infection, Real-time Polymerase Chain Reaction, Amplification, MANN-WHITNEY