Structured Review

Shanghai Generay Biotech primer sequences
Primer Sequences, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 92/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/Shanghai Generay Biotech
Average 92 stars, based on 39 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Reverse Transcription Polymerase Chain Reaction:

Article Title: Phenolic alkaloids from Menispermum dauricum inhibits BxPC-3 pancreatic cancer cells by blocking of Hedgehog signaling pathway
Article Snippet: .. Primer sequences (synthesized by Shanghai Generay Biotech Co., Ltd.) used in RT-PCR for Shh (forward 5’- GCTCGGTGAAAGCAGAGAACT-3’ and reverse 5’- CCCAGGAAAGTGAGGAAGTCG-3’), and Gli-1(forward 5’- ATCCTTACCTCCCAACCTCTGT-3’ and reverse 5’- CCAACTTCTGGCTCTTCCTGTA-3’), using GAPDH (forward 5’-AGAAGGCTGGGGCTCATTTG-3’ and reverse 5’- AGGGGCCATCCACAGTCTTC-3’) as control. ..

Synthesized:

Article Title: Phenolic alkaloids from Menispermum dauricum inhibits BxPC-3 pancreatic cancer cells by blocking of Hedgehog signaling pathway
Article Snippet: .. Primer sequences (synthesized by Shanghai Generay Biotech Co., Ltd.) used in RT-PCR for Shh (forward 5’- GCTCGGTGAAAGCAGAGAACT-3’ and reverse 5’- CCCAGGAAAGTGAGGAAGTCG-3’), and Gli-1(forward 5’- ATCCTTACCTCCCAACCTCTGT-3’ and reverse 5’- CCAACTTCTGGCTCTTCCTGTA-3’), using GAPDH (forward 5’-AGAAGGCTGGGGCTCATTTG-3’ and reverse 5’- AGGGGCCATCCACAGTCTTC-3’) as control. ..

Article Title: Astragaloside attenuates myocardial injury in a rat model of acute myocardial infarction by upregulating hypoxia inducible factor-1α and Notch1/Jagged1 signaling
Article Snippet: .. The following primer sequences were synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China): Forward, 5′-CAGCGATGACACGGAAAC-3′ and reverse, 5′-AGTGACTCTGGGCTTGAC-3′ for HIF-1α; forward, 5′-CTTCGTGCTCCTGTTCTTTG-3′ and reverse, 5′-GCCTCTGACACTTTGAAACC-3′ for Notch1; and forward, 5′-CACCCGAACTGGACAAAC-3′ and reverse, 5′-AGCCTCAGACTGGGATAC-3′ for Jagged1. .. These primer pairs resulted in 210, 105, and 170 bp amplified products, respectively.

Article Title: Up-regulation of antioxidative proteins TRX1, TXNL1 and TXNRD1 in the cortex of PTZ kindling seizure model mice
Article Snippet: .. The primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, PRC) based on the mRNA sequences obtained from the NCBI database as follows: Trx1 (Genebank NM_011660.3): 5’-CCCTTCTTCCATTCCCTCT-3’ and 5’-TCCACATCCACTTCAAGGAAC-3’ , Txnl1 (Genebank NM_016792.4): 5’-TTCAAACGAGTGGTTGGCA-3’ and 5’- GCAGTAAGTCTTCCAGTGTC-3’ , Txnrd1 (Genebank NM_001042513.1): 5’- GTGGCGACTTGGCTAATC-3’ and 5’- ACCAGGAGAGACACTCAC-3’ , GAPDH (Genebank NM_008084): 5’- TCATCCCAGAGCTGAACG-3’ and 5’-TCATACTTGGCAGGTTTCTCC-3 ’. .. The expression levels of mRNAs were normalized to GAPDH and were calculated using the 2-ΔΔCt method (Livak and Schmittgen, 2001).

Article Title: Biochemical, Physiological and Transcriptomic Comparison between Burley and Flue-Cured Tobacco Seedlings in Relation to Carbohydrates and Nitrate Content
Article Snippet: .. The primer sequences were designed in the laboratory and synthesized by Generay Biotech (Shanghai, China) based on the mRNA sequences obtained from the NCBI database ( ). .. The expression levels of mRNAs were normalized to the expression in flue-cured tobacco (mean of HD and Z100) and were calculated using the 2−ΔΔC t method [ ].

Article Title: LncRNAs expression signatures of hepatocellular carcinoma revealed by microarray
Article Snippet: .. The primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, Shanghai, PRC), based on the mRNA sequences obtained from the NCBI database and are shown in Table . .. The Statistical Program for Social Sciences (SPSS) 18.0 software (SPSS, Chicago, IL, United States) performed all the statistical analyses.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Shanghai Generay Biotech fhs primer sequences
    Radiographs, histopathologic changes, and expression of <t>BMP-2</t> and PPAR-γ of <t>FHs</t> in all rabbit groups. (A) There were obvious collapse, lessened shape, serious defect, greater joint space, and even a changed para position in the control group. (B) The central zone density was lower, while the edge higher and the sclerosis lines appeared in the CD group. (C) High-density image and bone trabeculae appeared in the PBMSCT group at 8 w. (D) Post-operation HE staining of the model group, (E) CD group, and (F) PBMSCT group at 8 w ×100. (G) Percentage of area of bone trabeculae. (H) Expression of BMP-2 at 2 weeks. (I) Expression of PPAR-γ at 2 weeks. (J) Expression of BMP-2 at 8 weeks. (K) Expression of PPAR-γ at 8 weeks. * p
    Fhs Primer Sequences, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fhs primer sequences/product/Shanghai Generay Biotech
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fhs primer sequences - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    88
    Shanghai Generay Biotech mirna specific primer sequences
    Expression profiles of candidate <t>miRNAs</t> in patients with and without CAD. The three candidate miRNAs were evaluated with <t>qRT-PCR</t> using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P
    Mirna Specific Primer Sequences, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 88/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mirna specific primer sequences/product/Shanghai Generay Biotech
    Average 88 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    mirna specific primer sequences - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    92
    Shanghai Generay Biotech exons
    Sequencing of the <t>POR</t> gene in coding regions. ( A ) Schematic diagram of the POR gene where SNPs are located. rs1135612 is located on <t>exon</t> 4, and rs2228104 and rs1057868 are located on exon 12. ( B ) The arrow marks the POR SNP sequence, in which rs1135612 has an A > G nuclei acid change, and rs2228104 and rs1057868 both have a C > T nucleic acid change.
    Exons, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exons/product/Shanghai Generay Biotech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    exons - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    Shanghai Generay Biotech codon optimized peptide bmk1
    Application of designed elements for peptide <t>BmK1</t> expression and DXP pathway engineering in E. coli . (A) Sketch maps of plasmids for designed elements applications. Plasmids s21- gfp , s05- gfp and s14- gfp contain gene gfp between BamHI/EcoRI sites, plasmids s21- bmk 1, s05- bmk 1 and s14- bmk 1 contain gene bmk 1 between NcoI/HindIII sites, plasmids s21- dxs , s05- dxs and s14- dxs contain gene dxs between NcoI/EcoRI sites. (B) Effect of applying designed elements for peptide BmK1 expression and DXP pathway engineering in E. coli . The wild-type Trc promoter and RBS (without inserting dxs gene) served as the blank control.
    Codon Optimized Peptide Bmk1, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/codon optimized peptide bmk1/product/Shanghai Generay Biotech
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    codon optimized peptide bmk1 - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results


    Radiographs, histopathologic changes, and expression of BMP-2 and PPAR-γ of FHs in all rabbit groups. (A) There were obvious collapse, lessened shape, serious defect, greater joint space, and even a changed para position in the control group. (B) The central zone density was lower, while the edge higher and the sclerosis lines appeared in the CD group. (C) High-density image and bone trabeculae appeared in the PBMSCT group at 8 w. (D) Post-operation HE staining of the model group, (E) CD group, and (F) PBMSCT group at 8 w ×100. (G) Percentage of area of bone trabeculae. (H) Expression of BMP-2 at 2 weeks. (I) Expression of PPAR-γ at 2 weeks. (J) Expression of BMP-2 at 8 weeks. (K) Expression of PPAR-γ at 8 weeks. * p

    Journal: Yonsei Medical Journal

    Article Title: Preclinical Study of Cell Therapy for Osteonecrosis of the Femoral Head with Allogenic Peripheral Blood-Derived Mesenchymal Stem Cells

    doi: 10.3349/ymj.2016.57.4.1006

    Figure Lengend Snippet: Radiographs, histopathologic changes, and expression of BMP-2 and PPAR-γ of FHs in all rabbit groups. (A) There were obvious collapse, lessened shape, serious defect, greater joint space, and even a changed para position in the control group. (B) The central zone density was lower, while the edge higher and the sclerosis lines appeared in the CD group. (C) High-density image and bone trabeculae appeared in the PBMSCT group at 8 w. (D) Post-operation HE staining of the model group, (E) CD group, and (F) PBMSCT group at 8 w ×100. (G) Percentage of area of bone trabeculae. (H) Expression of BMP-2 at 2 weeks. (I) Expression of PPAR-γ at 2 weeks. (J) Expression of BMP-2 at 8 weeks. (K) Expression of PPAR-γ at 8 weeks. * p

    Article Snippet: Detection of the mRNA expressions of BMP-2 and PPAR-γ in local tissue from FHs Primer sequences were designed by Primer Premier 6 and synthesized by Shanghai Generay Biotech Co., Ltd.

    Techniques: Expressing, Staining

    Expression profiles of candidate miRNAs in patients with and without CAD. The three candidate miRNAs were evaluated with qRT-PCR using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P

    Journal: BMC Cardiovascular Disorders

    Article Title: miR-941 as a promising biomarker for acute coronary syndrome

    doi: 10.1186/s12872-017-0653-8

    Figure Lengend Snippet: Expression profiles of candidate miRNAs in patients with and without CAD. The three candidate miRNAs were evaluated with qRT-PCR using 72 samples, including 16 non-CAD, 20 SA, 18 NSTE-ACS, and 18 STEMI samples. miR-941 was significantly upregulated in the SA, NSTE-ACS, and STEMI groups compared with that in non-CAD patients ( a ). miR-182-5p ( b ) and miR-363-3p ( c ) were not significantly different in patients with CAD (SA, NSTE-ACS, and STEMI) compared with that in patients without CAD. Abbreviations: CAD: coronary artery disease, SA: stable angina, NSTE-ACS: non-ST elevation acute coronary syndromes, STEMI: ST elevation myocardial infarction. * P

    Article Snippet: At the end of the PCR cycling, melt curve analysis was performed to validate the specific generation of the expected PCR product. miRNA-specific primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, PRC) based on the miRNA sequences obtained from the miRBase database (Release 20.0) as follows: hsa-miR-182-5p , UUUGGCAAUGGUAGAACUCACACU; hsa-miR-363-3p , AAUUGCACGGUAUCCAUCUGUA; and hsa-miR-941 , CACCCGGCUGUGUGCACAUGUGC).

    Techniques: Expressing, Quantitative RT-PCR

    Expression profiles of candidate miRNAs in patients with SA, NSTE-ACS, and STEMI. The three candidate miRNAs were evaluated by qRT-PCR using 56 samples (20 cases of SA, 18 cases of NSTE-ACS, and 18 cases of STEMI). ( a ) miR-941 , ( b ) miR-182-5p , and ( c ) miR-363-3p are shown. Abbreviations: CAD, coronary artery disease; SA, stable angina; NSTE-ACS, non-ST elevation acute coronary syndrome; STEMI, ST elevation myocardial infarction. * P

    Journal: BMC Cardiovascular Disorders

    Article Title: miR-941 as a promising biomarker for acute coronary syndrome

    doi: 10.1186/s12872-017-0653-8

    Figure Lengend Snippet: Expression profiles of candidate miRNAs in patients with SA, NSTE-ACS, and STEMI. The three candidate miRNAs were evaluated by qRT-PCR using 56 samples (20 cases of SA, 18 cases of NSTE-ACS, and 18 cases of STEMI). ( a ) miR-941 , ( b ) miR-182-5p , and ( c ) miR-363-3p are shown. Abbreviations: CAD, coronary artery disease; SA, stable angina; NSTE-ACS, non-ST elevation acute coronary syndrome; STEMI, ST elevation myocardial infarction. * P

    Article Snippet: At the end of the PCR cycling, melt curve analysis was performed to validate the specific generation of the expected PCR product. miRNA-specific primer sequences were designed in the laboratory and synthesized by Generay Biotech (Generay, PRC) based on the miRNA sequences obtained from the miRBase database (Release 20.0) as follows: hsa-miR-182-5p , UUUGGCAAUGGUAGAACUCACACU; hsa-miR-363-3p , AAUUGCACGGUAUCCAUCUGUA; and hsa-miR-941 , CACCCGGCUGUGUGCACAUGUGC).

    Techniques: Expressing, Quantitative RT-PCR

    Sequencing of the POR gene in coding regions. ( A ) Schematic diagram of the POR gene where SNPs are located. rs1135612 is located on exon 4, and rs2228104 and rs1057868 are located on exon 12. ( B ) The arrow marks the POR SNP sequence, in which rs1135612 has an A > G nuclei acid change, and rs2228104 and rs1057868 both have a C > T nucleic acid change.

    Journal: Scientific Reports

    Article Title: Functional POR A503V is associated with the risk of bladder cancer in a Chinese population

    doi: 10.1038/srep11751

    Figure Lengend Snippet: Sequencing of the POR gene in coding regions. ( A ) Schematic diagram of the POR gene where SNPs are located. rs1135612 is located on exon 4, and rs2228104 and rs1057868 are located on exon 12. ( B ) The arrow marks the POR SNP sequence, in which rs1135612 has an A > G nuclei acid change, and rs2228104 and rs1057868 both have a C > T nucleic acid change.

    Article Snippet: To screen the hypothesized functional variants, we designed primers for 16 exons throughout the coding region of the POR gene (Generay Biotech, Shanghai, China).

    Techniques: Sequencing

    Application of designed elements for peptide BmK1 expression and DXP pathway engineering in E. coli . (A) Sketch maps of plasmids for designed elements applications. Plasmids s21- gfp , s05- gfp and s14- gfp contain gene gfp between BamHI/EcoRI sites, plasmids s21- bmk 1, s05- bmk 1 and s14- bmk 1 contain gene bmk 1 between NcoI/HindIII sites, plasmids s21- dxs , s05- dxs and s14- dxs contain gene dxs between NcoI/EcoRI sites. (B) Effect of applying designed elements for peptide BmK1 expression and DXP pathway engineering in E. coli . The wild-type Trc promoter and RBS (without inserting dxs gene) served as the blank control.

    Journal: PLoS ONE

    Article Title: Quantitative Design of Regulatory Elements Based on High-Precision Strength Prediction Using Artificial Neural Network

    doi: 10.1371/journal.pone.0060288

    Figure Lengend Snippet: Application of designed elements for peptide BmK1 expression and DXP pathway engineering in E. coli . (A) Sketch maps of plasmids for designed elements applications. Plasmids s21- gfp , s05- gfp and s14- gfp contain gene gfp between BamHI/EcoRI sites, plasmids s21- bmk 1, s05- bmk 1 and s14- bmk 1 contain gene bmk 1 between NcoI/HindIII sites, plasmids s21- dxs , s05- dxs and s14- dxs contain gene dxs between NcoI/EcoRI sites. (B) Effect of applying designed elements for peptide BmK1 expression and DXP pathway engineering in E. coli . The wild-type Trc promoter and RBS (without inserting dxs gene) served as the blank control.

    Article Snippet: All primers, designed sequences, codon optimized peptide BmK1 (bmk 1, Genbank: AAD39510), and amorphadiene synthase (ads , Genbank: AAF98444) genes , were synthesized by Generay Biotech Ltd. (Shanghai, China).

    Techniques: Expressing