Structured Review

Sangon Biotech primer sequences
Primer Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 94/100, based on 188 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer sequences/product/Sangon Biotech
Average 94 stars, based on 188 article reviews
Price from $9.99 to $1999.99
primer sequences - by Bioz Stars, 2020-07
94/100 stars

Images

Related Articles

Countercurrent Chromatography:

Article Title: Effects of TGF-β1 and alginate on the differentiation of rabbit bone marrow-derived mesenchymal stem cells into a chondrocyte cell lineage
Article Snippet: .. The primer sequences (Sangon Biotech Co. Ltd., Shanghai, China) were as follows: GAPDH upstream primer, 5′-GAA GGT CGG AGT CAA CGG-3′; GAPDH downstream primer, 5′-GGA AGA TGG TGA TGG GATT-3′; TGF-β1 upstream primer, 5′-CGC GTC GAC ATG CCG CCC GG GCTG-3′; TGF-β1 downstream primer, 5′-CCA AGC TTC AGC TGC ACT TGC AGG AGC-3′. .. The PCR products were identified by 1.5% agarose gel electrophoresis; the scanning and analysis of the results were performed by the gel imaging system (Bio-Rad Laboratories, Hercules, CA, USA).

Activated Clotting Time Assay:

Article Title: Effects of TGF-β1 and alginate on the differentiation of rabbit bone marrow-derived mesenchymal stem cells into a chondrocyte cell lineage
Article Snippet: .. The primer sequences (Sangon Biotech Co. Ltd., Shanghai, China) were as follows: GAPDH upstream primer, 5′-GAA GGT CGG AGT CAA CGG-3′; GAPDH downstream primer, 5′-GGA AGA TGG TGA TGG GATT-3′; TGF-β1 upstream primer, 5′-CGC GTC GAC ATG CCG CCC GG GCTG-3′; TGF-β1 downstream primer, 5′-CCA AGC TTC AGC TGC ACT TGC AGG AGC-3′. .. The PCR products were identified by 1.5% agarose gel electrophoresis; the scanning and analysis of the results were performed by the gel imaging system (Bio-Rad Laboratories, Hercules, CA, USA).

Cellular Antioxidant Activity Assay:

Article Title: Effects of TGF-β1 and alginate on the differentiation of rabbit bone marrow-derived mesenchymal stem cells into a chondrocyte cell lineage
Article Snippet: .. The primer sequences (Sangon Biotech Co. Ltd., Shanghai, China) were as follows: GAPDH upstream primer, 5′-GAA GGT CGG AGT CAA CGG-3′; GAPDH downstream primer, 5′-GGA AGA TGG TGA TGG GATT-3′; TGF-β1 upstream primer, 5′-CGC GTC GAC ATG CCG CCC GG GCTG-3′; TGF-β1 downstream primer, 5′-CCA AGC TTC AGC TGC ACT TGC AGG AGC-3′. .. The PCR products were identified by 1.5% agarose gel electrophoresis; the scanning and analysis of the results were performed by the gel imaging system (Bio-Rad Laboratories, Hercules, CA, USA).

Synthesized:

Article Title: XBP1 inhibits mesangial cell apoptosis in response to oxidative stress via the PTEN/ AKT pathway in diabetic nephropathy
Article Snippet: .. In this experiment, the following primer sequences were synthesized by Sangon Biotech Co., Ltd (Shanghai, China): XBP1 forward: 5′‐TTACGAGAGAAAACTCATGGGC‐3′; XBP1 reverse: 5′‐ACACATAGCGCCTCTGACTG‐3′; GAPDH forward: 5′‐GGGTCCAACTTGTCCAGAATGC‐3′; and GAPDH reverse: 5′‐AGAAGGCTGGGGCTCATTTG‐3′. .. Transfection To express PTEN and XBP1 in HBZF‐1 cells, we utilized pcDNA‐PTEN and XBP1 (Shanghai GeneChem Co., Ltd., Shanghai, China) to transfect the cells, and an empty vector was used as the control.

Article Title: Bmi-1 in gallbladder carcinoma: Clinicopathology and mechanism of regulation of human gallbladder carcinoma proliferation
Article Snippet: .. Primer sequences are shown in (synthesized by Sangon Biotech Co., Ltd.). ..

Article Title: Single nucleotide polymorphisms in the CDH17 gene of colorectal carcinoma
Article Snippet: .. Primer sequences for the CDH17 gene c.343A > G and c.2216A > C were synthesized by Shanghai Sangon Biological Engineering Technology and Services Co. Ltd (Table ). .. The fragments encompassing the CDH17 gene c.343A > G and c.2216A > C were amplified by PCR.

Article Title: Intermittent Hypoxia Composite Abnormal Glucose Metabolism-Mediated Atherosclerosis In Vitro and In Vivo: The Role of SREBP-1
Article Snippet: .. Primer sequences are as follows: β -actin mouse F-CCATGTACGTAGCCATCCAG, β -actin mouse R-GAGTCCATCACAATGCCTGT, SREBP-1c mouse F-TTGTGGAGCTCAAAGACCTG, SREBP-1c mouse R–TGCAAGAAGCGGATGTAGTC, IRS-1 mouse F–ATTAAACACTGGGCCTCTGG, and IRS-1 mouse R–GCTGTGCCATACTCTCTCCA (synthesized by Sangon Biotech, Shanghai). .. Animals Male 8-week-old ApoE−/− mice and 8-week-old C57BL/6J mice were purchased from Beijing Vital River Laboratory Animal Technology Co. Ltd.

Article Title: Intra-hippocampal administration of ZIP alleviates depressive and anxiety-like responses in an animal model of posttraumatic stress disorder
Article Snippet: .. The primer sequences (designed and synthesized by Sangon Biotech Co., Shanghai, China) were presented in Table . .. Complementary DNA (cDNA) was obtained from total RNA using PrimeScript™ RT Reagent Kit (TaKaRa Biotech, Dalian, China).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Sangon Biotech lv nls rarα primer sequences
    Downregulation of p-p38α protein level may be induced by a direct interaction between <t>NLS-RARα</t> and p38α protein. ( A ) Immunofluorescence microscopy of NLS-RARα staining with FITC(green) and p38α protein staining with TRITC(red) in NLS-RARα-overexpressed NB4 cells; ( B, C ) NLS-RARα was immunoprecipitated by anti-RARα, p38α protein(Myc-tagged) was detected by Western blot; ( D ) p38α was immunoprecipitated by anti-Myc, NLS-RARα (HA-tagged) was detected by Western blot. IgG was used as control antibody. The overexpressions of p38α protein and NLS-RARα(input) were determineded with Western blot analysis.
    Lv Nls Rarα Primer Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lv nls rarα primer sequences/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    lv nls rarα primer sequences - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    91
    Sangon Biotech hsa circ 0021001 primers
    <t>Hsa_circ_0021001</t> expression level in IA development (A) hsa_circ_0021001 expression in the experimental and control groups; (B) ROC curve for detection of the diagnostic efficiency of hsa_circ_0021001 in IA with an AUC of 0.87, a sensitivity of 0.81 and a specificity of 0.92. ROC curve: Receiver Operating Characteristic curve; AUC: area under the ROC curve.
    Hsa Circ 0021001 Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hsa circ 0021001 primers/product/Sangon Biotech
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hsa circ 0021001 primers - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    91
    Sangon Biotech biotinylated primer
    Detection and evaluation of biotinylation of Rfa2 and Orc1 using Western blotting. Whole-protein extracts of yFYV3, yFYV6, yFYV7, and yFYV8 were used to analyze the biotinylation of target proteins. (A) Rfa2 biotinylation by BirA in vivo was successfully detected using streptavidin-HRP in lane 3 (top). The bands in lanes 1–3 (top), which are most likely Arc1, are indicated by an asterisk. <t>Biotinylated</t> Rfa2 (Rfa2-biotin) was almost totally shifted in the presence of streptavidin in lane 4, which was analyzed using streptavidin-HRP (top) and anti-Flag antibody (bottom). (B) Orc1 biotinylation. Biotinylated Orc1 (biotin-Orc1) was detected successfully in lane 2 (top), and 91% Orc1 was shifted in the presence of streptavidin (SA) in lane 3 (bottom), which was quantified using Image J.
    Biotinylated Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated primer/product/Sangon Biotech
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    biotinylated primer - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    94
    Sangon Biotech Shanghai Co Ltd qrt pcr primers
    let-7d-5p directly inhibited the expression of TGF-βRI. ( A ) The expression of TGF-βRI under different treatments was tested by Western blotting. ( B ) The expression of TGF-βRI mRNA under different treatments was tested by <t>qRT-PCR.</t> ( C ) Schematic representation of matching sequence between TGF-βRI 3′UTR mRNA and let-7d-5p. ( D ) Luciferase activity of ATII cells co-transfected with reporter plasmid (“TGF-βRI wt” or “TGF-βRI mt”) and let-7d-5p or miRNA-NC. (* p
    Qrt Pcr Primers, supplied by Sangon Biotech Shanghai Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr primers/product/Sangon Biotech Shanghai Co Ltd
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    qrt pcr primers - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results


    Downregulation of p-p38α protein level may be induced by a direct interaction between NLS-RARα and p38α protein. ( A ) Immunofluorescence microscopy of NLS-RARα staining with FITC(green) and p38α protein staining with TRITC(red) in NLS-RARα-overexpressed NB4 cells; ( B, C ) NLS-RARα was immunoprecipitated by anti-RARα, p38α protein(Myc-tagged) was detected by Western blot; ( D ) p38α was immunoprecipitated by anti-Myc, NLS-RARα (HA-tagged) was detected by Western blot. IgG was used as control antibody. The overexpressions of p38α protein and NLS-RARα(input) were determineded with Western blot analysis.

    Journal: International Journal of Medical Sciences

    Article Title: NLS-RARα Inhibits the Effects of All-trans Retinoic Acid on NB4 Cells by Interacting with P38α MAPK

    doi: 10.7150/ijms.15374

    Figure Lengend Snippet: Downregulation of p-p38α protein level may be induced by a direct interaction between NLS-RARα and p38α protein. ( A ) Immunofluorescence microscopy of NLS-RARα staining with FITC(green) and p38α protein staining with TRITC(red) in NLS-RARα-overexpressed NB4 cells; ( B, C ) NLS-RARα was immunoprecipitated by anti-RARα, p38α protein(Myc-tagged) was detected by Western blot; ( D ) p38α was immunoprecipitated by anti-Myc, NLS-RARα (HA-tagged) was detected by Western blot. IgG was used as control antibody. The overexpressions of p38α protein and NLS-RARα(input) were determineded with Western blot analysis.

    Article Snippet: Construction of eukaryotic expression vectors of pCMV-Myc-p38α and LV-NLS-RARα Primer sequences of p38α(forward: TAA CTCGAG TAA TGT CTC AG G AGA GGC CCA CGT; reverse: TAT TAA GCGGCCGC TCA GGA CTC CAT CTC TTC TTGG) were designed by Primer-Premier 5.0 and synthesized by Sangon Biotech company.

    Techniques: Immunofluorescence, Microscopy, Staining, Immunoprecipitation, Western Blot

    ATRA application led to NLS-RARα-induced differential inhibition while accelerated proliferation of NB4 cells via down regulating p-p38α protein level. ( A )Western blot analysis of the overexpression of NLS-RARα in NB4 cells; ( B, C ) Western blot analysis the expressions of p38α, p-p38α, C/EBPβ and CD11b proteins in NB4 cells after treating cells with/without 10 nM ATRA for 3 days; ( D-F ) Quantitative analysis of the expression levels of p-p38α/p38α, C/EBPβ, CD11b proteins after normalization with β-actin; ( G ) NB4 cells were treated with 10 nM ATRA for 3 days. Then the optical density value at 450nm(OD450) was measured by CCK-8 assay. All data are presented as mean±SD. * p

    Journal: International Journal of Medical Sciences

    Article Title: NLS-RARα Inhibits the Effects of All-trans Retinoic Acid on NB4 Cells by Interacting with P38α MAPK

    doi: 10.7150/ijms.15374

    Figure Lengend Snippet: ATRA application led to NLS-RARα-induced differential inhibition while accelerated proliferation of NB4 cells via down regulating p-p38α protein level. ( A )Western blot analysis of the overexpression of NLS-RARα in NB4 cells; ( B, C ) Western blot analysis the expressions of p38α, p-p38α, C/EBPβ and CD11b proteins in NB4 cells after treating cells with/without 10 nM ATRA for 3 days; ( D-F ) Quantitative analysis of the expression levels of p-p38α/p38α, C/EBPβ, CD11b proteins after normalization with β-actin; ( G ) NB4 cells were treated with 10 nM ATRA for 3 days. Then the optical density value at 450nm(OD450) was measured by CCK-8 assay. All data are presented as mean±SD. * p

    Article Snippet: Construction of eukaryotic expression vectors of pCMV-Myc-p38α and LV-NLS-RARα Primer sequences of p38α(forward: TAA CTCGAG TAA TGT CTC AG G AGA GGC CCA CGT; reverse: TAT TAA GCGGCCGC TCA GGA CTC CAT CTC TTC TTGG) were designed by Primer-Premier 5.0 and synthesized by Sangon Biotech company.

    Techniques: Inhibition, Western Blot, Over Expression, Expressing, CCK-8 Assay

    Recruitment p38α-combinded NLS-RARα by ATRA eventually caused activation of p38α protein. ( A ) Western blot analysis of the expressions of p38α, p-p38α, NLS-RARα, C/EBPβ and CD11b proteins in cultured NLS-RARα-overexpressed NB4 cells after dealing cells with various treatments for 3 days. ( B ) The proliferation of NLS-RARα-overexpressed NB4 cells in different groups was determined with CCK-8 Kit. ( C ) NLS-RARα(HA-tagged) was co-immunoprecipitated by anti-Myc in different groups. ( D ) The expressions of p38α protein(Myc-tagged) and p-p38α protein in different groups. All data are presented as mean±SD. * p

    Journal: International Journal of Medical Sciences

    Article Title: NLS-RARα Inhibits the Effects of All-trans Retinoic Acid on NB4 Cells by Interacting with P38α MAPK

    doi: 10.7150/ijms.15374

    Figure Lengend Snippet: Recruitment p38α-combinded NLS-RARα by ATRA eventually caused activation of p38α protein. ( A ) Western blot analysis of the expressions of p38α, p-p38α, NLS-RARα, C/EBPβ and CD11b proteins in cultured NLS-RARα-overexpressed NB4 cells after dealing cells with various treatments for 3 days. ( B ) The proliferation of NLS-RARα-overexpressed NB4 cells in different groups was determined with CCK-8 Kit. ( C ) NLS-RARα(HA-tagged) was co-immunoprecipitated by anti-Myc in different groups. ( D ) The expressions of p38α protein(Myc-tagged) and p-p38α protein in different groups. All data are presented as mean±SD. * p

    Article Snippet: Construction of eukaryotic expression vectors of pCMV-Myc-p38α and LV-NLS-RARα Primer sequences of p38α(forward: TAA CTCGAG TAA TGT CTC AG G AGA GGC CCA CGT; reverse: TAT TAA GCGGCCGC TCA GGA CTC CAT CTC TTC TTGG) were designed by Primer-Premier 5.0 and synthesized by Sangon Biotech company.

    Techniques: Activation Assay, Western Blot, Cell Culture, CCK-8 Assay, Immunoprecipitation

    Hsa_circ_0021001 expression level in IA development (A) hsa_circ_0021001 expression in the experimental and control groups; (B) ROC curve for detection of the diagnostic efficiency of hsa_circ_0021001 in IA with an AUC of 0.87, a sensitivity of 0.81 and a specificity of 0.92. ROC curve: Receiver Operating Characteristic curve; AUC: area under the ROC curve.

    Journal: Oncotarget

    Article Title: Circular RNA hsa_circ_0021001 in peripheral blood: a potential novel biomarker in the screening of intracranial aneurysm

    doi: 10.18632/oncotarget.22349

    Figure Lengend Snippet: Hsa_circ_0021001 expression level in IA development (A) hsa_circ_0021001 expression in the experimental and control groups; (B) ROC curve for detection of the diagnostic efficiency of hsa_circ_0021001 in IA with an AUC of 0.87, a sensitivity of 0.81 and a specificity of 0.92. ROC curve: Receiver Operating Characteristic curve; AUC: area under the ROC curve.

    Article Snippet: Hsa_circ_0021001 primers and GAPDH primers were synthesized by Shanghai Sangon biotechnology Inc.

    Techniques: Expressing, IA, Diagnostic Assay

    Identification of hsa_circ_0021001 in IA patients (A) hsa_circ_0021001 is produced at the ARFIP2 gene locus containing exon 2-5; (B) Sanger sequencing of hsa_circ_0021001 showed the back-splice junction.

    Journal: Oncotarget

    Article Title: Circular RNA hsa_circ_0021001 in peripheral blood: a potential novel biomarker in the screening of intracranial aneurysm

    doi: 10.18632/oncotarget.22349

    Figure Lengend Snippet: Identification of hsa_circ_0021001 in IA patients (A) hsa_circ_0021001 is produced at the ARFIP2 gene locus containing exon 2-5; (B) Sanger sequencing of hsa_circ_0021001 showed the back-splice junction.

    Article Snippet: Hsa_circ_0021001 primers and GAPDH primers were synthesized by Shanghai Sangon biotechnology Inc.

    Techniques: IA, Produced, Sequencing

    Kaplan-Meier analysis of survival rate of IA patients according to the expression status of hsa_circ_0021001 (A) association between hsa_circ_0021001 expression and DFS, P

    Journal: Oncotarget

    Article Title: Circular RNA hsa_circ_0021001 in peripheral blood: a potential novel biomarker in the screening of intracranial aneurysm

    doi: 10.18632/oncotarget.22349

    Figure Lengend Snippet: Kaplan-Meier analysis of survival rate of IA patients according to the expression status of hsa_circ_0021001 (A) association between hsa_circ_0021001 expression and DFS, P

    Article Snippet: Hsa_circ_0021001 primers and GAPDH primers were synthesized by Shanghai Sangon biotechnology Inc.

    Techniques: IA, Expressing

    Detection and evaluation of biotinylation of Rfa2 and Orc1 using Western blotting. Whole-protein extracts of yFYV3, yFYV6, yFYV7, and yFYV8 were used to analyze the biotinylation of target proteins. (A) Rfa2 biotinylation by BirA in vivo was successfully detected using streptavidin-HRP in lane 3 (top). The bands in lanes 1–3 (top), which are most likely Arc1, are indicated by an asterisk. Biotinylated Rfa2 (Rfa2-biotin) was almost totally shifted in the presence of streptavidin in lane 4, which was analyzed using streptavidin-HRP (top) and anti-Flag antibody (bottom). (B) Orc1 biotinylation. Biotinylated Orc1 (biotin-Orc1) was detected successfully in lane 2 (top), and 91% Orc1 was shifted in the presence of streptavidin (SA) in lane 3 (bottom), which was quantified using Image J.

    Journal: Frontiers in Microbiology

    Article Title: Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    doi: 10.3389/fmicb.2017.02062

    Figure Lengend Snippet: Detection and evaluation of biotinylation of Rfa2 and Orc1 using Western blotting. Whole-protein extracts of yFYV3, yFYV6, yFYV7, and yFYV8 were used to analyze the biotinylation of target proteins. (A) Rfa2 biotinylation by BirA in vivo was successfully detected using streptavidin-HRP in lane 3 (top). The bands in lanes 1–3 (top), which are most likely Arc1, are indicated by an asterisk. Biotinylated Rfa2 (Rfa2-biotin) was almost totally shifted in the presence of streptavidin in lane 4, which was analyzed using streptavidin-HRP (top) and anti-Flag antibody (bottom). (B) Orc1 biotinylation. Biotinylated Orc1 (biotin-Orc1) was detected successfully in lane 2 (top), and 91% Orc1 was shifted in the presence of streptavidin (SA) in lane 3 (bottom), which was quantified using Image J.

    Article Snippet: Biotinylated ssDNA preparation for single-molecule assay Biotinylated single-strand DNA (ssDNA) was prepared by rolling circle DNA replication (RCR) as described in several publications (Gibb et al., ; Qi and Greene, ), except that phi 29 DNA polymerase was bought from Thermo Fisher Scientific (EP0091), RCR reaction time was extended to 18 h, and the biotinylated primer was synthesized by Sangon Biotech, China.

    Techniques: Western Blot, In Vivo

    RPA purification and single-molecule visualization. (A) Single-molecule experiment platform. DNA was tethered on the coverslip through a biotin–streptavidin linkage. A protein bound on DNA is illustrated. Flow is from left to right. (B) Purified RPA and its biotinylation extent evaluation. Purified RPA (lane 1); RPA + unboiled streptavidin (SA) (lane 2); unboiled streptavidin (lane 3). Purified biotinylated-Rfa2 was shifted almost completely in the presence of streptavidin. (C) Illustration of streptavidin-coated-Qdot 705 labeled RPA (RPA-Qdot 705 , red) binding on and stretching ssDNA (green), together with flow (top), 0.1 nM RPA-Qdot 705 was pumped into flow cell (middle). 0.1 nM streptavidin-coated-Qdot 705 was pumped into flow cell (bottom). Red arrows point out the two ends of RPA-ssDNA. (D) Length of ssDNA bound with RPA.

    Journal: Frontiers in Microbiology

    Article Title: Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    doi: 10.3389/fmicb.2017.02062

    Figure Lengend Snippet: RPA purification and single-molecule visualization. (A) Single-molecule experiment platform. DNA was tethered on the coverslip through a biotin–streptavidin linkage. A protein bound on DNA is illustrated. Flow is from left to right. (B) Purified RPA and its biotinylation extent evaluation. Purified RPA (lane 1); RPA + unboiled streptavidin (SA) (lane 2); unboiled streptavidin (lane 3). Purified biotinylated-Rfa2 was shifted almost completely in the presence of streptavidin. (C) Illustration of streptavidin-coated-Qdot 705 labeled RPA (RPA-Qdot 705 , red) binding on and stretching ssDNA (green), together with flow (top), 0.1 nM RPA-Qdot 705 was pumped into flow cell (middle). 0.1 nM streptavidin-coated-Qdot 705 was pumped into flow cell (bottom). Red arrows point out the two ends of RPA-ssDNA. (D) Length of ssDNA bound with RPA.

    Article Snippet: Biotinylated ssDNA preparation for single-molecule assay Biotinylated single-strand DNA (ssDNA) was prepared by rolling circle DNA replication (RCR) as described in several publications (Gibb et al., ; Qi and Greene, ), except that phi 29 DNA polymerase was bought from Thermo Fisher Scientific (EP0091), RCR reaction time was extended to 18 h, and the biotinylated primer was synthesized by Sangon Biotech, China.

    Techniques: Recombinase Polymerase Amplification, Purification, Flow Cytometry, Labeling, Binding Assay

    ORC purification and single-molecule visualization. (A) Purified ORC and its biotinylation efficiency evaluation. Purified ORC (lane 1); ORC + unboiled streptavidin (SA) (lane 2); unboiled streptavidin (lane 3). 90% Orc1 was shifted in the presence of streptavidin in lane 3, which was quantified using Image J. The band appearing between Orc3 and Orc4/5 in lane 1 of (A) , indicated by a black arrow, was identified as the degradation band of Orc1 using MALDI-TOF mass spectrometry. (B) DNA substrates for ORC binding. An 838 bp DNA fragment containing ARS1 sequence was inserted into native lambda DNA at XbaI site (24, 508 bp) and named λ-ARS1; a 715 bp DNA fragment containing ARS609 sequence was inserted into at XhoI site (34, 336 bp) of λ-ARS1 and named λ-ARS1-ARS609. (C) ORC-Qdot 705 binding on λ-ARS1/λ-ARS1-ARS609. DNA tethered on coverslip with the aid of the biotinylated oligonucleotide complementary to the left end of native λ DNA, together with flow in theory. (D) ORC-Qdot 705 binding on λ-ARS1 (top) and λ-ARS1-ARS609 (bottom). 0.5 nM ORC-Qdot 705 was pumped into a flow cell with binding buffer. (Left) DNA was stained using SYTOX Orange and excited using a 532 nm laser; (center) ORC-Qdot 705 was excited using a 405 nm laser; (right) merged images. Three ORC binding positions at ARS1 and ARS609 inserted sites are indicated by red and black arrows, respectively.

    Journal: Frontiers in Microbiology

    Article Title: Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    doi: 10.3389/fmicb.2017.02062

    Figure Lengend Snippet: ORC purification and single-molecule visualization. (A) Purified ORC and its biotinylation efficiency evaluation. Purified ORC (lane 1); ORC + unboiled streptavidin (SA) (lane 2); unboiled streptavidin (lane 3). 90% Orc1 was shifted in the presence of streptavidin in lane 3, which was quantified using Image J. The band appearing between Orc3 and Orc4/5 in lane 1 of (A) , indicated by a black arrow, was identified as the degradation band of Orc1 using MALDI-TOF mass spectrometry. (B) DNA substrates for ORC binding. An 838 bp DNA fragment containing ARS1 sequence was inserted into native lambda DNA at XbaI site (24, 508 bp) and named λ-ARS1; a 715 bp DNA fragment containing ARS609 sequence was inserted into at XhoI site (34, 336 bp) of λ-ARS1 and named λ-ARS1-ARS609. (C) ORC-Qdot 705 binding on λ-ARS1/λ-ARS1-ARS609. DNA tethered on coverslip with the aid of the biotinylated oligonucleotide complementary to the left end of native λ DNA, together with flow in theory. (D) ORC-Qdot 705 binding on λ-ARS1 (top) and λ-ARS1-ARS609 (bottom). 0.5 nM ORC-Qdot 705 was pumped into a flow cell with binding buffer. (Left) DNA was stained using SYTOX Orange and excited using a 532 nm laser; (center) ORC-Qdot 705 was excited using a 405 nm laser; (right) merged images. Three ORC binding positions at ARS1 and ARS609 inserted sites are indicated by red and black arrows, respectively.

    Article Snippet: Biotinylated ssDNA preparation for single-molecule assay Biotinylated single-strand DNA (ssDNA) was prepared by rolling circle DNA replication (RCR) as described in several publications (Gibb et al., ; Qi and Greene, ), except that phi 29 DNA polymerase was bought from Thermo Fisher Scientific (EP0091), RCR reaction time was extended to 18 h, and the biotinylated primer was synthesized by Sangon Biotech, China.

    Techniques: Purification, Mass Spectrometry, Binding Assay, Sequencing, Lambda DNA Preparation, Flow Cytometry, Staining

    ORC binding on inverted λ-ARS1-ARS609. (A) ORC binding on inverted λ-ARS1-ARS609 together with flow in theory. DNA was biotinylated using the biotinylated oligonucleotide complementary to the right end of native λDNA. (B) ORC-Qdot 705 binding on inverted λ-ARS1-ARS609. (left) DNA was stained using SYTOX Orange and excited using a 532 nm laser; (center) ORC-Qdot 705 was excited using a 405 nm laser; (right) merged images. Three ORC binding positions at ARS1 and ARS609 are indicated by red and black arrows, respectively. (C) Distribution of ORC binding on inverted λ-ARS1-ARS609. Positions of ARS1 and ARS609 inserted sites are indicated by red and black arrows, respectively.

    Journal: Frontiers in Microbiology

    Article Title: Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    doi: 10.3389/fmicb.2017.02062

    Figure Lengend Snippet: ORC binding on inverted λ-ARS1-ARS609. (A) ORC binding on inverted λ-ARS1-ARS609 together with flow in theory. DNA was biotinylated using the biotinylated oligonucleotide complementary to the right end of native λDNA. (B) ORC-Qdot 705 binding on inverted λ-ARS1-ARS609. (left) DNA was stained using SYTOX Orange and excited using a 532 nm laser; (center) ORC-Qdot 705 was excited using a 405 nm laser; (right) merged images. Three ORC binding positions at ARS1 and ARS609 are indicated by red and black arrows, respectively. (C) Distribution of ORC binding on inverted λ-ARS1-ARS609. Positions of ARS1 and ARS609 inserted sites are indicated by red and black arrows, respectively.

    Article Snippet: Biotinylated ssDNA preparation for single-molecule assay Biotinylated single-strand DNA (ssDNA) was prepared by rolling circle DNA replication (RCR) as described in several publications (Gibb et al., ; Qi and Greene, ), except that phi 29 DNA polymerase was bought from Thermo Fisher Scientific (EP0091), RCR reaction time was extended to 18 h, and the biotinylated primer was synthesized by Sangon Biotech, China.

    Techniques: Binding Assay, Flow Cytometry, Staining

    Recombination-protein biotinylated system established in budding yeast. (A) Avi-tagged target protein biotinylated by BirA. (B) Main elements and enzyme sites of (top) pC-AVI and (bottom) pN-AVI. The two plasmid maps are given in Figures S1 , S2 .

    Journal: Frontiers in Microbiology

    Article Title: Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    doi: 10.3389/fmicb.2017.02062

    Figure Lengend Snippet: Recombination-protein biotinylated system established in budding yeast. (A) Avi-tagged target protein biotinylated by BirA. (B) Main elements and enzyme sites of (top) pC-AVI and (bottom) pN-AVI. The two plasmid maps are given in Figures S1 , S2 .

    Article Snippet: Biotinylated ssDNA preparation for single-molecule assay Biotinylated single-strand DNA (ssDNA) was prepared by rolling circle DNA replication (RCR) as described in several publications (Gibb et al., ; Qi and Greene, ), except that phi 29 DNA polymerase was bought from Thermo Fisher Scientific (EP0091), RCR reaction time was extended to 18 h, and the biotinylated primer was synthesized by Sangon Biotech, China.

    Techniques: Plasmid Preparation

    let-7d-5p directly inhibited the expression of TGF-βRI. ( A ) The expression of TGF-βRI under different treatments was tested by Western blotting. ( B ) The expression of TGF-βRI mRNA under different treatments was tested by qRT-PCR. ( C ) Schematic representation of matching sequence between TGF-βRI 3′UTR mRNA and let-7d-5p. ( D ) Luciferase activity of ATII cells co-transfected with reporter plasmid (“TGF-βRI wt” or “TGF-βRI mt”) and let-7d-5p or miRNA-NC. (* p

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Extracellular Vesicles Derived from Adipose Mesenchymal Stem Cells Alleviate PM2.5-Induced Lung Injury and Pulmonary Fibrosis

    doi: 10.12659/MSM.922782

    Figure Lengend Snippet: let-7d-5p directly inhibited the expression of TGF-βRI. ( A ) The expression of TGF-βRI under different treatments was tested by Western blotting. ( B ) The expression of TGF-βRI mRNA under different treatments was tested by qRT-PCR. ( C ) Schematic representation of matching sequence between TGF-βRI 3′UTR mRNA and let-7d-5p. ( D ) Luciferase activity of ATII cells co-transfected with reporter plasmid (“TGF-βRI wt” or “TGF-βRI mt”) and let-7d-5p or miRNA-NC. (* p

    Article Snippet: DMEM, F12 nutrient medium, fetal bovine serum (FBS) without exosome, Trizol-LS, exosomal protein extraction kit, and Annexin V-FITC Apoptosis Kit were purchased from Invitrogen (Carlsbad, USA). qRT-PCR primers, let-7d-5p mimics, miR-NC, and let-7d-5p inhibitor were from Sangon Biotech (Shanghai, China).

    Techniques: Expressing, Western Blot, Quantitative RT-PCR, Sequencing, Luciferase, Activity Assay, Transfection, Plasmid Preparation

    ADSCs-EVs repressed TGF-βRI expression. ( A ) Western blotting analysis of TGF-β1, TGF-βRI, and TGF-βRII levels in ATII cells under different treatments. ( B ) The miRNA levels in ATII cells with different treatments were measured by qRT-PCR. (* p

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Extracellular Vesicles Derived from Adipose Mesenchymal Stem Cells Alleviate PM2.5-Induced Lung Injury and Pulmonary Fibrosis

    doi: 10.12659/MSM.922782

    Figure Lengend Snippet: ADSCs-EVs repressed TGF-βRI expression. ( A ) Western blotting analysis of TGF-β1, TGF-βRI, and TGF-βRII levels in ATII cells under different treatments. ( B ) The miRNA levels in ATII cells with different treatments were measured by qRT-PCR. (* p

    Article Snippet: DMEM, F12 nutrient medium, fetal bovine serum (FBS) without exosome, Trizol-LS, exosomal protein extraction kit, and Annexin V-FITC Apoptosis Kit were purchased from Invitrogen (Carlsbad, USA). qRT-PCR primers, let-7d-5p mimics, miR-NC, and let-7d-5p inhibitor were from Sangon Biotech (Shanghai, China).

    Techniques: Expressing, Western Blot, Quantitative RT-PCR