primer sequences  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Millipore primer sequences
    Primer Sequences, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer sequences/product/Millipore
    Average 98 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    primer sequences - by Bioz Stars, 2020-07
    98/100 stars

    Images

    Related Articles

    Multiplex Assay:

    Article Title: NF-κB-dependent airway inflammation triggers systemic insulin resistance
    Article Snippet: .. Cytokine (TNF-α, IL-1β, IL-5, and IL-6) content in BAL samples and plasma was assessed using multiplex technology (MAGPIX, Millipore Billerica, MA). .. Liver protein samples were homogenized using an extraction buffer (50 mM Tris, 1 mM EDTA, 1 mM EGTA, 10% glycerol, 1% Triton X-100 at pH 7.5 with 1 mM DTT, 1 mM PMSF, 5 μg/ml protease inhibitor cocktail, 10 μg/ml trypsin inhibitor, 50 mM NaF, and 5 mM NaPP added before homogenization).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Modulation of Insulin Resistance and the Adipocyte-Skeletal Muscle Cell Cross-Talk by LCn-3PUFA
    Article Snippet: .. Quantification of Adipokines and Non-Esterified Fatty Acids in Conditioned Media from Mature Adipocytes IL-6, adiponectin, MCP-1 and CCL5 were quantified using enzyme-linked immunosorbent assay (ELISA) kit from Sigma-aldrich, Assaypro, Thermo Fisher Scientific and R & D Systems, respectively. .. Non-esterified fatty acids (NEFA) were quantified using a colorimetric kit from Diasys (Grabels, France) according to the manufacturer’s instructions operated on Konelab TM 20 analyzer (Thermo Electron SA, Cergy-Pontoise, France).

    Article Title: Soluble epoxide hydrolase inhibitor 1-trifluoromethoxyphenyl-3- (1-propionylpiperidin-4-yl) urea attenuates bleomycin-induced pulmonary fibrosis in mice
    Article Snippet: .. The serum concentrations of pro-fibrogenic cytokine (TGF-β1) and pro-inflammatory cytokines (IL-1β and IL-6) were measured by using the commercially available ELISA kit (Sigma, USA), according to the manufacturer’s instructions. .. The fibroblast cells (NIH3T3, ATCC Number CRL-1658) were seeded in a 96-well cell culture plate and were incubated with TPPU (0.1, 1, 10 µM) or DMSO (0.1%) for 12, 24 or 36 h at 37°C.

    Article Title: Pharmacological manipulation of the inflammatory cascade by the superoxide dismutase mimetic, M40403
    Article Snippet: .. Cytokines (TNFα, IL-1β, IL-6 and I1-10) and PGE2 were measured in the exudates by ELISA's using commercially available kits (Calbiochem-Novabiochem Corporation, U.S.A.). ..

    Incubation:

    Article Title: Helminths-based bi-functional molecule, tuftsin-phosphorylcholine (TPC), ameliorates an established murine arthritis
    Article Snippet: .. For inducing differentiation from M0 to M1 macrophages, secreting pro-inflammatory cytokines IL-6 and TNF-α, the cells were incubated with 10 ng/ml LPS (Sigma-Aldrich) and 20 ng/ml recombinant mouse IFN-γ (R & D systems Minneapolis, MN, USA) for 24 hours. .. Differentiation from M1 to M2 macrophages secreting anti-inflammatory cytokine IL-10, the M1cells were exposed to 20 ng/ml recombinant mouse IL-4 (R & D systems Minneapolis, MN, USA) for 48 hours.

    other:

    Article Title: Efficacy of Repeated Intravenous Administration of Peramivir against Highly Pathogenic Avian Influenza A (H5N1) Virus in Cynomolgus Macaques
    Article Snippet: Levels of inflammatory cytokines and chemokines (interleukin-6 [IL-6], IL-8, IL-1β, IL-10, IL-12p40, macrophage inflammatory protein 1α [MIP-1α], tumor necrosis factor alpha [TNF-α], monocyte chemotactic protein 1 [MCP-1], and gamma interferon [IFN-γ]) in tracheal swab fluid and serum samples were measured with the Milliplex MAP nonhuman primate cytokine panel and Luminex200 (Millipore Corp., Billerica, MA).

    Expressing:

    Article Title: In vitro and in vivo antitumor effects of the recombinant immunotoxin IL6(T23)-PE38KDEL in multiple myeloma
    Article Snippet: .. The gene fragment encoding IL6(T23)-PE38KDEL was inserted between the Nco I and Xho I sites of the expression vector pET28a(+) plasmid (Novagen). .. The recombinant plasmid carrying the fusion gene was expressed via isopropyl-β-D-1-thiogalacto-pyranoside (IPTG) induction in the E. coli BL21 (λDE3) cells.

    Recombinant:

    Article Title: Helminths-based bi-functional molecule, tuftsin-phosphorylcholine (TPC), ameliorates an established murine arthritis
    Article Snippet: .. For inducing differentiation from M0 to M1 macrophages, secreting pro-inflammatory cytokines IL-6 and TNF-α, the cells were incubated with 10 ng/ml LPS (Sigma-Aldrich) and 20 ng/ml recombinant mouse IFN-γ (R & D systems Minneapolis, MN, USA) for 24 hours. .. Differentiation from M1 to M2 macrophages secreting anti-inflammatory cytokine IL-10, the M1cells were exposed to 20 ng/ml recombinant mouse IL-4 (R & D systems Minneapolis, MN, USA) for 48 hours.

    Plasmid Preparation:

    Article Title: In vitro and in vivo antitumor effects of the recombinant immunotoxin IL6(T23)-PE38KDEL in multiple myeloma
    Article Snippet: .. The gene fragment encoding IL6(T23)-PE38KDEL was inserted between the Nco I and Xho I sites of the expression vector pET28a(+) plasmid (Novagen). .. The recombinant plasmid carrying the fusion gene was expressed via isopropyl-β-D-1-thiogalacto-pyranoside (IPTG) induction in the E. coli BL21 (λDE3) cells.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Millipore chip qrt pcr primers
    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for <t>qRT-PCR</t> analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p
    Chip Qrt Pcr Primers, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chip qrt pcr primers/product/Millipore
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    chip qrt pcr primers - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    91
    Millipore anti tspan1 antibody
    <t>Tspan1</t> regulated cell cycle progession and CDK1 expression. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNA (siRNA) and scramble siRNA (Ctrl), pLNCX-TSPAN1-cDNA recombinant plasmid (Tspan1) and pLNCX plasmid (Ctrl). The cell cycle was analyzed by flow cytometry. A. Cell cycle assay after knockdown of Tspan1. B. Cell cycle assay after overexpression of Tspan1. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNAs (siRNA) and scrambled siRNA (Ctrl). The mRNA expression (C) and protein expression (D) of CDK1 after silencing of Tspan1 in BxPC3 and PNAC-1 cells were quantified, respectively. After pLNCX-TSPAN1-cDNA transfection, the mRNA levels of CDK1 were detected using qRT-PCR (E). The protein levels of Tspan1 were detected and quantity analysis of relative protein levels of Tspan1 was conducted (F). *P
    Anti Tspan1 Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti tspan1 antibody/product/Millipore
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    anti tspan1 antibody - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    85
    Millipore flag tagged ras grf2
    Model. When <t>GRF2</t> becomes activated by upstream signals, the REM assists in stabilizing the Cdc25 domain to allow for efficient exchange. This interaction and subsequent binding to Ras causes the DB to be looped out, creating a structure that is recognized by the ubiquitination machinery, resulting in ubiquitination of GRF2, followed by degradation. CC, coiled-coil motif; IQ, ilimaquinone motif.
    Flag Tagged Ras Grf2, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/flag tagged ras grf2/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    flag tagged ras grf2 - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    93
    Millipore cxcr4
    ERG factor mediates <t>CXCR4</t> expression in VCaP cells. (A) ERG, CXCR4 , and GAPDH gene expressions were determined in scrambled (Scr) and ERG siRNA-transfected VCaP cells, and ERG and CXCR4 gene expressions shown after normalization for GAPDH . (B) Scrambled
    Cxcr4, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr4/product/Millipore
    Average 93 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    cxcr4 - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: HIF-1α protein is transiently stabilized in hypoxia while its mRNA its suppressed. ( A ) HEK293, ( C ) MCF10A, ( D ) MCF7 and ( E ) MDA-mb-231 cells where exposed to the indicated time point to hypoxia (1% oxygen), protein lysates where prepared and blotted with the indicated antibodies. ( B – F ), densitometry of (A) and ( C–E ), respectively. ( G ) Cells where exposed to 8 hours of hypoxia (1% oxygen) or normoxia (21% oxygen), the mRNA was collected and used for qRT-PCR analysis of HIF1A mRNA expression. Results are shown as fold change to normoxia. ( H ) ChIP assays coupled to qRT-PCR where performed on HEK293 cells exposed to hypoxia for the indicated time points using p65 and IgG control antibodies, primers covering the NFκB site on the HIF-1α gene where used (see sequence highlighted in blue in Fig. 3A ). N = 3-4 independent experiments. Data are represented as mean ± SEM. In (G), *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Multiple Displacement Amplification, Quantitative RT-PCR, Expressing, Chromatin Immunoprecipitation, Sequencing

    REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Journal: Scientific Reports

    Article Title: REST mediates resolution of HIF-dependent gene expression in prolonged hypoxia

    doi: 10.1038/srep17851

    Figure Lengend Snippet: REST negatively regulates Hif-1α. (A) Schematic representation of the HIF1A genomic locus, grey rectangles indicate approximate Exon position, the white rectangle with diagonal black lines indicates the genomic sequence -491 bp/ATG of the human HIF1A gene. Highlighting is the REST binding site (RE1) in red, and the previously reported NFκB binding site in blue, on the -491 bp/ATG genomic sequence. Blue arrows indicate the primers used to detect REST, COREST, mSin3A and IgG binding to the RE1 site in the ChIP assays. (B) ChIP assays on the RE1 site in the HIF1A gene promoter using the indicated antibodies in HEK293 cells exposed to the indicated time points to hypoxia (1% oxygen). Precipitated chromatin was quantified by qRT-PCR. (C–G) Cells were exposed to hypoxia (1% O 2 ) for the indicated time points. REST knockdown was performed using REST specific (REST-RNAi) or control RNAi ( C–G ). Whole cell extracts from HEK293 ( C,D ) and MCF7 ( E,F ) were collected and analysed for the expression of the indicated protein by immunoblotting ( C,E ) and densitometry analysis ( D,F ). HEK293 mRNA was collected and analysed for HIF mRNA expression by qRT-PCR ( G ). F.C. = fold change to 21% O 2 for ( G ) and control RNAi, 8 hours hypoxia for ( C–F ). Data are represented as mean ± SEM, N = 3–5 throughout. *p

    Article Snippet: The following ChIP qRT-PCR primers were used: HIF-RE1, F: AGAGGCTCGGAGCCGG, R: CGCTTCTCTCTAGTCTCACGAG The following antibodies were used: Rabbit CoREST, 5 μg, Millipore, 07–455; Rabbit REST, 2 μg, Millipore, 17–641; Rabbit mSin3A, 5 μg, SCB, sc-994; Rabbit IgG, 5 μg, Millipore, PP64B.

    Techniques: Sequencing, Binding Assay, Chromatin Immunoprecipitation, Quantitative RT-PCR, Expressing

    Tspan1 regulated cell cycle progession and CDK1 expression. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNA (siRNA) and scramble siRNA (Ctrl), pLNCX-TSPAN1-cDNA recombinant plasmid (Tspan1) and pLNCX plasmid (Ctrl). The cell cycle was analyzed by flow cytometry. A. Cell cycle assay after knockdown of Tspan1. B. Cell cycle assay after overexpression of Tspan1. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNAs (siRNA) and scrambled siRNA (Ctrl). The mRNA expression (C) and protein expression (D) of CDK1 after silencing of Tspan1 in BxPC3 and PNAC-1 cells were quantified, respectively. After pLNCX-TSPAN1-cDNA transfection, the mRNA levels of CDK1 were detected using qRT-PCR (E). The protein levels of Tspan1 were detected and quantity analysis of relative protein levels of Tspan1 was conducted (F). *P

    Journal: bioRxiv

    Article Title: TSPAN1 promotes human pancreatic cancer cells proliferation by modulating CDK1 via Akt

    doi: 10.1101/2020.05.29.123091

    Figure Lengend Snippet: Tspan1 regulated cell cycle progession and CDK1 expression. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNA (siRNA) and scramble siRNA (Ctrl), pLNCX-TSPAN1-cDNA recombinant plasmid (Tspan1) and pLNCX plasmid (Ctrl). The cell cycle was analyzed by flow cytometry. A. Cell cycle assay after knockdown of Tspan1. B. Cell cycle assay after overexpression of Tspan1. BxPC3 and PNAC-1 cells were transfected with Tspan1 siRNAs (siRNA) and scrambled siRNA (Ctrl). The mRNA expression (C) and protein expression (D) of CDK1 after silencing of Tspan1 in BxPC3 and PNAC-1 cells were quantified, respectively. After pLNCX-TSPAN1-cDNA transfection, the mRNA levels of CDK1 were detected using qRT-PCR (E). The protein levels of Tspan1 were detected and quantity analysis of relative protein levels of Tspan1 was conducted (F). *P

    Article Snippet: The sequences of used primers were listed as following: Human Tspan1 forward, 5’-CGTTGTGGTCTTTGCTCTTG-3 ‘and reverse, 5’-TTCTTGATGGCAGGCACTAC-3’; Human CDK1 forward,5’ TTTTCAGAGCTTTGGGCACT −3’ and reverse: 5’-CCATTTTGCCAGAAATTCGT-3’.

    Techniques: Expressing, Transfection, Recombinant, Plasmid Preparation, Flow Cytometry, Cell Cycle Assay, Over Expression, Quantitative RT-PCR

    Tspan1 up-regulated BxPC3 and PNAC-1 cells proliferation and CDK1 expression depend on the activation of Akt HEK293 cells were transfected with CDK1 siRNA, the expression levels of CDK1 were detected with qRT-PCR (A) and Western blot (B). BxPC3 and PNAC-1 cells were transfected with pLNCX-TSPAN1-cDNA plasmid (Tspan1). Plasmid pLNCX was transfected into BxPC3 and PNAC-1 cells as control cells (Ctrl). After transfection of CDK1 siRNA, cell proliferation ability and CDK1 expression were observed and analyzed. Alamar blue assay method results of cell survival and proliferation in the Tspan1-overexpressed BxPC3 cells (C) and PNAC-1 cells (D) after CDK1-silencing. CDK1 knock-down significantly abolished the increased cell survival and proliferation ability induced by Tspan1 overexpression. E. The expression levels of PI3K, Akt and p-Akt in the Tspan1-overexpressed BxPC3 cells and PNAC-1 cells were measured by western blotting. It demonstrated that Tspan1 overexpression could promote the expression and phosphorylation of Akt. Then MK-2206 2HCl, a specific inhibitor of Akt were used to suppress the Akt activation, then the expression of CDK1 was assessed in the Tspan1-overexpressed BxPC3 cells (F) and PNAC-1 cells (G). It showed that suppression of Akt significantly attenuated the increased CDK1 expression induced by Tspan1 over-expression. * P

    Journal: bioRxiv

    Article Title: TSPAN1 promotes human pancreatic cancer cells proliferation by modulating CDK1 via Akt

    doi: 10.1101/2020.05.29.123091

    Figure Lengend Snippet: Tspan1 up-regulated BxPC3 and PNAC-1 cells proliferation and CDK1 expression depend on the activation of Akt HEK293 cells were transfected with CDK1 siRNA, the expression levels of CDK1 were detected with qRT-PCR (A) and Western blot (B). BxPC3 and PNAC-1 cells were transfected with pLNCX-TSPAN1-cDNA plasmid (Tspan1). Plasmid pLNCX was transfected into BxPC3 and PNAC-1 cells as control cells (Ctrl). After transfection of CDK1 siRNA, cell proliferation ability and CDK1 expression were observed and analyzed. Alamar blue assay method results of cell survival and proliferation in the Tspan1-overexpressed BxPC3 cells (C) and PNAC-1 cells (D) after CDK1-silencing. CDK1 knock-down significantly abolished the increased cell survival and proliferation ability induced by Tspan1 overexpression. E. The expression levels of PI3K, Akt and p-Akt in the Tspan1-overexpressed BxPC3 cells and PNAC-1 cells were measured by western blotting. It demonstrated that Tspan1 overexpression could promote the expression and phosphorylation of Akt. Then MK-2206 2HCl, a specific inhibitor of Akt were used to suppress the Akt activation, then the expression of CDK1 was assessed in the Tspan1-overexpressed BxPC3 cells (F) and PNAC-1 cells (G). It showed that suppression of Akt significantly attenuated the increased CDK1 expression induced by Tspan1 over-expression. * P

    Article Snippet: The sequences of used primers were listed as following: Human Tspan1 forward, 5’-CGTTGTGGTCTTTGCTCTTG-3 ‘and reverse, 5’-TTCTTGATGGCAGGCACTAC-3’; Human CDK1 forward,5’ TTTTCAGAGCTTTGGGCACT −3’ and reverse: 5’-CCATTTTGCCAGAAATTCGT-3’.

    Techniques: Expressing, Activation Assay, Transfection, Quantitative RT-PCR, Western Blot, Plasmid Preparation, Alamar Blue Assay, Over Expression

    Expression level of Tspan1 in human pancreatic cancer tissue specimen and PDAC cells lines. The expression level of Tspan1 was detected. A. High mRNA expression of Tspan1 was observed in human pancreatic cancer tissue specimen. B. The mRNA expression level of Tspan1 was assessed by qRT-PCR assay in human pancreatic ductal adenocarcinoma (PDAC) cells lines BxPC3 and PNAC-1cells, and normal human pancreatic cell line HPC-Y5. C. Western blot result of Tspan1 expression. Data are reported as the mean ± standard deviation. *P

    Journal: bioRxiv

    Article Title: TSPAN1 promotes human pancreatic cancer cells proliferation by modulating CDK1 via Akt

    doi: 10.1101/2020.05.29.123091

    Figure Lengend Snippet: Expression level of Tspan1 in human pancreatic cancer tissue specimen and PDAC cells lines. The expression level of Tspan1 was detected. A. High mRNA expression of Tspan1 was observed in human pancreatic cancer tissue specimen. B. The mRNA expression level of Tspan1 was assessed by qRT-PCR assay in human pancreatic ductal adenocarcinoma (PDAC) cells lines BxPC3 and PNAC-1cells, and normal human pancreatic cell line HPC-Y5. C. Western blot result of Tspan1 expression. Data are reported as the mean ± standard deviation. *P

    Article Snippet: The sequences of used primers were listed as following: Human Tspan1 forward, 5’-CGTTGTGGTCTTTGCTCTTG-3 ‘and reverse, 5’-TTCTTGATGGCAGGCACTAC-3’; Human CDK1 forward,5’ TTTTCAGAGCTTTGGGCACT −3’ and reverse: 5’-CCATTTTGCCAGAAATTCGT-3’.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot, Standard Deviation

    Tspan1 modulated BxPC3 cells and PNAC-1 cells proliferation. A. pLNCX-TSPAN1-cDNA recombinant plasmid and control pLNCX plasmid were transfected into BxPC3 and PNAC-1cells. The mRNA levels of Tspan1 were analyzed by qRT-PCR analysis. Control pLNCX plasmid-transfected BxPC3 and PNAC-1 cells serve as control cells (Ctrl). After pLNCX-TSPAN1-cDNA was transfected into BxPC3 and PNAC-1 cells (Tspan1), Tspan1 mRNA expression was up-regulated. B. Western blot results showed that Tspan1 protein expression was increased after pLNCX-TSPAN1-cDNA transfection. C. The siRNA targeted to Tspan1 was transfected into BxPC3 and PNAC-1 cells (siRNA). BxPC3 and PNAC-1 cells transfected with scramble siRNA were treated as control (Ctrl). Quantitative RT-PCR method was used to analyze the mRNA expression levels of Tspan1. D. Western blot results showed that Tspan1 protein expression was decreased after Tspan1-siRNA transfection. E. Cell proliferation was measured by MTT method after TSPAN1 overexpression, BxPC3 and PNAC-1 cells proliferation was significantly increased after Tspan1 overexpression. F. Cell proliferation assay after knockdown of Tspan1. BxPC3 and PNAC-1 cells proliferation was significantly suppressed by Tsapn1-siRNA transfection. *P

    Journal: bioRxiv

    Article Title: TSPAN1 promotes human pancreatic cancer cells proliferation by modulating CDK1 via Akt

    doi: 10.1101/2020.05.29.123091

    Figure Lengend Snippet: Tspan1 modulated BxPC3 cells and PNAC-1 cells proliferation. A. pLNCX-TSPAN1-cDNA recombinant plasmid and control pLNCX plasmid were transfected into BxPC3 and PNAC-1cells. The mRNA levels of Tspan1 were analyzed by qRT-PCR analysis. Control pLNCX plasmid-transfected BxPC3 and PNAC-1 cells serve as control cells (Ctrl). After pLNCX-TSPAN1-cDNA was transfected into BxPC3 and PNAC-1 cells (Tspan1), Tspan1 mRNA expression was up-regulated. B. Western blot results showed that Tspan1 protein expression was increased after pLNCX-TSPAN1-cDNA transfection. C. The siRNA targeted to Tspan1 was transfected into BxPC3 and PNAC-1 cells (siRNA). BxPC3 and PNAC-1 cells transfected with scramble siRNA were treated as control (Ctrl). Quantitative RT-PCR method was used to analyze the mRNA expression levels of Tspan1. D. Western blot results showed that Tspan1 protein expression was decreased after Tspan1-siRNA transfection. E. Cell proliferation was measured by MTT method after TSPAN1 overexpression, BxPC3 and PNAC-1 cells proliferation was significantly increased after Tspan1 overexpression. F. Cell proliferation assay after knockdown of Tspan1. BxPC3 and PNAC-1 cells proliferation was significantly suppressed by Tsapn1-siRNA transfection. *P

    Article Snippet: The sequences of used primers were listed as following: Human Tspan1 forward, 5’-CGTTGTGGTCTTTGCTCTTG-3 ‘and reverse, 5’-TTCTTGATGGCAGGCACTAC-3’; Human CDK1 forward,5’ TTTTCAGAGCTTTGGGCACT −3’ and reverse: 5’-CCATTTTGCCAGAAATTCGT-3’.

    Techniques: Recombinant, Plasmid Preparation, Transfection, Quantitative RT-PCR, Expressing, Western Blot, MTT Assay, Over Expression, Proliferation Assay

    Model. When GRF2 becomes activated by upstream signals, the REM assists in stabilizing the Cdc25 domain to allow for efficient exchange. This interaction and subsequent binding to Ras causes the DB to be looped out, creating a structure that is recognized by the ubiquitination machinery, resulting in ubiquitination of GRF2, followed by degradation. CC, coiled-coil motif; IQ, ilimaquinone motif.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Model. When GRF2 becomes activated by upstream signals, the REM assists in stabilizing the Cdc25 domain to allow for efficient exchange. This interaction and subsequent binding to Ras causes the DB to be looped out, creating a structure that is recognized by the ubiquitination machinery, resulting in ubiquitination of GRF2, followed by degradation. CC, coiled-coil motif; IQ, ilimaquinone motif.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Binding Assay

    Mass spectra of peptides generated from a trypsin digest of GRF2. (A) GRF2 was immunoprecipitated from a stably expressing 293 cell line and separated by SDS-PAGE, and the GRF2-specific band was analyzed by MS as described in Materials and Methods. Shown are two peptides that differ in size by the molecular weight of a phosphate group. This indicates that this peptide is phosphorylated. (B) Both peptides from panel A were isolated and sequenced by MS-MS. The peptide is located at amino acids 723 to 734 of GRF2. The upper graph shows the spectrum derived from the 643.3-Da peptide; the lower graph shows the spectrum derived from the 683.3-Da peptide. The arrow depicts the loss of the phosphate group from the larger ion. amu, atomic mass units; TOF, time of flight.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Mass spectra of peptides generated from a trypsin digest of GRF2. (A) GRF2 was immunoprecipitated from a stably expressing 293 cell line and separated by SDS-PAGE, and the GRF2-specific band was analyzed by MS as described in Materials and Methods. Shown are two peptides that differ in size by the molecular weight of a phosphate group. This indicates that this peptide is phosphorylated. (B) Both peptides from panel A were isolated and sequenced by MS-MS. The peptide is located at amino acids 723 to 734 of GRF2. The upper graph shows the spectrum derived from the 643.3-Da peptide; the lower graph shows the spectrum derived from the 683.3-Da peptide. The arrow depicts the loss of the phosphate group from the larger ion. amu, atomic mass units; TOF, time of flight.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Generated, Immunoprecipitation, Stable Transfection, Expressing, SDS Page, Mass Spectrometry, Molecular Weight, Isolation, Derivative Assay

    Ability of the ΔREM protein to bind Ras and become ubiquitinated. (A) In vitro association of GRF2 and the ΔREM protein with GST-Ras. GST-Ras complexed with agarose beads was incubated with lysate from transiently transfected 293T cells expressing Flag-GRF2 or the ΔREM protein. Bound GRF2 proteins were detected by Western blotting with the M2 monoclonal Flag antibody. GRF2 and ΔREM protein expression in lysate was detected by Western blotting with the M2 monoclonal Flag antibody (lanes 1 to 2). The GST fusion protein had been prepared in either its nucleotide-free (NF), GDP-bound (GDP), or GTPγS-bound (GTPγS) form. The − and + refer to the absence and presence of cell lysate during the incubation, respectively. In lane 4, lysate from cells expressing WT GRF2 was added. The data shown are representative of two experiments. (B) ERK 1 activity in 293T cells. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 construct. In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-MAPK antibody. Equal levels of expression of ERK 1 and 2 were confirmed by Western blotting of the lysate with a polyclonal MAPK antibody (middle gel). The data shown are representative of three experiments. (C) Ubiquitination of the ΔREM protein. The assays were carried out 2 days after transfection of 293T cells with the indicated construct. Flag-GRF2 or the mutant protein was isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The data shown are representative of two experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Ability of the ΔREM protein to bind Ras and become ubiquitinated. (A) In vitro association of GRF2 and the ΔREM protein with GST-Ras. GST-Ras complexed with agarose beads was incubated with lysate from transiently transfected 293T cells expressing Flag-GRF2 or the ΔREM protein. Bound GRF2 proteins were detected by Western blotting with the M2 monoclonal Flag antibody. GRF2 and ΔREM protein expression in lysate was detected by Western blotting with the M2 monoclonal Flag antibody (lanes 1 to 2). The GST fusion protein had been prepared in either its nucleotide-free (NF), GDP-bound (GDP), or GTPγS-bound (GTPγS) form. The − and + refer to the absence and presence of cell lysate during the incubation, respectively. In lane 4, lysate from cells expressing WT GRF2 was added. The data shown are representative of two experiments. (B) ERK 1 activity in 293T cells. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 construct. In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-MAPK antibody. Equal levels of expression of ERK 1 and 2 were confirmed by Western blotting of the lysate with a polyclonal MAPK antibody (middle gel). The data shown are representative of three experiments. (C) Ubiquitination of the ΔREM protein. The assays were carried out 2 days after transfection of 293T cells with the indicated construct. Flag-GRF2 or the mutant protein was isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The data shown are representative of two experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: In Vitro, Incubation, Transfection, Expressing, Western Blot, Activity Assay, Construct, Mutagenesis, Isolation, Immunoprecipitation

    Overexpressing Ras affects ubiquitination levels of GRF2. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 constructs. 293T cells were transiently transfected with Flag-GRF2, HA-ubiquitin (Ub) and either pcDNA3 (lanes 2, 4, and 6) or H-Ras (lanes 3, 5, and 7). Equal amounts of protein in lysates were separated by SDS-PAGE and Western blotted as follows: ERK 1 expression was detected with a polyclonal MAPK antibody (third panel); activated ERK was detected with a polyclonal phospho-MAPK antibody (fourth panel); in the second panel, the presence of overexpressed H-Ras was verified with LAO45 Ras monoclonal antibody (on a much longer exposure, endogenous Ras can be detected as well). GRF2 or the point mutant proteins were isolated by anti-Flag immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (bottom panel) and with 12CA5 antibody for ubiquitin (top panel). The data shown are representative of two experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Overexpressing Ras affects ubiquitination levels of GRF2. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 constructs. 293T cells were transiently transfected with Flag-GRF2, HA-ubiquitin (Ub) and either pcDNA3 (lanes 2, 4, and 6) or H-Ras (lanes 3, 5, and 7). Equal amounts of protein in lysates were separated by SDS-PAGE and Western blotted as follows: ERK 1 expression was detected with a polyclonal MAPK antibody (third panel); activated ERK was detected with a polyclonal phospho-MAPK antibody (fourth panel); in the second panel, the presence of overexpressed H-Ras was verified with LAO45 Ras monoclonal antibody (on a much longer exposure, endogenous Ras can be detected as well). GRF2 or the point mutant proteins were isolated by anti-Flag immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (bottom panel) and with 12CA5 antibody for ubiquitin (top panel). The data shown are representative of two experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Transfection, Construct, SDS Page, Western Blot, Expressing, Mutagenesis, Isolation, Immunoprecipitation

    Treatment with 26S proteasome inhibitors. A stable 293 cell line expressing Flag-tagged GRF2 and HA-tagged ubiquitin was treated for the indicated amounts of time with 50 μM LLnL or 50 μM MG-132, two potent 26S proteasome inhibitors, or with 0.02% DMSO alone as a control. GRF2 was isolated by anti-Flag antibody immunoprecipitation; the washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower panel) and with 12CA5 antibody for ubiquitin (upper panel). The data shown are representative of three experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Treatment with 26S proteasome inhibitors. A stable 293 cell line expressing Flag-tagged GRF2 and HA-tagged ubiquitin was treated for the indicated amounts of time with 50 μM LLnL or 50 μM MG-132, two potent 26S proteasome inhibitors, or with 0.02% DMSO alone as a control. GRF2 was isolated by anti-Flag antibody immunoprecipitation; the washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower panel) and with 12CA5 antibody for ubiquitin (upper panel). The data shown are representative of three experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Expressing, Isolation, Immunoprecipitation, Western Blot

    Schematic representation of the domain structure of murine GRF2 with a sequence alignment of the DB motif of GRF2 (codons 743 to 751); the Ras exchange factor in yeast, Cdc25p (codons 148 to 156); and the consensus sequence of mitotic A-type cyclins. The boxed residues are those that are conserved in known DBs; the R and L residues are conserved in A- and B-type cyclins, whereas the N residue is conserved only in B-type cyclins. CC, coiled-coil motif, IQ, ilimaquinone motif.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Schematic representation of the domain structure of murine GRF2 with a sequence alignment of the DB motif of GRF2 (codons 743 to 751); the Ras exchange factor in yeast, Cdc25p (codons 148 to 156); and the consensus sequence of mitotic A-type cyclins. The boxed residues are those that are conserved in known DBs; the R and L residues are conserved in A- and B-type cyclins, whereas the N residue is conserved only in B-type cyclins. CC, coiled-coil motif, IQ, ilimaquinone motif.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Sequencing

    Ras-GRF2 protein levels decrease in response to stimulation by Ca 2+ -ionomycin. Serum-starved 293 cells stably expressing Flag-tagged GRF2 were stimulated for 5 min at 37°C with 4 μM ionomycin and harvested at the indicated periods of time. GRF2 protein levels in 60 μg of lysate were assessed by Western blotting with the M2 monoclonal anti-Flag antibody to detect GRF2; actin levels were assessed by blotting with an anti-actin monoclonal antibody. The data shown are representative of four experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Ras-GRF2 protein levels decrease in response to stimulation by Ca 2+ -ionomycin. Serum-starved 293 cells stably expressing Flag-tagged GRF2 were stimulated for 5 min at 37°C with 4 μM ionomycin and harvested at the indicated periods of time. GRF2 protein levels in 60 μg of lysate were assessed by Western blotting with the M2 monoclonal anti-Flag antibody to detect GRF2; actin levels were assessed by blotting with an anti-actin monoclonal antibody. The data shown are representative of four experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Stable Transfection, Expressing, Western Blot

    Deleting the DB protects GRF2 from N17 Ras-induced degradation. (A) The assays were carried out 2 days after transfection of 293 cells with the indicated GRF2 construct. Thirty micrograms of lysate was separated by SDS-PAGE and transferred to nitrocellulose membranes. In the upper gel, the samples were Western blotted for GRF2 using M2 anti-Flag monoclonal antibody. In the middle gel, the presence of N17 Ras was verified by Western blotting of lysates with the LAO45 anti-Ras monoclonal antibody. In the lower gel, the lysate was Western blotted for β-galactosidase (β-gal) using an anti-β-galactosidase monoclonal antibody. The data shown are representative of four experiments. (B) The bar graph shows the quantitated data as relative protein levels. These data were generated from the phosphorimager image shown below the histogram, and this image was generated from the same membrane used for the upper gel of panel A. The data shown are representative of four experiments. (C) N17 Ras expression does not affect ΔDB transcript levels differently than it affects WT transcript levels. Northern analysis was performed as described in Materials and Methods. A random-primed probe of DNA corresponding to codons 686 to 933 of GRF2 was used to probe RNA extracted from cells transiently transfected with the indicated construct. The data shown are representative of two experiments. (D) ERK 1 activity in 293T cells. The assay was carried out 3 days after transfection of 293T cells with the indicated GRF2 construct and myc-ERK 1. Cells were serum starved for 20 h and then either left untreated (−) or treated with 4 μM ionomycin for 5 min at 37°C (+). In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates with M2 anti-Flag antibody. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-ERK 1 and 2 antibody. Equal levels of expression of myc-ERK 1 were confirmed by Western blotting of the lysate with 9E10 myc monoclonal antibody (middle gel). The data shown are representative of three experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Deleting the DB protects GRF2 from N17 Ras-induced degradation. (A) The assays were carried out 2 days after transfection of 293 cells with the indicated GRF2 construct. Thirty micrograms of lysate was separated by SDS-PAGE and transferred to nitrocellulose membranes. In the upper gel, the samples were Western blotted for GRF2 using M2 anti-Flag monoclonal antibody. In the middle gel, the presence of N17 Ras was verified by Western blotting of lysates with the LAO45 anti-Ras monoclonal antibody. In the lower gel, the lysate was Western blotted for β-galactosidase (β-gal) using an anti-β-galactosidase monoclonal antibody. The data shown are representative of four experiments. (B) The bar graph shows the quantitated data as relative protein levels. These data were generated from the phosphorimager image shown below the histogram, and this image was generated from the same membrane used for the upper gel of panel A. The data shown are representative of four experiments. (C) N17 Ras expression does not affect ΔDB transcript levels differently than it affects WT transcript levels. Northern analysis was performed as described in Materials and Methods. A random-primed probe of DNA corresponding to codons 686 to 933 of GRF2 was used to probe RNA extracted from cells transiently transfected with the indicated construct. The data shown are representative of two experiments. (D) ERK 1 activity in 293T cells. The assay was carried out 3 days after transfection of 293T cells with the indicated GRF2 construct and myc-ERK 1. Cells were serum starved for 20 h and then either left untreated (−) or treated with 4 μM ionomycin for 5 min at 37°C (+). In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates with M2 anti-Flag antibody. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-ERK 1 and 2 antibody. Equal levels of expression of myc-ERK 1 were confirmed by Western blotting of the lysate with 9E10 myc monoclonal antibody (middle gel). The data shown are representative of three experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Transfection, Construct, SDS Page, Western Blot, Generated, Expressing, Northern Blot, Random Primed, Activity Assay

    GRF2 ubiquitination in vivo. The assays were carried out 2 days after transfection of 293T cells with the indicated construct. (A) Flag-GRF2 or the mutant proteins were isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The data shown are representative of five experiments. (B) p120 Ras-GAP (GAP) was isolated by anti-KT3 antibody immunoprecipitation. The washed immune complexes were Western blotted with anti-KT3 ascites fluid for GAP (lower gel) and with 12CA5 antibody for ubiquitin (upper gel). The data shown are representative of two experiments. (C) Flag-RACK1 was isolated by anti-Flag immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for RACK1 (right gel) and with 12CA5 antibody for ubiquitin (left gel). The data shown are representative of two experiments. (D) GRF2 was isolated by anti-Flag antibody immunoprecipitation. Two samples were then boiled in SDS buffer for 5 min, allowed to cool, and then diluted in TX-100 buffer. GRF2 was again isolated from these samples by anti-Flag antibody immunoprecipitation. All of the washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (upper gel) and with 12CA5 antibody for ubiquitin (lower gel). The bands seen in lanes 1 and 4 are the result of the 12CA5 antibody cross-reacting with the large amount of GRF2 present in the gel; there are no HA-tagged proteins present in these lanes. The data shown are representative of three experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: GRF2 ubiquitination in vivo. The assays were carried out 2 days after transfection of 293T cells with the indicated construct. (A) Flag-GRF2 or the mutant proteins were isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The data shown are representative of five experiments. (B) p120 Ras-GAP (GAP) was isolated by anti-KT3 antibody immunoprecipitation. The washed immune complexes were Western blotted with anti-KT3 ascites fluid for GAP (lower gel) and with 12CA5 antibody for ubiquitin (upper gel). The data shown are representative of two experiments. (C) Flag-RACK1 was isolated by anti-Flag immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for RACK1 (right gel) and with 12CA5 antibody for ubiquitin (left gel). The data shown are representative of two experiments. (D) GRF2 was isolated by anti-Flag antibody immunoprecipitation. Two samples were then boiled in SDS buffer for 5 min, allowed to cool, and then diluted in TX-100 buffer. GRF2 was again isolated from these samples by anti-Flag antibody immunoprecipitation. All of the washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (upper gel) and with 12CA5 antibody for ubiquitin (lower gel). The bands seen in lanes 1 and 4 are the result of the 12CA5 antibody cross-reacting with the large amount of GRF2 present in the gel; there are no HA-tagged proteins present in these lanes. The data shown are representative of three experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: In Vivo, Transfection, Construct, Mutagenesis, Isolation, Immunoprecipitation, Western Blot

    Ability of proteins with the Cdc25 domain point mutations R1022E and R1092A to bind Ras and become ubiquitinated. (A) In vitro association of GRF2, R1022E, and R1092A with GST-Ras. GST-Ras complexed with agarose beads was incubated with lysate from transiently transfected 293T cells expressing Flag-GRF2 or the indicated point mutant protein. Bound GRF2 proteins were detected by Western blotting with the M2 monoclonal Flag antibody. GRF2 and mutant protein expression in lysate was detected by Western blotting with the M2 monoclonal Flag antibody (lanes 1 to 3). The GST fusion protein had been prepared in either its nucleotide-free (NF), GDP-bound (GDP), or GTPγS-bound (GTPγS) form. The − and + refer to the absence or presence of cell lysate during the incubation. In lane 5, lysate from cells expressing WT GRF2 was added. The data shown are representative of four experiments. (B) ERK 1 activity in 293T cells. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 construct. In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-MAPK antibody. Equal levels of expression of ERK 1 and 2 were confirmed by Western blotting of the lysate with a polyclonal MAPK antibody (middle gel). The data shown are representative of three experiments. (C) Ubiquitination of mutant proteins. The assays were carried out 2 days after transfection of 293T cells with the indicated constructs. Flag-GRF2 or the mutant proteins were isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The asterisk indicates a degradation product of the R1092A protein in lane 5. The data shown are representative of four experiments.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: Ability of proteins with the Cdc25 domain point mutations R1022E and R1092A to bind Ras and become ubiquitinated. (A) In vitro association of GRF2, R1022E, and R1092A with GST-Ras. GST-Ras complexed with agarose beads was incubated with lysate from transiently transfected 293T cells expressing Flag-GRF2 or the indicated point mutant protein. Bound GRF2 proteins were detected by Western blotting with the M2 monoclonal Flag antibody. GRF2 and mutant protein expression in lysate was detected by Western blotting with the M2 monoclonal Flag antibody (lanes 1 to 3). The GST fusion protein had been prepared in either its nucleotide-free (NF), GDP-bound (GDP), or GTPγS-bound (GTPγS) form. The − and + refer to the absence or presence of cell lysate during the incubation. In lane 5, lysate from cells expressing WT GRF2 was added. The data shown are representative of four experiments. (B) ERK 1 activity in 293T cells. The assay was carried out 2 days after transfection of 293T cells with the indicated GRF2 construct. In the upper gel, GRF2 protein expression was verified by Western blotting of the lysates. In the lower gel, activated ERK was detected by Western blotting with a polyclonal phospho-MAPK antibody. Equal levels of expression of ERK 1 and 2 were confirmed by Western blotting of the lysate with a polyclonal MAPK antibody (middle gel). The data shown are representative of three experiments. (C) Ubiquitination of mutant proteins. The assays were carried out 2 days after transfection of 293T cells with the indicated constructs. Flag-GRF2 or the mutant proteins were isolated by anti-Flag antibody immunoprecipitation. The washed immune complexes were Western blotted with M2 Flag antibody for GRF2 (lower gel) and with 12CA5 antibody for ubiquitin (Ub) (upper gel). The asterisk indicates a degradation product of the R1092A protein in lane 5. The data shown are representative of four experiments.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: In Vitro, Incubation, Transfection, Expressing, Mutagenesis, Western Blot, Activity Assay, Construct, Isolation, Immunoprecipitation

    MS analysis of peptides generated by tryptic digest of GRF2 excised from an SDS-polyacrylamide gel. Bands were excised from the gel at 135 (the molecular mass of GRF2), 175, and 200 kDa. These bands were analyzed by a quadrapole time-of-flight mass spectrometer to detect the peptides generated. Individual peptides were used to generate an MS-MS spectrum, and the amino acid sequence was manually determined. The upper graph shows a peptide detected in the 135-kDa GRF2 that corresponds to residues 463 to 476. The lower graph shows a peptide in the GRF2 tryptic digest that corresponds to ubiquitin (residues 12 to 27). amu, atomic mass units. (B) The graphs on the right show the time-of-flight MS for the GRF2 peptide in the gel slices from 135, 175, and 200 kDa, and the graphs on the left show the spectra for the ubiquitin peptide.

    Journal: Molecular and Cellular Biology

    Article Title: Ras Binding Triggers Ubiquitination of the Ras Exchange Factor Ras-GRF2

    doi: 10.1128/MCB.21.6.2107-2117.2001

    Figure Lengend Snippet: MS analysis of peptides generated by tryptic digest of GRF2 excised from an SDS-polyacrylamide gel. Bands were excised from the gel at 135 (the molecular mass of GRF2), 175, and 200 kDa. These bands were analyzed by a quadrapole time-of-flight mass spectrometer to detect the peptides generated. Individual peptides were used to generate an MS-MS spectrum, and the amino acid sequence was manually determined. The upper graph shows a peptide detected in the 135-kDa GRF2 that corresponds to residues 463 to 476. The lower graph shows a peptide in the GRF2 tryptic digest that corresponds to ubiquitin (residues 12 to 27). amu, atomic mass units. (B) The graphs on the right show the time-of-flight MS for the GRF2 peptide in the gel slices from 135, 175, and 200 kDa, and the graphs on the left show the spectra for the ubiquitin peptide.

    Article Snippet: 293 cells (clone 13) stably expressing low levels of Flag-tagged Ras-GRF2 ( ) at 90% confluence were serum starved for 20 h and then stimulated with 4 μM ionomycin (Calbiochem) for 5 min at 37°C; the ionomycin medium was removed, and serum-free DMEM was added.

    Techniques: Mass Spectrometry, Generated, Sequencing

    ERG factor mediates CXCR4 expression in VCaP cells. (A) ERG, CXCR4 , and GAPDH gene expressions were determined in scrambled (Scr) and ERG siRNA-transfected VCaP cells, and ERG and CXCR4 gene expressions shown after normalization for GAPDH . (B) Scrambled

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: ERG factor mediates CXCR4 expression in VCaP cells. (A) ERG, CXCR4 , and GAPDH gene expressions were determined in scrambled (Scr) and ERG siRNA-transfected VCaP cells, and ERG and CXCR4 gene expressions shown after normalization for GAPDH . (B) Scrambled

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques: Expressing, Transfection

    The synthetic androgen, R1881, induces ERG and CXCR4 expression in PC cells. (A) Relative gene expressions of ERG, CXCR4 , and PSA are shown in PC-3, LNCaP, and VCaP cells. (B) R1881- and vehicle-treated VCaP cells were analyzed for ERG, CXCR4 , and GAPDH

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: The synthetic androgen, R1881, induces ERG and CXCR4 expression in PC cells. (A) Relative gene expressions of ERG, CXCR4 , and PSA are shown in PC-3, LNCaP, and VCaP cells. (B) R1881- and vehicle-treated VCaP cells were analyzed for ERG, CXCR4 , and GAPDH

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques: Expressing

    CXCR4 is an androgen-responsive gene in VCaP cells. VCaP cells were treated with different concentrations of R1881, and cell surface expression of CXCR4 was determined by FACS analysis.

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: CXCR4 is an androgen-responsive gene in VCaP cells. VCaP cells were treated with different concentrations of R1881, and cell surface expression of CXCR4 was determined by FACS analysis.

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques: Expressing, FACS

    Cycloheximide abrogates R1881 induction of CXCR4 gene expression. VCaP cells were treated with vehicle, R1881 (0.5 nM), cycloheximide (5 µ g/ml), and a combination of cycloheximide and R1881. In the combination experiment, cycloheximide was initially

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: Cycloheximide abrogates R1881 induction of CXCR4 gene expression. VCaP cells were treated with vehicle, R1881 (0.5 nM), cycloheximide (5 µ g/ml), and a combination of cycloheximide and R1881. In the combination experiment, cycloheximide was initially

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques: Expressing

    R1881 induced CXCR4 active in the chemoinvasion of VCaP cells: (A) VCaP cells were serum-starved, and chemoinvasion was performed using Matrigel-coated filters. CXCL12 was included in the bottom chamber as a chemoattractant. The cells were treated either

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: R1881 induced CXCR4 active in the chemoinvasion of VCaP cells: (A) VCaP cells were serum-starved, and chemoinvasion was performed using Matrigel-coated filters. CXCL12 was included in the bottom chamber as a chemoattractant. The cells were treated either

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques:

    ERG and CXCR4 were highly expressed in TMPRSS2-ERG fusion-positive cell and prostate tumor cells, and ERG binds to CXCR4 promoter. (A) Expression array data for ERG and CXCR4 were obtained from GDS2546 record from Gene Expression Omnibus database. Mann-Whitney

    Journal: Translational Oncology

    Article Title: Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1Androgens Induce Functional CXCR4 through ERG Factor Expression in TMPRSS2-ERG Fusion-Positive Prostate Cancer Cells 1 2

    doi:

    Figure Lengend Snippet: ERG and CXCR4 were highly expressed in TMPRSS2-ERG fusion-positive cell and prostate tumor cells, and ERG binds to CXCR4 promoter. (A) Expression array data for ERG and CXCR4 were obtained from GDS2546 record from Gene Expression Omnibus database. Mann-Whitney

    Article Snippet: Chromatin was then eluted by reverse cross-linking and was treated with proteinase K. PCR was performed with primers designed with 5′ sequences of CXCR4 and GAPDH promoters.

    Techniques: Expressing, MANN-WHITNEY